Dietary flavonoids do not affect vitamin E status in growing rats

O R I G I N A L A R T I C L E

Dietary flavonoids do not affect vitamin E status in growing ratsH. Wiegand1, C. Boesch-Saadatmandi1, S. Wein2, S. Wolffram2, J. Frank1 and G. Rimbach1

1 Institute of Human Nutrition and Food Science, Christian-Albrechts-University (CAU), Kiel, Germany, and

2 Institute of Animal Nutrition and Physiology, Christian-Albrechts-University (CAU), Kiel, Germany

Introduction

a-Tocopherol, the major vitamin E congener in mam-

mals, is recognised as the most important lipid-

soluble, chain-breaking antioxidant in the body

(Burton et al., 1982; Rimbach et al., 2002) and its

blood and tissue concentrations are generally approxi-

mately 10 times higher than those of the quantita-

tively second most important congener c-tocopherol.

Vitamin E uptake, transport and tissue distribution

are closely related to those of other dietary lipids. Dur-

ing intestinal absorption, which was previously

thought to be solely mediated by passive diffusion,

the body does not discriminate between the different

vitamin E congeners (subsequently also referred to as

vitamers) (Kayden and Traber, 1993) The involve-

ment of the membrane transporters scavenger

receptor class B type I (Reboul et al., 2006) and

Niemann-Pick C1-like 1 (Narushima et al., 2008) in

a-tocopherol uptake has only recently been described.

Keywords

flavonoid, quercetin, catechin, genistein,

a-tocopherol, vitamin E, rat

Correspondence

Prof. Gerald Rimbach, Institute of Human

Nutrition and Food Science, Christian-

Albrechts-University, Olshausenstrasse 40,

Kiel, 24118, Germany. Tel: +49 431 880 2583;

Fax: +49 431 880 2628; E-mail: rimbach@

foodsci.uni-kiel.de

Received: 4 September 2008;

accepted: 17 November 2008

First published online: 31 March 2009

Summary

This study aimed at investigating potential effects of the flavonoids geni-

stein, quercetin and catechin and the role of co-ingested dietary fat on

vitamin E concentrations in rats. In experiment 1, genistein, quercetin

and catechin were fed to rats, incorporated into semisynthetic diets at

concentrations of 2 g/kg, either as individual compounds or in combina-

tion to investigate their individual and possible synergistic actions

towards a-tocopherol in plasma and selected tissues. For experiments 2

and 3, quercetin was selected as a representative model flavonoid to

study the effects of the quantity (5% vs. 10%) and type of dietary fat

(coconut fat plus corn oil vs. rapeseed oil; experiment 2) and the role of

cholesterol (experiment 3) on potential flavonoid-vitamin E interactions.

The concentrations of a-tocopherol and c-tocopherol in the plasma,

liver, lung and cortex of flavonoid-fed rats were not significantly differ-

ent from the concentrations measured in control rats in all three experi-

ments. However, increasing the amount of coconut fat plus corn oil

from 5 to 10% resulted in lower a-tocopherol concentrations in plasma

and tissue. The a-tocopherol concentrations in the rats fed rapeseed oil

were significantly higher than in rats fed coconut fat plus corn oil. The

addition of 0.2% cholesterol to the diet did not influence the tocopherol

concentrations in plasma and tissue in both quercetin-supplemented

and control rats. Additionally, the mRNA levels of a-TTP, CYP3A4,

CYP4F and Mdr2, which are integral proteins involved in vitamin E

homeostasis were measured. Only genistein reduced the Mdr2 mRNA

level, but none of the other transcripts. All other flavonoids were with-

out effect. In conclusion, co-ingested dietary fat appears to influence

vitamin E concentrations in rats, but does not seem to be an important

determinant of flavonoid-vitamin E interactions.

DOI: 10.1111/j.1439-0396.2008.00910.x

Journal of Animal Physiology and Animal Nutrition 94 (2010) 307–318 ª 2009 The Authors. Journal compilation ª 2009 Blackwell Verlag GmbH 307

From the intestine, all vitamers are transported, via

the lymphatic pathway, to the liver where a number

of proteins appear to affect the discrimination of the

non-a-tocopherol congeners resulting in their low tis-

sue concentrations. All other vitamers and, to a lesser

extent, a-tocopherol are metabolised to water-soluble

metabolites that are excreted in urine (Parker and

Swanson, 2000). Degradation of the vitamin is initi-

ated by x-hydroxylation of the terminal methyl group

of its aliphatic side-chain by cytochrome P450 (subse-

quently CYP refers to the human and Cyp to rodent

gene and protein) enzymes followed by subsequent

side-chain shortening by b-oxidation (Lodge et al.,

2001; Sontag and Parker, 2002). CYP3A4 and

CYP4F2 have been suggested to facilitate the initial

x-oxidation of a-tocopherol (Birringer et al., 2001)

and c-tocopherol (Sontag and Parker, 2002), respec-

tively. Another hepatic protein, namely, a-tocopherol

transfer protein, has a higher binding affinity for

a-tocopherol than for the non-a-tocopherol vitamers

(Hosomi et al., 1997) and appears to be involved in

the selective secretion of a-tocopherol from the liver

into plasma (Kaempf-Rotzoll et al., 2003). Excretion

of a-tocopherol into bile seems to be dependent on

the presence of a functioning ATP binding cassette

(ABC) transporter Mdr2 (also known as ABCB4)

(Mustacich et al., 1998).

a-Tocopherol is an integral part of a cellular anti-

oxidant network protecting macromolecules, such as

membrane lipids, proteins and DNA from oxidative

damage (Constantinescu et al., 1993; Packer et al.,

2001). Peroxide radicals generated in the lipid

compartments are scavenged by a-tocopherol, which

is turned into a less reactive radical itself. a-Toco-

pherol radicals are recycled at the lipid-water inter-

face by the water-soluble antioxidant vitamin C

which, in turn, is regenerated from its radical by

thiol antioxidant enzymes that are recycled

through the conversion of NAD(P)H + H+ to

NAD(P)+ (oxidized and reduced forms of nicotin-

amide adenine dinucleotide).

Flavonoids, a large group of phenolic compounds

in plants, have been associated with protective

effects in a multitude of disease states including

cancer, cardiovascular diseases and neurodegenera-

tive disorders (Manach et al., 2005; Scalbert et al.,

2005). Many of the reported biological functions of

flavonoids are based on their antioxidant potential

(Williams et al., 2004). Flavonoids may also affect

cellular functions by altering the phosphorylation of

signalling molecules and/or by modulating gene

expression (Williams et al., 2004; Moon et al., 2006;

Morris and Zhang, 2006).

Cell culture and animal studies (Nanjo et al.,

1993; Virgili et al., 1998; Murakami et al., 2002;

Frank, 2005) demonstrated that flavonoids may

influence vitamin E status by directly scavenging

free radicals, thus protecting vitamin E from oxida-

tion and by regenerating it from its radical form

(Zhu et al., 1999; Frank et al., 2006) similar to vita-

min C within the antioxidant network.

Therefore, we studied the influence of three com-

mon dietary flavonoids, namely, genistein, quercetin

and catechin, on vitamin E status in rats. As flavo-

noids have been tested as individual substances in

the past, we also used combinations of flavonoids to

investigate possible synergistic interactions. Querce-

tin was selected as a representative model flavonoid

to study the effects of co-ingested fat and cholesterol

on the potential vitamin E-sparing activity of flavo-

noids. Quercetin is widely distributed in edible plants

and is thus abundant in the human diet and animal

feed. The occurrence of genistein and catechin is

restricted to certain classes of edible plants and,

therefore, foodstuffs. Furthermore, the in vitro anti-

oxidant capacity of quercetin was higher than that

of genistein and catechin (Hundhausen et al., 2005).

Material and methods

Test substances

Genistein (CAS no. 446-72-0), quercetin dihydrate

(CAS no. 6151-25-3) and (+)-catechin hydrate (CAS

no. 225937-10-0) were purchased from LC Laboratories

(Woburn, MA, USA), Carl Roth (Karlsruhe, Germany)

andSigma-Aldrich(Schnelldorf,Germany)respectively.

Animals

Male Wistar Unilever rats (HsdCpb:WU; Harlan-Win-

kelmann GmbH, Borchen, Germany) were housed in

pairs in Macrolon cages with spruce and fir wood bed-

ding in a controlled environment (21 � 2 �C, 55 �5% relative humidity, 12 h light-dark cycle). Each

cage was equipped with a water bottle and a feed

container for powdery feed. The rats had free access to

feed and water throughout the experiments. All

animal experiments were performed according to

German animal welfare laws and regulations and with

permission of the appropriate authorities.

Study designs and diets

Experiment 1

Fifty-four rats were randomly divided into nine

groups of six animals each with an initial body

Dietary flavonoids do not affect vitamin E status in growing rats H. Wiegand et al.

308 Journal of Animal Physiology and Animal Nutrition. ª 2009 The Authors. Journal compilation ª 2009 Blackwell Verlag GmbH

weight of 89 � 4 g (mean � SD) and fed their

respective diets for 22 days. The compositions of the

semisynthetic diets (Sniff special diets GmbH, Soest,

Germany) are shown in Table 1. The basal diet (con-

trol diet) contained all racemic-a-tocopheryl acetate

as the only form of vitamin E at a concentration of

7.7 mg/kg diet. To prepare a a-tocopherol-enriched

diet, 10 mg/kg diet all racemic-a-tocopheryl acetate

(Rovimix� E-50 Adsorbate; DSM, Basel, Switzerland)

was added to the basal diet (vitamin E control group;

total a-tocopherol, 17.7 mg/kg diet). The fat in the

diet was composed of 3% coconut fat and 2%

tocopherol-stripped corn oil (from MP Biomedicals

GmbH, Heidelberg, Germany). To prepare the exper-

imental diets, the basal diet was supplemented with

genistein, quercetin or catechin, respectively, or

combinations of the three flavonoids (genistein +

quercetin, genistein + catechin, quercetin + catechin

and genistein + quercetin + catechin) at a concentra-

tion of 2 g total flavonoids/kg diet.

Experiment 2

Sixty-four rats were randomly divided into eight

groups of eight animals each with an initial body

weight of 91 � 3.9 g (mean � SD) and fed the experi-

mental diets for 28 days. The basal diets (Table 1) con-

tained 5% or 10% fat from rapeseed oil or coconut fat

plus tocopherol-stripped corn oil, respectively. Each

of the four diets was supplemented with quercetin at a

concentration of 2 g/kg diet and the unsupplemented

diets served as the controls. The vitamin E contents of

all diets were adjusted to match the a-tocopherol con-

centration in the diet containing 10% rapeseed oil

(Table 1). Accordingly, natural (RRR)-a-tocopherol

(gift from Dr. Gaertner, Cognis Deutschland GmbH &

Co KG, Monheim am Rhein, Germany) was added to

the 5% and 10% coconut fat plus tocopherol-stripped

corn oil diets and to the 5% rapeseed oil diet. The

diets with rapeseed oil as fat source in addition

contained RRR-c-tocopherol.

Experiment 3

Thirty-two rats were randomly divided into four

groups of eight animals each with an initial body

weight of 80 � 4.4 g (mean � SD) and fed their

respective diets for 28 days. Basal diets containing

10% rapeseed oil (by weight) as the sole source of

dietary RRR-a- and RRR-c-tocopherols, were pre-

pared (Table 1) and 0.2% cholesterol (by weight)

added to two of four diets. Quercetin was added to a

cholesterol-fortified and an unfortified diet at a con-

centration of 2 g/kg.

The experimental diets in all three experiments

were prepared weekly and stored at 4 �C. Food

intake and body weights were controlled weekly.

Sample collection

At the end of the experiments, the rats were starved

for 12 h before anaesthesia by carbon dioxide and

Table 1 Compositions of the basal diets

Experiment 1 Experiment 2 Experiment 3

5% Coconut

fat/corn oil

10% Coconut

fat/corn oil

5% Rapeseed

oil

10% Rapeseed

oil )Cholesterol +Cholesterol

Ingredients (g/kg)

Cornstarch 472.5 472.5 415 480 430 430 430

Glucose 110 110 110 110 110 110 110

Cellulose 50 50 50 50 50 50 50

Casein 240 240 240 240 240 240 240

Coconut oil concentrate* 37.5 37.5 75 – – – –

Rapeseed oil – – – 50 100 100 100

Tocopherol-stripped corn oil 20 20 40 – – – –

Mineral and trace element premix 60 60 60 60 60 60 60

Vitamin premix (vitamin E-free) 10 10 10 10 10 10 10

Cholesterol – – – – – – 2

Vitamin E (mg/kg)

All-racemic a-tocopheryl acetate 7.7 – – – – – –

RRR-a-tocopherol – 16.4� 16.9� 18.9�/� 21.0� 24.0� 36.0�

RRR-c-tocopherol – – – 15.0� 30.0� 21.0� 21.0�

*Containing 80% crude fat from coconut.

�Originated from rapeseed oil.

�Natural (RRR)-a-tocopherol was added as pure substance.

H. Wiegand et al. Dietary flavonoids do not affect vitamin E status in growing rats

Journal of Animal Physiology and Animal Nutrition. ª 2009 The Authors. Journal compilation ª 2009 Blackwell Verlag GmbH 309

decapitated. Blood samples were collected in tubes

containing lithium-heparin coated beads, centrifuged

(3000 g; 10 min, 4 �C) and the plasma was stored at

)80 �C until analysed. Liver tissue was rinsed with

0.9% NaCl solution. Liver, lung and cortex tissues

were excised, frozen in liquid nitrogen and stored at

)80 �C until analysed.

Tocopherol analysis

Plasma (100 ll) was mixed with 900 ll sodium phos-

phate solution, pH 7.0 [50 mmol/l Na2HPO4, 5 mmol/

l EDTA, 0.5% (w/v) ascorbic acid], and lung, cortex

(200 mg) or liver (250 mg) tissue was homogenised

in 5 g sodium phosphate solution. One millilitre of

the prepared plasma samples or the tissue homogen-

ates was mixed with 1.5 ml ethanol containing 1%

ascorbic acid and 25 ll of 0.1% butylated hydroxytol-

uene. Vitamin E was extracted with 2 ml hexane,

phases were separated by centrifugation (1200 g,

10 min, 10 �C), 1 ml of the supernatant was trans-

ferred to a clean tube, dried under N2 gas and resus-

pended in the mobile phase.

Plasma and tissue a-tocopherol and c-tocopherol

were quantified on a JASCO HPLC system (AS-2057

Plus autosampler, PU-2080 Plus pump, FP-2020 Plus

fluorescence detector, LG-2080-02 gradient unit and

a 3-line degasser; Jasco, Groß-Umstadt, Germany).

Separation of tocopherols was performed on a Supe-

lco silica C18 column (Waters Spherisorb ODS-2,

100 · 4.6 mm, 3 lm; Sigma-Aldrich) using metha-

nol/water (98:2, v/v) as the mobile phase. Flow rate

was set to 1.2 ml/min and the detector was operated

at an excitation wavelength of 290 nm and emission

wavelength of 325 nm. Peaks were recorded and inte-

grated using the chromatography software ChromPass

version 1.8.6.1 (Jasco). The concentrations of

a-tocopherol and c-tocopherol were quantified against

an external standard curve with authentic tocophe-

rols (Tocopherol Set, catalog no. 613424; Calbio-

chem�, Merck Chemicals, Nottingham, UK).

Antioxidant capacity of plasma

The ferric reducing ability of plasma (FRAP) was

determined according to the method of Benzie and

Strain (1996). At low pH, the ferric-tripyridyltriazine

(Fe3+-TPTZ) complex is reduced to ferrous (Fe2+)

resulting in an intense blue colour with maximum

absorption at 593 nm (DU� 800 spectrophotometer;

Beckmann Coulter, Krefeld, Germany). The results

are expressed relative to the activity of the reference

substance ascorbic acid.

Cholesterol analysis

Cholesterol was quantified photometrically in plasma

with an enzymatic colorimetric test kit (Flui-

test�CHOL, Biocon� Diagnostik, Voehl-Marienhagen,

Germany).

RNA isolation and real time qRT-PCR

Total RNA was isolated from rat liver tissue using

RNeasy Mini kit (Qiagen, Hilden, Germany). RNA was

quantified photometrically and RNA quality was con-

trolled by gel electrophoresis. One-step real-time PCR

was performed with SensiMixTM PCR kits from Quan-

tace (Berlin, Germany). mRNA concentrations of the

respective target genes were normalized for mRNA

concentrations of the housekeeping gene b-actin.

Primers (Table 2) were designed to the corresponding

sequences of Rattus norvegicus mRNA with Primer3

software (version 0.4.0; http://frodo.wi.mit.edu/

cgi-bin/primer3/primer3_www.cgi) and purchased

from MWG-Biotech AG (Ebersberg, Germany).

Statistical analysis

Statistical analysis of the registered variables was

performed with the statistical software spss (Version

13.1, SPSS GmbH Software, Munich, Germany) by

means of a one-way anova and Dunnett as post hoc

test. Data with inhomogeneity of variance were anal-

ysed by Games-Howell post hoc test (Experiment 1).

In experiment 2, a 3-factorial anova was used to

Table 2 Nucleotide sequences of primers and conditions used for the

real time qRT-PCR experiments

Gene identification Sequence (5¢-3¢)AT

(�C)

Product

size (bp)

Ttpa F: GCTTTTCAAATTACCCCATC

R: GATCCCACGAACTTTCAATG

55 81

Cyp3a23/3a1 F: TGGTGCTCCTCTACGGATTT

R: TTATGGCACTCCACATCGAA

57 142

Cyp4f F: GAGGCTGACACCTTCATGTT

R: AGGTCGTCCCATTCAATCTC

55 164

Abcb4 F: CGCCAAGAGAGATAAAAAGG

R: AGTGATGCCGTAGATGTGAG

55 178

Actb F: GGGGTGTTGAAGGTCTCAAA

R: TGTCACCAACTGGGACGATA

56 165

AT, annealing temperature; F forward primer; R reverse primer; Ttpa,

alpha-tocopherol transfer protein; Cyp3a23/3a1, cytochrome P450,

family 3, subfamily a, polypeptide 23/polypeptide 1; Cyp4f, cyto-

chrome P450, family 4, subfamily f; Abcb4, ATP-binding cassette, sub-

family B, member 4 (multidrug resistance 2 P-glycoprotein); Actb,

beta-actin.



analyse for effects of different dietary fat and quer-

cetin supplementation on a-tocopherol levels. A

two-way anova was performed in experiment 3 to

calculate the effects of quercetin and cholesterol sup-

plementation on plasma cholesterol levels. In all

statistical tests, differences were considered signifi-

cant if p < 0.05.

Results

Feed intake and body weight

Feed intake (data not shown) and final body

weights (experiment 1, 247 � 12.6 g; experiment 2,

267 � 15.8 g; experiment 3, 264 � 16.8 g) of the

rats did not differ among the groups at the end

of the feeding period in each of the three

experiments.

Experiment 1

The concentrations of a-tocopherol in plasma, liver

and lung of flavonoid-fed rats were not significantly

different from the concentrations measured in con-

trol animals (Table 3). Accordingly, no differences in

effect were found between individual and combined

administration of the flavonoids. a-Tocopherol con-

centrations in cortices of rats fed quercetin were sig-

nificantly lower compared with the controls

(p < 0.05). As expected, a-tocopherol concentrations

in all tissues were significantly higher in the VE con-

trol group compared with control animals (Table 3).

The antioxidant capacity of plasma, as deter-

mined by the FRAP assay, was not affected by

flavonoid or a-tocopherol (VE control group) sup-

plementation (data not shown). Plasma cholesterol

concentrations of the flavonoid-fed rats did not

differ from those in control animals. a-Tocopherol

supplementation (VE control group), on the other

hand, significantly increased plasma cholesterol

(p < 0.05; Table 3).

Compared with control rats, neither dietary flavo-

noids nor a-tocopherol significantly changed the

hepatic mRNA levels of Ttpa, Cyp3a23/3a1, or Cyp4f

(Table 4). Dietary genistein and vitamin E (VE con-

trol group) supplementation significantly lowered

relative mRNA concentrations of the Abcb4 in the

liver whereas dietary quercetin and catechin did not

(Table 4).

Experiment 2

Quercetin supplementation did not affect a- and

c-tocopherol concentrations in plasma and selected

tissues (Fig. 1; Table 5) of rats fed 5% or 10% coco-

nut fat plus corn oil or rapeseed oil, respectively, in

their diets. Rats fed rapeseed oil had higher

a-tocopherol concentrations in plasma, liver and

lung compared with rats fed coconut fat plus corn

oil (Fig. 1). The quantity (5% or 10%) of rapeseed

oil in the diet did not significantly affect a-tocoph-

erol concentrations. Increasing the amount of coco-

nut fat plus corn oil from 5 to 10%, on the other

hand, lowered a-tocopherol concentrations in

plasma, liver, lung and cortex. However, the cortex

a-tocopherol levels were moderately altered by the

fat type and fat quantity. The quantity (5% vs.

10%) and type (coconut fat plus corn oil vs. rape-

seed oil) of the dietary fat had no significant impact

on the antioxidant capacity (data not shown) and

cholesterol concentrations (Table 6) of plasma.

Table 3 Experiment 1: a-Tocopherol concentrations in plasma, liver, lung and cortex* of rats fed either the control diet or the diets supplemented

with the flavonoids

Group Control Genistein Quercetin Catechin

Genistein +

Quercetin

Genistein +

Catechin

Quercetin +

Catechin

Genistein +

Quercetin +

Catechin

Vitamin E

control

Plasma (lmol/l)

a-Tocopherol 10.1 � 0.8 11.6 � 1.3 11.5 � 1.5 10.8 � 0.9 10.5 � 0.9 11.3 � 1.1 11.4 � 2.6 10.1 � 1.5 19.2 � 3.2a

Cholesterol (mg/dl) 96.0 � 7.3 99.8 � 6.7 102 � 12 99.3 � 23 97.3 � 3.3 104 � 12 107 � 23 98.1 � 17 113 � 13a

Liver (nmol/g)

a-Tocopherol 23.6 � 1.0 23.1 � .1.8 22.5 � 1.0 24.5 � 1.8 23.7 � 2.4 24.6 � 2.6 23.5 � 2.2 21.6 � 2.1 38.8 � 5.3a

Lung (nmol/g)

a-Tocopherol 23.6 � 1.9 29.8 � 3.4 21.7 � 5.1 24.6 � 5.5 24.2 � 5.8 24.0 � 5.3 24.1 � 4.0 26.1 � 4.0 41.7 � 2.9a

Cortex (nmol/g)

a-Tocopherol 35.7 � 1.1 35.8 � 1.5 30.3 � 1.8a 33.9 � 3.4 30.0 � 3.9 33.1 � 5.3 31.5 � 4.0 31.6 � 3.3 43.5 � 3.3a

*Values are means � SD, n = 6.aDifferent from the control group, p < 0.05 Games-Howell test).



Experiment 3

No significant differences in a- and c-tocopherol con-

centrations in plasma, liver, lung and cortex were

observed in rats fed diets supplemented with choles-

terol and quercetin compared with the animals fed

the respective control diets (Table 7). While dietary

quercetin did not affect plasma cholesterol concen-

trations, dietary cholesterol supplementation signifi-

cantly lowered plasma cholesterol (p < 0.05;

Table 7).

Discussion

The published literature on vitamin E-sparing activi-

ties of flavonoids in vivo is at present inconclusive.

Some researchers observed pronounced increases in

plasma and tissue vitamin E concentrations in flavo-

noid-fed rats (Nanjo et al., 1993; Choi et al., 2003;

Frank et al., 2003, 2006; Kawakami et al., 2004); oth-

ers did not (Fremont et al., 2000; Yamagishi et al.,

2001; Benito et al., 2004; Ameho et al., 2008). Fur-

thermore, studies in pigs reported no vitamin E-spar-

ing effect of dietary flavonoids on tissue vitamin E

status (Augustin et al., 2008). The fact that the com-

positions of the diets fed during the above mentioned

rat experiments differed, especially with regard to the

fat component, suggested that other dietary factors

such as fat might be important factors influencing the

bioactivities of the studied flavonoids. To evaluate sys-

tematically the potential vitamin E-sparing activities

of dietary flavonoids and the importance of the co-

ingested fat, we performed the above reported experi-

ments in growing male rats.

Our first experiment aimed at studying the effects

of genistein, quercetin and catechin, as individual

compounds or in combination, on vitamin E status

in vivo. To this end, weanling male Wistar rats were

fed genistein, quercetin or catechin individually or

in combination, for 22 days. To confirm that

flavonoids were bioavailable from the diets, plasma

concentrations of quercetin and isorhamnetin (a

methylated metabolite of quercetin) were measured

in the rats fed the highest quercetin concentrations

(quercetin group, experiment 1) according to

the method of Cermak et al. (2003). Plasma

quercetin and isorhamnetin concentrations were

1.90 � 0.36 and 12.98 � 2.87 lmol/l (means � SD)

respectively.

To investigate potential mechanisms of action of

the tested dietary flavonoids on vitamin E status that

are independent of their antioxidant function, we

measured relative mRNA levels of genes coding for

enzymes and transporters that are involved in the

hepatic processing and metabolism of vitamin E

(Fig. 2). Feeding of genistein, quercetin and catechin

did not alter the mRNA levels of Cyp3a23/3a1

(homologue to the human CYP3A4), Cyp4f (the rat

primer for Cyp4f binds to the four known subunits

Cyp4f1, Cyp4f4, Cyp4f5 and Cyp4f6) and Ttpa in

rats (Table 4). mRNA concentrations of the ABC

transporter Mdr2 (Abcb4) were significantly reduced

by dietary genistein and vitamin E (VE control

group) compared with the control animals. The

transporter Mdr2 is located in the liver canalicular

membranes and is believed to function as phosphati-

dylcholine translocase (Ruetz and Gros, 1994) and to

secrete tocopherols into the bile (Mustacich et al.,

1998). To the best of our knowledge, a reduction in

this specific ABC transporter by genistein and

a-tocopherol in vivo has not yet been reported. While

the reduction in gene transcription cannot be con-

clusively explained at present, it appears possible

that a-tocopherol reduced Mdr2 gene expression

through its elevating effect on plasma cholesterol

(Table 3). It was previously shown that cholesterol

feeding resulted in reduced hepatic Mdr2 mRNA

concentrations in rats (Gupta, 2000). However, this

Table 4 Experiment 1: Hepatic mRNA levels*

of Ttpa, Cyp3a23/3a1, Cyp4f and Abcb4 of rats

fed either the control diet or the diets supple-

mented with genistein, quercetin, catechin or

a-tocopherol (vitamin E control group)

Groups Control Genistein Quercetin Catechin Vitamin E control

Flavonoid (g/kg) – 2 2 2 –

Ttpa 1.00 � 0.18 1.14 � 0.45 1.38 � 0.22 1.16 � 0.25 0.99 � 0.29

Cyp3a23/3a1 1.00 � 0.36 0.99 � 0.69 1.47 � 0.28 1.22 � 0.39 0.80 � 0.21

Cyp4f 1.00 � 0.14 1.06 � 0.27 1.15 � 0.12 1.02 � 0.13 0.98 � 0.24

Abcb4 1.00 � 0.16 0.66 � 0.34a 0.97 � 0.19 0.86 � 0.19 0.60 � 0.17a

Ttpa, alpha-tocopherol transfer protein; Cyp3a23/3a1, cytochrome P450, family 3, subfamily a,

polypeptide 23/polypeptide 1, Cyp4f, cytochrome P450, family 4, subfamily f; Abcb4, ATP-bind-

ing cassette, subfamily B, member 4 (multidrug resistance 2 P-glycoprotein).

*Values are means � SD, n = 6.aDifferent from the control group, p < 0.05 (Dunnett test).



would not explain the effect observed in our geni-

stein-fed rats where no changes in cholesterol con-

centrations were found. In general, effects of

flavonoids on ABC transporters and on CYP enzymes

were demonstrated in numerous cell culture and

animal studies (Cermak and Wolffram, 2006; Moon

et al., 2006; Morris and Zhang, 2006). Despite the

decreased mRNA levels of Mdr2 (Abcb4) in the geni-

stein-fed rats, dietary supplementation of genistein,

quercetin and catechin, as individual compounds or

in combination, did not change the a-tocopherol

concentrations in plasma, liver and lung compared

with the control animals. Only in the cortex,

a-tocopherol concentrations of quercetin fed rats

were significantly lower than in control rats (Table 3).

Low amounts of flavonoids have been detected in

brain tissue of flavonoid-fed rats (Chang et al., 2000;

De Boer et al., 2005). Hence, flavonoids appear to be

able to pass the blood-brain barrier and may affect

biological functions in the brain. Therefore, the

a-tocopherol lowering effects of dietary quercetin in

the cortex warrant further investigations.

Similar to our findings, 0.3% quercetin or cate-

chin in the diet did not affect plasma a-tocopherol

levels in rats fed the flavonoids for 10 days (Benito

et al., 2004). However, the vitamin E concentrations

in these diets were very high (approximately

120 mg/kg diet) and may have masked any potential

vitamin E-sparing effects. We, in contrast, used mar-

ginal vitamin E concentrations in the diets during

our first experiment. Similar to our findings, other

researchers who fed quercetin (Ameho et al., 2008)

or cocoa polyphenols (Yamagishi et al., 2001)

together with a vitamin E-deficient diet did not find

any a-tocopherol sparing effects of the flavonoids.

Nevertheless, other published studies reported

marked increases in a-tocopherol concentrations in

plasma, liver and lung tissue by flavonoids indepen-

dent of the vitamin E concentrations in the diet

(Nanjo et al., 1993; Frank et al., 2003, 2006;

Kawakami et al., 2004). We did use both a low

vitamin E regime (approximately 8 mg/kg all race-

mic-a-tocopheryl acetate) in the first experiment and

an adequate vitamin E regime (16–36 mg/kg RRR-

a-tocopherol) in experiments 2 and 3. The vitamin E

requirements for growing rats were estimated at

18 mg/kg diet RRR-a-tocopherol (National Research

Council, 1995). Vitamin E requirements, however,

are known to depend on the amount of unsaturated

fatty acids present in the diet (Muggli, 1994).

Because of the low content of unsaturated fat in our

experimental diets, the true vitamin E requirement

of our growing rats was probably below 18 mg/kg

RRR-a-tocopherol. As mentioned before, these con-

tradicting findings suggested that other dietary fac-

tors, including fat, may be important determinants

of the interactions between flavonoids and vitamin E

in vivo and prompted us to address this issue in

experiments 2 and 3 systematically.

15

20

25

Plasma

Fat effect

0

5

10

alph

a-T

ocop

hero

l (µ

mol

/L)

alph

a-T

ocop

hero

l (nm

ol/g

)

80

Fat effect

20

40

60

Liver

60

80

Lung

0

0

20

40

alph

a-T

ocop

hero

l (nm

ol/g

)

80

Fat effect

40

60

Cortex

Fat effect

0

20

alph

a-T

ocop

hera

l (nm

ol/g

)

10 10 5 5 10 10 5 5 Fat quantity (%)

Coconut fat/Corn oil

Rapeseed oil

Quercetin (2 g/kg)

Fig. 1 Experiment 2: a-Tocopherol concentrations in plasma, liver,

lung and cortex of rats fed either the quercetin-free diets (fat quantity

5% vs. 10% and fat type: coconut fat plus corn oil vs. rapeseed oil) or

the respective diets supplemented with quercetin at a concentration

of 2 g/kg diet (experiment 2). Values are means � SD, n = 7–8. A

3-factorial ANOVA revealed significant effects of fat quantity, fat type

and the interaction between fat quantity and type (p < 0.05) in plasma

and tissues.



To investigate the influence of the quantity and

type of dietary fat on the potential tocopherol-sparing

actions of flavonoids, we performed experiment 2.

Quercetin was chosen as a representative flavonoid

for this experiment. Coconut fat (3%) was used as

the source of dietary fat because of its low vitamin E

content and tocopherol-stripped corn oil (2%) was

added to improve the fatty acid composition. Rape-

seed oil was chosen as a second alternative fat

source (Table 1). These dietary fats were provided at

Table 5 Experiment 2: c-Tocopherol concentrations in plasma, liver, lung and cortex* of rats fed either the control diet or the respective diet sup-

plemented with quercetin

Group 5% Rapeseed oil 5% Rapeseed oil 10% Rapeseed oil 10% Rapeseed oil

Quercetin (2 g/kg) ) + ) +

Plasma (lmol/l)

c-Tocopherol 0.5 � 0.1 0.5 � 0.2 0.8 � 0.3 0.6 � 0.1

Liver (nmol/g)

c-Tocopherol 2.1 � 0.4 2.1 � 0.5 3.4 � 0.9 2.8 � 0.5

Lung (nmol/g)

c-Tocopherol 3.8 � 1.3 3.4 � 1.4 4.7 � 1.3 4.2 � 1.1

Cortex (nmol/g)

c-Tocopherol 0.9 � 0.2 1.0 � 0.2 1.3 � 0.4 1.0 � 0.2

*Values are means � SD, n = 8. Tissue c-tocopherol concentrations were <0.2 nmol/g in the groups with coconut fat plus corn oil.

Table 6 Experiment 2: Plasma cholesterol concentrations* of rats fed either the control diet or the respective diet supplemented with quercetin

Group

5% Coconut

fat/corn oil

5% Coconut

fat/corn oil

10% Coconut

fat/corn oil

10% Coconut

fat/corn oil

5% Rapeseed

oil

5% Rapeseed

oil

10% Rapeseed

oil

10% Rapeseed

oil

Quercetin (2 g/kg) ) + ) + ) + ) +

Plasma

Cholesterol (mg/dl) 75.3 � 11 76.5 � 12 72.4 � 6.8 73.1 � 13 79.1 � 17 78.5 � 9.0 82.2 � 9.5 80.3 � 6.7

*Values are means � SD, n = 8.

Table 7 Experiment 3: Plasma cholesterol, a-tocopherol and c-tocoph-

erol concentrations in plasma, liver, lung and cortex* of rats fed either

the control or the respective experimental diet supplemented with

quercetin and cholesterol

Group 1 2 3 4

Cholesterol (2 g/kg) ) ) + +

Quercetin (2 g/kg) ) + ) +

Plasma (lmol/l)

a-Tocopherol 20.7 � 2.9 19.8 � 3.3 17.2 � 0.9 18.6 � 2.3

c-Tocopherol 0.5 � 0.1 0.4 � 0.1 0.3 � 0.1 0.3 � 0.1

Cholesterol (mg/dl)� 86.2 � 10 77.7 � 9.8 66.2 � 6.5 66.3 � 11

Liver (nmol/g)

a-Tocopherol 71.1 � 5.3 73.0 � 6.6 76.1 � 6.2 80.9 � 5.9

c-Tocopherol 2.5 � 0.3 2.2 � 0.2 2.0 � 0.2 2.7 � 0.4

Lung (nmol/g)

a-Tocopherol 62.0 � 7.8 57.5 � 6.5 60.6 � 8.7 59.2 � 7.3

c-Tocopherol 4.2 � 0.7 3.6 � 0.3 3.6 � 1.1 3.6 � 0.4

Cortex (nmol/g)

a-Tocopherol 55.1 � 3.7 52.0 � 4.8 52.7 � 3.0 53.4 � 3.6

c-Tocopherol 1.3 � 0.2 1.1 � 0.1 1.1 � 0.1 1.1 � 0.1

*Values are means � SD, n = 8.

�Plasma cholesterol concentrations were significantly different

between the groups (Two-way ANOVA for quercetin and cholesterol sup-

plementation, p < 0.05.).

E n i m a t i V α P T T - α l o r e h p o c o T -

4 A 3 P Y C

F 4 P Y C

a m s a l P

F 4 P Y C

C H E C

2 r d M

e l i B

e n i r U

α-TTP alpha-Tocopherol-transferprotein

Cytochrom-P-450 isoenzyme CYP

Carboxyethydroxychroman metabolites CEHC

Multidrug resistance P-glycoprotein Type 2Mdr2

Fig. 2 Enzymes and transporters that are involved in the hepatic pro-

cessing and metabolism of vitamin E.



concentrations of 5% or 10% of the diets. The vita-

min E contents of all diets were adjusted to match

the a-tocopherol concentration in the diet containing

10% rapeseed oil. We observed significant effects of

both the quantity and type of fat on vitamin E con-

centrations in plasma and tissues (Fig. 1). Twofold

higher a-tocopherol levels in plasma, liver and lung

tissues in the rats fed the diets with rapeseed oil

compared with coconut fat plus corn oil were evi-

dent. Interestingly, rats fed diets with 10% coconut

fat plus corn oil had significantly lower a-tocopherol

concentrations in plasma, liver and lung compared

with the rats fed 5% of this fat type. The removal of

natural antioxidants during the production of

tocopherol-stripped corn oil in conjunction with its

high content of polyunsaturated fatty acids may

result in reduced oxidative stability of the oil, and

thus an increased utilisation of endogenous vitamin E.

Furthermore, the higher concentration of medium

chain fatty acids in coconut fat which can be

absorbed without lipase and bile salts activity; (Bach

and Babayan, 1982) may affect micelle formation

and thus, the absorption of a-tocopherol.

A previous rat study also reported that increasing

the fat component from 5 to 19% of the diet (mix-

ture of monoacylglycerols esterfied with stearic or

palmitic acid and lard) did not improve vitamin E

absorption and did not affect liver a-tocopherol con-

centrations (Brink et al., 1996). In a human study,

on the other hand, Jeanes et al. (2004) observed

that both the quantity of dietary fat as well as the

food matrix affected vitamin E absorption. Higher

plasma concentrations of H2-labelled a-tocopherol

were measured in subjects that ingested vitamin E

with a high-fat diet (toast with butter, 17.5 g fat) as

compared with a low-fat (cereals with semi-skimmed

milk, 2.5 g fat) or a second high-fat diet (cereals

with full fat milk, 17.5 g). Quercetin absorption was

also affected by the fat component of the diet. The

bioavailability of quercetin (30 lmol/kg body

weight) in pigs, observed as a shorter tmax and an

increased area under the curve was significantly

improved by raising the fat quantity from 3 to 7%

or 32% (Lesser et al., 2004). Many of the rodent

studies investigating flavonoid-vitamin E interactions

used fat at a level of 10% or even 30% in the diet,

although the National Research Council recom-

mends 5% dietary fat for growing rats (National

Research Council, 1995). Furthermore, the fat

sources varied and included rapeseed (Frank et al.,

2003, 2006), palm, perilla (Nanjo et al., 1993) and

safflower (Kawakami et al., 2004) oils. These large

differences in the compositions of the experimental

diets in addition to the different experimental

designs render a direct comparison of the results

from these studies and ours difficult.

It is generally known that the plasma concentra-

tions of cholesterol and vitamin E are closely cor-

related (Perugini et al., 2000). Moreover, increases

in plasma and liver vitamin E concentrations were

measured in rats fed diets supplemented with

flavonoids in the presence of dietary cholesterol

(0.2%) (Frank et al., 2003, 2006). The aim of our

third experiment, therefore, was to investigate the

impact of dietary cholesterol on the potential

effects of quercetin on vitamin E status in rats.

Diets with 10% rapeseed oil and 0.2% cholesterol

were prepared. Neither cholesterol nor quercetin,

alone or in combination, affected vitamin E status

in rats fed their respective diets for 28 days. Inter-

estingly, plasma concentrations of cholesterol were

significantly lower in rats fed the cholesterol diet,

independent of quercetin supplementation. Similar

to our findings, Fremont et al. (2000) who fed

diets with and without 0.3% cholesterol together

with wine polyphenols to rats, observed signifi-

cantly lower total plasma cholesterol and high den-

sity lipoprotein cholesterol concentrations in the

cholesterol-fed rats, independent of wine polyphe-

nol supplementation.

As vitamin E is thought to protect cell components

from oxidative damage by acting within the body’s

so called ‘antioxidant network’, other dietary antiox-

idants may be of importance for interactions

between flavonoids and the vitamin. High doses of

vitamin C (10 g/kg diet) increased the vitamin E

concentration in plasma and lungs of guinea pigs

(Bendich et al., 1984) and ascorbic acid supplemen-

tation (30 mg/100 g body weight) of vitamin

E-depleted rats resulted in increased plasma vitamin E

concentrations (Chen and Thacker, 1986). Frank

et al. (2003, 2006) who fed quercetin and catechin

(2 g/kg diet) to rats in diets containing 500 mg/kg

vitamin C, found marked increases in a-tocopherol

plasma and tissue concentrations. In comparison, the

diets used in our experiments contained only 15 mg

vitamin C per kg diet. Furthermore, a reduced intes-

tinal absorption of vitamin C in flavonoid-fed rats

cannot be ruled out, as a reversible and non-compet-

itive inhibition of the vitamin C transporter 1 by

quercetin and genistein was shown in cell culture

experiments (Song et al., 2002). These studies sug-

gest that redox interactions between vitamin C and

flavonoids may be the underlying mechanism for an

effective protection of vitamin E from oxidation. In

agreement with this notion, caffeic acid, another



dietary polyphenol, was shown to form an antioxi-

dant network with a-tocopherol and ascorbic acid

protecting a-tocopherol from oxidation and regener-

ating it from it tocopheroxyl radical (Laranjinha and

Cadenas, 1999). Thus the discrepancy between this

study, where no vitamin E-sparing effects of dietary

flavonoids were observed and the literature data in

which a potential interaction between vitamin E and

flavonoids was evident may be related to differences

in vitamin C supply.

Conclusion

In summary, the flavonoids genistein, quercetin and

catechin, as individual substances or in combination,

did not affect vitamin E status in our growing rats. Co-

ingested dietary fat appears to influence vitamin E

concentration in rats, but does not seem to be an

important determinant of flavonoid-vitamin E inter-

actions.

Acknowledgements

H.W. is supported by a scholarship from the post-

graduate programme ‘Natural Antioxidants’

(GRK820), German Research Foundation (DFG). J.F.

was supported by DFG grant no. FR 2478/1-1.

C.B.S., S.W. and G.R. are supported by a grant from

the Germany Ministry of Science and Education

(BMBF 0313856A).

References

Ameho, C. K.; Chen, C. Y.; Smith, D.; Sanchez-Moreno,

C.; Milbury, P. E.; Blumberg, J. B., 2008: Antioxidant

activity and metabolite profile of quercetin in vitamin-

E-depleted rats. The Journal of Nutritional Biochemistry

19, 467–474.

Augustin, K.; Blank, R.; Boesch-Saadatmandi, C.;

Frank, J.; Wolffram, S.; Rimbach, G., 2008: Dietary

green tea polyphenols do not affect vitamin E status,

antioxidant capacity and meat quality of growing pigs.

Journal of Animal Physiology and Animal Nutrition 92,

705–711.

Bach, A. C.; Babayan, V. K., 1982: Medium-chain trigly-

cerides: an update. American Journal of Clinical Nutrition

36, 950–962.

Bendich, A.; D’apolito, P.; Gabriel, E.; Machlin, L. J.,

1984: Interaction of dietary vitamin C and vitamin E

on guinea pig immune responses to mitogens. The

Journal of Nutrition 114, 1588–1593.

Benito, S.; Buxaderas, S.; Mitjavila, M. T., 2004: Flavo-

noid metabolites and susceptibility of rat lipoproteins

to oxidation American Journal of Physiology. Heart and

Circulatory Physiology 287, H2819–H2824.

Benzie, I. F.; Strain, J. J., 1996: The ferric reducing abil-

ity of plasma (FRAP) as a measure of ‘‘antioxidant

power’’: the FRAP assay. Analytical Biochemistry 239,

70–76.

Birringer, M.; Drogan, D.; Brigelius-Flohe, R., 2001: Toc-

opherols are metabolized in HepG2 cells by side chain

omega-oxidation and consecutive beta-oxidation. Free

Radical Biology and Medicine 31, 226–232.

Brink, E. J.; Haddeman, E.; Tijburg, L. B., 1996: Vitamin

E incorporated into a very-low-fat meal is absorbed

from the intestine of young rats. The British Journal of

Nutrition 75, 939–948.

Burton, G. W.; Joyce, A.; Ingold, K. U., 1982: First proof

that vitamin E is major lipid-soluble, chain-breaking

antioxidant in human blood plasma. Lancet 2, 327.

Cermak, R.; Wolffram, S., 2006: The potential of flavo-

noids to influence drug metabolism and pharmacoki-

netics by local gastrointestinal mechanisms. Current

Drug Metabolism 7, 729–744.

Cermak, R.; Landgraf, S.; Wolffram, S., 2003: The bio-

availability of quercetin in pigs depends on the glyco-

side moiety and on dietary factors. The Journal of

Nutrition 133, 2802–2807.

Chang, H. C.; Churchwell, M. I.; Delclos, K. B.; Newbold,

R. R.; Doerge, D. R., 2000: Mass spectrometric determi-

nation of Genistein tissue distribution in diet-exposed

Sprague–Dawley rats. The Journal of Nutrition 130,

1963–1970.

Chen, L. H.; Thacker, R. R., 1986: Vitamin C partially

reversed some biochemical changes produced by vita-

min E deficiency. Biotechnology Applied Biochemistry 8,

40–45.

Choi, E. J.; Chee, K. M.; Lee, B. H., 2003: Anti- and pro-

oxidant effects of chronic quercetin administration in

rats. European Journal of Pharmacology 482, 281–285.

Constantinescu, A.; Han, D.; Packer, L., 1993: Vitamin E

recycling in human erythrocyte membranes. The Jour-

nal of Biological Chemistry 268, 10906–10913.

De Boer, V. C.; Dihal, A. A.; Van Der Woude, H.; Arts, I.

C.; Wolffram, S.; Alink, G. M.; Rietjens, I. M.; Keijer,

J.; Hollman, P. C., 2005: Tissue distribution of querce-

tin in rats and pigs. The Journal of Nutrition 135,

1718–1725.

Frank, J., 2005: Beyond vitamin E supplementation: an

alternative strategy to improve vitamin E status. Jour-

nal of Plant Physiology 162, 834–843.

Frank, J.; Lundh, T.; Parker, R. S.; Swanson, J. E.;

Vessby, B.; Kamal-Eldin, A., 2003: Dietary (+)-catechin

and BHT markedly increase alpha-tocopherol concen-

trations in rats by a tocopherol-omega-hydroxylase-

independent mechanism. The Journal of Nutrition 133,

3195–3199.



Frank, J.; Budek, A.; Lundh, T.; Parker, R. S.; Swanson,

J. E.; Lourenco, C. F.; Gago, B.; Laranjinha, J.; Vessby,

B.; Kamal-Eldin, A., 2006: Dietary flavonoids with a

catechol structure increase alpha-tocopherol in rats

and protect the vitamin from oxidation in vitro. Journal

of Lipid Research 47, 2718–2725.

Fremont, L.; Gozzelino, M. T.; Linard, A., 2000: Response

of plasma lipids to dietary cholesterol and wine po-

lyphenols in rats fed polyunsaturated fat diets. Lipids

35, 991–999.

Gupta, S.; Todd Stravitz, R.; Pandak, W. M.; Reno

Vlahcevic, Z.; Hylemon, P. B., 2000: Regulation of

multidrug resistance 2 P-glycoprotein expression by

bile salts in rats and in primary cultures of rat hepato-

cytes. Hepatology 32, 341–347.

Hosomi, A.; Arita, M.; Sato, Y.; Kiyose, C.; Ueda, T.; Igar-

ashi, O.; Arai, H.; Inoue, K., 1997: Affinity for alpha-

tocopherol transfer protein as a determinant of the bio-

logical activities of vitamin E analogs. FEBS Letters 409,

105–108.

Hundhausen, C.; Bosch-Saadatmandi, C.; Augustin, K.;

Blank, R.; Wolffram, S.; Rimbach, G., 2005: Effect of

vitamin E and polyphenols on ochratoxin A-induced

cytotoxicity in liver (HepG2) cells. Journal of Plant Phys-

iology 162, 818–822.

Jeanes, Y. M.; Hall, W. L.; Ellard, S.; Lee, E.; Lodge, J.

K., 2004: The absorption of vitamin E is influenced by

the amount of fat in a meal and the food matrix. The

British Journal of Nutrition 92, 575–579.

Kaempf-Rotzoll, D. E.; Traber, M. G.; Arai, H., 2003:

Vitamin E and transfer proteins. Current Opinion in

Lipidology 14, 249–254.

Kawakami, Y.; Tsurugasaki, W.; Yoshida, Y.; Igarashi, Y.;

Nakamura, S.; Osada, K., 2004: Regulative actions of

dietary soy isoflavone on biological antioxidative sys-

tem and lipid metabolism in rats. Journal of Agricultural

and Food Chemistry 52, 1764–1768.

Kayden, H. J.; Traber, M. G., 1993: Absorption, lipopro-

tein transport, and regulation of plasma concentrations

of vitamin E in humans. Journal of Lipid Research 34,

343–358.

Laranjinha, J.; Cadenas, E., 1999: Redox cycles of caffeic

acid, alpha-tocopherol, and ascorbate: implications for

protection of low-density lipoproteins against oxida-

tion. IUBMB Life 48, 57–65.

Lesser, S.; Cermak, R.; Wolffram, S., 2004: Bioavailability

of quercetin in pigs is influenced by the dietary fat

content. The Journal of Nutrition 134, 1508–1511.

Lodge, J. K.; Ridlington, J.; Leonard, S.; Vaule, H.; Trab-

er, M. G., 2001: Alpha- and gamma-tocotrienols are

metabolized to carboxyethyl-hydroxychroman deriva-

tives and excreted in human urine. Lipids 36, 43–48.

Manach, C.; Mazur, A.; Scalbert, A., 2005: Polyphenols

and prevention of cardiovascular diseases. Current

Opinion in Lipidology 16, 77–84.

Moon, Y. J.; Wang, X.; Morris, M. E., 2006: Dietary

flavonoids: effects on xenobiotic and carcinogen

metabolism. Toxicology In Vitro 20, 187–210.

Morris, M. E.; Zhang, S., 2006: Flavonoid-drug interac-

tions: effects of flavonoids on ABC transporters. Life

Sciences 78, 2116–2130.

Muggli, R., 1994: Physiological requirements of vitamin

E as a function of the amount and type of polyunsatu-

rated fatty acid. World Review of Nutrition and Dietetics

75, 166–168.

Murakami, C.; Hirakawa, Y.; Inui, H.; Nakano, Y.; Yosh-

ida, H., 2002: Effect of tea catechins on cellular lipid

peroxidation and cytotoxicity in HepG2 cells. Bioscience

Biotechnology and Biochemistry 66, 1559–1562.

Mustacich, D. J.; Shields, J.; Horton, R. A.; Brown,

M. K.; Reed, D. J., 1998: Biliary secretion of alpha-

tocopherol and the role of the mdr2 P-glycoprotein in

rats and mice. Archives of Biochemistry and Biophysics

350, 183–192.

Nanjo, F.; Honda, M.; Okushio, K.; Matsumoto, N.; Ish-

igaki, F.; Ishigami, T.; Hara, Y., 1993: Effects of dietary

tea catechins on alpha-tocopherol levels, lipid peroxi-

dation, and erythrocyte deformability in rats fed on

high palm oil and perilla oil diets. Biological & Pharma-

ceutical Bulletin 16, 1156–1159.

Narushima, K.; Takada, T.; Yamanashi, Y.; Suzuki, H.,

2008: Niemann-pick C1-like 1 mediates alpha-tocoph-

erol transport. Molecular Pharmacology 74, 42–49.

National Research Council. , 1995: Nutrient Requirements

of Laboratory Animals. National Academic Press,

Washington, DC, USA, pp 11–79.

Packer, L.; Weber, S. U.; Rimbach, G., 2001: Molecular

aspects of alpha-tocotrienol antioxidant action and cell

signalling. The Journal of Nutrition 131, 369S–373S.

Parker, R. S.; Swanson, J. E., 2000: A novel 5’-carbo-

xychroman metabolite of gamma-tocopherol secreted

by HepG2 cells and excreted in human urine. Biochemi-

cal and Biophysical Research Communications 269,

580–583.

Perugini, C.; Bagnati, M.; Cau, C.; Bordone, R.; Zoppis,

E.; Paffoni, P.; Re, R.; Albano, E.; Bellomo, G., 2000:

Distribution of lipid-soluble antioxidants in lipoproteins

from healthy subjects. I. correlation with plasma anti-

oxidant levels and composition of lipoproteins. Pharma-

cological Research 41, 53–63.

Reboul, E.; Klein, A.; Bietrix, F.; Gleize, B.; Malezet-Des-

moulins, C.; Schneider, M.; Margotat, A.; Lagrost, L.;

Collet, X.; Borel, P., 2006: Scavenger receptor class B

type I (SR-BI) is involved in vitamin E transport across

the enterocyte. The Journal of Biological Chemistry 281,

4739–4745.

Rimbach, G.; Minihane, A. M.; Majewicz, J.; Fischer, A.;

Pallauf, J.; Virgli, F.; Weinberg, P. D., 2002: Regulation

of cell signalling by vitamin E. The Proceedings of the

Nutrition Society 61, 415–425.



Ruetz, S.; Gros, P., 1994: Phosphatidylcholine translocase:

a physiological role for the mdr2 gene. Cell 77, 1071–

1081.

Scalbert, A.; Manach, C.; Morand, C.; Remesy, C.; Jime-

nez, L., 2005: Dietary polyphenols and the prevention

of diseases. Critical Reviews in Food Science and Nutrition

45, 287–306.

Song, J.; Kwon, O.; Chen, S.; Daruwala, R.; Eck, P.; Park,

J. B.; Levine, M., 2002: Flavonoid inhibition of

sodium-dependent vitamin C transporter 1 (SVCT1)

and glucose transporter isoform 2 (GLUT2), intestinal

transporters for vitamin C and glucose. The Journal of

Biological Chemistry 277, 15252–15260.

Sontag, T. J.; Parker, R. S., 2002: Cytochrome P450

omega-hydroxylase pathway of tocopherol catabolism.

Novel mechanism of regulation of vitamin E status. The

Journal of Biological Chemistry 277, 25290–25296.

Virgili, F.; Kim, D.; Packer, L., 1998: Procyanidins

extracted from pine bark protect alpha-tocopherol in

ECV 304 endothelial cells challenged by activated

RAW 264.7 macrophages: role of nitric oxide and per-

oxynitrite. FEBS Letters 431, 315–318.

Williams, R. J.; Spencer, J. P.; Rice-Evans, C., 2004:

Flavonoids: antioxidants or signalling molecules? Free

Radical Biology and Medicine 36, 838–849.

Yamagishi, M.; Osakab, N.; Takizawa, T.; Osawa, T.,

2001: Cacao liquor polyphenols reduce oxidative stress

without maintaining alpha-tocopherol levels in rats fed

a vitamin E-deficient diet. Lipids 36, 67–71.

Zhu, Q. Y.; Huang, Y.; Tsang, D.; Chen, Z. Y., 1999:

Regeneration of alpha-tocopherol in human

low-density lipoprotein by green tea catechin.

Journal of Agricultural and Food Chemistry 47,

2020–2025.



Dietary flavonoids do not affect vitamin E status in growing rats

Documents