Development of a 16S rDNA primer and PCR-RFLP metho d for ...The PCR was set up in a 50- l reaction volume containing 25 l of GoTaq Hot Start Green Master Mix (Promega), 1 M of each

1

Development of a 16S rDNA primer and PCR-RFLP method for the rapid 1

detection of genus Megasphaera and species level identification 2

3

Running title: Megasphaera-specific PCR-based detection assay 4

5

Akihiro Ohnishi*, Shinko Abe, Shiho Nashirozawa, Sayaka Shimada, Naoshi Fujimoto, 6

and Masaharu Suzuki 7

8

Department of Fermentation Science, Faculty of Applied Bio-Science, Tokyo University of 9

Agriculture, Tokyo, Japan 10

11

*Correspondence to: Akihiro Ohnishi, Department of Fermentation Science, Faculty of Applied 12

Bio-Science, Tokyo University of Agriculture, 1-1 Sakuragaoka 1-chome, Setagaya-ku, Tokyo 13

156-8502, Japan 14

E-mail: [email protected], Tel.: +81-3-5477-2387, Fax: +81-3-5477-2287 15

16

Key words 17

specific primer, Megasphaera, PCR-RFLP, 16S rRNA gene, anaerobes 18

19

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00359-11 AEM Accepts, published online ahead of print on 24 June 2011

on June 13, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

A b s t r a c t 20

The genus Megasphaera is relevant to the environment, human health and food, and 21

renewable energy for the future. In this study, a primer set was designed for PCR-RFLP 22

analyses to detect and identify the members of Megasphaera. Direct detection and 23

identification was achieved for environmental samples and isolates. 24

25

The genus Megasphaera includes 5 species and is relevant to the environment, human health 26

and food, and renewable energy for the future (2, 11). M. cerevisiae, M. paucivorans, and M. 27

sueciensis are regarded as obligate, beer-spoilage bacteria (1, 6). M. elsdenii is a normal 28

inhabitant of the gastrointestinal tract in mammals such as humans and cattle (3-5) and is a 29

useful hydrogen producer in a very simple bio-hydrogen production system (8). Bio-hydrogen 30

figures prominently in the solution of future energy problems, because hydrogen an inexhaustible 31

fuel and produces only water as a combustion product (12). M. micronuciformis was isolated 32

from a liver abscess and a pus sample of a human being (7). This study aimed to develop a 33

methodology for the rapid detection and species-level identification of Megasphaera. 34

35

All handling concerning cultivation was executed in an anaerobic glove box (ANX-1; Hirasawa) 36

with an N2-CO2-H2 (85:10:5, vol/vol/vol) atmosphere. All strains (Table 1) were cultivated using 37

the recommended media (DSMZ medium 104) and conditions. To determine the detection limit 38

of Megasphaera, we used a standardized series of DNA samples. The precultivated cells were 39

counted using a Petroff-Hausser Bacteria Counter (Arthur H. Thomas Company) with an E500 40

microscope (Nikon). Environmental samples were obtained from a field-scale biogas plant 41


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

(garbage was treated at 100 kg/d) at the Tokyo University of Agriculture system (35° 64' N, 139° 42

63' E; floor area, 17 m2). The samples were taken from the surface of the raw garbage resolver 43

system (at a depth of 10 cm), methane fermentation granule, and acid generation tank. 44

Thereafter, 50 µl of samples of 102 to 109 dilutions were plated on DSMZ-medium-104 plates, 45

which were incubated at 30°C for 4 d. Five colonies that appeared on the plates inoculated with 46

the highest dilution were transferred with a sterile toothpick to 1 ml of 10 mM Tris-HCl and 1 mM 47

EDTA (pH 8.0) (TE buffer). For PCR, DNA was extracted from the suspension. 48

49

For DNA extraction, 1 ml of the cell suspension or the environmental sample was pelleted at 50

10,000 g for 5 min at 4°C and resuspended in 1 ml of TE buffer. This process was repeated twice 51

for irrigation. The cells were boiled for 10 min, and the cell debris was removed by centrifugation 52

at 10,000 g for 10 min at 4°C. The supernatant was used for PCR. 53

54

The 16S rRNA gene sequences of the genus Megasphaera were aligned with each other and 55

with those of closely related species by using Clustal X (version 1.83, www-igbmc.u-strasbg.fr) 56

(10). Thereafter, a search for Megasphaera-specific primer-binding sites was performed. The 57

specificity of the potential primer sequences were tested in silico by using the basic local 58

alignment search tool (BLAST; www.ncbi.nlm.nih.gov/BLAST/). The primer Mega-X was the only 59

sequence typical of the genus Megasphaera. Moreover, comparison of the primer sequence 60

against the GenBank/EMBL/DDBJ database showed that the primer was not complementary to 61

DNA from any non-target microbe. The PCR was set up in a 50-µl reaction volume containing 25 62

µl of GoTaq Hot Start Green Master Mix (Promega), 1 µM of each primer set (Table 2; 63


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

Mega-142F/Mega-X or 20F/1540R (9)), and 1 µl of DNA solution. The amplification profile was 64

94°C for 2.5 min, followed by 40 cycles of 15 s at 94°C, 30 s at an annealing temperature, and 30 65

s at 72°C. The last extension step lasted 7 min at 72°C. The optimal annealing temperature was 66

58°C and 55°C for the Mega-142F/Mega-X and the 20F/1540R primer sets, respectively. Five 67

microliters of the PCR products was separated by gel electrophoresis; the gel was stained with 68

ethidium bromide and visualized under UV light with a transilluminator (AE- 6943V-FX; ATTO). 69

70

The PCR product obtained from M. elsdenii by using the Mega-142F/Mega-X primer set was 71

cloned into pTAC-2. The cloning reactions and transformations were performed using the 72

DynaExpress TA Cloning Kit (BioDynamics Laboratory). The PCR products were sequenced 73

using an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction kit and an ABI 74

PRISM Model 310 genetic analyzer (Applied Biosystems). 75

76

For restriction enzyme digestion, 10 µl of the PCR product was mixed with 20 U of HaeIII and 77

MspI (Takara), according to the manufacturer's instructions. The restriction fragments were 78

electrophoresed on a 4% agarose gel. 79

80

The specificity of the constructed Mega-142F/Mega-X primer set was evaluated by PCR. 81

Genomic DNA was extracted from strains representing 17 different bacterial species. By using 82

the optimized annealing conditions (58°C), a correct-sized PCR product (1200 bp) was amplified 83

only from Megasphaera spp. (Table 1). The detection limit for all the Megasphaera spp. was 84

1000 cells/ml, as shown using a 10-fold serial dilution (see Fig. S1 in the supplemental material). 85


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

86

The RFLP profiles differed greatly at the species level (Fig. 1). The predicted restriction patterns 87

by in silico analysis for the 4 species were obtained, with the exception of <80-bp fragments, 88

which were not sufficiently separated in the agarose gel and thus could not be distinguished. 89

However, an unexpected restriction band of ~350 bp was detected in the restriction profiles for M. 90

elsdenii. 91

92

Two RFLP profiles were obtained from different colonies of M. elsdenii DSM 20460 (see Fig. S2 93

in the supplemental material). The restriction profile of clone type B was predicted by in silico 94

analysis (Fig. 1 and Fig. S2); that of clone type A (Fig. S2) included the unexpected band (Fig. 1) 95

but lacked a predicted band in the vicinity of 131 bp. Mutation sites at nucleotide positions 1015 96

(A or C), 1016 (A or G), and 1018 (T or C) between clone type A and B were detected (see Fig. 97

S3 in the supplemental material). Clone type B included 2 restriction sites, GG/CC for HaeIII and 98

C/CGG for MspI, in this region, but clone type A did not. These results confirmed that M. elsdenii 99

DSM 20460 has a complex restriction profile involving 2 clone types. 100

101

To confirm the efficacy of the Mega-142F/Mega-X primer set, we analyzed DNA obtained from 3 102

environmental samples. Only 1 sample taken from the acid generation tank showed a positive 103

PCR result (Fig. 2(A)). This sample was used for the further isolation of anaerobes and yielded 5 104

isolates. The isolated strain MET1 showed positive PCR results with the Mega-142F/Mega-X 105

primer set. RFLP analysis of the PCR products from the original sample and the isolated MET1 106

strain showed that the restriction profiles (Fig. 2(B)) were the same as those of M. elsdenii clone 107


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

type A (see Fig. S2 in the supplemental material). By sequencing analysis, the isolated strain 108

MET1 was identified as M. elsdenii (similarity, 97%; see Fig. S4 in the supplemental material). In 109

conclusion, we showed that our PCR-RFLP method was useful for the rapid detection and 110

identification of Megasphaera species from environmental samples and isolated strains. This 111

method may offer understanding of the global distribution of Megasphaera spp. in the 112

environment. 113

114

We thank Kazumasa Tonooka, Akiyo Toshitsuna, and Takuya Ebisawa (Faculty of Applied 115

Bio-Science, Tokyo University of Agriculture) for allowing us to take samples from the 2-phase 116

methane fermentation system. 117

118

REFERENCES 119

1. Engelmann, U., and N. Weiss. 1985. Megasphaera cerevisiae sp. nov.: A new 120

gram-negative obligately anaerobic coccus isolated from spoiled beer. Syst. Appl. 121

Microbiol. 6:287–290. 122

2. Haikara, A., and I. Helander. 2006. Pectinatus, Megasphaera and Zymophilus. 123

Prokaryotes 4:965–981. 124

3. Hashizume, K., T. Tsukahara, K. Yamada, H. Koyama, and K. Ushida. 2003. 125

Megasphaera elsdenii JCM1772T normalizes hyperlactate production in the large 126

intestine of fructooligosaccharide-fed rats by stimulating butyrate production. J. Nutr. 127

133:3187–3190. 128

4. Hino, T., and S. Kuroda. 1993. Presence of lactate dehydrogenase and lactate 129


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

racemase in Megasphaera elsdenii grown on glucose or lactate. Appl. Environ. Microbiol. 130

59:255–259. 131

5. Hino, T., K. Shimada, and T. Maruyama. 1994. Substrate preference in a strain of 132

Megasphaera elsdenii, a ruminal bacterium, and its implications in propionate production 133

and growth competition. Appl. Environ. Microbiol. 60:1827–1831. 134

6. Juvonen, R., and M. L. Suihko. 2006. Megasphaera paucivorans sp. nov., 135

Megasphaera sueciensis sp. nov. and Pectinatus haikarae sp. nov., isolated from 136

brewery samples, and emended description of the genus Pectinatus. Int. J. Syst. Evol. 137

Microbiol. 56:695–702. 138

7. Marchandin, H., E. Jumas-Bilak, B. Gay, C. Teyssier, H. Jean-Pierre, M. S. de 139

Buochberg, C. Carrière, and J. Carlier. 2003. Phylogenetic analysis of some 140

Sporomusa sub-branch members isolated from human clinical specimens: description of 141

Megasphaera micronuciformis sp. nov. Int. J. Syst. Evol. Microbiol. 53:547–553. 142

8. Ohnishi, A., Y. Bando, N. Fujimoto, and M. Suzuki. 2010. Development of a simple 143

bio-hydrogen production system through dark fermentation by using unique microflora. Int. 144

J. Hydrogen Energ. 35:8544–8553. 145

9. Ohnishi, A., A. Nagano, N. Fujimoto, and M. Suzuki. 2011. Phylogenetic and 146

physiological characterization of mesophilic and thermophilic bacteria from a sewage 147

sludge composting process in Sapporo, Japan. World J. Microbiol. Biotechnol. 148

27:333–340. 149

10. Thompson, J., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. 150

The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment 151


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

aided by quality analysis tools. Nucleic Acids Res. 25:4876–4882. 152

11. Vos, P., G. Garrity, D. Jones, N. Krieg, W. Ludwig, F. Rainey, K. Schleifer, and W. 153

Whitman. 2009. Bergey's Manual of Systematic Bacteriology 2nd edn, vol. 3: The 154

Firmicutes. 155

12. Züttel, A., A. Remhof, A. Borgschulte, and O. Friedrichs. 2010. Hydrogen: the future 156

energy carrier. Philos. Trans. R. Soc. A-Math. Phys. Eng. Sci. 368:3329–3342. 157

158


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

Figure legends 159

Fig. 1. PCR-RFLP profiles of the genus Megasphaera obtained by digestion with HindIII and 160

MspI by using the Mega-142F/Mega-X primer set. (A) In silico analysis based on 16S rDNA 161

sequences. Lanes: M, molecular size standard (20-bp ladder); 1, M. elsdenii is represented by 162

the 241-, 212-, 139-, 131-, and 85-bp bands; 2, M. sueciensis is represented by the 346-, 209-, 163

108-, and 93-bp bands; 3, M. paucivorans is represented by the 371-, 208-, 141-, and 107-bp 164

bands; 4, M. cerevisiae is represented by the 346-, 151-, 139-, 107-, and 90-bp bands; 5, M. 165

micronuciformis is represented by the 346-, 248-, 139-, 107-, and 103-bp bands. (B) The gel 166

image has been reversed (i.e., converted to a photo negative) for a clearer visualization of the 167

faint bands. Arrow indicates the unexpected band. 168

169

Fig. 2. PCR detection of Megasphaera by using the Mega-142F/Mega-X primer set (A) and 170

PCR-RFLP profiles of an environmental sample and isolate obtained with HindIII and MspI 171

digestion (B). Lanes: M1, molecular size standard (λHindIII digest); M2, molecular size standard 172

(20-bp ladder); B, negative control; 1, environmental sample taken from the surface of the raw 173

garbage resolver system; 2, environmental sample taken from the methane fermentation 174

granule; 3, environmental sample from the acid generation tank; MET1, MET1 strain isolated 175

from the acid generation tank. 176

177

Supplemental Fig. 1. PCR detection of Megasphaera elsdenii. For determining the detection 178

limit, genomic DNA was extracted using a rapid isolation protocol from a known number of 179

serially diluted bacterial cells. One microliter was used in the PCR reaction using the primer pair 180


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

Mega-142F/Mega-X. B, the control without template did not yield a PCR product. M, molecular 181

marker (100-bp DNA ladder). 182

183

Supplemental Fig. 2. PCR-RFLP profiles of M. elsdenii DSM 20460 clone type A and B 184

obtained by digestion with HindIII and MspI by using the Mega-142F/Mega-X primer set. (A) In 185

silico analysis based on 16S rDNA sequences. Lanes: M, molecular size standard (20-bp 186

ladder); A, M. elsdenii DSM 20460 clone type A is represented by the 345-, 241-, 139-, and 85-bp 187

bands; B, M. elsdenii DSM 20460 clone type B is represented by the 241-, 212-, 139-, 131-, and 188

85-bp bands. (B) The gel image has been reversed for a clearer visualization of the faint bands. 189

Arrows indicate bands found either in lanes A or B but not in both. 190

191

Supplemental Fig. 3. Restriction sites and specific sequences for the partial 16S rDNA clones of 192

M. elsdenii DSM 20460. (A): Restriction sites for the full type A and type B clone sequences. (B): 193

Specific sequences resulting in variation in the restriction profiles. Mutation sites are indicated by 194

bold-face letters. a, HaeIII (GG/CC) restriction site; b, MspI (C/CGG) restriction site. 195

196

Supplemental Fig. 4. Phylogenetic relationship between the isolates and related bacteria based 197

on 16S rRNA gene sequences. The tree, constructed using the neighbor-joining method, is 198

based on the comparison of approximately 1100 nucleotides in the 16S rRNA gene. Bootstrap 199

values, expressed as a percentage of 1000 replicates, are shown at the branching points; only 200

values ≥50% are shown. 201


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

202

203

Table 1. Results of the specificity tests for the Megasphaera-specific primer set

Species Strain

Reaction with the

Mega-142F/Mega-X primer

set

Anaeroglobus geminatus CCUG 44773T -

Anaerovibrio lipolytica DSM 3074T -

Megasphaera cerevisiae DSM 20462T +

Megasphaera elsdenii DSM 20460T +

Megasphaera micronuciformis DSM 17226T +

Megasphaera paucivorans DSM 16981T +

Megasphaera sueciensis DSM 17042T +

Mitsuokella jalaludinii DSM 13811T -

Pectinatus cerevisiiphilus DSM 20467T -

Pectinatus frisingensis DSM 6306T -

Pectinatus haikarae DSM 16980T -

Schwartzia succinivorans DSM 10502T -

Selenomonas ruminantium DSM 2872T -

Veillonella magna DSM 19857T -

Veillonella parvula DSM 2008T -

Veillonella ratti DSM 20736T -

Veillonella atypica DSM 20739T -

204

205

206

207

208

209

210

211

212


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

213

Table 2. List of primers used for PCR and sequencing

Primer Sequence (5′-3′) E. coli

position

Purpose

Mega-142F GATGGGGACAACAGCTGGA 142–160 Megasphaera genus-specific

PCR and sequencing

Mega-X GACTCTGTTTTTGGGGTTT 1315–1297 Megasphaera genus-specific

PCR and sequencing

20F AGTTTGATCATGGCTCA 10–26 PCR and sequencing

1540R AAGGAGGTGATCCAACCGCA 1541–1521 PCR and sequencing

800F GTAGTCCACGCCGTAAACGA 803–819 Sequencing

900R CGGCCGTACTCCCCAGGCGG 898–879 Sequencing

214

215


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

216

217

Fig.1 218

219

220

221

222

223

224

225

226

227


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

228

Fig.2 229

230


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Development of a 16S rDNA primer and PCR-RFLP metho d for ...The PCR was set up in a 50- l reaction volume containing 25 l of GoTaq Hot Start Green Master Mix (Promega), 1 M of each

Documents