Journal of Bacteriology and Virology 2015. Vol. 45, No. 1 p.54 – 61 http://dx.doi.org/10.4167/jbv.2015.45.1.54 Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine Siwon Lee 1 , Jin-Young Lee 2 , Yong-Gil Shin 2 , Su-Heon Lee 3 * and Tae-Young Ahn 4 * 1 Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon; 2 Incheon International Airport Regional Office, Animal and Plant Quarantine Agency, Incheon; 3 School of Applied Biosciences, Kyungpook National University, Daegu; 4 Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan, Korea Tobacco rattle virus (TRV) is a plant pathogen belonging to the Group IV positive-sense single-stranded RNA viruses. TRV causes disease in various plants (e.g., potato, tomato and tobacco), for which it was classified as a controlled quarantine virus in Korea. This study aimed to develop specific primer sets for the rapid detection of TRV. Two RT-PCR primer sets were developed for specific detection of TRV. Furthermore, nested primer sets were also developed, which is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products had the following sizes: set 5 (1,096→540 bp), and set 7 (878→756 bp), respectively. In addition, a modified positive-control plasmid was also developed for use as a positive control in TRV quarantine. The diagnostic system for TRV detection was verified using samples from Korean quarantine sites for the last five years (2009-2014). A total of 83 cases were detected among various import crops. This system for detection of TRV will continuously contribute to plant quarantine in the future. Key Words: Tobacco rattle virus, Nested PCR, Quarantine INTRODUCTION 수입개방화에 따라 다양한 종류의 식물들이 국내로 수 입되고 있으며, 이에 따라 잠재적 또는 동정되지 않은 병 원성 식물바이러스들이 함께 유입될 가능성이 높아지고 있다 (1). 이들은 유입 시 막대한 경제적 피해를 입힐 가 능성을 가지고 있어, 수출입 유통 시 철저한 관리가 필요 하다 (2). 우리나라에서는 위험평가를 통하여, 금지, 관리, 규제-비검역, 비검역 및 잠정규제 등으로 검역바이러스 를 지정하고 있다 (3). 이 중 Tobacco rattle virus (TRV) 는 Group IV positive-sense single-stranded RNA virus에 속하는 바이러스로, 전체 핵산은 RNA 1 (약 7 kb)과 RNA2 (약 2~4 kb)로 약 11 kb 길이로 구성되며, 폭 22 nm 길이는 약 190 nm 또는 50~115 nm의 막대형이다. TRV는 식물 병원성 바이러스로 주로 즙액과 선충에 의해 전염되며 감 자, 토마토 및 담배 등 400여종 이상의 숙주를 가지며 자 연상태에서는 가지과 식물, 구근류 및 잡초에 발생할 수 있는 관리급 검역바이러스이다. 농림축산검역본부 예규 제107호와 식물병해충정보시스 템에 따르면, TRV는 수입 식물에서 가장 많은 검사를 수 행해야 하는 바이러스이며, 평균 검사건수는 연간 4,200 54 Received: December 12, 2014/ Revised: February 22, 2015/ Accepted: February 27, 2015 * Corresponding author: Su-Heon Lee. School of Applied Biosciences, Kyungpook National University, Daegu 702-701, Korea. Phone: +82-53-950-5763, Fax: +82-53-950-6758, e-mail: [email protected]* Corresponding author: Tae-Young Ahn. Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan 330-714, Korea. Phone: +82-41-550-3451, Fax: +82-41-550-3450, e-mail: [email protected]** The present research was conducted by the Research Fund of Animal and Plant Quarantine Agency in 2006-2008. ○ CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/by-nc/3.0/). Communication
8
Embed
Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Journal of Bacteriology and Virology 2015. Vol. 45, No. 1 p.54 – 61 http://dx.doi.org/10.4167/jbv.2015.45.1.54
Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine
1Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon; 2Incheon International Airport Regional Office, Animal and Plant Quarantine Agency, Incheon; 3School of Applied Biosciences, Kyungpook National University, Daegu; 4Department of Microbiology, College of Natural Sciences,
Dankook University, Cheonan, Korea
Tobacco rattle virus (TRV) is a plant pathogen belonging to the Group IV positive-sense single-stranded RNA viruses. TRV causes disease in various plants (e.g., potato, tomato and tobacco), for which it was classified as a controlled quarantine virus in Korea. This study aimed to develop specific primer sets for the rapid detection of TRV. Two RT-PCR primer sets were developed for specific detection of TRV. Furthermore, nested primer sets were also developed, which is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products had the following sizes: set 5 (1,096→540 bp), and set 7 (878→756 bp), respectively. In addition, a modified positive-control plasmid was also developed for use as a positive control in TRV quarantine. The diagnostic system for TRV detection was verified using samples from Korean quarantine sites for the last five years (2009-2014). A total of 83 cases were detected among various import crops. This system for detection of TRV will continuously contribute to plant quarantine in the future.
Group IV positive-sense single-stranded RNA virus에 속하는
바이러스로, 전체 핵산은 RNA 1 (약 7 kb)과 RNA2 (약
2~4 kb)로 약 11 kb 길이로 구성되며, 폭 22 nm 길이는
약 190 nm 또는 50~115 nm의 막대형이다. TRV는 식물
병원성 바이러스로 주로 즙액과 선충에 의해 전염되며 감
자, 토마토 및 담배 등 400여종 이상의 숙주를 가지며 자
연상태에서는 가지과 식물, 구근류 및 잡초에 발생할 수
있는 관리급 검역바이러스이다.
농림축산검역본부 예규 제107호와 식물병해충정보시스
템에 따르면, TRV는 수입 식물에서 가장 많은 검사를 수
행해야 하는 바이러스이며, 평균 검사건수는 연간 4,200
54
Received: December 12, 2014/ Revised: February 22, 2015/ Accepted: February 27, 2015
*Corresponding author: Su-Heon Lee. School of Applied Biosciences, Kyungpook National University, Daegu 702-701, Korea. Phone: +82-53-950-5763, Fax: +82-53-950-6758, e-mail: [email protected]
*Corresponding author: Tae-Young Ahn. Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan 330-714, Korea. Phone: +82-41-550-3451, Fax: +82-41-550-3450, e-mail: [email protected]
**The present research was conducted by the Research Fund of Animal and Plant Quarantine Agency in 2006-2008. ○CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/by-nc/3.0/).
Communication
Development of TRV Nested PCR Assay 55
건이다. TRV는 전 세계적으로 potato (4~6), greenhouse
and field specimens (7), soil (8, 9) 등 다양한 시료로부터의
감염 보고가 있으며, TRV를 진단하기 위한 RT-PCR (4,
6, 10), multiplex PCR (5), real-time RT-PCR (8, 11), real
multiplex PCR (12) 그리고 immunocapture real-time RT-PCR
Figure 2. Results of selection of TRV RT-PCR primer sets. Panel (A), First selection of specific RT-PCR primer sets for the detection ofTRV. M, 100 bp step DNA Ladder maker (Genepia, Korea); dot, selected PCR primer set; Lane number, primer set for detection of TRV. Panel (B), Second selection of specific RT-PCR primer sets for the detection of TRV. Lane M, 100 bp step DNA Ladder maker (Genepia); lane AM, Alfalfa mosaic virus; lane Ar, Arabis mosaic virus; lane CM, Cucumber mosaic virus; lane Pe, Pepper mottle virus; lane PY, Potatovirus Y; lane RM, Ribgrass mosaic virus; lane TG, Tobacco mild-green mosaic virus; lane TM, Tobacco mosaic virus; lane To, Tomato mosaicvirus; lane TS, Tomato spotted wilt virus.
Table 2. Final selection of RT-PCR and nested primer sets for the detection of TRV
Primer Sequence (5'→3') Product size (bp)
Set 5 TRV-N20 CGCGGTCGAAAGGATGAGTGATTA
1,096 TRV-C40 TCCCGGAAACAAAGCGTCGTA
Nested primer of set 5 TR-N22 GTAAGTCGACAATGATTGTC
543 TR-C45 GAAGGAAAGTTATGTACTGAG
Set 7 TRV-N10 GGCCGTGAAGAACAAGCAAAGTG
880 TRV-C60 TTGTACCGCTTGTTTCCCCTCTT
Nested primer of set 7 TR-N11 GATTCTCGAGATTTACAGTTG
760 TR-C62 TGCTCCATGATCTCCTCATC
Figure 3. RT-PCR sensitivity test on the selective primer sets for TRV.
Figure 4. Result of selected RT-PCR and nested-PCR productsfor the detection of TRV. Lane M, 100 bp step DNA Ladder; lane1, final selected primer set #5 (1,096 bp); lane 2, nested-PCRproduct from primer set #5 (543 bp); lane 3, final selected primerset #7 (880 bp); lane 4, nested-PCR product from primer set #7(760 bp).
58 S Lee, et al.
RESULTS AND DISCUSSION
TRV를 특이적으로 검출하기 위한 primer는 총 12개(정
방향 7개, 역방향 8개)를 제작하였고(Fig. 1), 제작된 primer
들을 조합하여 273~1,096 bp 크기의 PCR 산물로 증폭이
가능한 7개의 조합을 구성하였다(Table 1). TRV 주형 RNA
및 참고바이러스 주 들의 총 핵산의 최초 농도는 약 20~
500 ng/μl였다. TRV를 주형으로 한 종 특이적 실험 결과,
7개 조합 중 반응강도가 뛰어나고 진단에 장해가 되는
비특이적 반응을 보이지 않는 6개의 조합을 선발하였다
(Fig. 2A). 1차로 선발된 6개 primer 조합으로 TRV 유연
관계 바이러스 또는 기주 식물과 관련된 10가지 바이러
스와의 특이적 반응을 보이지 않는 조합 5 (1,096 bp)와
조합 7 (878 bp) (Fig. 2B)을 최종 선발하였으며(Table 2),
최종 선발한 두 조합의 검출감도를 실험한 결과 각각
10-2와 10-4으로 분석되어(Fig. 3), TRV를 검출하기에 적합
한 primer 조합으로 확인되었다. 또한, 최종 선발된 TRV
RT-PCR 조합 5의 nested PCR primer는 540 bp를 조합 7의
nested PCR primer는 756 bp 크기의 PCR 산물을 각각 증
Figure 5. BamH I sequence insertion of the TRV genetically modified-positive control plasmids.
Development of TRV Nested PCR Assay 59
Table 3. Results of detection for TRV from plant quarantine sites in 2009-2014
Item Year (number of detection)
Total 2009 2010 2011 2012 2013 2014
Bulb (119 cases) Gladiolus 5 5
Nectaroscordum 1 1
Dahlia 1 1
Leucocoryne 1 2 3
Ranunculus 1 1
Garlic 1 1
Druce 1 1
Poison 1 1
Lily 1 1 2
Narcissus 3 11 1 2 6 15 38
Snowflake 1 1
Anemone 1 2 4 8 15
Amaryllis 1 1
Iris 1 1
Alium 1 12 5 18
Alstromeria 1 1
Ornithogalum 1 1
Orange Daylily 1 1
Calochortus 1 1
Crocus 1 1 4 6
Tulip 3 3
Puschkinia 1 1
Ornamental Plants Etc. 1 4 5
Hemerocalis 1 1
Hyacinth 5 1 3 9
Seed (16 cases) Hot pepper 3 3 6
Iceland Poppy 1 1 2
Tomato 1 1 1 3 6
Paprika 1 1 2
Etc. (1 case) Shallot 1 1
Total 9 19 3 14 28 63 136
60 S Lee, et al.
폭하였다(Fig. 4 and Table 2).
본 연구에서 개발한 TRV 종 특이적 primer 조합은
TRV strain ppK20 RNA1 (NCBI accession number AF314165)
을 기준으로 조합 5 (location 2,782~3,877)와 조합 7
(location 1,459~2,336)로, 이것을 증폭하는 산물을 얻기가
어려워 조합 5와 7에 대한 각각의 유전자변형-양성대조
구 플라스미드를 개발하였다. 그 결과, 조합 5는 염기서
열 'GGA'를, 조합 7은 염기서열 'GG'가 삽입된 것이 분석
되어 nested PCR 증폭산물 부위에 제한효소 site (BamH I;
GGATCC)를 삽입이 확인되었다(Fig. 5). 따라서 양성대조
구로부터 오염이 있을 경우 다음의 2가지 증상이 나타날
것이라고 예상된다; i) 각각의 nested PCR 산물에서 제한
효소 BamH I가 반응하면 조합 5는 362와 561 bp 크기의,
조합 7은 364, 396 bp 크기의 PCR 산물이 생산되어 각각
2개씩의 밴드가 관찰될 것이고, ii) nested PCR 산물의 염
기서열을 multiple sequence alignment하면 조합 5와 7에서
는 삽입한 각각 3개와 2개의 염기서열이 추가로 분석될
것이다(Supplementary Fig. S4).
TRV는 국내에서는 농림축산검역본부 예규 제 107호
에 의거하여 다음의 다양한 수입 종자 및 식물로부터
검사를 수행한다; 종자류[감자(Solanum tuberosum), 고추
(Capsicum annuum)(파프리카 포함), 사탕무(Beta vulgaris var.