Dental pulp stem cell-conditioned medium for tissue ...

HAL Id: tel-03378198https://tel.archives-ouvertes.fr/tel-03378198

Submitted on 14 Oct 2021

HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, estdestinée au dépôt et à la diffusion de documentsscientifiques de niveau recherche, publiés ou non,émanant des établissements d’enseignement et derecherche français ou étrangers, des laboratoirespublics ou privés.

Dental pulp stem cell-conditioned medium for tissueregenerationBatoul Chouaib

To cite this version:Batoul Chouaib. Dental pulp stem cell-conditioned medium for tissue regeneration. Human healthand pathology. Université Montpellier, 2020. English. �NNT : 2020MONTT039�. �tel-03378198�

https://tel.archives-ouvertes.fr/tel-03378198

https://hal.archives-ouvertes.fr

THÈSE POUR OBTENIR LE GRADE DE DOCTEUR

DE L’UNIVERSITÉ DE MONTPELLIER

En Biologie Santé

École doctorale Sciences Chimiques et Biologiques pour la Santé CBS2

Laboratoire Bioingénierie et Nanoscience LBN EA 4203

Présentée par Batoul CHOUAIB

Le 30 Octobre 2020

Sous la direction de Pr. Frédéric CUISINIER

et Dr. Pierre-Yves COLLART-DUTILLEUL

Devant le jury composé de

Mme Csilla GERGELY, Professeur des universités, Université de Montpellier

Mme Joelle AMÉDÉE, Directeur de Recherche, Inserm, Université de Bordeaux

M. Ziad SALAMEH, Professeur des univ - praticien hosp., Université Libanaise

Mme Frédérique SCAMPS, Chargée de Recherche, Inserm, Université Montpellier

M. Pierre-Yves COLLART-DUTILLEUL, Maitre de conf univ - praticien hosp., Université de Montpellier

M. Frédéric CUISINIER, Professeur des univ - praticien hosp., Université de Montpellier

Mme Sophie GANGLOFF, Professeur des universités, Université de Reims Champagne-Ardenne

M. Philippe KEMOUN, Professeur des univ - praticien hosp., Université de Toulouse III-Paul Sabatier

Président du jury

Membre du jury

Membre du jury

Membre du jury

Directeur de thèse

Co-directeur de thèse

Rapporteur

Rapporteur

Dental pulp stem cell -conditioned medium for tissue

regeneration

i

ii

REMERCIEMENTS

Je tiens tout d’abord à remercier l’Université Libanaise de m’avoir attribué une bourse

pour faire mes études supérieures de master et de doctorat, et à mes enseignants à la

faculté de médecine dentaire qui n’ont pas cessé de m’encourager. Merci pour votre

confiance.

Je remercie le Professeur Frédéric Cuisinier qui m’a accueillie au sein du laboratoire

LBN dès mon arrivée en France. Merci pour m’avoir donné ma chance lors de mon

stage de master 2, puis à nouveau en thèse. Merci pour votre bienveillance et

l’environnement international très familial que vous avez créé au laboratoire. Cette

expérience restera l’une des plus profitables dans ma vie.

Je remercie les membres de mon jury qui me font l’honneur d’évaluer mes travaux de

thèse : le Professeur Philippe Kemoun, le Professeur Sophie Gangloff, le Docteur

Joelle Amédée, le Docteur Frédérique Scamps et le Professeur Ziad Salameh. J’espère

que vous appréciez ce travail.

Merci au Docteur Pierre-Yves Collart-Dutilleul qui m’a suivi depuis mon stage de

master 2 effectué au sein de l’équipe. Au fur et à mesure que le temps passe, notre

relation a évolué : c’est ainsi que je suis passée de jeune stagiaire à doctorante. Et

maintenant je peux dire qu’on est devenu des amis. Merci pour ton encadrement, et le

temps que tu m’as dédié. Je suis ravie d’être ta première thésarde officielle.

J’exprime ma gratitude auprès du Professeur Csilla Gergely. Vous m’avez connue

depuis le Master, et après vous avez suivi mon travail durant la thèse. Merci pour ce

que vous avez fait pour moi, pour votre dévouement, votre humanité, et votre

disponibilité.

Je remercie le Docteur Olivier Romieu. Merci pour ton encadrement dans l’un des

projets de ma thèse, pour ta gentillesse et ton humanité. Merci à Elodie pour m’avoir

appris la culture cellulaire et les bases des expériences du laboratoire. Merci également

à Alban et à Catherine.

Je remercie aussi les différentes personnes avec qui j’ai eu l’occasion de collaborer, en

particulier le Docteur Frédérique Scamps et le Docteur Cédric Raoul. Je suis fière

d’avoir travaillé avec vous.

iii

Merci à toutes les personnes que j’ai rencontrées dans les instituts ou plateformes de

recherche, qui m’ont appris les techniques de laboratoire indispensables pour faire les

manips et aboutir à ce manuscrit.

Merci à tous les membres du laboratoire LBN. Vous êtes tous agréables, merci pour

nos discussions au labo, et tous les jolis moments que nous avons passé ensemble. Un

merci tout particulier à Siham : nous sommes arrivées le même jour en France, et depuis

lors nous sommes devenues amies. Par chance, nous avons suivi le même master et

nous avons ensuite partagé le même bureau au laboratoire. Au fil du temps, nous

sommes devenues de plus en plus proches, jusqu'à ce que tu deviennes un membre de

ma famille. Merci pour cette coïncidence qui nous a réunies pour mener pas à pas notre

aventure commune. Merci à mes compagnons de paillasse et co-thésards qui me sont

tous chers : Nesrine, Naveen, Sofia, Eve, Jean, Richard, Ossama, Yassin et Fidane. Je

vous souhaite tous des très bons futurs et qu’on reste amis pour toujours. Je remercie

également Orsi et Bela, Amel et Fares, et Hamideh. Merci beaucoup pour votre aide,

soutien et amitié, vous allez me manquer.

Merci à tous mes amis en France, les moments qu’on a passé ensemble sont des

souvenirs inoubliables. Je suis chanceuse de vous rencontrer et connaitre. Merci

également à mes amis au Liban qui m’ont soutenue de loin, et m’attendaient avec

impatience chaque été.

Enfin, un immense merci à mes parents surtout mes grands-mères et ma tante Amira,

et à ma famille. Maman, Papa, Racha, Sahar, Mohamad et Hour : c’est à vous que je

dédie ce travail. Merci pour votre amour et votre soutien en toutes circonstances. Mes

réussites sont les vôtres. Je vous aime…

iv

RESUMÉ DE THÈSE

En raison de leur capacité d'auto-renouvellement et de différenciation, les cellules

souches ont été utilisées en médecine régénérative et ont été développées comme une

thérapie prometteuse pour la restauration structurale et fonctionnelle des tissus suite à

une perte tissulaire causée par une maladie ou une blessure. Les cellules souches

mésenchymateuses (MSCs) sont la population de cellules souches la plus fréquemment

utilisée dans les essais cliniques en médecine régénérative.

Cependant, des études récentes ont révélé que les MSCs ne survivent pas longtemps

après l’implantation, et que les avantages de la thérapie cellulaire pourraient être dus

aux facteurs bioactifs que les MSCs produisent. Le large spectre de ces facteurs, appelé

sécrétome des MSCs et collecté sous forme de milieux conditionnés (CM), module le

comportement des cellules endogènes, contribuant ainsi à la formation de nouveaux

tissus.

MSC-CM sont alors des combinaisons de biomolécules et de facteurs de croissance

sécrétés par les MSCs dans un milieu de culture cellulaire. Leur préparation consiste à

laisser les cellules en culture pendant un certain temps, avant de collecter par

centrifugation leur milieu de croissance contenant toutes leurs sécrétions.

En effet, l'utilisation des CM présente plusieurs avantages par rapport à celle des MSCs.

L'absence de cellules dans les fractions des sécrétomes améliore considérablement le

profil de sécurité du patient, et élimine la nécessité de faire correspondre le donneur et

le receveur pour éviter les problèmes de rejet. En outre, les concentrations de facteurs

contenus dans les MSC-CM sont relativement faibles, de sorte que l'utilisation de ce

dernier n'induit pas les réponses inflammatoires histologiques graves qui peuvent être

observées lors de l'utilisation de facteurs recombinants. La faible activité métabolique

permet d'améliorer le contrôle et l'assurance qualité. De plus, les CM peut être

fabriqués, lyophilisés et transportés plus facilement que les cellules. La simplicité du

stockage constitue la base d'une expédition rentable de ces produits potentiellement

thérapeutiques. Par conséquent, les MSC-CM apparaissent comme une alternative

efficace à la thérapie cellulaire, et ont une perspective d'être fabriqués comme produits

pharmaceutiques en médecine régénérative.

v

Cependant, la littérature révèle un degré élevé de variabilité dans les sécrétomes de

MSCs, ce qui confirme la nécessité de la normalisation et d'optimisation des protocoles.

Plusieurs questions telles que la procédure de fabrication, le contrôle de la qualité, et

d'autres doivent être abordées avant l'application clinique de ces produits

biopharmaceutiques prometteurs. Il est essentiel de comprendre comment les

conditions de culture et de production interagissent pour déterminer la quantité, la

qualité et le profil des MSC-CM afin de développer une procédure conforme aux

bonnes pratiques de fabrication (BPF) adaptée au remplacement de la thérapie cellulaire

par les MSC-CM.

Dans cette thèse, nous nous concentrons sur le milieu conditionné par les cellules

souches mésenchymateuses de la pulpe dentaire (DPSC-CM), dans un but ultime

d'identifier les conditions de fabrication, et de développer des stratégies standardisées

et optimisées fournissant les DPSC-CM les plus riches en facteurs et les plus puissants

pour chaque application spécifique dans le domaine de la médecine régénérative

humaine.

Après avoir souligné l'influence de la procédure de production des CM sur la qualité de

ces produits et leurs dérivés à travers la littérature, nous avons évalué les impacts de

plusieurs paramètres et conditions de culture sur les sécrétomes des DPSCs. Ensuite,

nous avons étudié les potentiels des DPSC-CM pour différentes applications en

régénération tissulaire : la croissance neuronale, la régénération osseuse, l’angiogenèse,

et pour le traitement contre le cancer.

À cette fin, de nombreuses techniques ont été utilisées et diverses expériences ont été

réalisées. Premièrement, le test de Bradford et l'électrophorèse des protéines ont été

utilisés pour illustrer les impacts des donneurs des DPSCs, du nombre de passage

cellulaire, de la période de conditionnement et du milieu de croissance cellulaire sur les

concentrations totales de protéines dans les DPSC-CM. Des analyses avec des puces à

anticorps ont été effectué pour comparer les profils des DPSC-CM et de CM dérivés

d'autres types de cellules MSCs et leurs compositions en facteurs de croissance. Puis,

les effets de l’irradiation des DPSCs par un laser à diode et de la culture cellulaire en

tridimensionnelle sur les DPSC-CM ont été évalués.

vi

Ensuite, les potentiels des DPSC-CM pour la régenération tissuslaire ont été étudiés.

Brièvement, les neurones sensoriels primaires des ganglions de la racine dorsale de

souris ont été mis en culture avec ou sans DPSC-CM, et les longueurs des neurites

positifs à la βIII-tubuline ont été mesurée. L'impact de la durée du conditionnement des

cellules, le stockage des CM et la culture des DPSCs avec le supplément B-27 sur

l'activité fonctionnelle des CM ont été évalués. Par ailleurs, les potentiels des DPSC-

CM pour la régénération osseuse ont été examinés in vitro et in vivo. Après avoir

comparé les cellules de type ostéoblastes (MG-63) aux ostéoblastes primaires humains,

et avoir confirmé la similitude de leurs phénotypes. Les effets des DPSC-CM sur la

prolifération cellulaire, l'activité de la phosphatase alcaline (ALP), l'expression

génétique du facteur de transcription Runx2, de la sialoprotéine osseuse (BSP) et de

l'ostéocalcine (OCN), ainsi que la minéralisation de la matrice extracellulaire des MG-

63 et des cellules souches mésenchymateuses osteodifférenciées ont été évalués. Nous

avons utilisé un modèle de défaut de taille critique des vertèbres caudales de rats pour

étudier l'effet des DPSC-CM in vivo. D’autre part, afin d’investiguer les potentiels des

DPSC-CM pour l'angiogenèse et la régénération vasculaire, des anneaux des aortes de

rats ont été mises en culture avec du DPSC-CM, et la croissance des microvaisseaux a

été analysé. Finalement, les effets paracrines des DPSCs sur la croissance et la

dissémination du cancer ont été étudiés par une culture en transwell et une co-culture à

interaction minimale des DPSCs et des cellules cancéreuses MCF7 respectivement. Les

résultats ont été confirmé par la culture de ces cellules avec du DPSC-CM. Afin de

comprendre et de compléter les manips précédentes, nous avons analysé la composition

des DPSC-CM en facteurs de croissance avec des puces à anticorps.

Les résultats n'ont montré aucune différence significative de la concentration totale de

protéines dans les DPSC-CM entre les donneurs, alors que cette concentration

diminuait avec le nombre de passage cellulaire, et augmentait avec la durée de

conditionnement sans différence significative après les 48 premières heures.

L’irradiation au laser des DPSCs a stimulé leurs sécrétions, contrairement à leur culture

en tridimensionnelle. Une comparaison entre les profils de CM dérivés des DPSCs,

ASCs et des BMSCs a montré des différences significatives entre les trois CM ; Les

DPSC-CM et les ASC-CM étant nettement plus riches en facteurs de croissance que les

BMSC-CM.

vii

D'autre part, le DPSC-CM a considérablement amélioré la croissance des neurites des

neurones sensoriels en fonction de la dose utilisée. Le stockage à l'état congelé des

DPSC-CM n'a eu aucun impact sur les résultats expérimentaux et 48 heures de

conditionnement de milieu avec les DPSCs ont été optimales pour une activité efficace

du CM. La culture de DPSCs avec le supplément B-27 a renforcé de manière

significative l’effet neurorégénérateur de leur sécrétome en modifiant sa composition

en facteurs de croissance. En outre, le DPSC-CM a induit la prolifération des cellules

ostéoblastiques, accéléré leur maturation et ostéodifférenciation en augmentant

l'activité de l'ALP, et l'expression des gènes ostéoblastiques à un stade précoce de la

différenciation ostéoblastique par rapport au contrôle. Cependant, le DPSC-CM a

montré un effet léger sur la croissance des microvaisseaux, et a induit une prolifération

accrue des cellules cancéreuses. L'analyse des DPSC-CM par les puces d'anticorps a

révélé la présence de plusieurs facteurs impliqués dans la prolifération et la migration

cellulaires, la neurogenèse, la neuroprotection, l'angiogenèse et l'ostéogenèse.

Les effets des DPSC-CM sont multifactoriels, et même la variabilité minimale de leurs

compositions peut fortement affecter leurs activités. En outre, le processus de

production des produits dérivés des sécrétomes des DPSCs humaines est une

considération majeure dans l'élaboration de critères normalisés pour définir et qualifier

la préparation de ces produits pour des applications cliniques. En se basant sur les

données de la littérature et sur nos résultats, nous recommandons la préparation des

DPSC-CM avec des cellules à faible nombre de passage et à confluence cellulaire

élevée, à partir les donneurs relativement jeunes et sains. Nous recommandons aussi la

préparation dans des conditions sans sérum, et la collection des DPSC-CM pendant les

premiers jours de conditionnement.

Dans cette thèse, nous avons mis en évidence l'impact des signaux

microenvironnementaux sur les profils des sécrétomes des DPSCs. Nous avons montré

que la thérapie laser pourrait être une technique prospective pour stimuler les sécrétions

des DPSCs. Par contre, la culture tridimensionnelle des DPSCs n'a pas donné de bons

résultats dans notre étude, ce qui n'est pas conforme à la littérature. Des travaux

supplémentaires doivent être effectués pour déterminer quels signaux

environnementaux fournissent le produit le plus puissant pour chaque application

spécifique dans le domaine de la médecine régénérative humaine.

viii

Ensuite, nous avons démontré que le DPSC-CM améliore la croissance des neurites, et

avons défini une stratégie d’optimisation du DPSC-CM. Ensemble, nos travaux ouvre

des perspectives prometteuses pour l'application de DPSC-CM pour aider à la

régénération neuronale.

De plus, nos résultats ont mis en évidence les effets ostéorégénérateurs du DPSC-CM,

et son application potentielle pour la réparation des tissus osseux. Nous attendons les

résultats des expériences in vivo, toujours en cours.

Le test des anneaux de l'aorte nous avons utilisé pour étudier l'effet de DPSC-CM sur

l'angiogenèse récapitule l'ensemble des processus cellulaires et moléculaires complexes

qui régulent l'angiogenèse, et combine les avantages des modèles in vitro et in vivo.

Cependant, nous avons constaté une variabilité de la réponse angiogénique dans

différentes cultures aortiques, ce qui rend l'ensemble du test difficile à interpréter d’une

façon claire. Ceci pourrait être responsable de la détection d'un effet angiogénique

significatif de DPSC-CM, en une seule expérience sur trois répétitions indépendantes.

Pour mieux étudier le potentiel angiogénique de la DPSC-CM, d'autres essais

biologiques devraient être réalisés.

Finalement, nos résultats ont démontré que les DPSCs améliorent la croissance et la

dissémination du cancer grâce à leurs molécules bioactives sécrétées, ce qui nie

l'utilisation potentielle des DPSC-CM comme agents anticancéreux dans la thérapie des

tumeurs. Cependant, l'impact de la période de conditionnement sur les effets des

sécrétomes des DPSCs devrait être davantage étudiée. De plus, les sécrétomes des

MSCs pourraient affecter l’évolution des cancers de différentes manières autres que le

support ou l'inhibition de la prolifération des cellules cancéreuses, notamment en

augmentant ou en supprimant leur migration, l’activité des cellules immunitaires et

l'activité angiogénique, et/ou en régulant la transition épithélio-mésenchymateuse et la

sensibilité des cancers au médicament anticancéreux. D'autres études devraient être

réalisées pour évaluer les multiples potentiels de DPSC-CM dans le développement des

tumeurs.

Pris ensemble, les résultats de cette thèse ont permis d'identifier des conditions de

culture et de fabrication standardisées fournissant des DPSC-CM riches en facteurs, de

démontrer les potentiels des DPSC-CM pour la régénération tissulaire, et de développer

des stratégies optimisées pour générer des CM dédiés à des applications spécifiques en

ix

médecine régénérative humaine. Cette thèse contribue aux contrôles quantitatifs et

qualitatifs des produits dérivés des sécrétomes des DPSCs nécessaires à leur production

selon les bonnes pratiques de fabrication et à leur développement clinique.

x

THESIS SUMMARY

Mesenchymal stem cell secretome or conditioned medium (MSC-CM), is a

combination of biomolecules and growth factors secreted by mesenchymal stem cells

(MSCs) in the cell growth medium, and the starting point of several derived products.

MSC-CM could be applied after injuries and could mediate most of the beneficial

regenerative effects of MSCs without possible side effects of using cells. Therefore,

MSC-CM emerge as an effective alternative to cell therapy and have a prospect to be

manufactured as pharmaceutical products in regenerative medicine.

However, a high degree of variability in MSC secretomes is revealed in the literature,

confirming the need to standardize and optimize protocols. Several issues such as

manufacturing protocols, quality control, and others must be addressed before the

clinical application of these promising biopharmaceuticals. Understanding how

bioprocessing and manufacturing conditions interact to determine the quantity, quality,

and profile of MSC-CM is essential to the development of good manufacturing

practices (GMP)-compliant procedure suitable to replace mesenchymal stem cells in

regenerative medicine.

In this thesis, we focused on human dental pulp stem cells (DPSCs). After underlying

the influence of the procedure for CM production on the quality of these products and

their derivatives through the literature, we evaluated the impact of several

manufacturing parameters and culture conditions as cell donors, cell passage number,

conditioning period, and microenvironment cues on DPSC secretomes. Then, we

investigated DPSC-CM potentials for different applications in tissue regeneration:

neuronal growth, bone regeneration, angiogenesis, and cancer therapy. For these

purposes, many techniques were used and various assays and experiments were

performed.

Results showed no significant difference in total protein concentration of DPSC-CM

between donors, while this concentration decreased with cell passage number, and

increased with days without significant difference after the first 48 hours. DPSC’s laser

therapy could stimulate their secretions, unlike DPSC’s three-dimensional culture. A

comparison between the profiles of CM derived from DPSCs, ASCs, and BMSCs

xi

showed significant differences between the three CM, with DPSC-CM and ASC-CM

being markedly richer in growth factors than BMSC-CM.

On the other hand, DPSC-CM significantly enhanced neurites outgrowth of sensory

neurons in a concentration-dependent manner. The frozen storage of DPSC-CM had no

impact on experimental outcomes and 48 hours of medium conditioning with DPSCs

were optimal for effective activity of CM. The culture of DPSCs with the B-27

supplement enhanced significantly the neuroregenerative effect of their secretome by

changing the composition in growth factors. On the other hand, DPSC-CM induced

osteoblastic cell growth and accelerated the maturation of osteoblastic cells by

increasing ALP activity and the expression of key marker genes at an early stage of

osteoblastic differentiation compared to control. However, just a slight effect of DPSC-

CM was observed on microvessel growth as revealed by the aortic ring assays, while

an enhanced proliferation of breast cancer cells by DPSC-CM was demonstrated. The

analysis of DPSC-CM by human growth factor antibody array revealed the presence of

several factors involved in cellular proliferation and migration, neurogenesis,

neuroprotection, angiogenesis, and osteogenesis.

Taken together, the results of this thesis allowed to identify standardized culture and

manufacturing conditions providing factor-rich DPSC-CM, to demonstrate the

potentials of DPSC-CM for tissue regeneration, and to develop optimized strategies to

generate CM dedicated to specific applications of human regenerative medicine. This

thesis contributes to the quantitative and qualitative controls of DPSC’s secretome-

derived products necessary for their GMP-grade production and their clinical

translation.

xii

ABBREVIATIONS

MSCs: mesenchymal stem cells

CM: conditioned medium

GMP: good manufacturing practice

BMSCs: bone marrow mesenchymal stem cells

ASCs: adipose tissue mesenchymal stem cells

UMSCs: umbilical cord mesenchymal stem cells including Wharton’s jelly

mesenchymal stem cells and perivascular cells

PMSCs: placental chorionic villi derived mesenchymal stem cells

DPSCs: dental pulp stem cells

SHED: dental pulp stem cells isolated from deciduous teeth

FBS: fetal bovine serum

3D culture: three-dimensional culture

2D: two-dimensional culture

MWCO: molecular weight cut-off

EVs: extracellular vesicles

DNA: deoxyribonucleic acid

RNA: ribonucleic acid

MVs: microvesicles

DMSCs: dental mesenchymal stem cells

PDLSCs: periodontal ligament stem cells

SCAPs: stem cells from apical papilla

DFPCs: dental follicle progenitor cells

ECM: extracellular matrix

MEM: Minimum Essential Medium

DMEM: Dulbecco's Modified Eagle Medium

LPS: lipopolysaccharides

G-CSF: granulocyte-colony stimulating factor

BCA: bicinchoninic acid assay

ELISA: enzyme-linked immunosorbent assay

LC-MS-MS: liquid chromatography with tandem mass spectrometry

PBS: phosphate-buffered saline

PS: penicillin-streptomycin

xiii

C-: negative control

C+: positive control

Ctrl: control

ALP: alkaline phosphatase

MG-63: osteoblast-like cells derived from an osteosarcoma

MCF7: breast cancer cell line

MCF7TAX19: paclitaxel resistant breast cancer cell line

DMSO: dimethyl sulphoxide

MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide

DAPI: 4,6-Diamidino-2-Phenylindole, Dilactate

OCN: osteocalcin

BSA: bovine serum albumin

OM: osteogenic medium

OD: optical density

pNPP: p-Nitrophenyl Phosphate

OBs: osteodifferentiated DPSCs

ddH2O: distilled water

RT-qPCR: real-time polymerase chain reaction

Runx2: runt-related transcription factor 2

BSP: bone sialoprotein

PFA: paraformaldéhyde

PET: positron emission tomography

CT: x-ray computed tomography

NaOH: sodium hydroxyde

SEM: standard error of the mean

SD: standard deviation

DRG: dorsal root ganglia

DPSC-CM pre B-27: conditioned medium obtained with DPSCs cultured in media

containing B-27

DPSC-CM post B-27: B-27 added to the conditioned medium obtained with DPSCs

cultured in media without supplements

Col: collagen

GMSCs: MSCs from normal gingival tissue

MMP-2: matrix metalloproteinase-2

xiv

TIMP-1/2: tissue inhibitor of metalloproteinases-1/2

LLLI: low-level laser irradiation

BDNF: brain-derived neurotrophic factor

bNGF: nerve growth factor

NT-3/-4: neurotrophin-3/-4

bFGF: basic fibroblast growth factor

BMP-4/-5/-7: bone morphogenetic proteins

EGF, EGF R: epidermal growth factor and its receptor

EG-VEGF: endocrine gland derived vascular endothelial growth factor

FGF-4-7: fibroblast growth factors

GDF-15: growth differentiation factor-15

GDNF: glial cell-derived neurotrophic factor

GH: growth hormone

HB-EGF: heparin-binding EGF-like growth factor

HGF: hepatocyte growth factor

IGFBP-1/-2/-3/-4/-6: insulin-like growth factor-binding proteins

IGF-I: insulin-like growth factor 1

MCSF R: macrophage colony-stimulating factor receptor

NGF R: nerve growth factor receptor

OPG: osteoprotegerin

PDGF-AA: platelet-derived growth factor AA

PIGF: placental growth factor

SCF, SCF R: stem cell factor and its receptor

TGFα,β1,β3: transforming growth factors

VEGF, VEGF-D, VEGF R2/3: vascular endothelial growth factors and their

receptors.

xv

TABLE OF CONTENT

REMERCIEMENTS .............................................................................................................. II RESUMÉ DE THÈSE ........................................................................................................... IV THESIS SUMMARY .............................................................................................................. X ABBREVIATIONS ............................................................................................................. XII TABLE OF CONTENT ....................................................................................................... XV LIST OF FIGURES ............................................................................................................ XIX LIST OF TABLES ............................................................................................................. XXII CHAPTER 1: INTRODUCTION .......................................................................................... 1

1.1. MESENCHYMAL STEM CELLS (MSCS): GENERALITIES ................................................... 2 1.2. MESENCHYMAL STEM CELL-CONDITIONED MEDIUM (MSC-CM) .................................. 2

1.2.1. Definition ................................................................................................................. 2 1.2.2. MSC-CM versus stem cell therapy .......................................................................... 3 1.2.3. MSC-CM manufacturing ......................................................................................... 3

1.2.3.1. Cell sources ...................................................................................................... 4 1.2.3.2. Donors .............................................................................................................. 5 1.2.3.3. Cell passage number ......................................................................................... 7 1.2.3.4. Culture medium ................................................................................................ 7 1.2.3.5. Cell confluency and conditioning period .......................................................... 8 1.2.3.6. Microenvironment cues .................................................................................... 8 1.2.3.7. Secretome-derived products purification ........................................................ 10 1.2.3.8. Other manufacturing conditions ..................................................................... 12

1.2.4. Toward the standardization of MSC-CM manufacturing ...................................... 13 1.3. DENTAL MESENCHYMAL STEM CELL (DMSCS)............................................................ 14

1.3.1. Generalities ............................................................................................................ 14 1.3.2. Dental mesenchymal stem cell-conditioned medium (DMSC-CM)...................... 15

1.3.2.1. DMSC-CM for tissue regeneration................................................................. 15 1.3.2.2. DMSC-CM versus CM derived from other MSCs ......................................... 16 1.3.2.3. Comparison of CM derived from the various types of DMSCs ..................... 17 1.3.2.4. DMSC-CM manufacturing in the literature .................................................... 18

1.4. OBJECTIVES .................................................................................................................. 20

CHAPTER 2: MATERIALS AND METHODS ................................................................. 22

2.1. MATERIALS ................................................................................................................... 23 2.2. METHODS ...................................................................................................................... 25

2.2.1. Cell isolation, culture, and characterization .......................................................... 25 2.2.1.1. Human dental pulp stem cells ......................................................................... 25 2.2.1.2. MSCs derived from bone marrow (BMSCs) and adipose tissue (ASCs) ....... 26 2.2.1.3. Primary sensory neurons ................................................................................ 26 2.2.1.4. Human primary osteoblasts ............................................................................ 26 2.2.1.5. Osteoblast-like MG-63 ................................................................................... 27 2.2.1.6. MCF7 and resistant MCF7 ............................................................................. 27 2.2.1.7. Fibroblasts ...................................................................................................... 27

2.2.2. Cell freezing .......................................................................................................... 28 2.2.3. Cell reconstitution ................................................................................................. 28 2.2.4. Osteogenic medium (OM) ..................................................................................... 29 2.2.5. Preparation of CM ................................................................................................. 29

xvi

2.2.5.1. CM from MSCs in 2D culture ........................................................................ 29 2.2.5.2. CM from DPSCs irradiated with laser ............................................................ 30 2.2.5.3. CM from spheroid DPSCs .............................................................................. 30

2.2.6. Rat aortic ring assay .............................................................................................. 31 2.2.7. Culture of neurons with DPSC-CM....................................................................... 33 2.2.8. Immunostaining and fluorescence imaging ........................................................... 33

2.2.8.1. Immunostaining .............................................................................................. 33 2.2.8.2. Fluorescence imaging ..................................................................................... 34

2.2.9. Neurites Length Measurements ............................................................................. 34 2.2.10. Proliferation assay ............................................................................................... 34 2.2.11. Quantitative ALP Activity Assay ........................................................................ 35 2.2.12. Alizarin Red staining and quantification ............................................................. 35 2.2.13. Molecular biology ............................................................................................... 36

2.2.13.1. RNA extraction ............................................................................................. 36 2.2.13.2. Reverse transcription .................................................................................... 36 2.2.13.3. Real-time reverse transcription–polymerase chain reaction (Real-time RT-

PCR) ............................................................................................................................ 36 2.2.14. In vivo experiment ............................................................................................... 37

2.2.14.1. surgical procedure ........................................................................................ 37 2.2.14.2. Micro-CT analysis ........................................................................................ 38 2.2.14.3. Histology ...................................................................................................... 38

2.2.15. Transwell assay ................................................................................................... 39 2.2.16. Tumor spheroid dissemination assay ................................................................... 39 2.2.17. DPSC-CM analysis .............................................................................................. 41

2.2.17.1. Proteomic analysis ........................................................................................ 41 2.2.17.2. a. Bicinchoninic Acid (BCA) Assay ............................................................. 41 2.2.17.3. b. Protein electrophoresis ............................................................................. 41 2.2.17.4. Immunoassay: Growth factor antibody array ............................................... 42

2.2.18. Statistical Analyses .............................................................................................. 42

CHAPTER 3: PRODUCTION OF DPSC-CM ................................................................... 43

3.1. INTRODUCTION ............................................................................................................. 44 3.2. RESULTS........................................................................................................................ 44

3.2.1. DPSC characterization ........................................................................................... 44 3.2.2. Impact of donors .................................................................................................... 45 3.2.3. Impact of cell confluency, passage number, and conditioning period................... 46 3.2.4. Impact of growth medium ..................................................................................... 47 3.2.5. Comparison of secretome profiles: DPSC-CM, BMSC-CM, and ASC-CM ......... 48

3.3. DISCUSSION .................................................................................................................. 50

CHAPTER 4: THE EFFECT OF ENVIRONMENTAL CUES ON DPSC-CM ............. 53


4.2.1. Effect of laser irradiation on DPSCs and DPSC-CM protein concentration ......... 54 4.2.2. Effect of CM from irradiated DPSCs on fibroblast and MCF7 proliferation ........ 56 4.2.3. Composition of CM from irradiated DPSCs in growth factors ............................. 56 4.2.4. Composition of CM derived from spheroid DPSCs in growth factors .................. 57

4.3. DISCUSSION .................................................................................................................. 59

CHAPTER 5: DPSC-CM FOR NEURON GROWTH ...................................................... 62

5.1 INTRODUCTION .............................................................................................................. 63

xvii

5.2. RESULTS........................................................................................................................ 63 5.2.1. DPSC-CM potential for neurite outgrowth ........................................................... 63 5.2.2. Reproducibility of DPSC-CM between donors ..................................................... 65 5.2.3. Medium conditioning period ................................................................................. 65 5.2.4. Packaging conditions of DPSC-CM ...................................................................... 65 5.2.5. Culture of DPSCs with B-27 supplement during medium conditioning ............... 66 5.2.6. Composition of DPSC-CM in neurogenic factors ................................................. 68

5.3. DISCUSSION .................................................................................................................. 70

CHAPTER 6: DPSC-CM FOR BONE TISSUE REGENERATION ............................... 73

6.1. EVALUATION OF MG-63 AS A HUMAN PRIMARY OSTEOBLAST MODEL ........................ 74 6.1.1. Introduction ........................................................................................................... 74 6.1.2. Results ................................................................................................................... 75

6.1.2.1. Role of osteogenic supplements on osteoblastic cell ...................................... 75 6.1.2.2. Osteoblast characterization ............................................................................. 76 6.1.2.3. ALP activity mapping and calcium deposition in MG-63 cultures ................ 78 6.1.2.4. MG-63 versus osteoblasts: proliferation, ALP activity, and gene expressions

..................................................................................................................................... 78 6.1.2.5. MG-63 versus osteoblasts: collagen and osteocalcin expressions .................. 79 6.1.2.6. MG-63 versus osteoblasts: calcium deposition .............................................. 80

6.1.3. Discussion ............................................................................................................. 81 6.2. POTENTIAL OF DPSC-CM FOR BONE TISSUE REGENERATION ...................................... 84

6.2.1. Introduction ........................................................................................................... 84 6.2.2. Results ................................................................................................................... 85

6.2.2.1. DPSC-CM effect on MG-63 ........................................................................... 85 6.2.2.2. DPSC-CM effect on OBs ............................................................................... 86 6.2.2.3. Composition of DPSC-CM in growth factors ................................................ 88

6.2.3. Discussion ............................................................................................................. 89

CHAPTER 7: DPSC-CM FOR ANGIOGENESIS............................................................. 91


7.2.1. Effect of DPSC-CM on aorta microvessel growth ................................................ 92 7.2.2. Endothelial origin of newly formed microvessels ................................................. 93

7.3. DISCUSSION .................................................................................................................. 94

CHAPTER 8: DPSC-CM FOR CANCER THERAPY ...................................................... 96


8.2.1. Paracrine effect of DPSCs on MCF7 and MCF7TAX19 proliferation ...................... 98 8.2.2. Cancer growth and dissemination after minimal interaction with DPSCs ............ 99 8.2.3. Effect of DPSC-CM on MCF7 proliferation ....................................................... 100

8.3. DISCUSSION ................................................................................................................ 100

CHAPTER 9: SUMMARY AND PERSPECTIVES ........................................................ 103

9.1. PREPARATION OF MSC-CM........................................................................................ 104 9.2. DPSC-CM AND MICROENVIRONMENTAL CUES .......................................................... 104 9.3. DPSC-CM FOR NEURON GROWTH .............................................................................. 105 9.4. DPSC-CM FOR BONE TISSUE REGENERATION ............................................................ 105 9.5. DPSC-CM FOR ANGIOGENESIS ................................................................................... 105 9.6. DPSC-CM FOR CANCER THERAPY .............................................................................. 106

xviii

REFERENCES .................................................................................................................... 107 APPENDIX A: DMSC-CM MANUFACTURING IN THE LITERATURE ................ 151 APPENDIX B: HUMAN GROWTH FACTOR ANTIBODY ARRAY RESULTS ...... 166 APPENDIX C: NEURITES LENGTH RESULTS........................................................... 169 APPENDIX D: THE COMPOSITION OF B-27 SUPPLEMENT .................................. 170 APPENDIX E: DPSC-CM EFFECT ON CANCER GROWTH .................................... 171 SUBMITTED ARTICLES .................................................................................................. 173

xix

LIST OF FIGURES

Figure 1.1: Schematic representation of the procedure for obtaining MSC-CM, and the

different variations that can affect their production at different stages. 4

Figure 1.2: The different techniques and protocols to obtain secretome-derived

products. 12

Figure 1.3: The different components of the molar tooth. 15

Figure 1.4: The dental tissues from which different populations of dental MSCs can be

isolated. 15

Figure 2.1: Images of DPSCs cultured in 2D and 3D observed under phase-contrast

microscopy. 31

Figure 2.2: Preparation of rat aorta rings. 32

Figure 2.3: Vertebra intraosseous defect preparation using a surgical guide. 38

Figure 2.4: Tumor spheroid dissemination assay 40

Figure 3.1: DPSC characterization. 45

Figure 3.2: Total protein concentration in DPSC-CM compared to basal medium, and

obtained from 3 different donors. 46

Figure 3.3: Total protein concentration in DPSC-CM obtained from DPSCs at different

passages, different cell confluence, and after different periods of conditioning. 47

Figure 3.4: Protein analysis of CM obtained with a complete or serum-free basal

medium by the Agilent 2100 Bioanalyzer. 48

xx

Figure 3.5: Quantitative Antibody microarray analysis of 40 human growth factors in

DPSC-CM, BMSC-CM, and ASC-CM. 49/50

Figure 3.6: Preparation procedure of DPSC-CM. 52

Figure 4.1: Total protein concentration in CM collected from DPSCs irradiated at

multiple fluence, and the number of DPSCs in culture after the irradiation. 55

Figure 4.2: The effect of CM from irradiated and non-irradiated DPSCs on fibroblast

and MCF7 proliferation. 56


CM obtained from irradiated and non-irradiated DPSCs. 57


CM obtained from DPSCs cultured in 2D or 3D. 58

Figure 5.1: Effect of DPSC-CM on neurite growth. 64

Figure 5.2: Impact of donors and recipients, time conditioning elongation, and

packaging conditions on the effect of DPSC-CM. 66

Figure 5.3: Impact of DPSC culture with B-27 supplement on DPSC-CM. 67


CM obtained from DPSCs cultured with or without B-27 supplement. 69

Figure 6.1: Reciprocal and functionally coupled relationship between cell growth and

differentiation-related gene expression. 75

Figure 6.2: Roles of ascorbate phosphate, dexamethasone, and ß-glycerophosphate

supplements in osteoblastic cell proliferation, and extracellular matrix maturation and

mineralization. 76

xxi

Figure 6.3: Characterization of human primary osteoblasts. 77

Figure 6.4: Quantification of phosphatase alkaline activity and calcium deposits in MG-

63 cultures. 78

Figure 6.5: Comparison of proliferation, ALP activity, and osteogenic gene expressions

of Osteoblasts and MG-63 cultured in OM. 79

Figure 6.6: Expression of collagen and osteocalcin in osteoblast and MG-63 cultures.80

Figure 6.7: Quantification of calcium deposits in osteoblasts and MG-63. 81

Figure 6.8: DPSC-CM effect on proliferation, ALP activity, osteogenic gene

expressions, and extracellular calcium deposits of MG-63 cultures. 85

Figure 6.9: DPSC-CM effect on ALP activity, osteogenic gene expressions, and

extracellular calcium deposits of OB cultures. 87


DPSC-CM. 88

Figure 7.1: Quantification of microvessel sprouting from aortic rings. 93

Figure 7.2: Fluorescent images of microvessel sprouts of aortic rings. 94

Figure 8.1: Paracrine effect of DPSCs on cancer cell proliferation. 98

Figure 8.2: Paracrine effect of DPSCs on the dissemination of MCF7 spheroid cells. 99

Figure 8.3: Proliferative effect of DPSC-CM on MCF7 cells. 100

xxii

LIST OF TABLES

Table 1.1: Summary of DPSC-CM potentials for tissue regeneration. 16

Table 2.1: The combination of factors used to induce the in vitro osteogenesis. 29

Table 2.2: Blocking reagents, primary, secondary, and conjugated antibodies used for

immunostaining. 34

Table 2.3: Primer sequences used in the real-time polymerase chain reaction. 37

Table 5.1: Physiological effects of human growth factors detected in DPSC-CM

obtained with or without B-27. 70

1

CHAPTER 1: INTRODUCTION

Chapter 1: Introduction

2

1.1. Mesenchymal stem cells (MSCs): Generalities

Mesenchymal stem cells (MSCs) are the spindle-shaped cells isolated from many tissue

sources, with multipotent differentiation capacity in vitro (Horwitz 2006).

The term “mesenchymal stem cells” was coined in the early 1990s, and more than a

decade later, the International Society for Cellular Therapy (ISCT) has proposed a set

of standards to define human MSCs (1). First, MSCs must be plastic-adherent when

maintained in standard culture conditions using tissue culture flasks. Second, 95% of

the MSC population must express CD105, CD73, and CD90, as measured by flow

cytometry. Additionally, these cells must lack expression (5/2% positive) of CD45,

CD34, CD14 or CD11b, CD79a or CD19, and HLA class II. Third, the cells must be

able to differentiate to osteoblasts, adipocytes, and chondroblasts under standard in

vitro differentiating conditions (2).

Mesenchymal stem cells are present in fetal and many adult tissues. MSCs could be

isolated from bone marrow, adipose tissue, amniotic fluid, amniotic membrane, dental

tissues, endometrium, limb bud, menstrual and peripheral blood, placenta and fetal

membrane, salivary gland, skin and foreskin, sub-amniotic umbilical cord lining

membrane, synovial fluid and Wharton’s jelly (3).

Due to their self-renewal and differentiation capacity (4), stem cells have been

employed in regenerative medicine, and have been developed as a promising therapy

towards full restoration of tissue structure and subsequent function after tissue loss

through disease and injury. Mesenchymal stem cells are the most frequently stem cell

population used in regenerative medicine clinical trials (5).

However, recent studies have revealed that implanted cells do not survive for long and

that the benefits of MSC therapy could be due to the vast array of bioactive factors they

produce (6). The broad spectrum of these factors, referred to as MSC secretome and

collected as conditioned media (MSC-CM), modulates the behavior of endogenous

cells, thus contributing to the formation of new tissue (7).

1.2. Mesenchymal stem cell-conditioned medium (MSC-CM)

1.2.1. Definition

In recent years, it is becoming increasingly accepted that the regenerative effects

promoted by MSCs are mainly associated with the secretion of bioactive molecules,


3

which are endowed with paracrine activity, including soluble factors (proteins, nucleic

acids, lipids) and extracellular vesicles (EVs) (8), and defined as the secretome or

mesenchymal stem cell-conditioned medium (MSC-CM) (9, 10).

The preparation of MSC-CM consists in leaving the cells in culture for a certain period,

before collecting by centrifugation their growth medium containing all their secretions.

The number of peer-reviewed articles focusing on the use of MSC-CM has increased

exponentially in the last years (11, 12). MSC-CM is emerging as an alternative to direct

MSC therapy and has a promising prospect to be produced as pharmaceuticals for

regenerative medicine (11).

1.2.2. MSC-CM versus stem cell therapy

Indeed, the use of CM has several advantages compared to the use of stem cells. As it

is devoid of cells, there is no need to match the donor and the recipient to avoid rejection

problems (13), and the absence of replicating (allogeneic) cells in secretome fractions

significantly improves the patient safety profile.

The concentrations of factors contained in MSC-CM are relatively low, thus, the use of

MSC-CM does not induce the severe histological inflammatory responses that can be

observed with the clinical use of recombinant factors (14). The low metabolic activity

allows more efficient quality controls and quality assurance. Moreover, CM can be

manufactured, freeze-dried, packaged and transported more easily than cells. The

simplicity of storage provides the basis for cost-efficient shipping of this potentially

therapeutic substance (15).

1.2.3. MSC-CM manufacturing

Although all studies converge around the regenerative potential of MSC-CM and their

derivatives as the therapeutically active components of MSCs, the literature reveals

high variability in terms of MSC sources and manufacturing processes. This highlights

the challenges to the clinical translation of MSC-CM and their derivatives, and

underline the importance of methods and protocols standardization for MSC secretome-

derived products of GMP-Grade (16-22). Processing optimization and standardization

are needed to avoid changes in protein secretion profiles, and properly compare studies,

and ensure effective quality control (23). The standardization of the production of


4

MSC-CM and their derivatives are hampered by variations in MSC source, donors, cell

expansion, cell passage number, conditioning period, cell culture medium,

microenvironment cues, and secretome-derived products purification (Figure 1.1).

These characteristics and conditions will determine the quantity, quality, and types of

biomolecules secreted by MSCs in conditioned medium. It is essential understand these

parameters, to develop bioprocesses scaling up the production of secretome-derived

products (19).

Figure 1.1: Schematic representation of the procedure for obtaining the secretome from

mesenchymal stem cells (MSC-CM), and the different variations that can affect its

production at the different stages. (a) MSCs in culture; (b) Changing the culture

medium of adherent cells after reaching a certain degree of confluency; (c) MSCs,

incubated for some time, release their secretome in the growing medium; (d) MSC-CM

obtained after collection and centrifugation of the supernatant; (e) Purification of MSC-

CM derived products.

1.2.3.1. Cell sources

MSC secretomes vary significantly according to the source tissue (24). Baglio et al.

demonstrated that stem cells from bone marrow (BMSCs) and adipose tissue (ASCs)

secreted different tRNA species that may be relevant for clinical applications (25). Pires


5

et al. illustrated the difference in profiles and efficiencies of secretomes produced from

BMSCs, umbilical cord mesenchymal stem cells (UMSCs), and ASCs. Although

important changes observed within the secretome of the cell populations that were

analyzed, all cell populations shared the capability of secreting important regulatory

molecules (26). Du et al. demonstrated the heterogeneous proangiogenic properties of

BMSCs, ASCs, UMSCs, and placental chorionic villi (PMSCs), and suggested that

BMSCs and PMSCs might be preferred in clinical application for therapeutic

angiogenesis (27). A study conducted by Kehl et al. compared the angiogenic potential

of MSC secretomes from ASCs, BMSCs, and UMSCs, and suggested UMSCs as the

most potent MSC source for inflammation-mediated angiogenesis induction, while the

potency of ASC secretomes was the lowest (28). In contrast, Hsiao et al. suggested that

ASCs may be the preferred one, after a comparison of the angiogenic paracrine factors

expression in ASCs, BMSCs, and MSC from dermal tissues (29). Ribeiro et al. also

detected more factors in ASC-CM than in UMSC-CM (30). While, Hsieh et al.

suggested that UMSCs, because of their secreted factors involved in angiogenesis and

neurogenesis, were better than BMSCs to promote in vivo neuro-restoration and

endothelium repair (31).

Taken together, all these studies indicate that MSC secretomes differ between cell

sources. Thus, it is important, before the clinical translation of MSC secretome-based

products, to determine which cellular sources provide the most potential for each

application associated with tissue regeneration.

1.2.3.2. Donors

Since MSCs are used as a starting material for CM manufacturing, and since their

properties crucially influence the composition of CM, it is necessary to pay attention to

the standardization of MSCs, and to take into account the variability of MSC donor

characteristics during manufacturing (22).

The effect of donor variability on the MSC-CM profile is currently not well understood.

The composition of MSC-CM appears to be influenced by donor variability in some

studies (32), as well as their effect in vitro, including opposite effects sometimes (24).

However, other studies suggested that the trophic nature of MSCs and their cytokine

profiles do not depend on donor individuality (33). They showed a similar set of


6

proteins expressed in MSC secretomes of two different donors, while donor-dependent

variations were just reflected by the different expression levels of each protein (34).

Donor characteristics, may be responsible for the impact of donor variability on MSC

function and corresponding secretome. These characteristics are age, gender, metabolic

state, and disease. Whilst very few are the studies that report gender dimorphism of

MSC effects (35), functions and secretions (36), the age of donors has been shown to

have an impact on the properties and functions of MSCs (37, 38), as well as their

secretome profiles (39) and potentials (40).

Further understanding of the impact of age and other donor characteristics will be

crucial to the development and application of secretome-derived products (23). To date,

age effect on MSCs potential and their secretomes has not been demonstrated (41);

MSC functional properties and factors secretion status were not essentially determined

by age, despite their dissimilarity between different human MSC donors and

preparations (42).

Another explanation for this possible variation in MSC secretomes among donors is

MSC populations. The fraction of ‘‘stem-like’’ cells in a population of MSCs appears

to be quite heterogeneous and can vary in proportion depending on donor

(interpopulation heterogeneity). Variability in the secretion of several proteins from

cultured MSCs of individual subjects suggests that these cells exist as a heterogeneous

population containing functionally distinct subtypes, which differ in numbers between

donors (43). Variation can be found even when the same donor is utilized: significant

difference exists between secretomes of size-sorted MSC subpopulations from the same

donor (intrapopulation heterogeneity) (34). A significantly higher trophic factor

producing capacity is attributed to the large MSC subpopulations (34, 44, 45); The

majority of factors are pro-osteogenic, pro-senescence, and anti-chondrogenic. Some

factors associated with pro-chondrogenic and anti-osteogenic functions are found

higher in the small and medium-size subpopulations, and a more significant impact of

the size-dependent MSC secretome could be expected in long term cultures (34).

Current MSC-based clinical trials rarely select for competent subpopulations after

culture expansion, which might be an important cause for their inconsistent therapeutic

outcomes. Identification and sorting of subpopulations from culture-expanded MSCs

may lead to substantial improvements in the therapeutic outcomes, by selecting

subpopulations with the most suitable secretome profile for each specific therapeutic

application (34).


7

1.2.3.3. Cell passage number

Understanding the differences in properties of MSCs at early versus late passage will

help refine MSC treatment strategies. Early passage cell populations increase the

likelihood of heterogeneity whilst late passage cells retain characteristic markers for

MSC phenotype in a selectively more homogenous population (46). Moreover, the

immunomodulatory properties of MSCs in a long-term culture have been reported (47).

Nevertheless, prolonged in vitro culture of MSCs leads to a loss of MSC phenotype and

multipotency (37, 48-50) attenuating their stemness and contributing to reduced

therapeutic potential (51). Stem cells with low passage numbers can secrete larger

amounts of therapeutic paracrine factors, which are required for tissue regeneration, as

compared to stem cells with high passage number (52-54). Serra et al. characterized the

secretomes obtained from different passages (from passage 3 to passage 12) using

proteomic analysis. They revealed that different passages present distinct profiles, with

no significant variation in composition of proteins associated to

neuroprotection/differentiation and axonal growth (55).

1.2.3.4. Culture medium

Studies showed that cell culture media could have an impact on the potential of MSCs

for adhesion and growth, and can be positively selective for specific MSC

subpopulations (56, 57). Sagaradze et al. observed that the concentrations of factors are

different between MSC-CM where two different growth media were used (21). In

contrast, Ribeiro et al. found that MSCs cultured in three different media exhibited

similar secretion profile (58). In another study, Somasundaram et al. showed that MSCs

could be cultured in any basal medium, maintaining a constant phenotype profile (59).

Furthermore, some researchers use the fetal bovine serum (FBS) in culture medium for

MSC-CM production. Contamination risk from animal proteins is normally present in

FBS (60), and thus immunologic reactions are expectant when MSC-CM is used in

vivo. Concerns already exist with the FBS use, such as its ill-defined nature and the

variability of FBS from batch to batch (60). Different percentages of FBS result in

different amounts of growth factors present in a culture, thus some MSC manufacturers

emphasize the importance of qualifying FBS lots to facilitate product comparability

between manufacturing runs (16). The most common alternative for FBS is human


8

serum and its derivatives such as human platelet lysate (16, 61). However, the effect

of the human platelet lysate on the immunomodulatory capacity of MSC, its

contamination risk, and reproducibility (donor-to-donor variability) are still

contradictory (60). All these issues make it difficult for MSC secretome-based products

prepared in the presence of serum to validate GMP-compliant processes. The most

acceptable alternative is serum-free or preferably chemically-defined medium, the latter

not only serum-free but also lacking any hydrolysates or supplements of unknown

composition (61). Interestingly, it has been shown that serum-deprived cultures of

MSCs secreted a higher level of angiogenic factors (62, 63). Also, MSC-CM collected

under serum conditions was toxic to cells when used undiluted (100% concentration)

and, when diluted, did not have the positive effects of MSC-CM collected under serum

deprivation conditions. (64).

1.2.3.5. Cell confluency and conditioning period

There is significant controversy in the literature regarding the optimal conditions and

time-points of MSC-CM collection (64). Cell confluency as well as the period of

medium conditioning with MSC could affect the concentration of secreted factors. The

secretome could be richer in factors when there are more cells, or when less cells are

kept longer in culture so they become more confluent. However, the expression levels

of stemness genes reduce with high cell density (65), with an impact on their secretome.

Thus, MSC confluency and conditioning period should be determined carefully before

starting an experiment. Mizukami et al. showed that the majority of interesting proteins

from MSC secretome were enriched through time in culture (66). Sagaradze et al.

analyzed total concentrations of 4 growth factors in MSC-CM on certain days (until 14

days). Peak factor concentrations were mostly reached at days 7 or 10 for all of them

(21). Most commonly, MSC-CM is collected from 70%-90% of MSC confluency

during the first three days of culture (11).

1.2.3.6. Microenvironment cues

The use of microenvironment cues to manipulate MSC potency and secretome in

cultures has been extensively explored (67). They are used to change MSC secretome

profile or to increase growth factors secretion, to enhance the therapeutic

capacity/potential of MSC-CM. A variety of different factors were used, in the


9

literature, to change the microenvironment or induce an in vitro preconditioning of

MSCs, which included: 3D culture (68-70), hypoxia (71), biochemical stimuli

(including cytokines, growth factors, hormones, and pharmacological agents),

mechanical stimuli (23, 72), electrical stimuli (73), and photobiomodulation (74, 75).

Using 3D culture is a more complete modeling of MSC natural microenvironment,

allowing to retain MSC proliferation and differentiation potential for longer time (22).

The microenvironment established within the spheroids acts in an autocrine fashion

favoring an enhanced secretion of paracrine factors (76). The composition of the

resulting CM is significantly different from that obtained with 2D microenvironments

(70, 77). A 3D cell culture is a typical example of microgravity application (78), that

significantly increases the anti-apoptotic and anti-inflammatory effects of MSC-CM

(79). Changing the microenvironment in vitro can be produced also via MSC

preconditioning. There are different strategies for MSCs preconditioning to stimulate

growth factor secretion into their culture CM. Application of stress factors, such as

serum deprivation or hypoxic conditions has been widely used for this purpose, to

stimulate stress environment found in damage conditions in the in vivo situation. MSC

stimulation with hypoxia triggers an increase of growth factors secretion with enhanced

paracrine activity (80, 81). Other factors, treatment with pharmacological molecules or

cytokines, induction of thermal shock have been also applied (64). For example, bFGF

and selenium combination in MSCs improves the therapeutic effects of MSC-derived

CM (82). MSC differentiation affects the secretome profile of MSCs (83). MSC

exposure to mechanical stimuli is another strategy to influence MSC behavior and their

secretome profile. MSC secretomes respond to the mechanical properties of their

substrate, including stiffness (84). Surface topographies can change the shape of

stromal cells and influence quantitatively their cytokine secretion profile. However,

qualitative stromal cell secretory characteristics are preserved irrespective of

microenvironmental surface factors (85). CO2 laser enhanced secretion of pro-

angiogenic molecules and increased the regenerative capacity of MSCs (86).

Interestingly, the cell-conditioned medium of an extrinsic microenvironment can

modify the age-related properties of tissue-specific stem cells (87).

Each preconditioning regimen induces an individual expression profile with a wide

variety of factors, including several growth factors and cytokines (88). Further studies

are required to evaluate the best preconditioning regimen for each specific application

of MSC-CM in human regenerative medicine.


10

1.2.3.7. Secretome-derived products purification

MSC-CM or secretome is primarily prepared by centrifuging the expended medium of

MSCs. The resulting product can be used directly, or by adding concentration,

fractionation, and/or filtration steps. The preparation procedure of secretome products

derived from MSC culture supernatant differs between studies. It consists of one or a

combination of these steps. The centrifugation is essential to remove apoptotic and

detached cells, waste tissue material, and cell debris from the supernatant. The

centrifugal speed and time are very different between studies. Ultrafiltration technology

allows the choice of filtration modules with different molecular weight cut-off

(MWCO), and thus retention of only parts or the whole secretome (18). Centrifugal

ultra-filter units that have a MWCO of <3 KD are used to retain and concentrate the

whole CM (89, 90). MSC-CM were used concentrated in some studies (91, 92) and

diluted in others (64, 93, 94), possibly due to the achievement of the optimum balance

between metabolic inhibitory by-products and paracrine stimulatory products (64, 95).

Other pore sizes centrifugal ultra-filter units are used when just a fraction of the CM

needs to be retained. By fractionating CM, it is possible to correlate a particular

molecular subset or CM fractions with a specific measured effect (23). Many studies

have linked certain paracrine effects of CM to specific molecular size fractions. For

example, CM containing products >1000 kDa provide cardio-protection in a mouse

model of ischemia and reperfusion injury (91). Proteins fractions with the molecular

weight in the range of 10kDa-3kDa were the only fraction that could protect neurons

against induced neurodegeneration, suggesting that these micro proteins could be

responsible for the neuroprotection of DPSC-CM (96). Among four fractions of SHED-

CM, the only fraction of <6 kDa promoted the neurite outgrowth of dorsal root ganglion

neurons (97). Finally, filtration is usually done with a 0.2 μm pore-size filters, to remove

debris from CM and/or for sterility.

Extracellular vesicles (EVs) represent an important fraction of cell secretome (98),

containing cellular proteins, deoxyribonucleic acid (DNAs), ribonucleic acid (RNAs)

exosomes and microvesicles (MVs). These EVs are heterogeneous, membranous, cell-

derived vesicles with approximately 40 to 5,000 nm in diameter that are released by a

variety of cells into their microenvironment (99). Some confusion still exists in the

literature regarding the distinction between exosomes and MVs. The difference

between these two terms is based on the vesicle size (100): exosomes are within 100


11

nm (30 – 100 nm), while microvesicles range from 100–1000 nm, but these definitions

are flexible as this is still quite a novel research field (101).

The quali/quantitative composition, and thus the biological activity of MSC-derived

products is strongly influenced by the isolation method chosen (complete CM, soluble

factors, exosomes, or MVs). The isolation of EVs is a challenging procedure. Several

methods were introduced and utilized for isolation and purification of Evs: differential

centrifugation/ultracentrifugation with or without sucrose gradient cushion, polymeric

precipitation isolation, size exclusion chromatography, immunoaffinity isolation,

ultrafiltration and microfiltration technologies, microfluidic devices, and exosome

isolation reagents (99, 102). The most widely applied method for concentrating and

purifying EVs is isolation by differential centrifugation/ultracentrifugation. It consists

of several centrifugations, that sequentially increase in speed and time, and thus,

sequentially pellet smaller particles (103). Ultracentrifugation remains the most

commonly used isolation method (81%) (104), even if some authors reported some

limitations (105-107). Differential centrifugation/ultracentrifugation only sees recovery

rates of up to 25% (108). There is also evidence that the high forces involved

(typically100,000g) can affect the bioactivity of the EVs themselves (109). Indeed, each

of these isolation methods has advantages and limitations. None of them can offer a

high recovery together with high specificity (17, 110); wherefore, 59% of respondents

use a combination of methods (104) to achieve a higher quality of EVs. They can be

filter-sterilized at the end of the isolation process (20). (20). Data available in the

literature tend to state that secretome (or EVs) sterilization is possible by filtration,

without, apparent loss of efficacy (99). Figure 1.2 summarizes the different protocols

and techniques followed in the literature to obtain the secretome-derived products used

for their regenerative potentials.

EVs have been studied widely last years and are described as key regulators of the stem

cell paracrine activity (110). Subsequently, many studies have been made to identify

whether MSC-CM functions are mainly associated or not with EVs enriched fractions.

Kumar et al. demonstrated that MSC-CM mediates cardioprotection during myocardial

ischemia/reperfusion injury through the exosomes (111). MVs contribute along with

soluble factors to the regenerative effect of MSCs in a study conducted by Ahmed et

al. (112). In contrast, Walter et al. showed that the major paracrine angiogenic effect

of MSCs is associated with their soluble factors and not with their Evs (113). Further

studies should be conducted to confirm the benefits of MSC secretome fractionation


12

and determine which fraction of MSC-CM is most effective for each regenerative

application, especially since the isolation and characterization of EVs are costly and

time-consuming, which impairs their use in clinical practice (110).

Figure 1.2: The different techniques (in blue) and protocols (dotted arrows) followed in

the literature to obtain the secretome-derived products (in pink) used for their

regenerative potential.

1.2.3.8. Other manufacturing conditions

In addition to all the above-mentioned points, the development of a reproducible,

scalable, and well-controlled platform is an important key factor towards the

standardization of production of MSC-CM and their derivatives. Adherent cell

expansion has traditionally been performed on planar surfaces such as well-plates and

tissue culture flasks for simplicity and easy handling when large numbers of cells are

not required. For larger-scale expansion, transitioning from planar-based culture to

microcarrier-based systems not only allows for higher density culture (thus reducing

the cost of goods) but also for more stringent culture control and monitoring (114).

They avoid also the high risk of contamination due to manual interventions of the

manual process. Bioreactors improve the predictability in the composition and function

of secretome derived products. Suspension bioreactors offer a higher level of


13

homogeneity and process control which serve to reduce both batch-to-batch and within-

batch variability of cell cultures. Furthermore, bioreactors are used sometimes to

provide a specific physiological in vitro environment (115). Stirred suspension

bioreactors are highly scalable and several variables such as dissolved oxygen, pH, and

temperature can be computer-controlled to provide a high level of process control,

resulting in more uniform product batches (23).

In addition to manufacturing conditions, storage and transport of MSC secretome-

derived products should be considered as they play an important role in maintaining

characteristics and functions. It is important to consider the effects of freeze-thaw,

stability at various temperatures, and the effects of freeze-drying components (23).

Cells cultured with CM stored at 4°C before use maintained their viability. The longer

the storage time, the cell death increases. The conservation of CM for more than 2

months decreases their properties that keep the cells viable. This may be due to the

degeneration of hormones and growth factors in CM, or a concentration of these factors

that is too low for long-term preservation of the target cells (116). CM can reportedly

be stored at -20°C for several months without experiencing functional deterioration

(117). A study on urinary exosomes showed that freezing at −20°C resulted in major

losses, freezing at −80°C enabled almost complete recovery after up to 7 months of

storage. Further, protease inhibitors are essential for proper preservation and extensive

vortexing (i.e., 90 seconds) enabled maximum recovery of thawed exosome samples

(118). Lyophilization is used to guarantee the long-term stability and easy storage and

reconstitution of products. This process generates a variety of freezing and drying

stresses that can alter the stability of the biological samples (18).

1.2.4. Toward the standardization of MSC-CM manufacturing

Secretome characterization is required to confirm the reproducibility of MSC-CM

manufacturing method and in view of regulatory requirements concerning quality,

safety, and efficacy. The tools mostly used for studying the expression of MSC

secretome in vitro include protein/peptide separation techniques followed by protein

identification by mass spectrometry and immunological assays (119). The

characterization of the MSC-CM using antibody-based techniques such as Elisa and

antibody arrays provides only a narrow window of factors secreted by MSC. Global

proteomic approaches would better clarify the potential complexity of MSCs


14

secretome, with the ultimate aim of obtaining clear and defined MSC-CM profiles for

appropriate use of each MSC-CM according to its profile. However, all these

techniques can play an essential role in the standardization of the production of MSC-

CM which are hampered by the different variations previously discussed.

1.3. Dental mesenchymal stem cell (DMSCs)

1.3.1. Generalities

Dental mesenchymal stem cells (DMSCs) have drawn worldwide attention for future

therapies due to their both technical and practical superiorities over other types of MSCs

(120). Since 2000 when Gronthos et al. identified and isolated odontogenic progenitor

population in adult dental pulp (121), the data collected so far have shown that dental

tissue is an abundant source of several types of MSCs: Dental pulp stem cells (DPSCs),

stem cells from human exfoliated deciduous teeth (SHEDs), periodontal ligament stem

cells (PDLSCs), stem cells from apical papilla (SCAPs) which are located at the tips of

growing tooth roots (122), and dental follicle progenitor cells (DFPCs) surrounding the

tooth germ, which are responsible for cementum, periodontal ligament, and alveolar

bone formation in tooth development (123).

Figures 1.3 and 1.4 showed the different components of the molar tooth and the dental

tissues from which different populations of dental MSCs can be isolated respectively.

These dental MSCs possess many in vitro features of bone marrow-derived MSCs,

including clonogenicity, expression of certain markers, and following stimulation,

differentiation into cells that have the characteristics of osteoblasts, chondrocytes, and

adipocytes (124).

One advantage of this source of MSCs is the absence of morbidity and the fact that it

does not require additional surgical procedures (125). DMSCs are isolated from

exfoliated teeth, teeth extracted for orthodontically or any other reasons, and

supernumerary teeth. Though usually discarded as medical waste, teeth could serve as

an excellent source of mesenchymal stem cells.


15

Figure 1.3: The different components of the molar tooth.

Figure 1.4: The dental tissues from which different populations of dental MSCs can be

isolated.

1.3.2. Dental mesenchymal stem cell-conditioned medium (DMSC-CM)

1.3.2.1. DMSC-CM for tissue regeneration

Many articles have reviewed the application of dental mesenchymal stem cell-

conditioned medium (DMSC-CM) for the treatment of different diseases and tissue

regeneration (8, 126-128). Studies indicate that dental MSC-CM could repair


16

neurological disorders (129-134), cardiac injuries (135), diabetes (136), Hepatic

diseases (137, 138), lung injuries (139), immune disorders (140-142), bone and dental

tissue defects (143-146), and hair growth (147). These potentialities are attributed to

the cytoprotective/proliferative/migrative, apoptotic, angiogenic, osteogenic,

neurogenic, odontogenic, and immunomodulatory effects of DMSC secretome (table

1.1).

CM potentials References

Neurogenesis (66), (11), (70), (32), (16), (43) , (71), (9), (59), (10), (60), (42), (72), (73), (74), (75), (76), (77), (78)

Neuroprotection (66), (11), (70), (13), (67), (79), (42), (78) Angiogenesis (17), (32), (43) , (49), (67), (47), (80), (34), (42), (50), (30), (54), (73), (75), (81), (148), (149) Osteogenesis (48), (31), (41), (82), (77)

Anti-apoptosis (58), (83), (17), (40), (39), (16), (20), (28), (60), (38), (84), (73), (75), (85) Cytoprotection (32), (24), (59), (14), (44), (37), (86)

Cell proliferation (83), (40), (23), (80), (28), (42), (87), (84), (73), (85), (88), (89), (88), (81) Cell migration (58), (12), (83), (17), (40), (71), (59), (47), (80), (34), (28), (60), (44), (42), (50), (37), (87), (73),

(75), (77), (88), (90), (88) Odontogenesis (48), (49), (37), (29), (77), (91), (92), (93), (89), (94), (95), (96), (97), (98), (99), (100), (101), (102)

Immunomodulation (58), (59), (60), (103), (73), (74), (104), (76), (105), (22), (65), (43 ) , (67), (25), (21), (79), (20), (45),

(46), (61), (106), (37) Table 1.1: Summary of CM potentials in studies using DMSC secretome for tissue

regeneration.

1.3.2.2. DMSC-CM versus CM derived from other MSCs

Compared to non-dental MSC-CM, DMSC-CM contain higher levels of metabolic,

transcriptional, and proliferation-related proteins, chemokines, and neurotrophins, but

lower levels of proteins responsible for adhesion and extracellular matrix production

(126). DMSC-CM showed higher effects and demonstrated superior potentials in

differentiation, maturation, and regeneration (126). In a study conducted by Kumar et

al., comparing the neural potential of DMSC-CM obtained from three sources (DPSCs,

DFSCs, and SCAP) with BMSC-CM. Results showed that BMSC-CM induced the

minimum neurite extension in neural cells (150).

DPSC-CM were almost compared to BMSC-CM and ASC-CM in the literature. The

fraction of small particles with a molecular weight ranging between 30 and100 nm is

larger in DPSC-CM, while BM-MSC secrete a higher percentage of intermediate

particles (100–300 nm) (113). DPSC-CM appear to be more potent in neuroprotection

(96, 129, 151), neurogenesis (150, 152), migration (153), and angiogenesis (152, 153)

than BMSC-CM and ADCS-CM. Moreover, DPSC-CM are more anti-apoptotic than

BMSC-CM and ADSC-CM (96, 153) and more anti-necrotic than BMSC-CM (96).


17

However, DPSC-CM are less potent concerning endothelial cell chemotaxis and in ovo

neovascularization, compared to BM-MSCs (113). Despite the overall similar profiles

of UMSC-CM and DPSC-CM, some growth factors dominate in UMSC secretions,

while others are more secreted by DPSCs (154).

Important factors are abundant in SHED but barely detectable in ASCs (83). SHED-

CM are more anti-apoptotic (135) and anti-inflammatory (135, 155) comparing to

ADSC-CM and BMSC-CM. They are more effective than BMSC-CM for arthritis

(142) and diabetes (136) treatments and neuroprotection (156) and -reparation (134).

Comparing to BMSCs, SCAPs appear to exhibit increased secretion of proteins that are

involved in metabolic processes and transcription, but lower levels of those associated

with biological adhesion, developmental processes, and immune function. Besides,

SCAPs secreted significantly larger amounts of chemokines and neurotrophins than

BMSCs, whereas BMSCs secreted more ECM proteins and proangiogenic factors

(157).

1.3.2.3. Comparison of CM derived from the various types of DMSCs

In the literature, most studies investigate secretome effects of DPSC and SHED

consecutively. PDLSC, SCAF, and DFSC secretomes were less studied.

Although DPSCs, SHEDs, PDLSC, SCAPs, and DFPCs are all derived from tooth

related structures, the specific properties of these different dental stem cell populations

such as expression markers and differentiation potencies are slightly different according

to the location from which they are isolated (158). Their secretome may be different as

well. Although DMSC-CMs were all more effective, a significant difference was

observed between the three dental CM, based on both in vitro effects and secretome

profiles. Neurite lengths were highest in neural cells treated with DPSC-CM compared

to DFSC-CM and SCAP-CM, with different levels of measured neurotrophins and

cytokines in each of the three secretomes (150). However, a study made by Kolar et al.

comparing the neural potential of DPSC-CM, SCAP-CM, and PDLSC-CM of the same

donor showed higher neuroprotective effects of SCAP-CM. The quantification of some

secreted protein revealed similar levels in DPSC-CM and SCAP-CM compared to

PDLSC-CM (159). SHED-CM and DPSC-CM promoted the neurite extension of

neural cells indifferently (160).


18

1.3.2.4. DMSC-CM manufacturing in the literature

In the literature, most studies have investigated the secretome effects of DPSCs and

SHEDs consecutively. PDLSC, SCAF, and DFSC secretomes were less studied. The

majority of these studies characterized DMSCs to confirm their stem cell properties.

Before starting experiments, the expressions of MSC markers (i.e., CD90, CD73,

CD29, CD44 and CD105), but not endothelial/hematopoietic markers (i.e., CD34,

CD45, CD11b/c, CD31 and CD144 and HLA-DR) on DMSCs were verified, and/or

cells were approved to exhibit adipogenic, chondrogenic, and osteogenic differentiation

as well. In some other studies, they do not approve the stemness character of cells, or

they referred that to other references; whilst few of them do not even attribute this

character for dental cells (81, 161-165). Conditioned medium of tooth germ cells,

containing both epithelial and mesenchymal cells, and investigated for their

odontogenic potential in some studies, or used to induce the odontogenic differentiation

of other cells (166-173) were included also in this review.

The age range of DPSC donors in most of DMSC-CM studies was going from 14 to 30

years old. Three studies make an exception with donors between the ages of 21 and 36,

41 and 45 respectively (174-176); Difference of age was not duly noted, but DMSC-

CM generally demonstrated good results. The number of donors, their gender, and their

health status were mostly not indicated. Teeth are mainly extracted from several donors;

nevertheless, inter-donor’s variability was rarely taken into consideration. Although

third molars, erupted or impacted, were the major source of DPSCs, premolars, canine

and incisors were also used for isolation. PDLSCs, SCAPs, and DFSCs were mostly

isolated form molars and premolars. Intra-donor (different teeth form the same donor),

as well as the developmental stage of teeth, were taken into account just in few studies,

and the clinical status of teeth (carious or not) was not always indicated. While teeth

were almost extracted from humans, rats, dogs, and pigs have been used for extraction

in a few articles (Table A1 of Appendix A).

DMEM medium was the mainly used in DMSC-CM processing, indifferently of the

therapeutic application: treatment of diabetes (136), lung (139) or liver (138) injuries,

cerebral ischemia (177), cardiac injury (135), bone (143)/dental (178) and nerve

regeneration (179). In most of the studies, no serum was added to the medium during

processing, and no PBS washing step was done before conditioning start (Table A2 of

Appendix A).


19

Cell populations were selected before investigating DMSC-CM in some studies. CD31-

side population was used in two studies (152, 153). This population from the dental

pulp was enriched in stem/progenitor cells and significantly stimulated angiogenesis/

vasculogenesis (180). G-CSF-induced stem cell mobilization method for stem cell

isolation was used in many studies (40, 178, 179, 181-183). This technique generated

a stable and age-independent, mobilized subpopulation of dental pulp stem cells, with

high proliferation, migration, and regeneration potential. Finally, De Rosa et al.

selected DPSCs which are CD117, CD34, STRO-1, CD44, OC, and RUNX-2 positive,

to investigate the potential of osteodifferentiated DPSC secretome (176) (Table A3 of

Appendix A).

Proteins fractions with the molecular weight in the range of 10kDa-3kDa were the only

fraction that could protect neurons against induced neurodegeneration, suggesting that

these micro proteins could be responsible for the neuroprotection of DPSC-CM (96).

Among four fractions of SHED-CM, the only fraction of <6 kDa promoted the neurite

outgrowth of dorsal root ganglion neurons (97). Finally, filtration is usually done with

a 0.2 μm pore-size filters, to ensure sterility. DMSC-CM were used concentrated in

some studies. In some others, they were used at 50% dilution (64, 150, 184, 185). 50%

of DMSC-CM have been proposed as the most effective concentration in few studies

(64), possibly due to the achievement of the optimum balance between metabolic

inhibitory by-products and paracrine stimulatory products (64, 95) (Table A4 of

Appendix A).

Many studies have made to identify whether DMSC-CM functions are mainly

associated or not with EVs enriched fractions of CM (Table A5 of Appendix A).

Merckx et al. showed that the major paracrine angiogenic effect of DPSCs by secreted

growth factors was not associated with EVs (113). Whilst the proangiogenic effects of

DPSC-CM were compromised when endothelial cells were incubated in CM, wherein

the EV secretion was blocked according to a study conducted by Zhou et al. (175).

Neuroprotective efficacy of DPSC-exosomes has been as efficient as DPSC-CM (96),

but they demonstrated superior anti-necrotic properties (96) and were involved in aging

processes (186). SHED-exosomes, but not micro-vesicles derived from SHEDs,

approved anti-apoptotic effects in dopaminergic neurons (132). Whereas, they were not

responsible for the neuritogenesis potential of SHED-CM exosomes (97).

In most of the studies, DMSC-CM were stored at -80°C. Secretomes have been kept at

-20°C in three studies (187-189) and showed effective actions when used. In two studies


20

(190, 191), CM were kept at +4°C until the following experiments. Protease inhibitors

were added to secretomes just in few studies (129, 132, 153, 178) (Table A6 of Appendix

A).

Five different techniques were used in articles to characterize DMSC-CM. Bradford

and BCA protein assays, ELISA, antibody array, multiplex immunoassay, and liquid

chromatography with tandem mass spectrometry (LC-MS-MS). Bradford and BCA

protein assays were used to measure the protein concentration in the secretome.

Whereas, ELISA, antibody array, and multiplex immunoassay were used to identify

CMs qualitatively and quantitatively. With technology development, proteomics had

become a powerful identification tool, and mass spectrometry appeared to be the major

applied technique for proteins detection of cell secretomes (192). Tachida et al. have

already identified the secreted profile of DPSC-CM by mass spectrometry with higher

protein coverage (193). To prepare their CM, they have kept DPSC, isolated from rat

incisors, at 80-90% of confluency for 72h in serum-free alpha-MEM, after 3 times

washing with PBS. Then, they filtered with a 0.2 µm filter and concentrated 50 times

with 3 KDa MWCO centrifugal units (193). However, this protocol was not always the

one used in all DMSC-CM studies (as shown in this review). Therefore, this CM profile

cannot represent all DPSC-CM in general. Direct comparison of protein profiles and

concentrations between studies is impeded by variations in all the factors previously

detailed, and standardized production might be crucial for clear profiles of DMSC-CM

and appropriate utilization of each according to its profile (Table A7 of Appendix A).

1.4. Objectives

In this thesis, we focus on dental pulp stem cell-conditioned medium with the ultimate

goal of identifying GMP manufacturing conditions and developing standardized and

optimized strategies to provide the more factor-rich and most potent DPSC-CM for

each specific application in the field of human regenerative medicine. To achieve this

goal, numerous objectives were defined, as described:

Chapter 3

• Evaluation of the impact of several manufacturing features as cell donors, cell

passage number, cell confluency, culture medium, and conditioning period on

human DPSC secretome.


21

Chapter 4

• Evaluation of the impact of some microenvironment cues on the profile and/or

efficiency of human DPSC-CM: the effect of laser therapy and three-

dimensional culture of DPSCs on DPSC secretomes.

Chapter 5

• Investigation of the neuroregenerative potentials of DPSC-CM

• Assessment of the impact of cell conditioning duration, CM storage, and

preconditioning of DPSCs with some factors on CM functional activity on

neurite length.

• Definition of an optimization strategy of DPSC-CM production for enhanced

neuronal outgrowth.

Chapter 6

• Evaluation of the use of MG63 as a model to study the phenotypic development

of osteoblasts and the mineralization of bone matrix.

• Identification of factors necessary to achieve an optimal osteodifferentiation of

osteoblasts in vitro.

• Investigation of human DPSC-CM potentials for MG63 and OB proliferation,

and for osteodifferentiation in vitro and in vivo.

Chapter 7

• Investigation of human DPSC-CM potentials for angiogenesis, through rat aorta

ring assay.

Chapter 8

• Investigation of human DPSC-CM effects on cancer growth.

22

CHAPTER 2: MATERIALS AND METHODS

Chapter 2: Material and methods

23

2.1. Materials

• Minimum essential medium, GlutaMAX™ supplement (MEM α; 32561-029;

Gibco)

• Collagenase, type I, powder (17018029; Gibco)

• Dispase type II, powder (17105041 ; Gibco)

• Penicillin-Streptomycin (PS; 15070-063; Gibco )

• Fetal bovine serum (FBS; F7524; Sigma )

• Recombinant Human FGF basic 146 aa Protein (233-FB-025; R&D System)

• Antibodies CD90, CD146, CD117, and CD45 (Miltenyi Biotec)

• Collagenase A (10103578001 ; Roche)

• Trypsine-EDTA 0,05 % phenol red (25300062; Gibco)

• Trypsin-EDTA solution 0.25% (T4049; Sigma-Aldrich)

• DNase (50 U/mL ; Sigma-Aldrich)

• Poly-L-ornithine hydrobromide (P3655; Sigma-Aldrich)

• Laminin from Engelbreth-Holm-Swarm murine sarcoma basement membrane

(L2020; Sigma-Aldrich)

• Recombinant Human β-NGF (450-01; Peprotech)

• Recombinant Human/Murine/Rat BDNF (450-02; Peprotech)

• Recombinant Human NT-3 (450-03; Peprotech)

• Dexamethasone (D4902; Sigma-Aldrich)

• Glycerol phosphate calcium salt (G6626; Sigma-Aldrich)

• L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (A8960; Sigma-

Aldrich)

• Dulbecco's Modified Eagle Medium, GlutaMAX™ Supplement (DMEM;

61965-026; Gibco)

• Dimethyl sulfoxide (DMSO; D4540; Sigma-Aldrich)

• HyClone™ Dulbecco's Phosphate Buffered Saline (PBS; SH30028.01; Cytiva)

• Neurobasal medium (21103049; Gibco)

• L-Glutamine solution (G7513; Sigma-Aldrich)

• Supplement B-27™ 50X, serum free (17504044; Gibco)

• Red- Color™ AP Staining Kit (AP100 R-1; System Biosciences)


24

• Opti-MEM Reduced-Serum Medium, GlutaMAX™ Supplement (51985-026;

Gibco)

• Rat monoclonalβ-tubulin III primary antibodies (ab6160, Abcam)

• Donkey anti-rat Alexa 488 secondary antibodies (ab150153, Abcam)

• Donkey serum (GTX73205; GeneTex)

• 4,6-Diamidino-2-Phenylindole, Dilactate (DAPI; Sigma-Aldrich)

• Fluoromount-G™ eBioscience™, with DAPI (00-4959-52; Invitrogen)

• Triton X-100 (T8787; Sigma-Aldrich)

• Paraformaldehyde (PFA; P6148; Sigma-Aldrich)

• Bovine Serum Albumin (BSA; A2153; Sigma-Aldrich)

• Rabbit collagen primary antibodies (1:500, ab34710, abcam)

• Mouse osteocalcin primary antibodies (1 µg/mL, ab13420, abcam)

• Goat anti-rabbit Alexa 594 secondary antibodies (1:500, ab150080, abcam)

• Goat anti-mouse FITC secondary antibodies (1:500, ab97239, abcam)

• Lectin from Bandeiraea simplicifolia (lectin-FITC; L9381; Sigma-Aldrich)

• Thiazolyl Blue Tetrazolium Bromide (M2128; Sigma-Aldrich)

• p-Nitrophenyl Phosphate Liquid Substrate System (pNPP solution; N7653;

Sigma-Aldrich)

• Alcool éthylique PharmEthyl 99 (Ethanol 99%; API)

• Alizarin Red S (A5533; Sigma-Aldrich)

• Cetylpyridinium chloride (C0732; Sigma-Aldrich)

• NucleoSpin® RNA Plus kit (740984.50; Macherey-Nagel)

• RevertAid First Strand cDNA Synthesis kit (K1622; ThermoFischer

Scientific)

• SensiFAST™ Syber No-Rox mix (BIO-98005; Bioline)

• Primers (eurofins Genomics)

• Ketamine (Alcyon)

• Xylazine (Alcyon)

• Centrifugal filter device Centriprep® 3 kD (4302; Millipore)

• Fibrinogen from bovine plasma (F8630; Sigma-Aldrich)

• Thrombin from bovine plasma (T7513; Sigma-Aldrich)

• Decalcifier Shandon™ TBD-2™ (6764004; ThermoFischer Scientific)


25

• Collagen, Type I solution from rat tail (C3867; Sigma-Aldrich)

• Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12, GlutaMAX

supplement (DMEM: F12; 21331-020; Gibco)

• Sodium hydroxyde 8 mol/l (NaOH; 1310-73-2; Fluka)

• Transwell inserts consisting of polyethylene terephthalate PET membrane

(0.4µm pore size; BD Falcon)

• Pierce® BCA protein Assay Kit (23225; ThermoFischer Scientific)

• Human Growth Factor Antibody Array (40 Targets) – Quantitative (ab197445;

Abcam)

• CelLytic™ M (C2978; Sigma-Aldrich)

• Agilent Protein 230 Kit (5067-1517 ; Agilent)

• Phosphate-buffered saline 10 X Solution (PBS; catalog number: ET330;

Euromedex)

2.2. Methods

2.2.1. Cell isolation, culture, and characterization

2.2.1.1. Human dental pulp stem cells

DPSCs were isolated from human wisdom teeth extracted for orthodontic reasons from

young healthy patients (15 to 23 years of age). Informed consents were obtained from

the patients after receiving approval by the local ethics committee (Comité de

protection des Personnes, Centre Hospitalier de Montpellier – Autorisation number :

DC-2017-2907). We used a previously described protocol to recover pulp cells (194,

195). Briefly, after disinfection, teeth were cut along the cementum–enamel junction

using a diamond disc and were broken in two pieces. Pulps were then recovered and

incubated for 1 hour in a collagenase-dispase solution (3 mg/mL collagenase and 4

mg/mL dispase). Digested pulps were filtered, centrifugated, and recovered cells were

incubated in α-MEM, with 1% Penicillin-Streptomycin (PS), 10% fetal bovine serum

(FBS), and 0.02% Recombinant Human FGF basic, in 75 cm2 flasks, at 37°C and 5%

CO2. The medium was changed after 24 hours and then changed twice a week. DPSCs

used for all experiments were between passages 1 and 5.


26

To characterize DPSCs, subconfluent cells were collected and analyzed for minimal

criteria to define human mesenchymal stem cells, such as adherence to plastic,

expression of cell surface antigens, and the ability to differentiate into another lineage

in vitro (196). The antigen profiles of cultured DPSCs were analyzed by detecting the

expression of the cell surface markers CD90, CD146, CD117, and CD45 using flow

cytometry. To assess their differentiation potential, DPSCs were cultured in osteogenic

medium (OM) for three weeks. Then, Alizarin red staining was performed to quantify

calcium deposits in order to assess cell osteodifferentiation.

2.2.1.2. MSCs derived from bone marrow (BMSCs) and adipose tissue (ASCs)

Human mesenchymal stem cells derived from human bone marrow (passage 2) and

adipose tissue (passage 1) were offered from the Institute for Regenerative Medicine &

Biotherapy (IRMB), Montpellier. Both cells were grown in MEM-alpha medium,

supplemented with 10% FBS, 1% PS, and 0.2% bFGF. Medium was changed 2 times

per week. Cells were used at passage 4.

2.2.1.3. Primary sensory neurons

All animal protocols were approved by the national ethics committee and all procedures

were performed following relevant institutional guidelines and regulations. Adult Swiss

mice (6 to 10-week-old, CERJ, Le Genest St Isle, France) were sacrificed by CO2

inhalation followed by cervical dislocation, and their dorsal root ganglions (DRG) were

then removed. Ganglia were successively treated by two incubations with collagenase

A (1 mg/mL) for 45 min each (37°C) and then with trypsin-EDTA (0.25%) for 30 min.

A mechanical dissociation was performed in a neurobasal medium supplemented with

10% FBS and DNase (50 U/mL). Isolated cells were collected then by centrifugation

and suspended in neurobasal supplemented with 2% B-27, 1% glutamine, 1% PS.

2.2.1.4. Human primary osteoblasts

Human primary osteoblasts were isolated from bone fragments obtained after the

extraction of molar teeth fused to the bone. Informed consent was obtained from the

patients after receiving approval by the local ethics committee (Comité de protection

des Personnes, Centre Hospitalier de Montpellier – Autorisation number : DC-2017-

2907). Bone fragments were rinsed twice with phosphate-buffered saline (PBS)


27

enriched with PS, cut into small pieces, and incubated successively for 10 minutes and

two hours in a collagenase-dispase solution (3 mg/mL collagenase and 4 mg/mL

dispase), PS (2%) at 37 °C. After the second incubation, the bone fragments and

released cells collected by centrifugation were suspended in a growth medium (DMEM,

10% FBS, 1% PS). The culture medium was changed twice a week until cells reached

70% confluence. The osteoblasts were used for experiments at the passage (2-4).

To confirm their identity, osteoblasts were incubated in a growth medium overnight to

allow cells to adhere, then colored with Red-Color Alkaline phosphatase Staining Kit.

The expression of phosphatase alkaline (ALP) has been mapped during the progressive

development of osteoblasts throughout 18 days of culture in OM or basal growth

medium. Calcium secretion was also examined after 21 days of culture with or without

osteogenic induction.

2.2.1.5. Osteoblast-like MG-63

Osteoblast-like MG-63 cells were obtained from the European Collection of Cell

Cultures (Gyorgyey et al. 2013). The frozen ampoule was transferred to a 37 °C water

bath for 1– 2 min. The contents of the ampoule were added to the growth medium

composed of DMEM medium, 10% FBS, 1% PS. The culture medium was changed

after cell attachment, and then twice a week until cells reached 70% confluence.

2.2.1.6. MCF7 and resistant MCF7

The MCF7 (ATCC-HTB22) derived from a metastatic breast cancer patient, is a

standard cell line model to use for cancer research (197). Paclitaxel-resistant subline

(MCF7TAX19) (offered from IRCM, Montpellier) was previously established (198) after

culturing the parental MCF7 cells in increasing paclitaxel concentrations and then

maintained in a paclitaxel-free medium. MCF7 and MCF7TAX19 were both grown in

DMEM media, containing 10% FBS and 1% PS. Accordingly, in DPSC-cancer cell co-

culture assays, the medium was changed gradually in two steps that, subsequently, the

cells were cultivated in αMEM.

2.2.1.7. Fibroblasts

Healthy human gingival tissue was obtained from patients undergoing extraction.

Informed consents were obtained from the patients after receiving approval by the local


28

ethics committee (Comité de protection des Personnes, Centre Hospitalier de

Montpellier – Autorisation number : DC-2017-2907). Briefly, the tissue was rinsed and

fragmented mechanically. Tissue fragments and fibroblast cells collected by

centrifugation were suspended in a growth medium (DMEM, 10% FBS, 1% PS) in 75

cm2 flasks, at 37°C and 5% CO2. The culture medium was changed twice a week until

cells reached 70% confluence.

2.2.2. Cell freezing

For cryopreservation of cells, a freezing medium containing 10% dimethyl sulphoxide

(DMSO) in FBS was used. DMSO prevents intracellular and extracellular crystals from

forming in cells during the freezing process.

After cell trypsinization and counting, cells were centrifuged at 946 rpm for 5 minutes

and suspended in a freezing medium to obtain 1 million cells per mL. Then, 1mL

aliquots of cells were distributed into 2 mL cryotubes, which were placed in freezing

container Mr. Frosty (ThermoFischer Scientific) at -80°C for 3 days maximum. This

system is designed to achieve a cooling rate very close to -1°C/minute, the optimal

speed for cell preservation. Next, cryotubes with frozen cells were stored in liquid

nitrogen.

2.2.3. Cell reconstitution

Cryotube with frozen cells was taken out of the nitrogen and thawed quickly by shaking

it in the water bath set at 37°C. After cleaning with 70% ethanol, the cryotube was

transferred into a sterile laminar flow, and cells were transferred into a 50 mL tube

containing 10 mL pre-warmed growth medium. Then, cells were centrifuged at 946

rpm for 5 minutes and re-suspended in a fresh and complete culture medium. After

manual counting, cells were plated into a T75 cell culture flask. Cell density differs

according to each cell type.


29

2.2.4. Osteogenic medium (OM)

To induce in vitro osteogenesis of cells in all experiments, a combination of factors

(Table 2.1) was added to the complete cell growth medium (basal culture medium, 10%

FBS, and 1% SP), thus constituting the osteogenic medium (OM).

Factors Concentration

Dexamethasone 10-8 M

ß-glycerophosphate 5 mM

L-Ascorbic acid 2-phosphate 50 µg/mL

Table 2.1: The combination of factors used to induce the in vitro osteogenesis in all

experiments.

2.2.5. Preparation of CM

2.2.5.1. CM from MSCs in 2D culture

When DPSCs, BMSCs, and ASCs reached 80% - 90% confluence (approximately 2

million cells per 75 cm2 flask), PBS washes were carried out and the medium was

replaced with 10 mL of serum-free medium (the medium changes according to the type

of cells or tissue used in each experiment),1% PS. 48 hours later, the medium was

collected by centrifugation for 5 min at 1,500 rpm and was centrifuged again for 3 min

at 3,000 rpm to remove cell debris. The CM was used fresh or stored at -20°C until use.

Here are some details about the preparation of DPSC-CM, depending on the type of

cells or tissue:

• Neurons

Neurobasal serum-free medium was used for CM preparation. To optimize DPSC-CM,

1% glutamine (200 mM) and 2% B-27 (serum-free) were added to the neurobasal

medium, after PBS washing step. Neurobasal medium without cell conditioning was

used as a negative control in the experiments.

• Osteoblastic cells

DMEM serum-free medium was used for CM preparation. For all in vitro experiments,

10% FBS and the combination of supplements that constitute the OM (Table 2.1) were


30

added to DPSC-CM. The roles of these supplements on osteoblastic cell proliferation,

and bone matrix maturation and mineralization were assessed before starting

experiments. OM was used as a control.

• Aorta rings

Opti-MEM serum-free was used for CM preparation. Opti-MEM medium without cell

conditioning was used as a negative control in the experiments.

• Cancer cells

DMEM serum-free medium was used for CM preparation, and DMEM without cell

conditioning was used as a negative control in the experiments.

2.2.5.2. CM from DPSCs irradiated with laser

CM was prepared following the same procedure described above, using DMEM serum-

free medium. However, at the beginning of the conditioning period, cells were

irradiated with a diode laser, power of 16 W and a wavelength of 980 nm (Doctor Smile

Dental Laser, LAMBDA SpA, Italy). Multiple energy densities of the laser (fluence)

were used (24; 8; 4; 2; 1 J/cm2 per well) to assess the best condition for DPSC secretion

stimulation. For each energy density, pulsed and continuous-wave laser stimulations

were done. The conditioned medium was used fresh or kept at − 80 °C until required.

CM collected from non-irradiated cells were used as a control in all experiments.

2.2.5.3. CM from spheroid DPSCs

After reaching 80-90% of confluency, cells were detached and 5×104 cells/mL dilution

was prepared for hanging drop cultures. Fifty drops (20 µL volume) of cells were

pipetted into the cover lids of each 10-cm dish, with 5 mL sterile PBS added into the

petri dish, and the lid was carefully inverted. Height petri-dishes were prepared with a

total of 400000 cells. After 72h of cell aggregation and spheroid generation, compact

spheroids were collected, using a micropipette by carefully pooling media. They were

centrifuged at 100 rcf for 1 minute, then washed with PBS two times. Next, the spheroid

cell pellet was recovered with 2 mL of neurobasal medium (to have the same ratio of

cells/added culture medium volume as in the 2D culture for an equivalent preparation

of the conditioned medium), and was transferred to be cultured in a well of corning™


31

costar™ ultra-low attachment 6-well microplate for 48 hours. The conditioned medium

was then collected by centrifugation at 1500 rpm for 5 minutes, followed by another at

3000 rpm for 3 minutes, and kept at - 80 °C until use. CM prepared with 2D DPSC

cultures was used as a control in the experiments. Figure 2.1 shows the microscopic

images of DPSCs under 2D and 3D culture.

Figure 2.1: Images of DPSCs cultured in (a) 3D and (b) 2D observed under phase-

contrast microscopy. Magnification 10x. Scale bar: 500 μm.

2.2.6. Rat aortic ring assay

The protocol of Baker et al. was used (199) with some modifications. Briefly, adult

male Wistar rats (aged from 3 to 6 months) rats were euthanized. The aortas were

dissected and transferred to a Petri dish containing Opti-MEM (Figure 2.2 a, b, and c).

under a dissection microscope, extraneous fat, tissue, and branching vessels were

removed with forceps and a scalpel (Figure 2.2 d). The aortae were cut into rings with

a scalpel and transfer to a petri dish containing Opti-MEM + 1% PS and kept at 37 °C

and 5% CO2, for few hours or overnight, until use (Figure 2.2 e). On the ice, the

collagen (Collagen Type I, rat tail) was diluted in DMEM: F12 for a final concentration

of 1 mg.mL – 1, and the pH was adjusted with a few drops of 5-N NaOH to turn the

mixture pink. Always on ice, 200 µL of collagen matrix was transferred to each well of

a 48-well plate, a few wells at a time, so that the matrix does not polymerize before

aortic rings are added. Next, the rings were carefully transferred from the collagen

starvation plate using forceps and placed so that they were completely submerged in

liquid collagen, with the luminal axis perpendicular to the bottom of the well. The plate

was then left undisturbed for 10 min at room temperature and before incubation at 37

°C/5% CO2 for 1 hour. Next, embedded rings were carefully fed with 600 µL of Opti-


32

MEM culture medium or DPSC-CM, both supplemented with 1% FBS. The growth

medium was changed on days 4 and 6 by carefully removing 520 µL of old medium

and replacing it with 600 µL of fresh medium, and the experiment was stopped at day

8. Microvessel growth was quantified at days 4, 6, and 8 by live phase-contrast

microscopy with a 10x objective (Zeiss). The focus was adjusted manually while

moving around the ring to ensure that vessels growing out in different planes are

counted. The data collected were plotted as mean microvessel numbers per ring, with

the SEM as the error margins. Photos were taken for the rings at days 4, 6, and 8 using

the phase-contrast microscope with a 5x objective. The experiment was repeated many

times for mastering the protocol, then three independent repetitions were performed

with DPSC-CM vs control.

Figure 2.2: Preparation of rat aorta rings. (a) After the opening of the chest cavity and

the removal of organs, the aorta was exposed. (b) The aorta was dissected. (c) The blood

was washed off, and the aorta was transferred to a petri dish containing Opti-MEM. (d)

Under a dissection microscope, extraneous fat, tissue, and branching vessels were

removed with forceps and a scalpel. (e) The aorta was cut into rings with a scalpel and

transfer to a petri dish containing Opti-MEM + 1% PS.


33

2.2.7. Culture of neurons with DPSC-CM

Dissociated neurons were plated on D,L-polyornithine (0.5 mg/mL)-laminin (5

mg/mL)-coated glass coverslips in 4 well-plates, and incubated four hours with

complete growth medium for neuron adherence, in an incubator with a 5% CO2

atmosphere. Then, the culture medium was carefully replaced by DPSC-CM,

neurobasal medium as a negative control (C-), or neurobasal medium enriched with

nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and

neurotrophin-3 (NT-3) (1:1000, Peprotech, USA) as a positive control (C+). Each

experimental condition was replicated in four wells (four glass slides) per mouse. The

number of isolated and dissociated ganglions corresponds to the number of conditions

in quadruplicate. Experiments were stopped 24 hours later.

2.2.8. Immunostaining and fluorescence imaging

2.2.8.1. Immunostaining

Following the culture of neurons, osteoblastic cells (50000 cells per well of 24-well

plate), and aortic rings in DPSC-CM or control medium for a period defined for each

experiment, samples were fixed at room temperature in 4% paraformaldehyde (PFA)

for 15-20 minutes. Then, they were washed many times with PBS and permeabilized

with PBS and 0.3 % Triton X-100 for 10 minutes. Next, samples were blocked with

PBS, 0.1% of Triton X-100, and blocking reagent for 20-30 minutes at room

temperature, washed two times with PBS and incubated with primary antibodies

overnight at 4°C. After an additional three washes of 10 min each, samples were

incubated with secondary antibodies for 1 hour, in dark at room temperature. No need

for this step when conjugated primary antibodies were used. Primary and secondary

antibodies were diluted in blocking solutions. Cultures were then washed three times

again, 10 min each, and were counterstained with 4,6-Diamidino-2-Phenylindole,

Dilactate (DAPI, 1:1000, Sigma). Glass slides were mounted in prolong mounting

media, and preparations were cured overnight at +4°C or -20°C protected from light

until microscopy analysis. Table 2.2 summarize the blocking reagents, primary,

secondary, and conjugated antibodies used for immunostaining.


34

Cells/Tissues Blocking reagent Primary

antibodies

Secondary antibodies Conjugated

antibodies

Neurons 10% donkey

serum

Rat monoclonal β-

tubulin III (1:1000)

Donkey anti-rat Alexa

488 (1:500)

Bone cells 1% BSA Rabbit collagen

(1:500)

Mouse osteocalcin

(1 µg/mL)

Goat anti-rabbit Alexa

594 (1:500)

Goat anti-mouse FITC

(1:500)

Aorta rings 1% BSA Lectin-FITC (1mg/mL)

Table 2.2: Blocking reagents, primary, secondary, and conjugated antibodies used for

immunostaining.

2.2.8.2. Fluorescence imaging

A microscope slide scanner (ZEISS Axio Scan.Z1) was used to scan immunostained

glass slides, containing tens of neurons. A 20x objective scan image was obtained for

each glass slide.

Fluorescent images of bone cells and aorta rings were taken by an inverted epi-

fluorescence microscope (Nikon TE2000-E) at 40x and 10x magnifications

respectively.

2.2.9. Neurites Length Measurements

Neuron images were separately obtained using the Zen® acquisition software, neurites

extensions of each cell were traced and the length of all the neurites per neuron was

measured manually by NeuronJ plugin for ImageJ analyzing software. All cells were

considered, except neurons presenting neurites connected to adjacent neurons (for

technical reasons). A total of 3898 neurons was measured throughout this study.

2.2.10. Proliferation assay

MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] assay was

performed to investigate cell proliferation. For each cell type, 5000 cells per well were

cultured for 4 days in 96-well plates. Then, cells were washed twice with PBS, and 200


35

µL of MTT solution diluted in the growth medium was added to each well. The plate

was incubated at 37°C for 2 hours to allow the formation of MTT formazan. The

medium was then replaced with 150 µL DMSO, and shaken at room temperature for 1

hour to dissolve the formazan. The optical density (OD, arbitrary unit) or absorbance

measured at a wavelength of 490 nm (ELX Ultra Microplate Reader; Bio-tek,

Winooski, Vt., USA) was plotted according to the number of days in culture.

Experiments were carried out in triplicate and repeated three times.

2.2.11. Quantitative ALP Activity Assay

The alkaline phosphatase catalyzes the hydrolysis of phosphate esters in an alkaline

buffer and produces an organic radical and inorganic phosphate. The ALP level and

activity are indicators of osteoblastic maturation.

To measure ALP activity in osteoblastic cultures, we used the colorimetric ALP assay.

Briefly, osteoblastic cells were seeded in 24-well plates (50000 cells per well) and

cultured with DPSC-CM or OM for a period indicated for each experiment. After

washing twice with PBS, 200 L of pNPP solution (p-Nitrophenyl Phosphate Liquid

Substrate) was added, and cells were incubated in the dark for 30 min at room

temperature. The absorbance was then measured at a wavelength of 405 nm. ALP

activity was then normalized by the total protein content measured at indicated days

and was expressed as absorbance per milligram of protein. All experiments were

conducted in triplicate and repeated minimum two times.

2.2.12. Alizarin Red staining and quantification

Alizarin Red is an anthraquinone dye used to evaluate calcium deposits in cell culture.

Calcium forms an Alizarin Red S-calcium complex in a chelation process, and the end

product is a bright red stain.

We used alizarin red staining to evaluate matrix mineralization in osteoblastic cell

cultures. Osteoblastic cells were seeded in 24-well plates (50000 cells per well) and

cultured for 21 days with DPSC-CM or OM. Cells were fixed in 95% ethanol for 30

min, before being rinsed 2 times in ddH2O. Cells were then incubated with 2% alizarin

red solution (pH 4.2) for 2 minutes. Stained cultures were washed 5 times with ddH2O.

Pictures were taken immediately with an optical microscope. For mineral


36

quantification, stained calcium nodules were dissolved in 10% cetylpyridinium for 15

min under gentle shaking at room temperature. The colored solutions were then

collected and absorbance was measured at 540 nm, with data expressed as OD, or

absorbance per milligram of protein. Experiments were conducted in triplicate and

repeated three times.

2.2.13. Molecular biology

Osteoblastic cells were seeded in 6-well plates (100000 cells per well) in DPSC-CM or

OM. After 9 and 15 days of culture, cells were analyzed for osteogenic markers gene

expression using the real-time qPCR. The expressions of Runt-related transcription

factor 2 (Runx2), osteonectin (OCN), and Bone sialoprotein (BSP) genes were

investigated.

2.2.13.1. RNA extraction

A NucleoSpin RNA Plus kit was used to extract mRNAs, according to the

manufacturer’s instructions. The quality and concentration of the extracted mRNA

were determined using the Agilent DNA 1000 instrument (Agilent, Santa Clara, CA,

USA), and Spectrophotometer Nanodrop 8000 (Thermo Scientific) respectively.

2.2.13.2. Reverse transcription

Then, RNA reverse transcription was performed using the RevertAid First Strand

cDNA Synthesis kit according to the manufacturer’s instructions.

2.2.13.3. Real-time reverse transcription–polymerase chain reaction (Real-time

RT-PCR)

The resultant cDNA was used as a template for real-time qPCR performed with the

SensiFAST™ Syber No-Rox mix using primers designed with Primer3 - PCR primer

design tool. The sequences of the specific primers used for the real-time RT-PCR

analysis are listed in Table 2.3. PCR conditions consisted of initial denaturation at 95°C

for 5 minutes, followed by 40 cycles of denaturation at 94°C for 10 seconds, annealing

at 60°C for 20 seconds, and extension at 72°C for 15 seconds. A standard denaturation


37

curve was then generated by increasing the temperature in 0.5°C increments for 70

cycles. The real-time qPCR analysis was performed on a LightCycler 480 Instrument

II (Roche Molecular Systems, Inc). The relative expression level for each target gene

was normalized to the Actin gene used as a reference. A negative control without a

cDNA template was checked for each primer combination. Experiments were

conducted in triplicate and repeated two times.

Gene Sequence

Runx2

F: GCCTCCATCAGGAGTACAGC

R: GAGTCAGCACCCCTTGCTAA

BSP

F: ACTGCAATCTCCACCTCCTG

R: GATAGTGCCACTGCACTCCA

OCN

F: TGGTCCCTCAGTCTCATTCC

R: CGCCTGGGTCTCTTCACTAC

Actin

F: GATCATTGCTCCTCCTGAGC

R: AAAGCCATGCCAATCTCATC

Table 2.3: Primer sequences used in the real-time qPCR. Runx2: runt-related

transcription factor 2; OCN: osteonectin; BSP: Bone sialoprotein.

2.2.14. In vivo experiment

2.2.14.1. surgical procedure

We used a previously described rat caudal vertebrae critical size defect model to

investigate the effect of DPSC-CM on bone regeneration (200). Shortly, animals were

anesthetized with an intraperitoneal injection of ketamine and xylazine (40 and 9mg/kg,

respectively). The tail was disinfected and a dorsal incision was made approximately

from Cd31 to Cd35 vertebrae. The skin and periosteum were gently retracted under

PBS irrigation and the vertebrae were exposed. Intraosseous defect preparations of

2x3mm were performed in the exposed surface of each of the 4 vertebras, using a

surgical guide for optimal positioning of the dental bur. The 4 bone defects were filled

with collagen membrane soaked with DPSC-CM/DMEM, and fibrine gel prepared with

DPSC-CM/DMEM respectively (Figure 2.3). DPSC-CM was concentrated 15 times

using the centrifugal filter device Centriprep® 3 kD (Millipore) and used without any

supplements. To prepare the fibrin gel, 9 mg/mL of fibrinogen dissolved in DPSC-CM


38

or DMEM were mixed with rat blood at the wound site. In vitro tests were first done to

optimize the properties of the gel in terms of gelation and degradation kinetics. After

the materials have been implanted, the skin was repositioned over the defects and

sutured together with a resorbable suture. Experiments were conducted in triplicate (3

rats, each rat being its control) and were stopped after 40 days. Rats were euthanized,

and collected tails were fixed in 4% PFA for 2 days at room temperature, then kept in

PBS at 4°C until micro-CT observation and histological processes.

Figure 2.3: Intraosseous defect preparation in 4 vertebras, using a surgical guide for

optimal positioning of the dental bur. The 4 bone defects were filled with collagen

membrane soaked with DPSC-CM/DMEM, and fibrine gel prepared with DPSC-

CM/DMEM respectively.

2.2.14.2. Micro-CT analysis

After fixation in 4% PFA, three-dimensional radiographic imaging was performed

using a positron emission tomography (PET)/x-ray computed tomography (CT) scanner

(nanoScan PET/CT, Mediso Medical Imaging Systems), with a 3D reconstruction

software (InterView™ FUSION, Mediso Medical Imaging Systems). Measurements

were made on the region of interest on the computer-reconstructed 3D samples.

2.2.14.3. Histology

PFA-fixed rat tails were washed twice in PBS. Then, the vertebrae were isolated using

a cutting blade, decalcified by the decalcifier Shandon™ TBD-2™ according to


39

manufacturer instructions, rinsed with PBS, and transferred into ethanol 70%. After the

inclusion of the samples in paraffin blocks, a series of consecutive sections were made

in the middle of the bone defect using a microtome and positioned on different slides.

Sirius red, Masson's trichrome, and hematoxylin and eosin stains were performed. A

microscope slide scanner (ZEISS Axio Scan.Z1) was used to scan stained slides

(objective 20x). Image analysis and quantification were done using ImageJ analyzing

software.

2.2.15. Transwell assay

Transwell insert co-culture system was selected to create an indirect interaction

environment for MCF7, and to test the paracrine activity from DPSCs on the cancer

cells. Breast cancer MCF7 and DPSCs were seeded in the lower and upper chambers

respectively. Filter membranes with 0.4 μm pore size were used to prevent physical cell

movement of DPSCs from the upper part to the bottom part through the membrane, for

the paracrine effect testing.

In detail, a total of 6000 MCF7 or MCF7TAX19 cells were seeded into 24 multi-well

plates in 600 µL culture medium. DPSCs were seeded (2000 cells in 100µL culture

medium) on transwell inserts consisting of polyethylene terephthalate PET membrane

(0.4µm pore size; BD Falcon). The co-culture ratio DPSC:MCF7 was 1:3. The plates

were incubated at 37 ⁰C under 5% CO2 in a humidified environment. In control wells,

tumor cells were cultured alone. After 5 days, the wells were transferred to the Celigo

cytometer (Nexcelom Bioscience) for live cell imaging and counting. Image cytometry

is a quantification method that allows a whole-well automated analysis, without the

need to detach or trypsinize the cells. Two independent experiments were conducted

for each cancer cell type.

2.2.16. Tumor spheroid dissemination assay

A 5×104 cells/mL dilution of MCF7 cells was prepared for hanging drop cultures. Forty

drops (20 µL volume) of cells were pipetted into the cover lids of each 10-cm dish, with

5 mL sterile PBS added into the petri dish, and the lid was carefully inverted. After 72h

of spheroid generation, compact spheroids (average diameter of 300 µm) were

collected, using a micropipette by carefully pooling media (201), and were then


40

transferred to be cultured in a flat-bottomed 6-well plate (Corning), until reaching an

overall diameter around 1-mm. The medium was carefully changed every 3 days.

The established “primary” spheroids were allowed to reattach and disseminate on the

culture surface forming viable monolayer for 12 days. Then, an average dose of

1x105 DPSCs or only medium were added and spheroidal dissemination was monitored

for an additional 3-5-7 days period. Images of spheroids were taken using a phase-

contrast microscope with a 5x objective (Zeiss), and the cellular dissemination area was

derived by measuring the total cellular area and subtract it from the initial area at day

0. Measurements were derived from average-axis diameters evaluated by ImageJ

software version 1.51a (NIH). Two independent experiments with a minimum of three

spheroids per condition were analyzed.

Figure 2.4: Tumor spheroid dissemination assay. (a) Drops of cancer cells were pipetted

into the cover lids. (b) The lid was carefully inverted with sterile PBS into the petri

dish. (c) After 72h of spheroid generation, compact spheroids were collected and

transferred to a flat-bottomed 6-well plate. (d) The established primary spheroids were

allowed to reattach and disseminate on the culture surface.


41

2.2.17. DPSC-CM analysis

2.2.17.1. Proteomic analysis

2.2.17.2. a. Bicinchoninic Acid (BCA) Assay

The total protein content of different DPSC-CM samples was determined using Pierce®

BCA protein Assay Kit (ThermoFischer Fisher) in 96-well plates. The Bicinchoninic

Acid Protein Assay primarily relies on two reactions. Firstly, the peptide bonds in the

protein sample reduce Cu2+ ions, in a temperature-dependent reaction, from the copper

solution to Cu+. The amount of Cu2+ reduced is proportional to the amount of protein

present in the solution. Next, two molecules of BCA chelate with each Cu+ ion, forming

a purple-colored product that strongly absorbs light at a wavelength between 540-

590nm that is linear for increasing protein concentrations between the range of 0.02-

2mg/ml. The amount of protein present in a solution can be quantified by measuring

the absorption spectra and comparing it with protein solutions with known

concentrations.

The assay mixture contained 200 μL of the reagent (solution A + B) and 20 μL of the

sample containing either CM or BSA standard. Absorbance was read at 540 nm using

an Infinite 200 plate reader.

2.2.17.3. b. Protein electrophoresis

For proteomic analysis of CM, we used the 2100 bioanalyzer system which allows a

fast and automated protein electrophoresis. The Agilent 2100 Bioanalyzer is a

microfluidics-based platform for sizing, quantification, and quality control of DNA,

RNA, and proteins. After loading the sample on the Agilent chip of choice, the sample

moves through microchannels and sample components are electrophoretically

separated. Smaller fragments migrate faster than the large ones. The fluorescent dye

molecules intercalate into DNA and RNA strands or with protein-SDS-micelles. They

are then detected by their fluorescence and translated into gel-like images (bands) and

electropherograms (peaks).

The analysis of CM were performed using the Agilent protein 230 kit which is designed

for the sizing and analysis of proteins from 14 to 230 kDa. Chips were prepared

according to the kit protocol. Briefly, 4 µl of CM were mixed with 2 μL sample buffer.


42

The sample solution and ladder were placed at 95°C for 5 min and further diluted with

84 μL water. 6 µl of solutions were then applied to the protein chip for analysis.

2.2.17.4. Immunoassay: Growth factor antibody array

The concept of antibody microarrays is one of the most versatile approaches within

multiplexed immunoassay technologies (202). Antibody arrays consisting of a

collection of capture antibodies fixed on a glass slide, to detect antigens. Each glass

slide is spotted with 16 identical antibody arrays, allowing a separate sample to be

applied to each array. Each antibody is spotted in quadruplicate in each array. Eight of

the arrays are used with a cocktail of protein standards to produce a standard curve.

Antibody arrays allow the screening/profiling of multiple proteins within a sample and

the comparison of protein profiles of several samples.

The profiles of DPSC-CM, ASC-CM, and BMSC-CM were screened with Human

Growth Factor Antibody Array (40 Targets) – Quantitative (ab197445 Abcam),

following the manufacturer's protocol. The methodology is much like that of an ELISA.

Briefly, after blocking for 30 minutes, the slide was incubated with CM for 2 hours,

washed, and incubated again with a biotinylated detector antibody cocktail for 2 hours.

Next, the slide was washed and incubated with fluorophore-labeled streptavidin for 1

hour. After washing, the slide was scanned using an InnoScan 300 Microarray Scanner

(Innopsys, Carbonne, France). Data extraction and quantification of signal intensities

were performed using Mapix software (Innopsys, France). Data analysis was done with

GraphPad Prism (GraphPad Software, La Jolla California USA).

2.2.18. Statistical Analyses

Statistical analyses were performed using SigmaPlot version 11.0 (Systat Software,

Inc., San Jose California USA). Multiple group comparisons were performed by

analysis of variance (ANOVA) followed by Bonferroni’s post hoc test. Comparisons

between two groups were performed by Student’s t-test. P < 0.05 was considered

statistically significant. Data were presented as mean ± standard deviation (SD) or

standard error of the mean (SEM) according to each experiment.

43

CHAPTER 3: PRODUCTION OF DPSC-CM

Chapter 3: Preparation of DPSC-CM

44

3.1. Introduction

As widely described in the introduction, the preparation of CM varies significantly

between studies, with contradictory findings sometimes concerning the impact of

several factors, like cell donors, cell passage number, cell confluency, conditioning

period, and growth medium, on the secretome of DPSCs.

Our ultimate goal was to optimize the approach to recover secreted molecules from

DPSCs, to obtain a more protein-rich and potent CM. In this study, we evaluated how

the different factors affect the total protein concentration in DPSC-CM, to define the

parameters that give the most concentrated secretome. To this end, we used Bradford

assay and protein electrophoresis to illustrate the effect of cell donors, cell passage

number, conditioning period, and cell growth medium on total protein concentrations

in DPSC-CM. Then, a microarray analysis assay was performed to compare the profiles

of DPSC-CM and CM derived from other MSC cell types.

3.2. Results

3.2.1. DPSC characterization

Before starting the preparation of DPSC-CM, we confirmed the stemness of isolated

DPSCs. In addition to plastic adherence, MSC-associated surface markers, including

CD90, CD146 were highly expressed on the cell surface of DPSCs. CD117 was slightly

expressed (203, 204). However, the hematopoietic marker CD45 displayed as a

negative control marker was not observed (Figure 3.1.a). Furthermore, the calcified

mineral deposition was observed by the Alizarin Red S staining after 21 days of culture

in OM, confirming the differentiation potential of DPSCs into osteogenic lineage

(Figure 3.1.b and c).


45

Figure 3.1: DPSC characterization. (a) Flow cytometry analysis of subconfluent dental

pulp cells. Single-parameter histograms showing the expression of markers CD 45, CD

146, CD 90, and CD 117. (b) and (c) Images of alizarin red staining of DPSCs observed

under phase-contrast microscopy after (b) and before (c) osteodifferentiation.

Magnification 10x. Scale bar: 500 μm.

3.2.2. Impact of donors

First, we assessed the efficiency of our protocol to recover secreted proteins, by

comparing total protein concentration in DPSC-CM to that without cell conditioning,

using the BCA test. Next, we sought to determine the reproducibility of our protocol

between donors. DPSC-CM were harvested from 3 different donors (15-23 years old)

following the same protocol previously described. As expected, protein concentration

in DPSC-CM was significantly higher compared to neurobasal medium (402 ±

14µg/mL vs. 52 ± 28µg/mL) (Figure 3.2.a). While the secreted protein concentration

did not statistically differ between DPSC-CM obtained from the three different donors

(Figure 3.2.b).


46

Figure 3.2: Total protein concentration in DPSC-CM: (a) DPSC-CM compared to the

basal medium. (b) DPSC-CM were obtained from 3 different donors. Results are the

Means ± SD. Data are presented in μg/mL as mean ± SD. ***P < 0.001 indicates

significance between CM and control as determined by two-tailed Student’s t-tests.

3.2.3. Impact of cell confluency, passage number, and conditioning period

Then, we evaluated the impact of cell passage number and conditioning period on the

total protein concentration of CM. The number of cell passage significantly affect the

concentration of protein: 438 ± 30 µg/mL with DPSCs at the 3rd passage vs. 330 ± 27

µg/mL with DPSCs at the 5th passage (Figure 3.3.a). The impact of secretion duration

was also investigated; protein concentration increased significantly and markedly over

the first two days, to reach 379 ± 33 µg/mL after 48 h. The kinetics of factors secretion

(for up to five days) revealed higher levels of secreted factors over time but did not

reveal any significant difference following 48 hours of conditioning (Figure 3.3.b).

Also, DPSC concentration (expressed as cell confluence) had a significant impact on

protein concentration recovered in conditioned media, varying from 337 ± 12 µg/ml for

60% of cell confluence to 400 ± 28 µg/ml for 90% cell confluence.


47

Figure 3.3: Total protein concentration in DPSC-CM as analyzed by Bradford assay:

(a) From DPSCs at passage 3, 4 and 5. (b) Obtained after 6, 24, 48, 72, 96, and 144

hours of medium conditioning with DPSCs. (c) From DPSCs at 90% and 60% of

confluence. Data are presented in μg/ml as Means +/- SD. *, **, *** indicate significant

difference at p<0.05, <0.01, and <0.001 respectively, as determined by one-way

ANOVA followed by Bonferroni post hoc test for (a) and (b), and by two-tailed

Student’s t-test for (c). (d) Phase-contrast images of DPSCs in the culture at 90% and

60% of confluence.

3.2.4. Impact of growth medium

The CM obtained with complete basal or growth medium (MEM-alpha with 5% human

platelet lysate), were manufactured by the Cardiology Stem Cell Center (Rigshospitalet,

Copenhagen, Denmark). CM were derived from ASCs, and harvested after 48, 72, 96,

and 120 hours of medium conditioning.

Analysis of these CMs showed that despite the decrease in their concentrations between

the second (4516 ± 379 ng/μl) and fifth day (3040 ± 197 ng/μl), serum proteins remain

at high levels in the media even after 5 days of culture. We suggested that these proteins


48

came from the basal culture medium for two reasons: firstly, we saw the same peaks in

the electropherogram of the control which was a complete medium not conditioned by

ASCs; secondly, we did not see peaks in the electropherogram corresponding to the

CM obtained with a serum-free medium, although the presence of the molecules in the

secretome had been confirmed by other techniques (BCA and microarray), indicating

that this technique was not suitable to detect and identify the factors secreted by MSCs.

These results are summarized in Figure 3.4.

Figure 3.4: Protein analysis of CM by the Agilent 2100 Bioanalyzer (Agilent protein

230 assay). (a) Overlay of four electropherogram traces of CM obtained with complete

basal medium (growth medium) after 48, 72, 96, and 120 hours of conditioning, and on

the right the electropherogram trace of their correspondent basal medium. (b) The

electropherogram trace of CM obtained with serum-free basal medium after 48 hours

of conditioning, and on the right the electropherogram trace of its corresponding basal

medium.

3.2.5. Comparison of secretome profiles: DPSC-CM, BMSC-CM, and ASC-CM

To assess the impact of MSC source on their secretome profile, we compare the

composition of DPSC-CM with human MSC-CM from bone marrow and adipose tissue

using microarray assay. The three CM were harvested following the same protocol,

with only one difference concerning the MSC sources (these MSC cells were isolated


49

from different individuals). The results showed significant differences in the profiles of

the three CM, with some factors being more concentrated in one CM than in the other,

or even present in one CM but not in the other (Figures 3.5.a and b). The overview of

the antibody array results of ASC-CM, BMSC-CM, and DPSC-CM is presented in

columns a, b, and c of Table B1 in Appendix B, respectively.


50


DPSC-CM, BMSC-CM, and ASC-CM. The array was scanned, and the intensities of

signals were quantified. The relative expression levels are displayed as subtraction

between DPSC-CM (gray bars) and ASC-CM (black bars) in (a), and BMSC-CM

(dashed bars) in (b). Data are presented in pg/mL as Means ± SD. ***P < 0.001,

**P<0.01, *P<0.05 indicate significance between CM, as determined by two-tailed

Student’s t-test.

3.3. Discussion

The DPSCs used in our experiments were isolated from young donors, as Horibe et al.

demonstrated that DPSC-CM from aged donors (44 – 70 years old) has inferior trophic

effects than those of the young (19 – 30 years old) (40), and a decrease of proliferative


51

and migratory potential and differentiation capacity was correlated with age in the

literature (38). Although we did not identify the composition of CM derived from these

donors, no significant difference in total protein concentrations was detected in our

study. Note that Alraies et al. identified significant variability in the proliferative and

differentiation capabilities of DPSCs expanded from donors within a similar age range

and inherent differences between DPSC populations derived from the same patient

(205).

To the best of our knowledge, no studies have already examined the impact of passage

number on cell secretions, and the changing in the concentration of secreted growth

factors according to the passage number has been noted just once, in a study conducted

by Miura-Yura et al. (97). The secretome was derived from DMSC at passage 1 to 10

in the studies investigating the potential of DMSC-CM (Table A8 of Appendix A).

Some studies do not even precise the cell passage number (97, 132, 136, 145, 146, 152,

176, 179, 190, 191, 206-210). Here, we demonstrated that the passage number could

affect the concentration of DPSC’s secreted molecules.

Most studies investigating the DMSC-CM effects harvested CM after 24 or 48 hours

consecutively (Table A9 of Appendix A). Paschalidis et al. showed also that the

collection of DPSC-CM every 4 days for 24 days had the most pronounced effects with

the first collection (64). Mussano et al. showed that after 14 days of culture in the

growth medium, SHED augmented the release of some factors and decrease some

others (83). In this study, we showed that the total protein concentration increased with

days with no significant difference after the first 48 hours.

We demonstrated that when a complete medium was used, the serum proteins remain

in the media even after 5 days of culture. Therefore, short culture duration might leave

certain serum-derived growth factors that were not consumed by the cells and might

add to the growth factor level, or, on the contrary, suppress growth factor secretion by

the cells (11).

Many differences were detected in the secretome profile of DPSCs, BMSCs, and ASCs,

which is consistent with other studies. Proteome analysis of CM from DPSCs, BMSCs,

and ASCs by mass spectrometry performed by Tachida et al. identified 1533 proteins

in total, with only 999 commonly expressed proteins in all of the three CM (193).

Kumar et al. identified a total of twenty proteins related to hepatic lineage in the

secretomes of four stem cell populations. Out of these, five proteins were identified in

DFSC secretome. Twelve proteins were obtained in SCAP secretome while BMSC


52

secretome showed six different proteins, and DPSC secretome showed five proteins

(211). In our study, DPSC-CM appeared to be significantly richer in growth factors

than BMSC-CM in terms of the number and concentrations of detected factors.

However, the number of factors detected in DPSC-CM and ASC-CM was close, with

a significant difference in the composition of the two CM. A more in-depth analysis of

the microarray results gives us an indication of the interest of using one of the two CMs

for a precise application in tissue regeneration.

Taken together, the outcomes of this study have helped us to define the characteristics

of the conditioned medium preparation procedure that we are going to use throughout

with the thesis, in terms of cell confluence, cell passage number, conditioning time, and

growth medium. Briefly, when DPSCs reached 80% - 90% confluence, PBS washes

were carried out and the complete medium was replaced with serum-free medium. 48

hours later, the medium was collected by two centrifugations to remove cell debris.

Figure 3.6 summarizes this procedure.

Figure 3.6: Preparation procedure of DPSC-CM used in all experiments. When DPSCs

reached 80% - 90% confluence, PBS washes were carried out and the complete medium

was replaced with serum-free medium. 48 hours later, the medium was collected by

two centrifugations to remove cell debris.

53

CHAPTER 4: THE EFFECT OF ENVIRONMENTAL

CUES ON DPSC-CM

Chapter 4: The effect of environmental cues on DPSC-CM

54

4.1. Introduction

The concept that MSCs act as repair cells of the body would imply that MSCs do not

only constitutively secrete regenerative factors, but also produce some factors in

response to stimuli (212). Various physical, chemical, and biological factors have been

shown to modulate the excretion of different potential therapeutic factors by MSCs.

During the production of DMSC-CM, the effects of hypoxia, 3D culture of dental

MSCs, preconditioning with LPS, and osteodifferentiation on DMSC secretome were

studied (Table A3 of Appendix 5). Hypoxia has been shown to increase the VEGF

secretion (206, 213) of DPSC secretome and the angiogenic potential of SCAP

secretome (213). 3D culture increases the anti-apoptotic effect of SHED secretome

against the dopaminergic neurons (132). LPS preconditioning increases the potential of

DPSC secretome for proliferation, migration, and odontogenic differentiation of

Schwann cells (214) and the anti-inflammatory effect of PDLSCs (207). Osteo-

induction significantly affected the cytokine, chemokine, and growth factor profile of

SHED-CM in a differential way (83), and enhanced the effect of SHED-Exosomes on

the osteogenic differentiation of PDLSCs (215). Osteodifferentiation of DPSCs

increases the potential of their secretome to stimulate osteogenesis of amniotic fluid

stem cells (176). Kolar et al. used a previously published protocol (216) and stimulated

the DMSCs with a mixture of growth factors. The stimulation of the DMSCs led to a

significant increase in the secretion of BDNF and VEGF-A proteins and potentiate the

DMSC secretome effect on neurite outgrowth (159).

As shown, environmental cues and culture conditions were widely used to change the

secretome profile or to increase growth factors secretion of dental MSCs. This meets

our goals of optimizing the preparation of DPSC-CM for a more factor-rich and

therapeutically potent secretome; therefore, we study here the effect of laser therapy

and 3D culture on the secretome of DPSCs.

4.2. Results

4.2.1. Effect of laser irradiation on DPSCs and DPSC-CM protein concentration

DPSCs were irradiated at 24, 8, 4, 2, and 1 J/cm2 per well, then BCA assay was

performed to evaluate the total protein concentration that contains each CM. The most


55

concentrated total protein was obtained in CM irradiated with a fluence of 24 J/cm2

(pulsed laser); Therefore, this density energy was used for further experiments.

The effect of pulsed laser irradiation of 24 J/cm2 (the total surface of each well was

irradiated for 2 minutes and 30 seconds each time with 1.5 W of laser power) on DPSC

proliferation was evaluated using the MTT assay, 48 hours after the irradiation of

DPSCs cultured in 6 well-plate. DPSCs cultured for 48 hours without irradiation were

used as control.

The pulsed laser irradiation of 24 J/cm2 increased significantly the total protein

concentration in DPSC-CM compared to the control (Figure 4.1.a). This was confirmed

by two independent experiments. However, the number of DPSC cells decreased 48

hours after the irradiation (Figure 4.2.b). This may be due to decreased cell proliferation

or cell death after irradiation. The two centrifugations performed after CM collection

before the BCA test eliminate the possibility that the increase in total protein

concentration comes from cell debris and apoptotic bodies.

Figure 4.1: (a) Total protein concentration in CM collected from DPSCs irradiated at

multiple fluence: 24, 8, 4, 2 and 1 J/cm2 compared to CM from non-irradiated DPSCs.

(b) Number of DPSCs in culture 48 hours after the irradiation at 24 J/cm2 compared to

non-irradiated DPSCs. Data are presented in μg/mL as mean ± SD. *P < 0.05 indicates

significance between irradiated and non-irradiated DPSCs as determined by two-tailed

Student’s t-tests.


56

4.2.2. Effect of CM from irradiated DPSCs on fibroblast and MCF7 proliferation

The effect of secretome collected from irradiated versus non-irradiated DPSCs was

assessed on the proliferation of fibroblasts passage 3 (in 96 well-plate; 10000 cells per

well), and MCF7 (in 96 well-plate; 5000 cells per well) using MTT assay during 4 days.

An increase in fibroblast proliferation was detected on Day 4 compared to control

(Figure 4.2.a). However, no effect of irradiated DPSC secretome on MCF7 proliferation

was observed (Figure 4.2.b).

Figure 4.2: The effect of CM from irradiated and non-irradiated DPSCs on (a) fibroblast

and (b) MCF7 proliferation. * p<0.05 significant difference between both CM.

4.2.3. Composition of CM from irradiated DPSCs in growth factors

24 over 40 factors were above the detection threshold in CM obtained from irradiated

or non-irradiated DPSCs. The irradiation of DPSCs increased significantly the

expression levels of BMP-4, EGF R, HGF, IGF-1, IGFBP-6, and PDGF-AA, while

OPG, PIGF, SCF R, and VEGF were significantly detected only in CM obtained from

irradiated DPSCs. The levels of other factors were not significantly modified by the

irradiation of DPSCs, or they were below the detection limit. The results are

summarized in Figure 4.3. The overview of the antibody array results of CM from non-

irradiated and irradiated cells is presented in columns f and g of Table B1 in Appendix

B, respectively.


57


CM obtained from irradiated and non-irradiated DPSCs. The relative expression levels

are displayed as subtraction between CM obtained after DPSC irradiation (black bars)

and CM obtained without irradiation (grey bars). Data are presented in pg/mL as Means

± SD. ***P < 0.001, **P<0.01, *P<0.05 indicate significance between both CM, as

determined by two-tailed Student’s t-test.

4.2.4. Composition of CM derived from spheroid DPSCs in growth factors

28 over 40 factors were above the detection threshold in CM obtained from DPSCs in

2D or 3D cultures. Just a few factors increased non-significantly when DPSCs were

cultured in 3D cultures, including BDNF, BMP-7, and IGFBP-2. However, the


58

expression levels of IGFBP-6 and IGF-1 were significantly higher in DPSC-CM from

2D cultures. IGFBP-3, IGFBP-4, NT-3, VEGF, VEGF-D, and VEGF R2 were

significantly detected only in CM obtained from 2D cultures. The levels of other factors

were not significantly modified by the 3D culture of DPSCs, or they were below the

detection limit. The results are summarized in Figure 4.4. The overview of the antibody

array results of CM obtained from DPSCs in 2D and 3D cultures are presented in

columns c, and d of Table B1 in Appendix B, respectively.


CM obtained from DPSCs cultured in 2D or 3D. The relative expression levels are

displayed as subtraction between CM obtained from DPSCs in 2D culture (grey bars)

and CM obtained from spheroid DPSCs (black bars). Data are presented in pg/mL as

Means ± SD. ***P < 0.001, **P<0.01, *P<0.05 indicate significance between both CM,

as determined by two-tailed Student’s t-test.


59

4.3. Discussion

Many studies have already shown the advantages of low-level laser irradiation (LLLI)

on mesenchymal stem cell viability and proliferation. Soares et al. demonstrated that

irradiation using a diode laser, a wavelength of 660 nm, and an energy density of 1.0

J/cm² has a positive stimulatory effect on the proliferation of PDLSCs (217). Similarly,

Barboza et al. showed an increase in ASC and BMSC growth curves when subjected to

the same laser energy density, without any detection of nuclear alterations or significant

change in cell viability (218). Zaccara et al. demonstrated that laser irradiation at the

same energy density contributed to the growth of DPSCs and maintenance of their

viability (219). Eduardo et al. conducted their experiments with an energy density of

3.0 J/cm2 and showed the same proliferative effect of laser irradiation on DPSCs (220).

Although 660 nm laser light application with a total fluence of 1.6 J/cm2 increased the

differentiation potential of DPSCs, there were a lot of dead cells during the culture

period (221).

The potential of laser therapy on MSC secretions was also investigated in many studies.

In vitro laser irradiation with an energy density of 4 J/cm2 applied to ASCs stimulates

their secretion of paracrine factors (222). CO2 laser irradiation of ASCs activates the

redox pathways, increasing cell proliferation, and enhancing the secretion of angiogenic

molecules (86). 650-nm GaAlAs laser treatment of cells at a radiant exposure of 4 J/cm2

enhanced ASC proliferation and increased secretion of growth factors (223). LLLT is

an effective stimulator of spheroid ASCs in tissue regeneration that enhanced the

survival of ASCs and stimulated the secretion of growth factors (75). In a study

conducted by Hou et al., BMSCs were exposed to a 635 nm diode laser (60mW;0, 0.5,

1.0, 2.0, or 5.0 J/cm2). 0.5 J/cm2 was found to be the optimal energy density for BMSC

proliferation stimulation. However, the irradiation at 5.0 J/cm2 was the best for the

stimulation of BMSC secretions (224).

We noticed that all these good results were obtained using laser irradiation of MSCs et

low energy densities (until 5 J/cm2) whatever was the type of laser used during the

experiments. The higher energy densities of laser are usually used for clinical

applications like hair reduction or removal, dermatology, dentistry, and oral surgery.

The long-pulsed diode laser is one of the most popular systems available for hair

removal (225), and hair reduction could be safely and effectively achieved using a

scanning 800 nm diode laser at 48 J/cm2 (226). The 1450-nm diode laser at 14 J/cm2


60

reduced inflammatory facial acne lesions (227). A 405 nm diode laser irradiation at

20J/cm2 led to a 40% decrease in the viability percentage of E. faecalis, the bacterium

which is commonly detected in the root canals of teeth with post-treatment apical

periodontitis or advanced marginal periodontitis (228). LLLT at a wavelength of 980

nm and 18 J/cm2 of energy density, reduced pain, and swelling compared to drug

therapy in impacted third molar surgery (229). Diode laser irradiation at 970 ± 15 nm

and 35 J/cm2 was effective in the reduction of postoperative pain and edema, and

minimizing the need for analgesic medication after secondary palatal operations (230).

Nevertheless, in our study, the highest energy density (24 J/cm2) was the only one that

showed an increase in secretions of DPSCs, despite the decrease in the number of cells

compared to control, 48 hours after irradiation, which seems normal given the high

energy applied directly to the cells. The presence, in the secretome of irradiated DPSCs,

of factors known for their proliferative effect on fibroblasts, like HGF (231) and IGF-1

(232) whose concentrations were increased after irradiation of DPSCs, and VEGF (233)

which was not detected in control, may explain the increase in fibroblast cell number

during the fourth day of cell culture. The detection of IGFBP-6, which has an anti-

proliferative effect on fibroblasts (234), at the highest concentration, could contribute

to this delayed and mild proliferative effect of this CM. However, no effect of irradiated

DPSC secretome on MCF7 proliferation was observed, despite evidence of the

proliferative effect of these same factors on MCF7 cells in the literature (235-237).

On the other hand, many studies have shown the positive impact of 3D cultures of MSC

on their secretome. Increased secretion of anti-inflammatory markers occurs when

MSCs were cultured in 3D (68). The formation of spheroidal aggregates enhances

paracrine secretion of angiogenic, antitumorigenic, and pro- and anti-inflammatory

factors of MSCs (238). In comparison to the adherent gingival mesenchymal stem cells,

spheroid GMSCs secrete an elevated level of a variety of cytokines and chemokines

which play important role in promoting cell migration, proliferation, survival, and

angiogenesis (239). VEGF secretion was higher from 3D-bullet umbilical cord blood-

derived mesenchymal stem cells (240). Cord blood MSCs transplanted as spheroids

into mouse ischemic hindlimbs showed an increase in the secretion of VEGF and FGF2

and the upregulation of antiapoptotic signals (241). ELISA revealed a significantly

greater HGF concentration in the spheroid-derived ASC culture medium compared to

monolayer cultures (242). A proteomics analysis performed to media conditioned by

umbilical cord tissue MSCs in monolayer and 3D cultures confirmed the significant


61

differences between both secretome profiles in terms of therapeutic potential (243). To

the best of our knowledge, no studies are investigating the impact of the 3D culture of

DPSCs on their secretome.

Our results did not show any advantage of growing DPSCs in 3D on their secretome

profile. Contrariwise, the factors secreted by spheroid DPSCs decreased significantly

compared to those in 2D culture. This could be due to the low number of DPSC spheroid

cells used to prepare the conditioned medium; although the ratio of cells to the volume

of added culture medium used in 2D and 3D cultures was the same, the number of

DPSC cells in 3D culture was much lower.

62

CHAPTER 5: DPSC-CM FOR NEURON GROWTH

Chapter 5: DPSC-CM for neuron growth

63

5.1. Introduction

The peripheral nervous system is fragile and easily damaged. After an injury, functional

recovery depends on the regeneration of peripheral nerve axons. However, the

mechanism is slow and the results are often unsatisfactory (244). Unsuccessful

regeneration leads to post-traumatic neuropathies, which are mostly resistant to current

treatments (245).

The current standard of care for peripheral nerve injury is autologous nerve

transplantation. Complications include loss of function at the donor site, limited

availability of donor nerve tissue, and donor site morbidity (246). The use of stem cells

as a regenerative therapy process is an appealing strategy to overcome these limitations.

MSCs have been of particular importance in central and peripheral nervous system

repair, due to their regenerative effects (247, 248). Their therapeutic potency is mainly

related to their secreted factors, that induce survival and regeneration of host neurons

(249, 250). Thus, the administration of MSC-CM into injury sites could be used as a

better alternative to the grafting of stem cells.

The present study focuses on the secretome of dental pulp stem cells (DPSC). DPSCs,

originating from the neural crest (251), express neuron-related markers (252), and can

differentiate into neuron-like cells (253). The neurotrophic factors secreted by DPSCs

are remarkably higher than those of BMSCs and ASCs (253). For all these reasons,

DPSCs are considered as an excellent candidate for stem cell-related therapies in nerve

diseases (254), and the leading role of DPSC-CM in neuroprotection and neuritogenesis

was described notably in many in vitro and in vivo studies (255).

Herein, we use DPSC-CM to enhance the neurite growth of dorsal root ganglia (DRG)

sensitive neurons. We study the DPSC-CM potential for axonal growth and we define

an optimization strategy of DPSC-CM to aide axonal growth.

5.2. Results

5.2.1. DPSC-CM potential for neurite outgrowth

After 24 hours in culture, neuron growth was mostly in stellar morphology with many

ramifications. Neurons were cultured in neurobasal medium complemented or not with

either 50%, 75% DPSC-CM or only in DPSC-CM. After fixation and immunostaining,

slides were scanned and neuron ramifications were measured using NeuronJ. Results


64

showed a dose-dependent effect of DPSC-CM on neurites outgrowth. Neurites length

per neuron increased from 1018 ± 157 µm (135 neurons from 3 independent

experiments) without DPSC-CM to 4128 ± 179 µm (89 neurons from 3 independent

experiments) with 100% DPSC-CM (Figure 5.1). Therefore, DPSC-CM was used

directly without any prior dilution for all the next experiments.

The results represent the average of cultures from three independent experiments on

three mice. For the results obtained in each experiment, see Figure C1.a of Appendix

C.

Figure 5.1: Effect of DPSC-CM on neurites growth: (a) After 24 h of incubation, DRG

neurons were fixed and stained with DAPI (blue) or βIII-Tubulin (green), then neurites

length of each neuron was measured with NeuronJ. (b) Neurites outgrowth of dorsal

root ganglion (DRG) neurons when cultured with neurobasal, 50% DPSC-CM + 50%

neurobasal, 75% DPSC-CM + 25% neurobasal and 100% DPSC-CM. (c) Box plot

diagram presenting the quantitative analyses for neurite outgrowth of DRG neurons.

***P < 0.001 indicates significance from other CM concentrations and **P<0.01

indicates significance between indicated concentrations, as determined by two-way


65

ANOVA followed by Bonferroni post hoc test. The results represent the mean of

triplicate cultures of three independent experiments; n= 3 mice.

5.2.2. Reproducibility of DPSC-CM between donors

Next, we sought to determine the reproducibility of our protocol between donors.

DPSC-CM harvested from 3 different donors (15-23 years old) were tested on primary

sensory neurons isolated from 3 different mice: neurons isolated from the various mice

were cultured in DPSC-CM and neurobasal as a negative control. No statistically

significant difference could be observed between mice (isolated neurons) when

considering neurite length per neuron, while a significant impact of DPSC-CM was

always present compared to neurobasal (Figure 5.2.a).

Takin together, these results showed no significant impact of DPSC donors on the

efficiency of their secretomes. However, to avoid variability in our study, we decided

to continue the experiments with CM produced from a single donor.

5.2.3. Medium conditioning period

The impact of the DPSC conditioning period on CM efficiency was investigated.

Neurons were cultured in DPSC-CM harvested after 48 or 72 hours. Extending the

conditioning time by one more day does not improve the effect of DPSC-CM (3028.5

± 358 µm, 86 neurons vs 3238.4 ± 328.3 µm, 100 neurons for 48h-CM and 72h-CM

respectively) (Figure 5.2.b). The results represent the average of cultures from two

independent experiments on two mice. For the results obtained in each experiment, see

Figure C1.b of Appendix C.

5.2.4. Packaging conditions of DPSC-CM

Next, we determine whether the storage conditions of DPSC-CM might influence their

regenerative capacities. Neurons were cultured with either freshly harvested DPSC-CM

or the same DPSC-CM frozen at -20°C for a few hours. Frozen storage of DPSC-CM

did not affect its positive effect on total neurite length per neuron (Figure 5.2.c).

Therefore, for the next experiments, multiple volumes of DPSC-CM were prepared at

once, aliquoted, and frozen until use (after one month).


66

The results represent the average of cultures from two independent experiments on two

mice. For the results obtained in each experiment, see Figure C1.b of Appendix C.

Figure 5.2: (a) Impact of donors and recipients on the effect of CM. DRG neurons of

three mice (M1, M2, and M3) were treated with unconditioned or DPSC-conditioned

medium. (b) Effect of time conditioning elongation (72 hours compared to 48 hours)

on neurites length. (c) Effect of frozen DPSC-CM on neurites length. The results in (c)

and (d) represent the mean of triplicate cultures of two independent experiments; n= 2

mice. Box plot diagrams presenting the quantitative analyses for neurite outgrowth of

DRG neurons. ***P< 0.001 in (a) indicate significance between CM and control for

each mouse as determined by one-way ANOVA followed by Bonferroni post hoc test.

Two-ways Anova tests were used in (b) and (c).

5.2.5. Culture of DPSCs with B-27 supplement during medium conditioning

Further, we investigated whether the culture of DPSCs with B-27 supplement during

medium conditioning could influence neuronal outgrowth. We, therefore, compared

CM obtained from DPSCs cultured or not with B-27, to a neurogenic medium

containing BDNF, NGF-ß, NT-3 (10 ng/mL each), and B-27 (positive control, C+).


67

Following media conditioning of DPSCs cultured with B-27 (DPSC-CM pre B-27),

this supplement could still be partially present in the medium. As an additional control,

we, therefore, added B-27 directly in the CM obtained with DPSCs cultured without B-

27 (DPSC-CM post B-27). The use of the neurobasal medium with B-27 only served a

negative control (C-). We observed that CM was more effective when B-27 was added

to DPSCs than when it was added after CM production: 2714 ± 97 µm (809 neurons)

vs 1630 ± 95 µm (883 neurons) for DPSC-CM pre B-27 and DPSC-CM post B-27,

respectively. Both CM were more effective than negative control C- (1147 ± 11 µm,

727 neurons) but less effective than positive control C+, which induced the longest

neurites (3563 ± 115 µm, 681 neurons) (Figure 5.3). The results represent the average

of cultures from six independent experiments on six mice. For the results obtained in

each experiment, see Figure C1.c of Appendix C.

Figure 5.3: (a) Illustration of neurites outgrowth from DRG neurons treated with an

unconditioned neurobasal medium but supplemented with B-27 (C-); CM obtained

from DPSC cultured with media containing B-27 (DPSC-CM pre B-27), DPSC-CM

where B-27 has added only following conditioning (DPSC-CM post B-27); Neurobasal

containing B-27 and NTFs served as a positive control (C+). (b) Box plot diagram

presenting the quantitative analyses for neurites outgrowth of DRG neurons with these

different mediums. ***P < 0.001 indicates significance from other treatments and

**P<0.01 indicate significance between indicated treatments, as determined by two-


68

way ANOVA followed by Bonferroni post hoc test. The results represent the mean of

quadruplicate cultures of six independent experiments; n= 6 mice.

5.2.6. Composition of DPSC-CM in neurogenic factors

We aimed at identifying the secreted factors that potentially promote the neurite

outgrowth effect of DPSC-CM in sensory neurons. An antibody arrays test, which

targets 40 factors, was performed for the CM obtained from DPSCs cultured in the

presence or absence of B-27 supplement. A total of 34 factors was above the detection

threshold.

The expression levels of NT-3, PDGF-AA, HGF, IGFBP (1-6), EGF R, OPG, and

VEGF were significantly higher in CM obtained from DPSCs cultured with B-27

supplement. GDF-15, SCF R, and Insulin were significantly detected only in this CM.

However, some factors (BMP-7, FGF-7, and IGF-1) were significantly higher when

DPSCs were cultured without B-27, and FGF-4, GH, and VEGF-D were significantly

detected only in that CM.

This total of factors is involved in cellular proliferation and migration, neurogenesis,

neuroprotection, angiogenesis, and osteogenesis (Table 5.1). The levels of other factors

were not significantly modified by the presence of B-27 during the cell conditioning,

or they were below the detection limit (Figure 5.4). The overview of the antibody array

results of CM obtained from DPSCs cultured with or without B-27 supplement is

presented in columns (e) and (c) of Table B1 in Appendix B, respectively.


69


CM obtained from DPSCs cultured with or without B-27 supplement. The array was

scanned, and the intensities of signals were quantified. The relative expression levels

are displayed as subtraction between DPSC-CM obtained with B-27 supplement (black

bars) and DPSC-CM obtained without B-27 (grey bars). Data are presented in pg/mL

as Means ± SD. ***P < 0.001, **P<0.01, *P<0.05 indicate significance between both

CM, as determined by two-tailed Student’s t-test.


70

Growth

factors

(pg/mL)

Functions

NT-3 Neurotrophins

BMP-7 BMPs induce the formation of both cartilage and bone (256)

EGF-R EGF-R Activation Mediates Inhibition of Axon Regeneration (257)

FGF-4 FGF4 induces cell proliferation (258) (259) and has angiogenic properties (260)

FGF-7 FGF7 induces cell growth (261-263), migration (263, 264), and differentiation (265)

GDF-15 GDF15 is a stress-induced cytokine released in response to tissue injury (266)

SCF R SCF induces the outgrowth of c-kit-positive neurites from DRGs (267). 20% of all DRG neurons expressed

c-Kit (SCFR) (268)

PDGF-AA PDGF-AA may function to regulate bone formation (269). PDGF-AA myelinate nerve fibers throughout the

CNS (270). PDGF-AA is important for neuroprotection (253)

GH GH promotes axon growth (271, 272)

HGF HGF cooperates with NGF to enhance axonal outgrowth from cultured DRG neurons (273)

IGF-1 IGF-1 promotes neurite outgrowth of DRG neurons (274, 275)

IGFBP-1 IGFBPL1 promotes axon growth (276)

IGFBP-2 IGFBP-2 participates in some aspect of axonal growth (277)

IGFBP-3 IGFBP-3 has a role in cell death and survival in response to a variety of stimuli (278)

IGFBP-4 IGFBP-4 was shown to inhibit IGF1 action (279)

IGFBP-6 IGFBP‑6 is an important neuronal survival factor secreted from hMSCs (280). The BP6 labeled cells

represent approximately only 10%–20% of the total neuronal population in a DRG (281)

Insulin Insulin receptor signaling has a role in regulating neurite growth (282, 283)

OPG OPG inhibits osteoclastogenesis and bone resorption (284, 285). It prevents the neurite growth-inhibitory

signal in sympathetic and sensory neurons (285)

VEGF VEGF is angiogenic factor (286). It stimulates axon outgrowth from DGR (287)

VEGF-D VEGF-D can control the length and complexity of dendrites (288)

Table 5.1: Physiological effects of the human growth factors in DPSC-CM,

significantly modified when DPSCs were cultured with B-27 supplement.

5.3. Discussion

Previous studies have shown that DPSCs significantly enhance axon regeneration, with

neuroprotective effects on DRG neurons (289). DPSCs release neurotrophic factors

which enhance neurite guidance, promote neuronal growth both in vivo and in vitro,


71

stimulates rescue survival of neurons, and induces neurogenesis at the site of injury

(290). The field of paracrine-mediated processes involving secreted trophic factors is

increasingly studied, with a specific interest in optimizing neurotrophic factors

production (291). Altering DPSCs culture conditions to prime and/or to pre-

differentiate the cells is a way to improve secreted factors production. Thus, it has been

demonstrated that following pre-differentiation into Schwann-like glial cells, DPSCs

secreted significantly more neurotrophins and were able to further stimulate neurite

outgrowth in an in vitro model of spinal cord injury as compared to nondifferentiated

cells (292). In another study, DPSC stimulation with neuregulin1-β1, basic fibroblast

growth factor, platelet-derived growth factor, and forskolin significantly increase

protein levels of neurotrophic factors compared to unstimulated controls (289). In this

work, we defined the optimal preconditioning of DPSCs to enhance neurites outgrowth

of DRG sensory neurons.

B-27 used to stimulate DPSCs, is the most cited neuronal cell culture supplement and

it is serum-free. While its composition has been published Brewer et al. in 1993, the

exact concentrations of its components are not known (293) (see Appendix D). B-27 is

commercially available as GMP-grade and has been already used in clinical-scale cell

productions (294), which does not alter the GMP character of our CM.

The levels of DPSC secreted factors, in our study, are similar to that of many other

studies that show a neuro-regenerative potential of mesenchymal stem cell-conditioned

medium: NGF, BDNF, NT-3.., with concentration levels varying between 0 and 70

pg/mL (191). However, differences in CM preparation procedures may explain why

some factors present in CM of some studies are not present in ours and inversely. Some

studies used fetal bovine serum or other supplements as human platelet lysate, while

we used serum-free media (13). The washing step before adding a serum-free medium

is important to remove any trace of the serum. Moreover, MSCs might be cultured in

different kind of basal medium, which affect the secretory potential of MSCs (21).

Furthermore, in our study, we did not concentrate CM before use.

A great variety of extracellular signals are already known to induce axon growth. For

instance, a family of peptide trophic factors called neurotrophins, which in mammals

include NGF, BDNF, NT-3, and NT-4/5, has been thoroughly studied (295). The

effects of neurotrophins on neuronal outgrowth have been well described in different

types of neuron populations in both the central (296-299) and the peripheral nervous

system (299-301). The DRG sensory neurons from adult mice in primary culture


72

express the cognate receptors of the neurotrophins NGF, BDNF, NT4, and NT3, which

are members of the tropomyosin-related kinase (TrkA, B, and C) receptor tyrosine

kinase family and probably account for part of CM effects (302).

In addition to neurotrophins, some other factors like VEGF (287), HGF (273), IGF-1

(274) have been known for their neurotrophic action and shown to promote DRG

neurites growth. The results of microarrays suggest that NTF might not be the only

effective growth factors on DRG sensory neurons, since they are almost present equally

in CM with and without stimulation of DPSCs, except for NT-3 which increased

significantly with stimulated DPSCs, but it acts only on 10% of DRG neurons.

Other than HGF and VEGF, various factors present in stimulated DPSC-CM may be

involved in its promoted neuro-potential. Further studies are needed to confirm whether

this effect is attributed to the release of these factors, not yet studied for this effect, such

as IGFBP (3-6), GDF-15, PDGF-AA…

Other studies investigating mesenchymal stem cells secretome effect on neurites

growth predicted as well the existence of undetermined factors responsible for the

neurite outgrowth, other than the well-known neurotrophic factors (303, 304). Park et

al. asked whether this effect is attributed to the release of paracrine acting factors, such

as IGFBP-4 and -6, secreted at high levels by stimulated MSCs (305). IGFBP‑6 is

already indicated as an important neuronal survival factor secreted from MSCs (280),

but its potential for neurites growth is not yet studied. Additional work must be done to

determine the factors secreted by stimulated DPSCs that are responsible for this

regenerative effect.

73

CHAPTER 6: DPSC-CM FOR BONE TISSUE

REGENERATION

Chapter 6: DPSC-CM for bone tissue regeneration

74

6.1. Evaluation of MG-63 as a human primary osteoblast model

6.1.1. Introduction

Primary human osteoblast should be used at low passage numbers, as phosphatase

alkaline (ALP) activity and the ability to form mineralized areas decreased on serially

passaged osteoblast cultures (306). Also, the availability of bone tissue to isolate human

primary osteoblasts is limited, and obtaining uniform cultures in high cell yields is

difficult (307). Therefore, the search of an osteoblast cell model for in vitro research is

necessary.

Immortalized cell lines are the most frequently used in basic and applied biology

research (308). Among others, a human osteoblast-like MG-63 cell line, derived from

a 13-year-old male Caucasian osteosarcoma patient (309), is widely used in bone

research studies (310-313), despite inconsistencies in the literature regarding their use

as a model for osteoblast phenotype development and matrix mineralization (314).

In a study conducted by Pautke et al., osteosarcoma cell lines MG-63, Saos-2, and U-

2OS were characterized and compared to human osteoblasts; the labeling profile of

MG-63 cells revealed both mature and immature osteoblastic features and was the most

heterogeneous of the investigated osteosarcoma cell lines (315). This could explain the

different results observed with this osteoblastic-like cell model.

One advantage of the MG-63 cell line is the stable characteristics in a wide range of

cell culture passages (316), allowing reproducible results and a high number of

biological replicates.

A temporal sequence of expression of genes encoding osteoblast phenotype markers

defines three distinct periods (Figure 6.1): a growth period, a period of matrix

development, and a mineralization period (317, 318). The proliferation stage is

characterized by an increase of type 1 collagen expression, ALP is considered a relative

early marker of matrix maturation and later (319), BSP and OCN are mature osteoblast

genes, expressed at late stages of osteodifferentiation (320-322).


75

Figure 6.1: Reciprocal and functionally coupled relationship between cell growth

(proliferation, matrix production, and mineralization) and differentiation-related gene

expression (ALP, Col, and OC).

Herein, we compare proliferation rate, phosphatase alkaline activity, bone marker genes

expression, and the mineralization of MG-63 to those of human primary osteoblasts, to

justify their use for in vitro research studies investigating the phenotypic development

and behavior of osteoblasts in response to environmental changes, external factors, and

therapeutic agents.

6.1.2. Results

6.1.2.1. Role of osteogenic supplements on osteoblastic cell

To create an appropriate in vitro environment, and induce efficient maturation and

mineralization of osteoblastic cells matrix, ascorbate phosphate, dexamethasone, and

ß-glycerophosphate were added to the culture medium throughout all the in vitro

experiments. These factors were investigated for their effect on proliferation,

maturation, and mineralization of MG-63 osteoblasts. Results showed that

dexamethasone stimulated cell proliferation and increased ALP activity. The presence

of ß-glycerophosphate seemed to be essential for calcium deposition, corresponding to

bone tissue mineralization. Ascorbate phosphate increased MG-63 cell number

insignificantly. Results are summarized in Figure 6.2.


76

Figure 6.2: Roles of ascorbate phosphate, dexamethasone and b-glycerophosphate

supplements in osteoblastic cell proliferation, and extracellular matrix maturation and

mineralization. (a) and (b) Proliferation assays at days 1, 2, 3, and 4 of MG-63 after

culture in medium with or without supplements. (c) Quantified ALP activity normalized

to total protein in MG-63 after 18 days of culture in medium with or without

supplements. (d) Quantified calcium deposits in MG-63 after 21 days of culture in

medium with or without supplements. The results represent the mean ± SD of triplicate

cultures of one representative experiment. *p<0.05, ***p<0.001 indicate significance

between medium with- versus without- supplements, as determined by two-tailed

Student’s t-tests for (a) one-way ANOVA test for (b), (c), and (d). (e) Representative

phase-contrast microscopy images of alizarin red staining of MG-63 after 21 days of

culture in medium with (e) or without (f) supplements, showing calcium deposits (dark

red staining) and mineralized nodules (in brown). Scale bar =200 µm. Magnification:

10x. +A: ascorbate phosphate; +B: ß-glycerophosphate; +D: dexamethasone.

6.1.2.2. Osteoblast characterization

Osteoblasts were first characterized before start experiments. After 4 days of culture in

DMEM + 10% SVF, 60% of cells were positive to Red-Color Alkaline phosphatase

Staining (Figure 6.3.b). The osteogenic environment induces ALP expression compared

to DMEM. ALP increases until it peaks around day 13, then it decreases. The absence


77

of such an environment and the non-osteodifferentiation of cells in DMEM medium

causes ALP to continue increasing over time (Figure 6.3.a).

The production of alkaline phosphatase is an identifying characteristic of osteoblasts.

However, some other cell types such as fibroblasts, which are the main cell type

contaminating the cultures of osteoblasts, may be able to produce this enzyme to some

extent. Therefore, osteoblasts' ability to form a mineralized matrix in vitro after

stimulation with β-glycerophosphate has to be confirmed (323). Indeed, calcium

secretion was induced by the osteogenic medium, while any sign of mineralization was

detected in the DMEM medium (Figure 6.3.c and d).

Figure 6.3: Characterization of human primary osteoblasts. (a) ALP activity at days 9,

13, and 18 of osteoblasts after culture in DMEM or OM. (b) ALP coloration with Red-

Color AP Staining Kit of human primary osteoblasts (passage 3) isolated from bone

fragment attached to the extracted tooth and cultured in DMEM + 10% FBS until

adherence. (c) Representative phase-contrast microscopy images of alizarin red staining

of osteoblasts after 21 days of culture in DMEM or OM. (d) Quantified calcium deposits

in osteoblasts after 21 days of culture in DMEM or OM. The data are presented as mean

± SD of triplicate culture. ***p < 0.001 significance between DMEM and OM, as

determined by two-tailed Student’s t-tests. Scale bar =200 µm. Magnification: 10x.


78

6.1.2.3. ALP activity mapping and calcium deposition in MG-63 cultures

Phosphatase alkaline measurements demonstrated that ALP activity increased over

time, peaking at day 18, before decreasing before returning to basal levels (Figure

6.4.a). Calcium deposits were observed at day 14 with the presence of some nodules.

The mineralization was increased with time as shown in Figures 6.4.b, c, and d.

Figure 6.4: Quantification of phosphatase alkaline activity and calcium deposits in MG-

63 cultures. (a) ALP activity after 9, 13, 18, 23, and 26 days of culture in OM. (b)

Quantified calcium deposits after 14 and 21 days of culture in OM. The data are

presented as mean ± SD of triplicate culture and are representative of two independent

experiments. (c) and (d) Representative phase-contrast microscopy images of alizarin

red staining of MG-63 cultures at days 14 and 21 respectively. Calcium deposits in

images are represented by the red staining and mineralized nodules are stained in

brown. Scale bar =200 µm. Magnification: 10x.

6.1.2.4. MG-63 versus osteoblasts: proliferation, ALP activity, and gene

expressions

Compared to osteoblasts, MG-63 cells have shown a greater proliferation. A significant

difference between the cell number of the two types of cells appeared as early as the

second day (Figure 6.5.a). ALP activity normalized to total protein was significantly

lower in MG-63 compared to osteoblasts cell as measured after 6 days of culture in OM

(Figure 6.5.b). Similarly, gene expression of BSP and OCN was lower in MG-63 cells


79

as determined after 10 days of culture in OM (Figures 6.5.d and e). Interestingly, Runx2

was not detected in MG-63 cells in contrast to osteoblasts (Figure 6.5.c).

Figure 6.5: Comparison of proliferation, ALP activity, and osteogenic gene expressions

of Osteoblasts and MG-63 cultured in OM. (a) Proliferation assay at days 1, 2, 3, and

4. (b) Quantified ALP activity normalized to total protein after 6 days of culture in OM.

(a) and (b) are representative of 3 three independent experiments. (c), (d) and (e) Real-

time reverse transcription-polymerase chain reaction showing respectively mRNA

levels of Runx2, BSP, and OCN genes respectively of cells after 9 days of culture in

OM. Actin was used as the house-keeping gene for normalization. (c) and (d) are

representative of two independent experiments. The data in all assays are presented as

the mean ± SD of a triplicate culture of one representative experiment. **p < 0.01 and

***p < 0.001 significance between osteoblasts and MG-63, as determined by two-tailed

Student’s t-tests.

6.1.2.5. MG-63 versus osteoblasts: collagen and osteocalcin expressions

Fluorescent images showed an increased cell number in MG-63 cultures compared to

osteoblasts as already demonstrated by the MTT test. This was accompanied by higher


80

expressions of collagen and osteocalcin in the whole culture after 6 (for col) and 21 (for

OCN) days of culture respectively in OM. These results are summarized in Figure 6.6.

Figure 6.6: Fluorescence microscopic images of osteoblasts and MG-63 cells incubated

with collagen antibodies (red) and FITC-labelled osteocalcin antibodies (green) after

respectively 6 and 21 days of culture in OM. (a) and (b) Col expression (red) in

osteoblasts and MG-63 cells respectively. (c) and (d) OCN expression (green) in

osteoblasts and MG-63 cells respectively. Nuclei were stained with DAPI (blue) Scale

bar =50 µm. Magnification: 40x.

6.1.2.6. MG-63 versus osteoblasts: calcium deposition

The same, results of quantified alizarin red staining showed a higher level of calcium

secretion in the whole MG-63 cultures compared to osteoblasts (Figure 6.7.a), and

images revealed more mineralized nodules (Figures 6.7.d and .6.7.c respectively),


81

which is attributed to the higher number of cells as more secreted calcium was observed

in osteoblasts cells when data were normalized by the total protein content (Figure

6.7.b).

Figure 6.7: (a) and (b) Quantified calcium deposits in osteoblasts and MG-63 in the

total sample and per cell respectively after 21 days of culture in OM. The results are the

mean ± SD of triplicate cultures of three representative experiments. ***p<0.001

indicates significance between osteoblasts and MG-63 as determined by two-tailed

Student’s t-tests. (c) and (d) Representative phase-contrast microscopy images of

alizarin red staining of osteoblasts and MG-63 respectively after 21 days of culture in

OM. Calcium deposits in images are represented by the dark red staining and

mineralized nodules are stained in brown. Scale bar =200 µm. Magnification: 10x.

6.1.3. Discussion

Numerous studies in the literature have concluded that the MG-63 cell type, derived

from a malignant solid bone tumor “osteosarcoma”, is not representative of primary

osteoblast cultures (324, 325). Tumor cells differentiate from normal osteoblasts at

different levels, such as cell proliferation and matrix production (324). A total of 268

microRNAs, which play roles in diverse biological processes including proliferation

and differentiation (326), were significantly dysregulated in MG-63 when compared

with the osteoblast cell line (327). Also, differences in matrix protein secretion by MG-


82

63 cells or osteoblasts were approved in the literature (328, 329). However, MG-63s

are widely used to investigate osteoblast behavior and functions (330-332). The

similarity of MG- 63 and normal osteoblasts in their response to vitamin D and

parathyroid hormone administration makes them an attractive model for hormonal

regulation of phenotypic change studies (314). Moreover, (333) showed that MG-63

has the osteoblast phenotype; during the differentiation of MG-63 cells, there are the

following three principal periods: proliferation, extracellular matrix maturation, and

mineralization.

In this study, a comparison was made between MG63 and osteoblasts to assess the

possibility of their use as a model to study the phenotypic development of osteoblasts

and their matrix mineralization.

To create an osteogenic environment necessary for the maturation of both osteoblastic

cells, a combination of supplements was used. β-glycerophosphate, dexamethasone,

ascorbic acid, and other supplements were used in the literature in varying

concentrations to generate a mature osteoblast phenotype (334). The impact of each

supplement and the needed concentrations were widely investigated. Dexamethasone

at 10-8 M had a significant effect on the proliferation and differentiation of osteoblasts

(335), and β-glycerophosphate appeared to be indispensable for mineralization (336),

which is consistent with our results. Ascorbic acid was suggested to stimulate the

osteoblast proliferation through its effect on the synthesis of collagen (337, 338), and

to promote the synthesis of osteocalcin and nodules by cells (339); however, no clear

effect of ascorbate was observed on osteoblastic cell proliferation, maturation, and

mineralization in our study.

A high rate of increase in the MG-63 cell number accompanied the osteodifferentiation

process. MG-63 undergone deregulation of cell growth and gene expression, which may

lead to high proliferation rates and differentiation into the osteoblastic lineage at the

same time (340).

Some studies showed that the regulation of alkaline phosphatase activity in MG-63 was

not representative of primary osteoblast cultures (341) and that ALP activity tended to

decrease with culture time in MG-63 cultures (342). Here, MG-63 cells appear to have

almost the same ALP activity pattern as osteoblasts, but at a lower level as already

shown by (343) and with a remarkable delay in reaching the peak of expression (after

13 and 18 days for osteoblasts and MG-63 respectively). ALP is suggested to peak

during differentiation and reduce with mineralization (340); this was clear in our study,


83

referring to the difference in the evolution of ALP activity in osteoblasts cultured in a

normal versus osteogenic medium (Figure 6.3.a). Taken together, these data indicate

that osteoblasts reach the mature level of osteodifferentiation faster than MG-63 cells,

which is normal since MG-63s are defined as pre-osteoblastic cells.

Surprisingly, the Runx2 gene was not detected in MG-63 cultures. Although the Runx2

gene dose is essential for normal bone formation, remodeling, and regeneration (344),

overexpression of Runx2 in osteoblasts inhibits osteoblast maturation (345) and leads

to high bone resorption (346). Thus, the precise functions of Runx2 in bone formation

are complex (347). Studies in vitro have shown that Runx2 regulates bone marker gene

expression (348). Nevertheless, the precise effects of Runx2 on BSP expression remain

unclear, and species variations in Runx2 regulation of BSP expression were suggested

(347). Unlike our results, the non-detection of Runx2 in MG63 cells was accompanied

by an absence of BSP as well, in a study conducted by (349). No effect of Runx2 was

observed on the human BSP promoter expressed in the rat osteosarcoma cell line (UMR

106-01), but the relative activities of the BSP constructs to the osteocalcin promoter

were much higher (350), which is coherent with our study outcomes. Compared with

human osteoblasts, levels of BSP and OC RNA in MG-63 cells were lower detected

which is consistent with previous observations (343).

Deletion of Runx2 in osteoblasts led to a decrease in the mineralized matrix beneath

the growth plate in a study conducted by (351), whereas the mineralization of MG-63

cultures was well established in our study despite the non-detection of the Runx2 gene.

Our finding demonstrated that MG-63 cells can form mineralized nodules when

exposed to a differentiation medium, unlike other studies (325). Calcium accumulation

was clear at 14 days, and we did not need to reach 28 days to see the mineralization

(349). (333) showed that MG-63 cells displayed nodule formation even at the 12th day,

and became more prominent on the 18th day.

Although osteoblasts showed higher expression of ALP and osteodifferentiation marker

genes and a higher calcium accumulation at the cellular level, it is interesting to note

that the total calcium content of MG-63 exceeded that of osteoblasts cultures after 21

days of culture in OM. Similarly, the fluorescent images showed a higher expression of

collagen and osteocalcin in the whole cultures of MG-63. This can be explained by the

very high number of cells in MG-63 cultures compared to osteoblasts.


84

6.2. Potential of DPSC-CM for bone tissue regeneration

6.2.1. Introduction

Reconstruction of bone defects generated by fractures, tumors, infections, or congenital

diseases is a real challenge in oral and maxillofacial surgery and orthopedics (352).

Bone can regenerate and repair itself; however, this capacity may be impaired or lost

depending on the size of the defect or the presence of certain disease states (353).

Currently, many strategies are used to augment the impaired or ‘insufficient’ bone

regeneration process, such as autologous bone graft, free fibula vascularized graft,

allograft implantation, distraction osteogenesis, and the use of biomaterials/scaffolds,

stem cells, and growth factors (354).

First, various stem cells have received extensive attention in the field of bone tissue

engineering due to their distinct biological capability to differentiate into osteogenic

lineages (355). Recently, Several studies suggested the therapeutic potential of MSC

secreted factors for bone regeneration (15).

To date, available data show an overall favorable effect of MSC-CM application in

bone engineering and regenerative medicine. In animal models, MSC-CM application

significantly increases the regeneration of bone defects, and the very few human studies

report early mineralization in regenerated bones, with no inflammation, nor local or

systemic alterations (352). However, few studies showed an unfavorable effect of

MSC-CM on bone regeneration. BMSC-CM was shown to transiently retard osteoblast

differentiation by downregulating Runx2 (356). Similarly, it was observed that BMSC-

CM repressed the proliferation and differentiation of osteoblasts in osteogenic medium

(357).

The few studies investigating the effect of DPSC-CM on bone tissue regeneration

indicate that DPSC-CM could initiate the new bone formation and accelerate bone

healing (358). Here, we assessed the effect of human DPSC-CM on the osteogenic

process and its potential for bone tissue regeneration.

Dental pulp stem cells were used for two distinct purposes in this study: to harvest their

secretome (DPSC-CM), and for their ability to differentiate into osteoblasts (OBs)

throughout the study. MG-63 and OBs were used to assess the effect of DPSC-CM on

cell maturation and osteodifferentiation respectively. Their effect on osteoblastic cell

proliferation and mineralization were also investigated.


85

6.2.2. Results

6.2.2.1. DPSC-CM effect on MG-63

MTT test showed that DPSC-CM promoted the proliferation of MG-63 compared to

OM, starting from the third day (Figure 6.8.a). ALP activity of cells cultured in DPSC-

CM was maximal at day 6 and decreased over time. MG-63 demonstrated higher ALP

activity with DPSC-CM compared to OM (Figure 6.8.b). Similarly, cells cultured in

DPSC-CM displayed higher gene expression of BSP and OCN (Figures 6.8.c and d).

Runx2 was very weakly expressed or not detected with DPSC-CM and OM. However,

no difference was observed in the quantity of calcium deposits between MG-63

cultures, reflecting the same mineralization level obtained with DPSC-CM and OM

(Figure 6.8.e).

Figure 6.8: DPSC-CM effect on proliferation, ALP activity, osteogenic gene

expressions, and extracellular calcium deposits of MG-63 cultures. (a) Proliferation

assay at days 1, 2, 3, and 4 of MG-63 after culture in DPSC-CM or OM. (b) Quantified

ALP activity normalized to total protein in MG-63 after 6, 12, and 18 days of culture

in DPSC-CM or OM. (c) and (d) Real-time reverse transcription-polymerase chain

reaction showing respectively mRNA levels of BSP and OCN genes of MG-63 after 9

days of culture in DPSC-CM or OM. Actin was used as the house-keeping gene for


86

normalization. (e) Quantified calcium deposits in MG-63 after 21 days of culture in

DPSC-CM or OM. The data are presented as mean ± SD of a triplicate culture of at

least two independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001

significance between DPSC-CM and OM, as determined by two-tailed Student’s t-tests.

6.2.2.2. DPSC-CM effect on OBs

To confirm and understand the findings obtained with MG-63 cells, the same

experiments were performed with another cell type (OB)s, and the osteogenic gene

expressions were assessed after 9 and 21 days of osteodifferentiation process. Besides,

the expression of collagen and osteocalcin was evaluated in CM and OM groups.

As for MG-63 cultures, OB cells cultured in DPSC-CM presented the highest ALP

activity after 6 days. This activity then decreased over time, unlike OB cells grown in

OM which showed an increase in ALP activity from day 6 to day 18. On day 6, ALP

activity was considerably increased with DPSC-CM (Figure 6.9.a). Fluorescent images

also showed higher collagen expression with DPSC-CM compared to OM. On day 9,

the Runx2, BSP, and OCN genes were significantly more expressed in OB grown in

DPSC-CM than in OM. Then, osteogenic genes expression increased to reach a similar

level at day 21 (Figure 6.9.b, c, and d) in both cultures, which were also equally

mineralized (Figure 6.9.e), with no significant difference in the expression of OCN

(figure 6.9.f.iii and ⅳ).


87

Figure 6.9: DPSC-CM effect on ALP activity, osteogenic gene expressions, and

extracellular calcium deposits of OB cultures. (a) Quantified ALP activity normalized

to total protein in OBs after 6, 12, and 18 days of culture in DPSC-CM or OM. (b), (c)

and (d) Real-time reverse transcription-polymerase chain reaction showing respectively

mRNA levels of Runx2, BSP, and OCN genes of OBs after 9 and 21 days of culture in


88

DPSC-CM or OM. Actin was used as the house-keeping gene for normalization. (e)

Quantified calcium deposits in OBs after 21 days of culture in DPSC-CM or OM. The

data are presented as mean ± SD of a triplicate culture of two independent experiments.

**p < 0.01, and ***p < 0.001 significance between DPSC-CM and OM, as determined

by two-tailed Student’s t-tests. (f) Fluorescence microscopic images of OBs incubated

with collagen antibodies (red) and FITC-labelled osteocalcin antibodies (green) after

respectively 6 and 21 days of culture in CM (i and iii) or OM (ii and ⅳ). Nuclei were

stained with DAPI (blue) Scale bar =50 µm. Magnification: 40x.

6.2.2.3. Composition of DPSC-CM in growth factors

Antibody arrays revealed the presence of 16 over 40 factors in DPSC-CM. The

expression levels of these growth factors (BDNF, bFGF, BMP-4, BMP-5, BMP-7,

bNGF, EGF R, GH, HGF, IGF-1, IGFBP-2, IGFBP-3, IGFBP-6, NT-4, PDGF-AA,

VEGF R2) were above the detection limit (Figure 6.10).


DPSC-CM.


89

6.2.3. Discussion

Previously published studies showed that BMSC-CM increased the migration,

proliferation, and expression of osteogenic and angiogenic marker genes of MSCs in

vitro, and enhanced early bone tissue regeneration in vivo (359-363). BMSC-CM

collected under hypoxic conditions enhanced bone regeneration in calvarial bone

defects by inducing migration of endogenous MSCs (364). It was also shown that the

conditioned medium collected from ASCs has a specific potential for bone tissue

regeneration (365). To our knowledge, the potential role of conditioned media collected

from dental MSCs for bone regeneration was investigated only in two studies. The first

showed that SHED-CM promoted bone morphogenesis not only around the implant

interface but also at distant locations from the implant surface during the early stages

of osseointegration (143). The other demonstrated that hypoxic DPSC-CM promoted

bone healing in the distraction osteogenesis model in vivo, however, it did not enhance

the mineralization capacity of osteoblasts in vitro (366). In the study presented here, we

evaluated the capacity of DPSC-CM to promote proliferation, differentiation, and

mineralization process of osteoblastic cells in vitro, and to stimulate bone tissue

regeneration in vivo.

As already described, three distinct periods characterize the phenotype of osteoblasts:

a growth period, a period of matrix development marked by the expression of ALP, and

a mineralization period (317, 318). There is a contradiction in the literature about the

relationship between cell growth and ALP activity (367-370). In this study, higher ALP

activity was correlated with an increased osteoblastic cell number, both induced by

DPSC-CM compared to control. However, the cellular proliferation rate during the

osteodifferentiation was not investigated as the proliferation assay was performed just

for the first 4 days. The development curve of the ALP activity has been modified with

DPSC-CM. While it continued to increase over time in the control group, the ALP level

decreased consecutively between days 6 and 18 with DPSC-CM. ALP activity

decreased as the progress of the culture to the mineralization stage (317), indicating that

DPSC-CM accelerated the osteogenic differentiation of osteoblastic cells. This was

confirmed by the increase in the expression of osteogenic markers at an early stage of

osteoblastic differentiation in the DPSC-CM group, before reaching the same level as

the control on day 21, with no difference in mineralization levels between the two

groups.


90

The results of the in vivo experiments (micro-CT and histological analysis), carried out

on rat bone defect models, are still in progress.

DPSC-CM are a mixture of several factors that are responsible for their final effects.

While the function of bFGF is inconclusive in the literature (371), several among the

analyzed and detected factors are known to play a role in osteogenesis like BMPs (372).

PDGF-AA increases osteoblast replication (373, 374). The exogenous addition of

BMP-4 and BMP-6 has been shown to stimulate osteoblast differentiation (375-377).

IGF-I play also significant roles in bone growth and remodeling (378), and it could

promote osteogenic differentiation when added to the medium (379). Moreover, GH

exerts direct anabolic effects on exposed human osteoblasts (380), and BDNF promotes

the regeneration of experimentally created periodontal defects (381). The addition of

IGFBP-2 to calvarial preosteoblasts isolated from IGFBP-2 knockout mice restored

impaired differentiation (382). IGFBP-2 added to osteoblasts in culture, plays a

potentiating role in IGF-II action in the early stages of differentiation (383). The role

of exogenous IGFBP-3 and IGFBP-6 is contradictory. Added IGFBP-3 stimulates the

IGF action of osteoblasts in vitro (384), but it inhibited osteoblast differentiation in a

study conducted by (385). Likewise, (386) suggested an inhibitory role of exogenous

IGFBP-6, as it preferentially blocks IGF-II in osteoblast cells; while extracellular

IGFBP-6 was not required to inhibit osteoblast differentiation (387).

91

CHAPTER 7: DPSC-CM FOR ANGIOGENESIS

Chapter 7: DPSC-CM for angiogenesis

92

7.1. Introduction

The growth of blood vessels (a process known as angiogenesis) is essential for organ

growth and repair, and an imbalance in this process contributes to numerous malignant,

inflammatory, ischemic, infectious, and immune disorders (388). Therapeutic

angiogenesis depends on the efficient delivery of exogenous angiogenic factors to

stimulate neovasculature formation (389).

There is substantial evidence that MSCs play a pivotal role in regulating blood vessel

formation and function through multiple mechanisms such as vasculogenesis,

arteriogenesis, and angiogenesis (390). Studies showed that MSCs could promote

endogenous angiogenesis via microenvironmental modulation (391), through their

secreted factors, which are capable of inducing angiogenesis in vitro and in vivo (392).

The important angiogenic factors secreted by MSCs include VEGF, FGF-2, Ang-1,

HGF, TGF-β, MCP-1, IL-6, and SDF-1α (393). However, the tissue origin of MSCs

has been shown to influence the angiogenic potential of the secretome or conditioned

medium, with different amounts and concentrations of secreted factors in MSCs from

different tissue sources (28). Most of the studies confirmed the potential effect of

DPSC-CM on angiogenesis (148, 149, 394, 395), with some evidence for the

superiority of DPSCs on the other stem cell types for neo-vessel regeneration (396),

and the higher amount of angiogenic factors and cytokines in DPSC secretome (148).

In this chapter, we investigate the effect of DPSC-CM on angiogenesis to assess its

potential use for vascular regeneration, using rat aortic ring assay. The aortic ring model

first described by Nicosia et al. in the early 1980s has become one of the most widely

used methods to study angiogenesis and its mechanisms (397). This three-dimensional

ex vivo model recapitulates and reproduces the entire complex cellular and molecular

processes that regulate the angiogenesis, and combines the advantages of in vitro and

in vivo models (398, 399).

7.2. Results

7.2.1. Effect of DPSC-CM on aorta microvessel growth

Results showed a significant increase in microvessel numbers of aorta rings cultured

with DPSC-CM compared to control, in only one experiment over three repetitions

(Figure 7.1.a). The outgrowths of single cells, many of which are likely to be


93

fibroblasts, are not considered to be microvessel sprouts (199), and therefore have not

been analyzed.

Figure 7.1: Microvessel sprouting from aortic rings. (a) Quantification of microvessel

sprouting from aortic rings embedded in collagen and cultured with DPSC-CM or opti-

MEM as a control. Counts were carried out using a phase-contrast microscope 6 days

after the embedding. Data are presented as the mean number of microvessel sprouts ±

SEM. (b) Phase-contrast images of aortic rings after 6 days of culture in DPSC-CM or

opti-MEM, showing microvessel outgrowth. Scale: 500 μm. Data and images represent

one experiment from three independent repetitions. Magnification: 5x.

7.2.2. Endothelial origin of newly formed microvessels

The use of phase-contrast microscopy for a crude view of microvessel outgrowth is

sufficient to identify and count microvessels during the experiment but does not

definitively distinguish endothelial sprouts from other cell types (199). Staining using

a fluorescently labeled endothelial cell-specific lectin from the bacteria Bandeiraea

simplicifolia reveals, that the sprouts observed consist of vessel-like structures

composed of endothelial cells (Figure 7.2).


94

Figure 7.2: Fluorescent images of microvessel sprouts of aortic rings after 8 days of

culture in DPSC-CM or opti-MEM as a control. (a) and (d) Endothelial sprouts were

stained with BS1 lectin-FITC (green). (b) and (e) Nuclei were counterstained with

DAPI (blue). (c) and (f) Two-channel merge. Scale bar: 500µm. Magnification: 10x.

7.3. Discussion

A wide range of proangiogenic and antiangiogenic factors was abundantly detected in

DPSC-CM by protein profiling array and ELISA (394). Application of DPSC-CM to

endothelial cells enhanced their survival under hypoxia and serum starvation in vitro

(148) and promoted cell proliferation (394) and migration (148, 149, 394, 395). Also,

DPSC-CM stimulated tubulogenesis (148, 149, 394, 395), and demonstrated

angiogenic potential in vivo (148, 395). The fraction of DPSC-CM that is responsible

for their angiogenic effects is still unclear. Xian et al. demonstrated that exosomes

promoted HUVEC proliferation, proangiogenic factor expression, and tube formation

(400). Zhou et al. showed that DPSC-CM promoted endothelial cell angiogenesis

through their Evs (401). However, the endothelial cell chemotactic potential was higher

for EV-depleted DPSC-CM compared to Evs, as demonstrated by Merckx et al. (402).

Contrariwise, Merckxs et al. showed that DPSC-CM could not increase the in ovo

angiogenesis (402). Our results showed a slight increase of microvessel number in the

DPSC-CM group, with a significant difference compared to control just in one

experiment over three independent repetitions. Interestingly, we share almost the same

procedure of DPSC-CM preparation with other studies which demonstrated

pronounced angiogenic responses triggered by DPSC-CM (394). However, we use

different study approaches. To our knowledge, it is the first time that the angiogenic

potential of DPSC-CM has been assessed using the aorta ring assay.


95

Despite the advantages of this technique, we noted the variability of the angiogenic

response in different aortic cultures, which were described in other studies. This is due

to the delicate nature of the endothelium, which can be damaged because of inadequate

handling of the aorta or the aortic rings, drying of the explants, or their excessive

exposure to alkaline pH (403). We noted also a poor angiogenic response in some

cultures, which could be caused by the suboptimal preparation of the gels resulting in a

defective matrix scaffold (403). Therefore, this method is somewhat delicate and it

requires experience in handling, to obtain robust and reproducible results (403, 404).

Variability between each assay can also occur as a result of slight inconsistencies in

animal tissue source (404). The age and genetic background of the animal significantly

affect the capacity of the aortic rings to sprout spontaneously or in response to

angiogenic factors (403).

The reported minimum effective VEGF concentration to induce effective in vivo

angiogenesis is ~5 ng/mL (405). Although the concentrations of angiogenic growth

factors in MSC-CM are too low for therapeutic use: 40 ± 5 pg/mL of VEGF in MSC-

CM in a study performed by Zisa et al. (406), 465.8 ± 108.8 pg/mL, and 339.8 ± 14.4

pg/mL of VEGF and TGF-β1 respectively in MSC-CM in the study conducted by

Katagiri et al. (407), MSC-CM demonstrated potential for angiogenesis and

vasculogenesis (407). This could be due to the synergistic angiogenic effect of the

factors altogether. To increase the concentrations of angiogenic factors in MSC-CM

secretome, many strategies were already developed. Bhang et al. used the 3D spheroid

culture of MSCs to produce a CM that is 23- to 27-fold more concentrated in angiogenic

factors than monolayer cultures (408). MSCs were stimulated by hypoxia to enhance

the angiogenic potential of their secretome (409, 410).

To optimize the outcomes of our experiment, and confirm if the angiogenic potential of

DPSC-CM is significantly present, we suggest concentrating the secretome before use.

Furthermore, the effect of DPSC-CM should be evaluated on other aspects of

angiogenesis, like endothelial cell proliferation and migration, as well as on

tubulogenesis using endothelial cell tube formation assay.

96

CHAPTER 8: DPSC-CM FOR CANCER THERAPY

Chapter 8: DPSC-CM for cancer therapy

97

8.1. Introduction

MSCs and tumor cells interact in a myriad of ways and thus the MSCs can either support

(411-416) or suppress (417-420) tumor growth depending on multiple factors (421).

The study of both direct and indirect co-culture of MSCs and cancer cells is necessary

to investigate the complexity of the interaction between these two cell types, the role of

the tumor microenvironment, and the potential use of MSCs and their derivatives as

anti-cancer agents in cancer therapy.

The exact process responsible for the effect of MSCs on cancer growth is still not clear.

While some studies refer this mostly to the secretome of MSCs (413, 422), others

demonstrated that MSC-cancer contact is determining (420, 423). A synergistic effect

involving different mechanisms was described in the literature. Several direct and/or

indirect mechanisms of interaction contribute to MSC-mediated stimulation of cancer

cell growth including notch signaling, nanotube formation, gap junctional intercellular

communication, and/or the exchange of cytokines/chemokines, extracellular vesicles,

and exosomes (424). Kalamegam et al. and Zhang et al. demonstrated that the MSC

effect on cancer is only partly due to the influence of secreted soluble factors (412,

425). Moreover, Chao et al. showed that interactions observed between selected

UMSCs and cancer cells, which caused breast cancer cell death, include binding

mechanism: breast cancer cell apoptosis from direct cell-cell contact with UMSCs, at a

various adhesion ratio, and infusion of some substance into the cancer cell by UMSCs;

cell-in-cell mechanism: breast cancer cell apoptosis from the internalization of UMSCs;

indirect (cytokine) mechanism: attenuation of breast cancer cell growth from one or

more cytokines secreted, predominantly, by co-cultured UMSCs and cancer cells or by

UMSCs alone, without direct contact with cancer cells (426).

The co-culture of cancer cells with MSCs and treatment with MSC-CM induce the same

effect in the majority of studies (412, 413, 427, 428). Nevertheless, Bajetto et al.

demonstrated the inverse, suggesting that when cocultured with tumor cells, MSCs

behave differently, either their secreted factors or the cells themselves (417).

Overall, the results obtained using MSC-CM are inconsistent and variations in

protocols might explain these differences (417). The source of the MSC population

used is crucial. For example, extravesicles (EVs) isolated from 48h CM collected from

bone marrow stem cells (BMSCs) and UMSCs decreased cell proliferation and induced

apoptosis of glioblastoma cell line. Whilst, adipose stem cells (ASCs) secreted EVs


98

increased proliferation and had no effect on apoptosis (429). Furthermore, the type of

cancer cells under study, culture media compositions, time of culture and conditioned

media collection are all factors that might strongly affect the influence of MSC-CM on

tumor cells (430).

Herein, we focus on the effect of DPSC secretome on cancer cells. We aimed to explore

the potential use of DPSC-CM as a therapeutic agent in cancer therapy. To this end, the

paracrine effect of DPSCs on cancer growth and dissemination was investigated by

transwell assay and minimal-interactive co-culture respectively, then the conditioned

medium of DPSCs was tested on cancer cells to confirm the results.

8.2. Results

8.2.1. Paracrine effect of DPSCs on MCF7 and MCF7TAX19 proliferation

Transwell assay showed an increased cancer cell proliferation by 148% ± 0.13 after 5

days of indirect co-culture with DPSCs. Similarly, a 122% ± 1.55 proliferative effect

was induced for resistant cells by DPSC’s paracrine activity (Figure 8.1.a). The MCF7

cancer cells (green fill) cultured alone or under DPSC paracrine activity are represented

in Figure 8.1.b.

Figure 8.1: Paracrine effect of DPSCs on cancer cell proliferation. (a) Paracrine effect

of DPSCs on MCF7 and MCF7TAX19 after 5 days, quantified using the Celigo plate

cytometer. The results represent the mean area ±SD of minimum triplicate cultures of


99

one representative experiment. **p<0.01, *p<0.05 between DPSCs and Control. (b)

Whole well images of MCF7 cancer cells when cultured alone or under paracrine effect

of DPSCs, segmented and presented by green fill.

8.2.2. Cancer growth and dissemination after minimal interaction with DPSCs

The MCF7 spheroid cell dissemination was carried out by the outgrowth of the whole-

cell monolayer, giving rise to symmetrical collective expansion surrounding the

spheroid base. In the co-culture model, a very minimal DPSC number is present in close

vicinity to the spheroid cells, while the main contribution of DPSCs is through a

paracrine communication. The large discrepancy of the localized area of MCF7

spheroid-derived cells compared to the DPSCs’ well-plate attachment area (around 20x

higher), in addition to the very minimal direct intercellular interaction (as limited to the

very outer MCF7 monolayer), make this model relevant for studying the effect in

“minimal-interactive” state, mostly the paracrine effect of DPSCs on spheroid cells

dissemination.

A significant increase in spheroid cell dissemination resulted from the paracrine effect

of DPSCs (Figure 8.2.a). Images at each incubation time reveal the remarkable effect

of DPSCs on spheroid cell dissemination (Figure 8.2.b).

Figure 8.2: Paracrine effect of DPSCs on the dissemination of MCF7 spheroid cells. (a)

Histogram showing the evolution of the MCF7 cell dissemination area in the presence

or not of DPSCs. The results represent the mean area ±SD of minimum triplicate


100

cultures of one representative experiment. (b) Optical phase-contrast images of

reattached MCF7 spheroids captured at 3-, 5- and 7-days in the presence or not of

DPSCs. Scale bar: 500µm. Magnification: 5x. ***p<0.001 versus control.

8.2.3. Effect of DPSC-CM on MCF7 proliferation

The secretome of DPSCs demonstrated the induction of proliferation of MCF7 cells

from the second day (Figure 8.3). The number of cells did not increase with time

throughout the experiment. This could be explained by the absence of serum in the

growth medium used for MSC-CM production since the serum is necessary for human

breast cancer cell culture (431). This is consistent with another study where they noted

a dramatic reduction in the baseline levels of MCF7 cell proliferation after 4 days of

culture in the absence of serum (432).

Figure 8.3: Proliferative effect of DPSC-CM after 2, 3, and 5 days of incubation with

MCF7 cells. * p<0.05, **p<0.01 between DPSC-CM and control. All results represent

the mean ±SD of triplicate cultures from one representative experiment.

8.3. Discussion

There is controversy over the use of MSC-CM in cancer therapy, with contradictory

results frequently observed regarding their effects on tumor proliferation and invasion,


101

whether they are predominantly tumor supportive or suppressive. The inter-study

differences in various experiments and CM preparation protocols could explain the

conflicting results in the literature.

BMSC-CM enhanced growth rates of MCF-7 cancer cells (413, 433). However,

Herheliuk et al. demonstrated that BMSC-CM suppressed tumor cell growth and

migration (434). The same, in a study conducted by Ji et al., tumor cell-MSCs from

normal gingival tissue (GMSCs) indirect co-culture via transwell system showed

significant inhibitory effect compared with tumor alone at day 5, and GMSC-CM

collected after 5 days could significantly suppress the growth of oral cancer cells dose-

and time-dependently (428).

Furthermore, studies showed that MSC-CM inhibit cancer growth via different

processes. ASC-CM and UMSC-CM could cause the differentiation of glioma

malignant cells towards a normal glial cell phenotype, thus inhibiting glioma cell

proliferation (435). An increased sensitivity against the chemotherapeutic drug

temozolomide was observed when human BMSC-CM and UMSC-CM were tested on

four different Glioblastoma stem-like cell lines, which are originally highly resistant to

conventional chemo- and radiotherapy regimens (436).

The fraction of MSC-CM that is responsible for the proliferative or the inhibitory effect

on cancer growth is not clear also. The inhibitory effect of 48h ADSC-CM on MCF7

viability was retained within its low molecular weight and non-protein component

(437). IL-6 in MSC-CM was found to be the principal mediator of MCF-7 growth (433),

whilst EVs were suggested to be responsible for the effects on glioma cells as MSC-

CM containing the secreted non-vesicular fraction did not induce any changes (429).

Exosomes isolated and purified from human BMSC culture supernatants promote

tumor growth (438).

While the interactions of MSCs with tumor have been well-documented in the

literature, scarce are the studies concerning the interaction between DPSCs and cancer

cells (411, 439), and the effect of DPSC-CM on cancer growth is very rarely analyzed.

24h-DPSC-CM increased cell proliferation and decreased apoptosis in prostate cancer

cell cultures in a study conducted by Dogan et al. (411). Hanyu et al. showed that 48h-

serum-free DPSC-CM does not affect tumor growth or drug resistance after 24 hours

in vitro, neither the tumor proliferation rate after 21 days in vivo, but induces VEGF

overexpression in tumor cells from the first day (439).


102

In our study, the paracrine activity of DPSCs, involving the secretome (soluble factors

and extracellular vesicles released in distance), was responsible for the increase in

cancer cell proliferation and dissemination. This was well revealed by the transwell

assay, where the membranes prevent the physical cell movement of DPSCs and MCF7,

and the dissemination test, where a localized geometry of the two cell types contributed

to minimal DPSC-MCF7 interaction.

The contact-dependent interaction with the tumor microenvironment can modulate the

secretome profile and function of MSCs. Comparative secretome analysis demonstrated

changes in the proteomic profiles of secretions from MSC single cultures versus MSCs-

cancer cells direct co-cultures in 2D/3D (416), confirming a discrepancy from direct

cell-cell contact compared to paracrine effect, as also demonstrated by our group (see

Appendix E). Preconditioning of DPSCs by direct co-culture with cancer cells before

collecting their medium may invert the effect of DPSC-CM, mediating then the

inhibition of cancer growth and dissemination.

Although the effect of secreted factors in the microenvironment during the paracrine

interactions is not accurately recapitulated by conditioned medium, and that CM cannot

mimic the natural kinetics of production and depletion of the factors involved (440),

DPSC-CM collected after 48 hours showed the same proliferative effect on cancer

growth.

The role that MSCs may play in tumor development, is dependent upon the balance of

secreted molecules, pro- and anti-tumorigenic, that can be influenced by time-related

dynamics (418). Clarke et al. showed that MSC secretion of matrix metalloproteinase-

2 (MMP-2) would dominate the first day, ensuring a promigratory, pro-metastatic effect

on the surrounding microenvironment. However, over time, the secretion of more tissue

inhibitor of metalloproteinases-1/2 (TIMP-1/2) would inhibit the activity of the MMP-

2, changing the balance towards being anti-invasive (418). We observed an anti-

proliferative effect of DPSC-CM harvested after four hours of conditioning (Figure

E1.b of Appendix E). Therefore, the period of medium conditioning with DPSCs may

be a determining factor in the role of MSC-CM in tumor growth. Even though we

studied the paracrine activity of DPSCs over 7 days, the potential of DPSC-CM

collected at multiple points of time conditioning should be carried out.

103

CHAPTER 9: SUMMARY AND PERSPECTIVES

Chapter 9: Summary and perspectives

104

9.1. Preparation of MSC-CM

The effects of MSC-CM are multifactorial, and even the minimal variability of its

composition can strongly affect its activity (22). Moreover, the process of producing of

human MSC secretome-derived products is a major consideration in developing

standardized criteria to define and qualify the preparation of these products for clinical

applications (441).

In this thesis, we discussed the essential origins of variability in MSC secretome-

derived products. Based on literature data and our outcomes, we recommend the

preparation of secretomes from MSCs at low cell passage number and high cell

confluency, obtained from relatively young and healthy donors. We also recommend

DPSC-CM preparation under serum-free conditions, and their collection during the first

days of conditioning.

Comparison of the profiles of the different CM studied in this thesis shows a difference

in the factors secreted in CM obtained with DPSCs derived from different donors, and

with different growth media (columns c and f of table B1 in Appendix B). It is not

known whether this difference is due to one or the other variation factor. A further

broad-spectrum study needs to be conducted to investigate the influence of donor

variability of DPSCs on the growth factor composition of their secretomes. Similarly,

the influence of the culture medium should be evaluated, comparing the secretions of

DPSCs grown in different media, but isolated from the same donor.

Nevertheless, the importance of this work lies in confirming the potentials and the

effectiveness of DPSC-CM, regardless of the donors.

9.2. DPSC-CM and microenvironmental cues

We highlighted the impact of microenvironmental cues on the profiles of MSC

secretomes. We showed that laser therapy could be a prospective technique to stimulate

secretions from MSCs. The three-dimensional culture of DPSCs did not yield good

results in our study, which is not consistent with the literature based on other types of

MSC cells. Further research should be conducted to evaluate the impact of spheroid

DPSC culture on the profile and potential of DPSC-CM and to determine which

environmental conditions provide the most potent MSC secretome-based product for

each specific application in the field of human regenerative medicine.


105

9.3. DPSC-CM for neuron growth

Then, we demonstrate that DPSC-CM enhances axonal outgrowth of primary sensory

DRG neurons in vitro. We identified several growth-promoting factors in the secretome

of DPSCs and we show that the B-27 supplement drastically changes the secretome’s

profile, further stimulating neurite outgrowth. Importantly, our work points towards

promising avenues for the application of dental pulp stem cell-conditioned media to

aide neuronal regeneration. Future studies must be done to determine the factors

secreted by stimulated DPSCs that are responsible for this regenerative effect.

9.4. DPSC-CM for bone tissue regeneration

To justify the use of osteoblast-like MG-63 for our in vitro research study investigating

the effect of DPSC-CM on bone tissue, we demonstrated the similarity in phenotypes

between MG-63 cells and primary osteoblasts.

Next, we evaluated the effect of human DPSC-CM on the osteogenic process and their

potential for bone tissue regeneration. We demonstrated increased proliferation and

accelerated osteogenic differentiation of osteoblastic cells induced by DPSC-CM. We

are waiting for the results of the in vivo experiments, still in progress, carried out on rat

bone defect models. Taken together, our findings pointed out the regenerative effect of

DPSC-CM and its potential application for bone tissue repair.

9.5. DPSC-CM for angiogenesis

To investigate the effect of DPSC-CM on angiogenesis, we used the aorta ring assay.

This assay recapitulates the entire complex cellular and molecular processes that

regulate angiogenesis and combines the advantages of in vitro and in vivo models.

However, we noted a variability of the angiogenic response in different aortic cultures,

making the whole assay difficult to interpret. This could be responsible for the detection

of a significant angiogenic effect of DPSC-CM, only in one experiment over three

independent repetitions. To better investigate the angiogenic potential of DPSC-CM,

other bioassays should be performed.


106

9.6. DPSC-CM for cancer therapy

On the other hand, our findings demonstrated that DPSCs enhance cancer growth and

dissemination through their secreted bioactive molecules, which denies the potential

use of DPSC-CM as an anti-cancer agent in tumor therapy. However, the impact of

time conditioning and preconditioning of DPSCs on DPSC-derived secretome effects

should be more investigated.

Besides, MSC’s secretome could affect carcinogenesis in different ways other than

supporting or inhibiting cancer cell proliferation, including enhancing or suppressing

cancer cell migration, immune cell activity, and angiogenic activity, and/or regulating

epithelial-mesenchymal transition and sensitivity against the anti-cancer drug. Further

experiments should be performed to study the multiple potentials of DPSC-CM in

tumor development.

107

REFERENCES

1. Andrzejewska A, Lukomska B, Janowski M. Concise Review: Mesenchymal

Stem Cells: From Roots to Boost. Stem Cells. 2019;37(7):855-64.

2. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D,

et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The

International Society for Cellular Therapy position statement. Cytotherapy.

2006;8(4):315-7.

3. Ullah I, Subbarao RB, Rho GJ. Human mesenchymal stem cells - current trends

and future prospective. Biosci Rep. 2015;35(2).

4. Iaquinta MR, Mazzoni E, Bononi I, Rotondo JC, Mazziotta C, Montesi M, et al.

Adult stem cells for bone regeneration and repair. Frontiers in Cell and Developmental

Biology. 2019;7.

5. Teixeira FG, Salgado AJ. Mesenchymal stem cells secretome: current trends

and future challenges. Neural regeneration research. 2020;15(1):75.

6. Vizoso FJ, Eiro N, Cid S, Schneider J, Perez-Fernandez R. Mesenchymal stem

cell secretome: toward cell-free therapeutic strategies in regenerative medicine.

International journal of molecular sciences. 2017;18(9):1852.

7. Chaparro O, Linero I. Regenerative Medicine: A New Paradigm in Bone

Regeneration. Advanced Techniques in Bone Regeneration. 2016:253-74.

8. Kichenbrand C, Velot E, Menu P, Moby V. Dental Pulp Stem Cell-Derived

Conditioned Medium: An Attractive Alternative for Regenerative Therapy. Tissue Eng

Part B Rev. 2019;25(1):78-88.

9. Baraniak PR, McDevitt TC. Stem cell paracrine actions and tissue regeneration.

Regenerative medicine. 2010;5(1):121-43.

10. Meyerrose T, Olson S, Pontow S, Kalomoiris S, Jung Y, Annett G, et al.

Mesenchymal stem cells for the sustained in vivo delivery of bioactive factors.

Advanced drug delivery reviews. 2010;62(12):1167-74.

11. Pawitan JA. Prospect of stem cell conditioned medium in regenerative

medicine. Biomed Res Int. 2014;2014:965849.

12. Gunawardena TNA, Rahman MT, Abdullah BJJ, Abu Kasim NH. Conditioned

media derived from mesenchymal stem cell cultures: The next generation for

regenerative medicine. J Tissue Eng Regen Med. 2019;13(4):569-86.

108

13. Pawitan JA. Prospect of stem cell conditioned medium in regenerative

medicine. BioMed research international. 2014;2014.

14. Katagiri W, Osugi M, Kawai T, Ueda M. Novel cell-free regeneration of bone

using stem cell-derived growth factors. International Journal of Oral & Maxillofacial

Implants. 2013;28(4).

15. Presen DM, Traweger A, Gimona M, Redl H. Mesenchymal stromal cell-based

bone regeneration therapies: From cell transplantation and tissue engineering to

therapeutic secretomes and extracellular vesicles. Frontiers in Bioengineering and

Biotechnology. 2019;7.

16. Mendicino M, Bailey AM, Wonnacott K, Puri RK, Bauer SR. MSC-based

product characterization for clinical trials: an FDA perspective. Cell Stem Cell.

2014;14(2):141-5.

17. Bari E, Ferrarotti I, Torre ML, Corsico AG, Perteghella S. Mesenchymal

stem/stromal cell secretome for lung regeneration: The long way through

"pharmaceuticalization" for the best formulation. J Control Release. 2019;309:11-24.

18. Bari E, Perteghella S, Di Silvestre D, Sorlini M, Catenacci L, Sorrenti M, et al.

Pilot Production of Mesenchymal Stem/Stromal Freeze-Dried Secretome for Cell-Free

Regenerative Nanomedicine: A Validated GMP-Compliant Process. Cells. 2018;7(11).

19. Crivelli B, Chlapanidas T, Perteghella S, Lucarelli E, Pascucci L, Brini AT, et

al. Mesenchymal stem/stromal cell extracellular vesicles: From active principle to next

generation drug delivery system. J Control Release. 2017;262:104-17.

20. Gimona M, Pachler K, Laner-Plamberger S, Schallmoser K, Rohde E.

Manufacturing of Human Extracellular Vesicle-Based Therapeutics for Clinical Use.

Int J Mol Sci. 2017;18(6).

21. Sagaradze G, Grigorieva O, Nimiritsky P, Basalova N, Kalinina N, Akopyan Z,

et al. Conditioned medium from human mesenchymal stromal cells: towards the clinical

translation. International journal of molecular sciences. 2019;20(7):1656.

22. Sagaradze GD, Nimiritsky PP, Akopyan ZA, Makarevich PI, Efimenko AY.

Cell-Free Therapeutics” from Components Secreted by Mesenchymal Stromal Cells as

a Novel Class of Biopharmaceuticals. Biopharmaceuticals. 2018:47.

23. Phelps J, Sanati-Nezhad A, Ungrin M, Duncan NA, Sen A. Bioprocessing of

Mesenchymal Stem Cells and Their Derivatives: Toward Cell-Free Therapeutics. Stem

Cells Int. 2018;2018:9415367.

109

24. Assoni A, Coatti G, Valadares MC, Beccari M, Gomes J, Pelatti M, et al.

Different donors mesenchymal stromal cells secretomes reveal heterogeneous profile

of relevance for therapeutic use. Stem cells and development. 2017;26(3):206-14.

25. Baglio SR, Rooijers K, Koppers-Lalic D, Verweij FJ, Perez Lanzon M, Zini N,

et al. Human bone marrow- and adipose-mesenchymal stem cells secrete exosomes

enriched in distinctive miRNA and tRNA species. Stem Cell Res Ther. 2015;6:127.

26. Pires AO, Mendes-Pinheiro B, Teixeira FG, Anjo SI, Ribeiro-Samy S, Gomes

ED, et al. Unveiling the differences of secretome of human bone marrow mesenchymal

stem cells, adipose tissue-derived stem cells, and human umbilical cord perivascular

cells: a proteomic analysis. Stem cells and development. 2016;25(14):1073-83.

27. Du WJ, Chi Y, Yang ZX, Li ZJ, Cui JJ, Song BQ, et al. Heterogeneity of

proangiogenic features in mesenchymal stem cells derived from bone marrow, adipose

tissue, umbilical cord, and placenta. Stem Cell Res Ther. 2016;7(1):163.

28. Kehl D, Generali M, Mallone A, Heller M, Uldry AC, Cheng P, et al. Proteomic

analysis of human mesenchymal stromal cell secretomes: a systematic comparison of

the angiogenic potential. NPJ Regen Med. 2019;4:8.

29. Hsiao ST, Asgari A, Lokmic Z, Sinclair R, Dusting GJ, Lim SY, et al.

Comparative analysis of paracrine factor expression in human adult mesenchymal stem

cells derived from bone marrow, adipose, and dermal tissue. Stem Cells Dev.

2012;21(12):2189-203.

30. Ribeiro CA, Fraga JS, Graos M, Neves NM, Reis RL, Gimble JM, et al. The

secretome of stem cells isolated from the adipose tissue and Wharton jelly acts

differently on central nervous system derived cell populations. Stem Cell Res Ther.

2012;3(3):18.

31. Hsieh JY, Wang HW, Chang SJ, Liao KH, Lee IH, Lin WS, et al. Mesenchymal

stem cells from human umbilical cord express preferentially secreted factors related to

neuroprotection, neurogenesis, and angiogenesis. PLoS One. 2013;8(8):e72604.

32. Walter MN, Kohli N, Khan N, Major T, Fuller H, Wright KT, et al. Human

mesenchymal stem cells stimulate EaHy926 endothelial cell migration: combined

proteomic and in vitro analysis of the influence of donor-donor variability. Journal of

stem cells & regenerative medicine. 2015;11(1):18.

33. Park CW, Kim K-S, Bae S, Son HK, Myung P-K, Hong HJ, et al. Cytokine

secretion profiling of human mesenchymal stem cells by antibody array. International

journal of stem cells. 2009;2(1):59.

110

34. Yin L, Yang Z, Wu Y, Denslin V, Yu CC, Tee CA, et al. Label-free separation

of mesenchymal stem cell subpopulations with distinct differentiation potencies and

paracrine effects. Biomaterials. 2020:119881.

35. Pasanen I, Pietilä M, Lehtonen S, Lehtilahti E, Hakkarainen T, Sequeiros RB,

et al. Mesenchymal stromal cells from female donors enhance breast cancer cell

proliferation in vitro. Oncology. 2015;88(4):214-25.

36. Crisostomo PR, Wang M, Herring CM, Markel TA, Meldrum KK, Lillemoe

KD, et al. Gender differences in injury induced mesenchymal stem cell apoptosis,

expression of VEGF, TNF, and IL-6 and abrogation via TNFR1 ablation. Journal of

molecular and cellular cardiology. 2007;42(1):142.

37. Kretlow JD, Jin Y-Q, Liu W, Zhang WJ, Hong T-H, Zhou G, et al. Donor age

and cell passage affects differentiation potential of murine bone marrow-derived stem

cells. BMC cell biology. 2008;9(1):60.

38. Zhang J, An Y, Gao LN, Zhang YJ, Jin Y, Chen FM. The effect of aging on the

pluripotential capacity and regenerative potential of human periodontal ligament stem

cells. Biomaterials. 2012;33(29):6974-86.

39. Efimenko A, Dzhoyashvili N, Kalinina N, Kochegura T, Akchurin R, Tkachuk

V, et al. Adipose‐derived mesenchymal stromal cells from aged patients with coronary

artery disease keep mesenchymal stromal cell properties but exhibit characteristics of

aging and have impaired angiogenic potential. Stem cells translational medicine.

2014;3(1):32-41.

40. Horibe H, Murakami M, Iohara K, Hayashi Y, Takeuchi N, Takei Y, et al.

Isolation of a stable subpopulation of mobilized dental pulp stem cells (MDPSCs) with

high proliferation, migration, and regeneration potential is independent of age. PLoS

One. 2014;9(5).

41. Dufrane D. Impact of age on human adipose stem cells for bone tissue

engineering. Cell transplantation. 2017;26(9):1496-504.

42. Siegel G, Kluba T, Hermanutz-Klein U, Bieback K, Northoff H, Schäfer R.

Phenotype, donor age and gender affect function of human bone marrow-derived

mesenchymal stromal cells. BMC medicine. 2013;11(1):146.

43. Kalinina N, Kharlampieva D, Loguinova M, Butenko I, Pobeguts O, Efimenko

A, et al. Characterization of secretomes provides evidence for adipose-derived

mesenchymal stromal cells subtypes. Stem cell research & therapy. 2015;6(1):221.

111

44. Wang Z, Wang Z, Lu WW, Zhen W, Yang D, Peng S. Novel biomaterial

strategies for controlled growth factor delivery for biomedical applications. NPG Asia

Materials. 2017;9(10):e435-e.

45. Poon Z, Lee WC, Guan G, Nyan LM, Lim CT, Han J, et al. Bone marrow

regeneration promoted by biophysically sorted osteoprogenitors from mesenchymal

stromal cells. Stem cells translational medicine. 2015;4(1):56-65.

46. Tropel P, Noël D, Platet N, Legrand P, Benabid A-L, Berger F. Isolation and

characterisation of mesenchymal stem cells from adult mouse bone marrow.

Experimental cell research. 2004;295(2):395-406.

47. Chapman V, Markides H, Sagar DR, Xu L, Burston JJ, Mapp P, et al.

Therapeutic benefit for late, but not early, passage mesenchymal stem cells on pain

behaviour in an animal model of osteoarthritis. Stem cells international. 2017;2017.

48. Igarashi A, Segoshi K, Sakai Y, Pan H, Kanawa M, Higashi Y, et al. Selection

of common markers for bone marrow stromal cells from various bones using real-time

RT-PCR: effects of passage number and donor age. Tissue engineering.

2007;13(10):2405-17.

49. Bonab MM, Alimoghaddam K, Talebian F, Ghaffari SH, Ghavamzadeh A,

Nikbin B. Aging of mesenchymal stem cell in vitro. BMC cell biology. 2006;7(1):14.

50. Requicha J, Viegas CA, Albuquerque C, Azevedo J, Reis R, Gomes ME. Effect

of anatomical origin and cell passage number on the stemness and osteogenic

differentiation potential of canine adipose-derived stem cells. Stem cell reviews and

reports. 2012;8(4):1211-22.

51. Jiang T, Xu G, Wang Q, Yang L, Zheng L, Zhao J, et al. In vitro expansion

impaired the stemness of early passage mesenchymal stem cells for treatment of

cartilage defects. Cell death & disease. 2017;8(6):e2851-e.

52. Im G-B, Kim YH, Kim Y-J, Kim S-W, Jung E, Jeong G-J, et al. Enhancing the

Wound Healing Effect of Conditioned Medium Collected from Mesenchymal Stem

Cells with High Passage Number Using Bioreducible Nanoparticles. International

Journal of Molecular Sciences. 2019;20(19):4835.

53. Crisostomo PR, Wang M, Wairiuko GM, Morrell ED, Terrell AM, Seshadri P,

et al. High passage number of stem cells adversely affects stem cell activation and

myocardial protection. Shock. 2006;26(6):575-80.

112

54. Sears V, Ghosh G. Harnessing mesenchymal stem cell secretome: Effect of

extracellular matrices on proangiogenic signaling. Biotechnol Bioeng.

2020;117(4):1159-71.

55. Serra SC, Costa JC, Assuncao-Silva RC, Teixeira FG, Silva NA, Anjo SI, et al.

Influence of passage number on the impact of the secretome of adipose tissue stem cells

on neural survival, neurodifferentiation and axonal growth. Biochimie. 2018;155:119-

28.

56. Riis S, Nielsen FM, Pennisi CP, Zachar V, Fink T. Comparative analysis of

media and supplements on initiation and expansion of adipose‐derived stem cells. Stem

cells translational medicine. 2016;5(3):314-24.

57. Hagmann S, Moradi B, Frank S, Dreher T, Kämmerer PW, Richter W, et al.

Different culture media affect growth characteristics, surface marker distribution and

chondrogenic differentiation of human bone marrow-derived mesenchymal stromal

cells. BMC musculoskeletal disorders. 2013;14(1):223.

58. Czapla J, Matuszczak S, Kulik K, Wisniewska E, Pilny E, Jarosz-Biej M, et al.

The effect of culture media on large-scale expansion and characteristic of adipose

tissue-derived mesenchymal stromal cells. Stem Cell Res Ther. 2019;10(1):235.

59. Somasundaram I, Mishra R, Radhakrishnan H, Sankaran R, Garikipati VNS,

Marappagounder D. Human adult stem cells maintain a constant phenotype profile

irrespective of their origin, Basal media, and long term cultures. Stem cells

international. 2015;2015.

60. Panchalingam KM, Jung S, Rosenberg L, Behie LA. Bioprocessing strategies

for the large-scale production of human mesenchymal stem cells: a review. Stem cell

research & therapy. 2015;6(1):225.

61. Barekzai J, Petry F, Zitzmann J, Czermak P, Salzig D. Bioprocess Development

for Human Mesenchymal Stem Cell Therapy Products. New Advances on

Fermentation Processes: IntechOpen; 2019.

62. Qu C, Brohlin M, Kingham PJ, Kelk P. Evaluation of growth, stemness, and

angiogenic properties of dental pulp stem cells cultured in cGMP xeno-/serum-free

medium. Cell Tissue Res. 2020;380(1):93-105.

63. Oskowitz A, McFerrin H, Gutschow M, Carter ML, Pochampally R. Serum-

deprived human multipotent mesenchymal stromal cells (MSCs) are highly angiogenic.

Stem Cell Res. 2011;6(3):215-25.

113

64. Paschalidis T, Bakopoulou A, Papa P, Leyhausen G, Geurtsen W, Koidis P.

Dental pulp stem cells’ secretome enhances pulp repair processes and compensates

TEGDMA-induced cytotoxicity. Dental Materials. 2014;30(12):e405-e18.

65. Kim DS, Lee MW, Lee TH, Sung KW, Koo HH, Yoo KH. Cell culture density

affects the stemness gene expression of adipose tissue-derived mesenchymal stem cells.

Biomed Rep. 2017;6(3):300-6.

66. Mizukami A, Thomé CH, Ferreira GA, Lanfredi GP, Covas DT, Pitteri SJ, et

al. Proteomic identification and time-course monitoring of secreted proteins during

expansion of human mesenchymal stem/stromal in stirred-tank bioreactor. Frontiers in

bioengineering and biotechnology. 2019;7:154.

67. Kusuma GD, Carthew J, Lim R, Frith JE. Effect of the microenvironment on

mesenchymal stem cell paracrine signaling: opportunities to engineer the therapeutic

effect. Stem Cells and Development. 2017;26(9):617-31.

68. Redondo-Castro E, Cunningham CJ, Miller J, Brown H, Allan SM, Pinteaux E.

Changes in the secretome of tri-dimensional spheroid-cultured human mesenchymal

stem cells in vitro by interleukin-1 priming. Stem Cell Res Ther. 2018;9(1):11.

69. Costa MHG, McDevitt TC, Cabral JMS, da Silva CL, Ferreira FC.

Tridimensional configurations of human mesenchymal stem/stromal cells to enhance

cell paracrine potential towards wound healing processes. J Biotechnol. 2017;262:28-

39.

70. Carter K, Lee HJ, Na KS, Fernandes-Cunha GM, Blanco IJ, Djalilian A, et al.

Characterizing the impact of 2D and 3D culture conditions on the therapeutic effects of

human mesenchymal stem cell secretome on corneal wound healing in vitro and ex

vivo. Acta Biomater. 2019;99:247-57.

71. Ribeiro TO, Silveira BM, Meira MC, Carreira ACO, Sogayar MC, Meyer R, et

al. Investigating the potential of the secretome of mesenchymal stem cells derived from

sickle cell disease patients. PLoS One. 2019;14(10):e0222093.

72. Ferreira JR, Teixeira GQ, Santos SG, Barbosa MA, Almeida-Porada G,

Gonçalves RM. Mesenchymal stromal cell secretome: influencing therapeutic potential

by cellular pre-conditioning. Frontiers in immunology. 2018;9:2837.

73. Beugels J, Molin DGM, Ophelders D, Rutten T, Kessels L, Kloosterboer N, et

al. Electrical stimulation promotes the angiogenic potential of adipose-derived stem

cells. Sci Rep. 2019;9(1):12076.

114

74. Kim K, Lee J, Jang H, Park S, Na J, Myung JK, et al. Photobiomodulation

Enhances the Angiogenic Effect of Mesenchymal Stem Cells to Mitigate Radiation-

Induced Enteropathy. Int J Mol Sci. 2019;20(5).

75. Park IS, Chung PS, Ahn JC. Enhanced angiogenic effect of adipose-derived

stromal cell spheroid with low-level light therapy in hind limb ischemia mice.

Biomaterials. 2014;35(34):9280-9.

76. Santos JM, Camões SP, Filipe E, Cipriano M, Barcia RN, Filipe M, et al. Three-

dimensional spheroid cell culture of umbilical cord tissue-derived mesenchymal

stromal cells leads to enhanced paracrine induction of wound healing. Stem cell

research & therapy. 2015;6(1):90.

77. Miceli V, Pampalone M, Vella S, Carreca AP, Amico G, Conaldi PG.

Comparison of immunosuppressive and angiogenic properties of human amnion-

derived mesenchymal stem cells between 2D and 3D culture systems. Stem cells


78. Imura T, Nakagawa K, Kawahara Y, Yuge L. Stem cell culture in microgravity

and its application in cell-based therapy. Stem cells and development.

2018;27(18):1298-302.

79. Otsuka T, Imura T, Nakagawa K, Shrestha L, Takahashi S, Kawahara Y, et al.

Simulated microgravity culture enhances the neuroprotective effects of human cranial

bone-derived mesenchymal stem cells in traumatic brain injury. Stem cells and

development. 2018;27(18):1287-97.

80. Binch AL, Richardson SM, Hoyland JA, Barry FP. Combinatorial conditioning

of adipose derived‐mesenchymal stem cells enhances their neurovascular potential:

Implications for intervertebral disc degeneration. JOR spine. 2019;2(4):e1072.

81. Xia X, Chiu PWY, Lam PK, Chin WC, Ng EKW, Lau JYW. Secretome from

hypoxia-conditioned adipose-derived mesenchymal stem cells promotes the healing of

gastric mucosal injury in a rodent model. Biochimica et Biophysica Acta (BBA)-

Molecular Basis of Disease. 2018;1864(1):178-88.

82. Park J, Lee JH, Yoon BS, Jun EK, Lee G, Kim IY, et al. Additive effect of bFGF

and selenium on expansion and paracrine action of human amniotic fluid-derived

mesenchymal stem cells. Stem cell research & therapy. 2018;9(1):293.

83. Mussano F, Genova T, Petrillo S, Roato I, Ferracini R, Munaron L. Osteogenic

differentiation modulates the cytokine, chemokine, and growth factor profile of ASCs

and SHED. International journal of molecular sciences. 2018;19(5):1454.

115

84. Nasser M, Wu Y, Danaoui Y, Ghosh G. Engineering microenvironments

towards harnessing pro-angiogenic potential of mesenchymal stem cells. Materials

Science and Engineering: C. 2019;102:75-84.

85. Leuning DG, Beijer NRM, du Fosse NA, Vermeulen S, Lievers E, van Kooten

C, et al. The cytokine secretion profile of mesenchymal stromal cells is determined by

surface structure of the microenvironment. Sci Rep. 2018;8(1):7716.

86. Constantin A, Dumitrescu M, Mihai Corotchi MC, Jianu D, Simionescu M.

CO2 laser increases the regenerative capacity of human adipose-derived stem cells by

a mechanism involving the redox state and enhanced secretion of pro-angiogenic

molecules. Lasers Med Sci. 2017;32(1):117-27.

87. Ma D, Ma Z, Zhang X, Wang W, Yang Z, Zhang M, et al. Effect of age and

extrinsic microenvironment on the proliferation and osteogenic differentiation of rat

dental pulp stem cells in vitro. Journal of Endodontics. 2009;35(11):1546-53.

88. Baer PC, Overath JM, Urbschat A, Schubert R, Koch B, Bohn AA, et al. Effect

of different preconditioning regimens on the expression profile of murine adipose-

derived stromal/stem cells. International journal of molecular sciences.

2018;19(6):1719.

89. Lotfinia M, Kadivar M, Piryaei A, Pournasr B, Sardari S, Sodeifi N, et al. Effect

of Secreted Molecules of Human Embryonic Stem Cell-Derived Mesenchymal Stem

Cells on Acute Hepatic Failure Model. Stem Cells Dev. 2016;25(24):1898-908.

90. Lee SC, Kim JO, Kim SJ. Secretome from human adipose-derived stem cells

protects mouse liver from hepatic ischemia-reperfusion injury. Surgery.

2015;157(5):934-43.

91. Timmers L, Lim SK, Arslan F, Armstrong JS, Hoefer IE, Doevendans PA, et

al. Reduction of myocardial infarct size by human mesenchymal stem cell conditioned

medium. Stem Cell Research. 2008;1(2):129-37.

92. Ho CH, Lan CW, Liao CY, Hung SC, Li HY, Sung YJ. Mesenchymal stem cells

and their conditioned medium can enhance the repair of uterine defects in a rat model.

J Chin Med Assoc. 2018;81(3):268-76.

93. Sun H, Benardais K, Stanslowsky N, Thau-Habermann N, Hensel N, Huang D,

et al. Therapeutic potential of mesenchymal stromal cells and MSC conditioned

medium in Amyotrophic Lateral Sclerosis (ALS)--in vitro evidence from primary

motor neuron cultures, NSC-34 cells, astrocytes and microglia. PLoS One.

2013;8(9):e72926.

116

94. Isele NB, Lee HS, Landshamer S, Straube A, Padovan CS, Plesnila N, et al.

Bone marrow stromal cells mediate protection through stimulation of PI3-K/Akt and

MAPK signaling in neurons. Neurochem Int. 2007;50(1):243-50.

95. Hu L, Zhao J, Liu J, Gong N, Chen L. Effects of adipose stem cell-conditioned

medium on the migration of vascular endothelial cells, fibroblasts and keratinocytes.

Exp Ther Med. 2013;5(3):701-6.

96. Venugopal C, Rai KS, Pinnelli VB, Kutty BM, Dhanushkodi A.

Neuroprotection by human dental pulp mesenchymal stem cells: from billions to nano.

Current gene therapy. 2018;18(5):307-23.

97. Miura‐Yura E, Tsunekawa S, Naruse K, Nakamura N, Motegi M, Nakai‐

Shimoda H, et al. Secreted factors from cultured dental pulp stem cells promoted neurite

outgrowth of dorsal root ganglion neurons and ameliorated neural functions in

streptozotocin‐induced diabetic mice. Journal of diabetes investigation. 2020;11(1):28-

38.

98. Codispoti B, Marrelli M, Paduano F, Tatullo M. NANOmetric BIO-Banked

MSC-Derived Exosome (NANOBIOME) as a Novel Approach to Regenerative

Medicine. Journal of Clinical Medicine. 2018;7(10).

99. Momen-Heravi F, Balaj L, Alian S, Mantel P-Y, Halleck AE, Trachtenberg AJ,

et al. Current methods for the isolation of extracellular vesicles. Biological chemistry.

2013;394(10):1253-62.

100. Franquesa M, Hoogduijn MJ, Ripoll E, Luk F, Salih M, Betjes MG, et al. Update

on controls for isolation and quantification methodology of extracellular vesicles

derived from adipose tissue mesenchymal stem cells. Front Immunol. 2014;5:525.

101. Katsuda T, Kosaka N, Takeshita F, Ochiya T. The therapeutic potential of

mesenchymal stem cell‐derived extracellular vesicles. Proteomics. 2013;13(10-

11):1637-53.

102. Yu L-L, Zhu J, Liu J-X, Jiang F, Ni W-K, Qu L-S, et al. A comparison of

traditional and novel methods for the separation of exosomes from human samples.

BioMed research international. 2018;2018.

103. Théry C, Amigorena S, Raposo G, Clayton A. Isolation and characterization of

exosomes from cell culture supernatants and biological fluids. Current protocols in cell

biology. 2006;30(1):3.22. 1-3.. 9.

117

104. Gardiner C, Vizio DD, Sahoo S, Théry C, Witwer KW, Wauben M, et al.

Techniques used for the isolation and characterization of extracellular vesicles: results

of a worldwide survey. Journal of extracellular vesicles. 2016;5(1):32945.

105. Lobb RJ, Becker M, Wen SW, Wong CS, Wiegmans AP, Leimgruber A, et al.

Optimized exosome isolation protocol for cell culture supernatant and human plasma.

J Extracell Vesicles. 2015;4:27031.

106. Cvjetkovic A, Lötvall J, Lässer C. The influence of rotor type and centrifugation

time on the yield and purity of extracellular vesicles. Journal of Extracellular Vesicles.

2014;3(1).

107. Witwer KW, Buzas EI, Bemis LT, Bora A, Lasser C, Lotvall J, et al.

Standardization of sample collection, isolation and analysis methods in extracellular

vesicle research. J Extracell Vesicles. 2013;2.

108. Lamparski HG, Metha-Damani A, Yao J-Y, Patel S, Hsu D-H, Ruegg C, et al.

Production and characterization of clinical grade exosomes derived from dendritic

cells. Journal of immunological methods. 2002;270(2):211-26.

109. Helwa I, Cai J, Drewry MD, Zimmerman A, Dinkins MB, Khaled ML, et al. A

Comparative Study of Serum Exosome Isolation Using Differential Ultracentrifugation

and Three Commercial Reagents. PLoS One. 2017;12(1):e0170628.

110. Théry C, Witwer KW, Aikawa E, Alcaraz MJ, Anderson JD, Andriantsitohaina

R, et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018):

a position statement of the International Society for Extracellular Vesicles and update

of the MISEV2014 guidelines. Journal of extracellular vesicles. 2018;7(1):1535750.

111. Lai RC, Arslan F, Lee MM, Sze NS, Choo A, Chen TS, et al. Exosome secreted

by MSC reduces myocardial ischemia/reperfusion injury. Stem Cell Res.

2010;4(3):214-22.

112. Bruno S, Grange C, Deregibus MC, Calogero RA, Saviozzi S, Collino F, et al.

Mesenchymal stem cell-derived microvesicles protect against acute tubular injury. J

Am Soc Nephrol. 2009;20(5):1053-67.

113. Merckx G, Hosseinkhani B, Kuypers S, Deville S, Irobi J, Nelissen I, et al.

Angiogenic Effects of Human Dental Pulp and Bone Marrow-Derived Mesenchymal

Stromal Cells and their Extracellular Vesicles. Cells. 2020;9(2):312.

114. Schnitzler AC, Verma A, Kehoe DE, Jing D, Murrell JR, Der KA, et al.

Bioprocessing of human mesenchymal stem/stromal cells for therapeutic use: Current

technologies and challenges. Biochemical Engineering Journal. 2016;108:3-13.

118

115. Hansmann J, Groeber F, Kahlig A, Kleinhans C, Walles H. Bioreactors in tissue

engineering—principles, applications and commercial constraints. Biotechnology

journal. 2013;8(3):298-307.

116. Vajrabhaya LO, Vongphan N, Hongskul P, Suwannawong SK. The effect of

age of refrigerated conditioned medium on cell survivability in vitro. Dental

Traumatology. 2003;19(1):41-4.

117. Turksen K. Embryonic stem cell protocols: Springer; 2006.

118. Zhou H, Yuen PS, Pisitkun T, Gonzales PA, Yasuda H, Dear JW, et al.

Collection, storage, preservation, and normalization of human urinary exosomes for

biomarker discovery. Kidney international. 2006;69(8):1471-6.

119. Kupcova Skalnikova H. Proteomic techniques for characterisation of

mesenchymal stem cell secretome. Biochimie. 2013;95(12):2196-211.

120. Karamzadeh R, Eslaminejad MB. Dental-related stem cells and their potential

in regenerative medicine. Regenerative Medicine and Tissue Engineering: IntechOpen;

2013.

121. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental

pulp stem cells (DPSCs) in vitro and in vivo. Proceedings of the National Academy of

Sciences. 2000;97(25):13625-30.

122. Chen F-M, Shi S. Periodontal Tissue Engineering. Principles of Tissue

Engineering2014. p. 1507-40.

123. Zhou T, Pan J, Wu P, Huang R, Du W, Zhou Y, et al. Dental Follicle Cells:

Roles in Development and Beyond. Stem Cells Int. 2019;2019:9159605.

124. Sharpe PT. Dental mesenchymal stem cells. Development. 2016;143(13):2273-

80.

125. Alkhalil M, Smajilagic A, Redzic A. Human dental pulp mesenchymal stem

cells isolation and osteoblast differentiation. Med Glas (Zenica). 2015;12(1):27-32.

126. El Moshy S, Radwan IA, Rady D, Abbass MMS, El-Rashidy AA, Sadek KM,

et al. Dental Stem Cell-Derived Secretome/Conditioned Medium: The Future for

Regenerative Therapeutic Applications. Stem Cells Int. 2020;2020:7593402.

127. Muhammad SA, Nordin N, Fakurazi S. Regenerative potential of secretome

from dental stem cells: a systematic review of preclinical studies. Rev Neurosci.

2018;29(3):321-32.

119

128. Stanko P, Altanerova U, Jakubechova J, Repiska V, Altaner C. Dental

Mesenchymal Stem/Stromal Cells and Their Exosomes. Stem Cells International.

2018;2018:1-8.

129. Ahmed NE-MB, Murakami M, Hirose Y, Nakashima M. Therapeutic potential

of dental pulp stem cell secretome for Alzheimer’s disease treatment: an in vitro study.

Stem cells international. 2016;2016.

130. Asadi-Golshan R, Razban V, Mirzaei E, Rahmanian A, Khajeh S, Mostafavi-

Pour Z, et al. Sensory and Motor Behavior Evidences Supporting the Usefulness of

Conditioned Medium from Dental Pulp-Derived Stem Cells in Spinal Cord Injury in

Rats. Asian Spine Journal. 2018;12(5):785-93.

131. Chen YR, Lai PL, Chien Y, Lee PH, Lai YH, Ma HI, et al. Improvement of

Impaired Motor Functions by Human Dental Exfoliated Deciduous Teeth Stem Cell-

Derived Factors in a Rat Model of Parkinson's Disease. Int J Mol Sci. 2020;21(11).

132. Jarmalaviciute A, Tunaitis V, Pivoraite U, Venalis A, Pivoriunas A. Exosomes

from dental pulp stem cells rescue human dopaminergic neurons from 6-hydroxy-

dopamine-induced apoptosis. Cytotherapy. 2015;17(7):932-9.

133. Wang J, Zuzzio K, Walker CL. Systemic Dental Pulp Stem Cell Secretome

Therapy in a Mouse Model of Amyotrophic Lateral Sclerosis. Brain Sci. 2019;9(7).

134. Mita T, Furukawa-Hibi Y, Takeuchi H, Hattori H, Yamada K, Hibi H, et al.

Conditioned medium from the stem cells of human dental pulp improves cognitive

function in a mouse model of Alzheimer’s disease. Behavioural Brain Research.

2015;293:189-97.

135. Yamaguchi S, Shibata R, Yamamoto N, Nishikawa M, Hibi H, Tanigawa T, et

al. Dental pulp-derived stem cell conditioned medium reduces cardiac injury following

ischemia-reperfusion. Sci Rep. 2015;5:16295.

136. Izumoto-Akita T, Tsunekawa S, Yamamoto A, Uenishi E, Ishikawa K, Ogata

H, et al. Secreted factors from dental pulp stem cells improve glucose intolerance in

streptozotocin-induced diabetic mice by increasing pancreatic β-cell function. BMJ

Open Diabetes Research and Care. 2015;3(1):e000128.

137. Matsushita Y, Ishigami M, Matsubara K, Kondo M, Wakayama H, Goto H, et

al. Multifaceted therapeutic benefits of factors derived from stem cells from human

exfoliated deciduous teeth for acute liver failure in rats. J Tissue Eng Regen Med.

2017;11(6):1888-96.

120

138. Hirata M, Ishigami M, Matsushita Y, Ito T, Hattori H, Hibi H, et al. Multifaceted

Therapeutic Benefits of Factors Derived From Dental Pulp Stem Cells for Mouse Liver

Fibrosis. Stem Cells Transl Med. 2016;5(10):1416-24.

139. Wakayama H, Hashimoto N, Matsushita Y, Matsubara K, Yamamoto N,

Hasegawa Y, et al. Factors secreted from dental pulp stem cells show multifaceted

benefits for treating acute lung injury in mice. Cytotherapy. 2015;17(8):1119-29.

140. Shimojima C, Takeuchi H, Jin S, Parajuli B, Hattori H, Suzumura A, et al.

Conditioned Medium from the Stem Cells of Human Exfoliated Deciduous Teeth

Ameliorates Experimental Autoimmune Encephalomyelitis. J Immunol.

2016;196(10):4164-71.

141. Pivoraite U, Jarmalaviciute A, Tunaitis V, Ramanauskaite G, Vaitkuviene A,

Kaseta V, et al. Exosomes from Human Dental Pulp Stem Cells Suppress Carrageenan-

Induced Acute Inflammation in Mice. Inflammation. 2015;38(5):1933-41.

142. Ishikawa J, Takahashi N, Matsumoto T, Yoshioka Y, Yamamoto N, Nishikawa

M, et al. Factors secreted from dental pulp stem cells show multifaceted benefits for

treating experimental rheumatoid arthritis. Bone. 2016;83:210-9.

143. Omori M, Tsuchiya S, Hara K, Kuroda K, Hibi H, Okido M, et al. A new

application of cell-free bone regeneration: immobilizing stem cells from human

exfoliated deciduous teeth-conditioned medium onto titanium implants using

atmospheric pressure plasma treatment. Stem Cell Res Ther. 2015;6:124.

144. Hiraki T, Kunimatsu R, Nakajima K, Abe T, Yamada S, Rikitake K, et al. Stem

cell-derived conditioned media from human exfoliated deciduous teeth promote bone

regeneration. Oral Dis. 2020;26(2):381-90.

145. De Cara S, Origassa CST, de Sa Silva F, Moreira M, de Almeida DC, Pedroni

ACF, et al. Angiogenic properties of dental pulp stem cells conditioned medium on

endothelial cells in vitro and in rodent orthotopic dental pulp regeneration. Heliyon.

2019;5(4):e01560.

146. Qiu J, Wang X, Zhou H, Zhang C, Wang Y, Huang J, et al. Enhancement of

periodontal tissue regeneration by conditioned media from gingiva-derived or

periodontal ligament-derived mesenchymal stem cells: a comparative study in rats.

Stem Cell Res Ther. 2020;11(1):42.

147. Gunawardena TNA, Masoudian Z, Rahman MT, Ramasamy TS, Ramanathan

A, Abu Kasim NH. Dental derived stem cell conditioned media for hair growth

stimulation. PLoS One. 2019;14(5):e0216003.

121

148. Shen C, Li L, Feng T, Li J, Yu M, Lu Q, et al. Dental pulp stem cells derived

conditioned medium promotes angiogenesis in hindlimb ischemia. Tissue Engineering

and Regenerative Medicine. 2015;12(1):59-68.

149. Lambrichts I, Driesen RB, Dillen Y, Gervois P, Ratajczak J, Vangansewinkel

T, et al. Dental Pulp Stem Cells: Their Potential in Reinnervation and Angiogenesis by

Using Scaffolds. J Endod. 2017;43(9S):S12-S6.

150. Kumar A, Kumar V, Rattan V, Jha V, Bhattacharyya S. Secretome cues

modulate the neurogenic potential of bone marrow and dental stem cells. Molecular

neurobiology. 2017;54(6):4672-82.

151. Mead B, Logan A, Berry M, Leadbeater W, Scheven BA. Paracrine-mediated

neuroprotection and neuritogenesis of axotomised retinal ganglion cells by human

dental pulp stem cells: comparison with human bone marrow and adipose-derived

mesenchymal stem cells. PloS one. 2014;9(10).

152. Ishizaka R, Hayashi Y, Iohara K, Sugiyama M, Murakami M, Yamamoto T, et

al. Stimulation of angiogenesis, neurogenesis and regeneration by side population cells

from dental pulp. Biomaterials. 2013;34(8):1888-97.

153. Hayashi Y, Murakami M, Kawamura R, Ishizaka R, Fukuta O, Nakashima M.

CXCL14 and MCP1 are potent trophic factors associated with cell migration and

angiogenesis leading to higher regenerative potential of dental pulp side population

cells. Stem Cell Res Ther. 2015;6:111.

154. Caseiro AR, Pedrosa SS, Ivanova G, Branquinho MV, Almeida A, Faria F, et

al. Mesenchymal Stem/Stromal Cells metabolomic and bioactive factors profiles: A

comparative analysis on the umbilical cord and dental pulp derived Stem/Stromal Cells

secretome. PloS one. 2019;14(11).

155. Matsushita Y, Ishigami M, Matsubara K, Kondo M, Wakayama H, Goto H, et

al. Multifaceted therapeutic benefits of factors derived from stem cells from human

exfoliated deciduous teeth for acute liver failure in rats. Journal of tissue engineering

and regenerative medicine. 2017;11(6):1888-96.

156. Song M, Jue SS, Cho YA, Kim EC. Comparison of the effects of human dental

pulp stem cells and human bone marrow‐derived mesenchymal stem cells on ischemic

human astrocytes in vitro. Journal of neuroscience research. 2015;93(6):973-83.

157. Yu S, Zhao Y, Ma Y, Ge L. Profiling the secretome of human stem cells from

dental apical papilla. Stem cells and development. 2016;25(6):499-508.

122

158. Park Y-J, Cha S, Park Y-S. Regenerative applications using tooth derived stem

cells in other than tooth regeneration: a literature review. Stem Cells International.

2016;2016.

159. Kolar MK, Itte VN, Kingham PJ, Novikov LN, Wiberg M, Kelk P. The

neurotrophic effects of different human dental mesenchymal stem cells. Scientific

reports. 2017;7(1):1-12.

160. Sakai K, Yamamoto A, Matsubara K, Nakamura S, Naruse M, Yamagata M, et

al. Human dental pulp-derived stem cells promote locomotor recovery after complete

transection of the rat spinal cord by multiple neuro-regenerative mechanisms. J Clin

Invest. 2012;122(1):80-90.

161. Akazawa Y, Hasegawa T, Yoshimura Y, Chosa N, Asakawa T, Ueda K, et al.

Recruitment of mesenchymal stem cells by stromal cell-derived factor 1α in pulp cells

from deciduous teeth. International journal of molecular medicine. 2015;36(2):442-8.

162. Wu J, Jia Q, He W, Liu J, Hou L, Zhang J, et al. Conditioned medium from

periapical follicle cells induces the odontogenic differentiation of stem cells from the

apical papilla in vitro. J Endod. 2013;39(8):1015-22.

163. Wen X, Nie X, Zhang L, Liu L, Deng M. Adipose tissue-deprived stem cells

acquire cementoblast features treated with dental follicle cell conditioned medium

containing dentin non-collagenous proteins in vitro. Biochem Biophys Res Commun.

2011;409(3):583-9.

164. Liu N, Gu B, Liu N, Nie X, Zhang B, Zhou X, et al. Wnt/β-Catenin Pathway

Regulates Cementogenic Differentiation of Adipose Tissue-Deprived Stem Cells in

Dental Follicle Cell-Conditioned Medium. PLoS ONE. 2014;9(5).

165. Ivica A, Ghayor C, Zehnder M, Valdec S, Weber FE. Pulp-Derived Exosomes

in a Fibrin-Based Regenerative Root Filling Material. J Clin Med. 2020;9(2).

166. Iohara K, Zheng L, Wake H, Ito M, Nabekura J, Wakita H, et al. A novel stem

cell source for vasculogenesis in ischemia: subfraction of side population cells from

dental pulp. Stem Cells. 2008;26(9):2408-18.

167. Yu J, Deng Z, Shi J, Zhai H, Nie X, Zhuang H, et al. Differentiation of dental

pulp stem cells into regular-shaped dentin-pulp complex induced by tooth germ cell

conditioned medium. Tissue engineering. 2006;12(11):3097-105.

168. Ye L, Chen L, Feng F, Cui J, Li K, Li Z, et al. Bone marrow-derived stromal

cells are more beneficial cell sources for tooth regeneration compared with adipose-

derived stromal cells. Cell Biol Int. 2015;39(10):1151-61.

123

169. Yang Z, Jin F, Zhang X, Ma D, Han C, Huo N, et al. Tissue engineering of

cementum/periodontal-ligament complex using a novel three-dimensional pellet

cultivation system for human periodontal ligament stem cells. Tissue Engineering Part

C: Methods. 2009;15(4):571-81.

170. Yang ZH, Zhang XJ, Dang NN, Ma ZF, Xu L, Wu JJ, et al. Apical tooth germ

cell‐conditioned medium enhances the differentiation of periodontal ligament stem

cells into cementum/periodontal ligament‐like tissues. Journal of periodontal research.

2009;44(2):199-210.

171. Wang YX, Ma ZF, Huo N, Tang L, Han C, Duan YZ, et al. Porcine tooth germ

cell conditioned medium can induce odontogenic differentiation of human dental pulp

stem cells. Journal of Tissue Engineering and Regenerative Medicine. 2011;5(5):354-

62.

172. Shan T, Zhou C, Yang R, Yan F, Zhang P, Fu Y, et al. Lithium chloride

promotes the odontoblast differentiation of hair follicle neural crest cells by activating

Wnt/beta-catenin signaling. Cell Biol Int. 2015;39(1):35-43.

173. Huo N, Tang L, Yang Z, Qian H, Wang Y, Han C, et al. Differentiation of

dermal multipotent cells into odontogenic lineage induced by embryonic and neonatal

tooth germ cell–conditioned medium. Stem cells and development. 2010;19(1):93-104.

174. Hu X, Zhong Y, Kong Y, Chen Y, Feng J, Zheng J. Lineage-specific exosomes

promote the odontogenic differentiation of human dental pulp stem cells (DPSCs)

through TGFbeta1/smads signaling pathway via transfer of microRNAs. Stem Cell Res

Ther. 2019;10(1):170.

175. Zhou H, Li X, Yin Y, He X-T, An Y, Tian B-M, et al. The proangiogenic effects

of extracellular vesicles secreted by dental pulp stem cells derived from periodontally

compromised teeth. Stem cell research & therapy. 2020;11(1):1-18.

176. De Rosa A, Tirino V, Paino F, Tartaglione A, Mitsiadis T, Feki A, et al.

Amniotic fluid-derived mesenchymal stem cells lead to bone differentiation when

cocultured with dental pulp stem cells. Tissue Eng Part A. 2011;17(5-6):645-53.

177. Inoue T, Sugiyama M, Hattori H, Wakita H, Wakabayashi T, Ueda M. Stem

cells from human exfoliated deciduous tooth-derived conditioned medium enhance

recovery of focal cerebral ischemia in rats. Tissue Eng Part A. 2013;19(1-2):24-9.

178. Kawamura R, Hayashi Y, Murakami H, Nakashima M. EDTA soluble chemical

components and the conditioned medium from mobilized dental pulp stem cells contain

124

an inductive microenvironment, promoting cell proliferation, migration, and

odontoblastic differentiation. Stem Cell Res Ther. 2016;7(1):77.

179. Yamamoto T, Osako Y, Ito M, Murakami M, Hayashi Y, Horibe H, et al.

Trophic Effects of Dental Pulp Stem Cells on Schwann Cells in Peripheral Nerve

Regeneration. Cell Transplantation. 2016;25(1):183-93.

180. Iohara K, Zheng L, Ito M, Ishizaka R, Nakamura H, Into T, et al. Regeneration

of dental pulp after pulpotomy by transplantation of CD31-/CD146-side population

cells from a canine tooth. 2009.

181. Murakami M, Horibe H, Iohara K, Hayashi Y, Osako Y, Takei Y, et al. The use

of granulocyte-colony stimulating factor induced mobilization for isolation of dental

pulp stem cells with high regenerative potential. Biomaterials. 2013;34(36):9036-47.

182. Iohara K, Murakami M, Takeuchi N, Osako Y, Ito M, Ishizaka R, et al. A novel

combinatorial therapy with pulp stem cells and granulocyte colony-stimulating factor

for total pulp regeneration. Stem Cells Transl Med. 2013;2(7):521-33.

183. Nakayama H, Iohara K, Hayashi Y, Okuwa Y, Kurita K, Nakashima M.

Enhanced regeneration potential of mobilized dental pulp stem cells from immature

teeth. Oral diseases. 2017;23(5):620-8.

184. Chen X, Yang B, Tian J, Hong H, Du Y, Li K, et al. Dental Follicle Stem Cells

Ameliorate Lipopolysaccharide-Induced Inflammation by Secreting TGF-beta3 and

TSP-1 to Elicit Macrophage M2 Polarization. Cell Physiol Biochem. 2018;51(5):2290-

308.

185. Wen X, Liu L, Deng M, Liu R, Zhang L, Nie X. In vitro cementoblast-like

differentiation of postmigratory neural crest-derived p75+ stem cells with dental follicle

cell conditioned medium. Experimental Cell Research. 2015;337(1):76-86.

186. Iezzi I, Pagella P, Mattioli-Belmonte M, Mitsiadis T. The effects of ageing on

dental pulp stem cells, the tooth longevity elixir. Eur Cell Mater. 2019;26:175-85.

187. Omi M, Hata M, Nakamura N, Miyabe M, Kobayashi Y, Kamiya H, et al.

Transplantation of dental pulp stem cells suppressed inflammation in sciatic nerves by

promoting macrophage polarization towards anti-inflammation phenotypes and

ameliorated diabetic polyneuropathy. Journal of Diabetes Investigation. 2016;7(4):485-

96.

188. Omi M, Hata M, Nakamura N, Miyabe M, Ozawa S, Nukada H, et al.

Transplantation of dental pulp stem cells improves long-term diabetic polyneuropathy

125

together with improvement of nerve morphometrical evaluation. Stem Cell Res Ther.

2017;8(1):279.

189. Makino E, Nakamura N, Miyabe M, Ito M, Kanada S, Hata M, et al.

Conditioned media from dental pulp stem cells improved diabetic polyneuropathy

through anti-inflammatory, neuroprotective and angiogenic actions: Cell-free

regenerative medicine for diabetic polyneuropathy. J Diabetes Investig.

2019;10(5):1199-208.

190. Tsuruta T, Sakai K, Watanabe J, Katagiri W, Hibi H. Dental pulp-derived stem

cell conditioned medium to regenerate peripheral nerves in a novel animal model of

dysphagia. PLoS One. 2018;13(12):e0208938.

191. Sugimura-Wakayama Y, Katagiri W, Osugi M, Kawai T, Ogata K, Sakaguchi

K, et al. Peripheral Nerve Regeneration by Secretomes of Stem Cells from Human

Exfoliated Deciduous Teeth. Stem Cells and Development. 2015;24(22):2687-99.

192. Stastna M, Van Eyk JE. Investigating the secretome: lessons about the cells that

comprise the heart. Circulation: Cardiovascular Genetics. 2012;5(1):o8-o18.

193. Tachida Y, Sakurai H, Okutsu J, Suda K, Sugita R, Yaginuma Y, et al.

Proteomic comparison of the secreted factors of mesenchymal stem cells from bone

marrow, adipose tissue and dental pulp. Journal of Proteomics & Bioinformatics.

2015;8(12):266.

194. Collart-Dutilleul P-Y, Secret E, Panayotov I, Deville de Périère D, Martín-

Palma RlJ, Torres-Costa V, et al. Adhesion and proliferation of human mesenchymal

stem cells from dental pulp on porous silicon scaffolds. ACS applied materials &

interfaces. 2014;6(3):1719-28.

195. Panayotov IV, Collart‐Dutilleul PY, Salehi H, Martin M, Végh A, Yachouh J,

et al. Sprayed cells and polyelectrolyte films for biomaterial functionalization: the

influence of physical PLL–PGA film treatments on dental pulp cell behavior.

Macromolecular bioscience. 2014;14(12):1771-82.

196. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D,

et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The

International Society for Cellular Therapy position statement. Cytotherapy.

2006;8(4):315-7.

197. Levenson AS, Jordan VC. MCF-7: the first hormone-responsive breast cancer

cell line. Cancer research. 1997;57(15):3071-8.

126

198. Merlin J-L, Bour-Dill C, Marchal S, Bastien L, Gramain M-P. Resistance to

paclitaxel induces time-delayed multinucleation and DNA fragmentation into large

fragments in MCF-7 human breast adenocarcinoma cells. Anti-cancer drugs.

2000;11(4):295-302.

199. Baker M, Robinson SD, Lechertier T, Barber PR, Tavora B, D'Amico G, et al.

Use of the mouse aortic ring assay to study angiogenesis. Nat Protoc. 2011;7(1):89-

104.

200. Renaud M, Farkasdi S, Pons C, Panayotov I, Collart-Dutilleul PY, Taillades H,

et al. A New Rat Model for Translational Research in Bone Regeneration. Tissue Eng

Part C Methods. 2016;22(2):125-31.

201. Foty R. A simple hanging drop cell culture protocol for generation of 3D

spheroids. JoVE (Journal of Visualized Experiments). 2011(51):e2720.

202. Chen Z, Dodig-Crnkovic T, Schwenk JM, Tao SC. Current applications of

antibody microarrays. Clin Proteomics. 2018;15:7.

203. Laino G, d'Aquino R, Graziano A, Lanza V, Carinci F, Naro F, et al. A new

population of human adult dental pulp stem cells: a useful source of living autologous

fibrous bone tissue (LAB). J Bone Miner Res. 2005;20(8):1394-402.

204. Gagari E, Rand MK, Tayari L, Vastardis H, Sharma P, Hauschka PV, et al.

Expression of stem cell factor and its receptor, c‐kit, in human oral mesenchymal cells.

European journal of oral sciences. 2006;114(5):409-15.

205. Alraies A, Alaidaroos NY, Waddington RJ, Moseley R, Sloan AJ. Variation in

human dental pulp stem cell ageing profiles reflect contrasting proliferative and

regenerative capabilities. BMC cell biology. 2017;18(1):12.

206. Aranha AM, Zhang Z, Neiva KG, Costa CA, Hebling J, Nör JE. Hypoxia

enhances the angiogenic potential of human dental pulp cells. Journal of endodontics.

2010;36(10):1633-7.

207. Kang H, Lee M-J, Park SJ, Lee M-S. Lipopolysaccharide-preconditioned

periodontal ligament stem cells induce M1 polarization of macrophages through

extracellular vesicles. International journal of molecular sciences. 2018;19(12):3843.

208. Li Y, Yang Y-Y, Ren J-L, Xu F, Chen F-M, Li A. Exosomes secreted by stem

cells from human exfoliated deciduous teeth contribute to functional recovery after

traumatic brain injury by shifting microglia M1/M2 polarization in rats. Stem Cell

Research & Therapy. 2017;8(1).

127

209. Li J, Ju Y, Liu S, Fu Y, Zhao S. Exosomes derived from lipopolysaccharide-

preconditioned human dental pulp stem cells regulate Schwann cell migration and

differentiation. Connect Tissue Res. 2019:1-10.

210. Yamagata M, Yamamoto A, Kako E, Kaneko N, Matsubara K, Sakai K, et al.

Human dental pulp-derived stem cells protect against hypoxic-ischemic brain injury in

neonatal mice. Stroke. 2013;44(2):551-4.

211. Kumar A, Kumar V, Rattan V, Jha V, Pal A, Bhattacharyya S. Molecular

spectrum of secretome regulates the relative hepatogenic potential of mesenchymal

stem cells from bone marrow and dental tissue. Sci Rep. 2017;7(1):15015.

212. Madrigal M, Rao KS, Riordan NH. A review of therapeutic effects of

mesenchymal stem cell secretions and induction of secretory modification by different

culture methods. Journal of translational medicine. 2014;12(1):1-14.

213. Bakopoulou A, Kritis A, Andreadis D, Papachristou E, Leyhausen G, Koidis P,

et al. Angiogenic Potential and Secretome of Human Apical Papilla Mesenchymal Stem

Cells in Various Stress Microenvironments. Stem Cells Dev. 2015;24(21):2496-512.

214. Li J, Ju Y, Liu S, Fu Y, Zhao S. Exosomes derived from lipopolysaccharide-

preconditioned human dental pulp stem cells regulate Schwann cell migration and

differentiation. Connective tissue research. 2019:1-10.

215. Wang M, Li J, Ye Y, He S, Song J. SHED-derived conditioned exosomes

enhance the osteogenic differentiation of PDLSCs via Wnt and BMP signaling in vitro.

Differentiation. 2020;111:1-11.

216. Kingham PJ, Kolar MK, Novikova LN, Novikov LN, Wiberg M. Stimulating

the neurotrophic and angiogenic properties of human adipose-derived stem cells

enhances nerve repair. Stem cells and development. 2014;23(7):741-54.

217. Soares DM, Ginani F, Henriques AG, Barboza CA. Effects of laser therapy on

the proliferation of human periodontal ligament stem cells. Lasers Med Sci.

2015;30(3):1171-4.

218. Barboza CA, Ginani F, Soares DM, Henriques AC, Freitas Rde A. Low-level

laser irradiation induces in vitro proliferation of mesenchymal stem cells. Einstein (Sao

Paulo). 2014;12(1):75-81.

219. Zaccara IM, Ginani F, Mota-Filho HG, Henriques AC, Barboza CA. Effect of

low-level laser irradiation on proliferation and viability of human dental pulp stem cells.

Lasers Med Sci. 2015;30(9):2259-64.

128

220. Eduardo Fde P, Bueno DF, de Freitas PM, Marques MM, Passos-Bueno MR,

Eduardo Cde P, et al. Stem cell proliferation under low intensity laser irradiation: a

preliminary study. Lasers Surg Med. 2008;40(6):433-8.

221. Yurtsever MC, Kiremitci A, Gumusderelioglu M. Dopaminergic induction of

human dental pulp stem cells by photobiomodulation: comparison of 660nm laser light

and polychromatic light in the nir. J Photochem Photobiol B. 2020;204:111742.

222. Han B, Fan J, Liu L, Tian J, Gan C, Yang Z, et al. Adipose-derived

mesenchymal stem cells treatments for fibroblasts of fibrotic scar via downregulating

TGF-beta1 and Notch-1 expression enhanced by photobiomodulation therapy. Lasers

Med Sci. 2019;34(1):1-10.

223. Liao X, Li SH, Xie GH, Xie S, Xiao LL, Song JX, et al. Preconditioning With

Low-Level Laser Irradiation Enhances the Therapeutic Potential of Human Adipose-

derived Stem Cells in a Mouse Model of Photoaged Skin. Photochem Photobiol.

2018;94(4):780-90.

224. Hou JF, Zhang H, Yuan X, Li J, Wei YJ, Hu SS. In vitro effects of low-level

laser irradiation for bone marrow mesenchymal stem cells: proliferation, growth factors

secretion and myogenic differentiation. Lasers Surg Med. 2008;40(10):726-33.

225. Grunewald S, Bodendorf MO, Zygouris A, Simon JC, Paasch U. Long-term

efficacy of linear-scanning 808 nm diode laser for hair removal compared to a scanned

alexandrite laser. Lasers Surg Med. 2014;46(1):13-9.

226. Baugh WP, Trafeli JP, Barnette Jr DJ, Ross EV. Hair reduction using a scanning

800 nm diode laser. Dermatologic surgery. 2001;27(4):358-64.

227. Jih MH, Friedman PM, Goldberg LH, Robles M, Glaich AS, Kimyai-Asadi A.

The 1450-nm diode laser for facial inflammatory acne vulgaris: dose-response and 12-

month follow-up study. J Am Acad Dermatol. 2006;55(1):80-7.

228. Astuti SD. An in-vitro antimicrobial effect of 405 nm laser diode combined with

chlorophylls of Alfalfa (Medicago sativa L.) on Enterococcus faecalis. Dental Journal

(Majalah Kedokteran Gigi). 2018;51(1).

229. Raiesian S, Khani M, Khiabani K, Hemmati E, Pouretezad M. Assessment of

Low-Level Laser Therapy Effects After Extraction of Impacted Lower Third Molar

Surgery. J Lasers Med Sci. 2017;8(1):42-5.

230. Ezzat AE, El-Shenawy HM, El-Begermy MM, Eid MI, Akel MM, Abbas AY.

The effectiveness of low-level laser on postoperative pain and edema in secondary

palatal operation. Int J Pediatr Otorhinolaryngol. 2016;89:183-6.

129

231. Okcu N, Baki A, Sari M, Arslan M, Kapicioglu S. The fibroblast proliferation,

relationship of hepatocyte growth factor (HGF) and interferon-A2A. Gastroenterology.

2000;118(4):A1404.

232. Scarpa RC, Carraway RE, Cochrane DE. Insulin-like growth factor (IGF)

induced proliferation of human lung fibroblasts is enhanced by neurotensin. Peptides.

2005;26(11):2201-10.

233. Lu Y, Azad N, Wang L, Iyer AK, Castranova V, Jiang BH, et al.

Phosphatidylinositol-3-kinase/akt regulates bleomycin-induced fibroblast proliferation

and collagen production. Am J Respir Cell Mol Biol. 2010;42(4):432-41.

234. Raykha C, Crawford J, Gan BS, Fu P, Bach LA, O'Gorman DB. IGF-II and

IGFBP-6 regulate cellular contractility and proliferation in Dupuytren's disease.

Biochim Biophys Acta. 2013;1832(10):1511-9.

235. Akl MR, Ayoub NM, Mohyeldin MM, Busnena BA, Foudah AI, Liu YY, et al.

Olive phenolics as c-Met inhibitors: (-)-Oleocanthal attenuates cell proliferation,

invasiveness, and tumor growth in breast cancer models. PLoS One. 2014;9(5):e97622.

236. Nie L, Oishi Y, Doi I, Shibata H, Kojima I. Inhibition of proliferation of MCF-

7 breast cancer cells by a blocker of Ca2+-permeable channel. Cell calcium.

1997;22(2):75-82.

237. Pinto MP, Badtke MM, Dudevoir ML, Harrell JC, Jacobsen BM, Horwitz KB.

Vascular endothelial growth factor secreted by activated stroma enhances angiogenesis

and hormone-independent growth of estrogen receptor-positive breast cancer. Cancer

Res. 2010;70(7):2655-64.

238. Cesarz Z, Tamama K. Spheroid Culture of Mesenchymal Stem Cells. Stem

Cells Int. 2016;2016:9176357.

239. Zhang Q, Nguyen AL, Shi S, Hill C, Wilder-Smith P, Krasieva TB, et al. Three-

dimensional spheroid culture of human gingiva-derived mesenchymal stem cells

enhances mitigation of chemotherapy-induced oral mucositis. Stem Cells Dev.

2012;21(6):937-47.

240. Lee EJ, Park SJ, Kang SK, Kim GH, Kang HJ, Lee SW, et al. Spherical bullet

formation via E-cadherin promotes therapeutic potency of mesenchymal stem cells

derived from human umbilical cord blood for myocardial infarction. Mol Ther.

2012;20(7):1424-33.

130

241. Bhang SH, Lee S, Shin JY, Lee TJ, Kim BS. Transplantation of cord blood

mesenchymal stem cells as spheroids enhances vascularization. Tissue Eng Part A.

2012;18(19-20):2138-47.

242. Cheng NC, Chen SY, Li JR, Young TH. Short-term spheroid formation

enhances the regenerative capacity of adipose-derived stem cells by promoting

stemness, angiogenesis, and chemotaxis. Stem Cells Transl Med. 2013;2(8):584-94.

243. Miranda JP, Camoes SP, Gaspar MM, Rodrigues JS, Carvalheiro M, Barcia RN,

et al. The Secretome Derived From 3D-Cultured Umbilical Cord Tissue MSCs

Counteracts Manifestations Typifying Rheumatoid Arthritis. Front Immunol.

2019;10:18.

244. Scheib J, Höke A. Advances in peripheral nerve regeneration. Nature Reviews

Neurology. 2013;9(12):668.

245. Martin M, Benzina O, Szabo V, Végh A-G, Lucas O, Cloitre T, et al.

Morphology and nanomechanics of sensory neurons growth cones following peripheral

nerve injury. Plos one. 2013;8(2):e56286.

246. Grasman JM, Kaplan DL. Human endothelial cells secrete neurotropic factors

to direct axonal growth of peripheral nerves. Scientific reports. 2017;7(1):4092.

247. Gögel S, Gubernator M, Minger S. Progress and prospects: stem cells and

neurological diseases. Gene therapy. 2011;18(1):1.

248. Teixeira FG, Carvalho MM, Sousa N, Salgado AJ. Mesenchymal stem cells

secretome: a new paradigm for central nervous system regeneration? Cellular and

Molecular Life Sciences. 2013;70(20):3871-82.

249. Blurton-Jones M, Kitazawa M, Martinez-Coria H, Castello NA, Müller F-J,

Loring JF, et al. Neural stem cells improve cognition via BDNF in a transgenic model

of Alzheimer disease. Proceedings of the National Academy of Sciences.

2009;106(32):13594-9.

250. Crigler L, Robey RC, Asawachaicharn A, Gaupp D, Phinney DG. Human

mesenchymal stem cell subpopulations express a variety of neuro-regulatory molecules

and promote neuronal cell survival and neuritogenesis. Experimental neurology.

2006;198(1):54-64.

251. Huang GT, Gronthos S, Shi S. Mesenchymal stem cells derived from dental

tissues vs. those from other sources: their biology and role in regenerative medicine. J

Dent Res. 2009;88(9):792-806.

131

252. Foudah D, Monfrini M, Donzelli E, Niada S, Brini AT, Orciani M, et al.

Expression of neural markers by undifferentiated mesenchymal-like stem cells from

different sources. J Immunol Res. 2014;2014:987678.

253. Mead B, Logan A, Berry M, Leadbeater W, Scheven BA. Paracrine-mediated

neuroprotection and neuritogenesis of axotomised retinal ganglion cells by human

dental pulp stem cells: comparison with human bone marrow and adipose-derived

mesenchymal stem cells. PloS one. 2014;9(10):e109305.

254. Luo L, He Y, Wang X, Key B, Lee BH, Li H, et al. Potential Roles of Dental

Pulp Stem Cells in Neural Regeneration and Repair. Stem Cells Int.

2018;2018:1731289.

255. Kichenbrand C, Velot E, Menu P, Moby V. Dental pulp stem cell-derived

conditioned medium: An attractive alternative for regenerative therapy. Tissue

Engineering Part B: Reviews. 2019;25(1):78-88.

256. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth factors.

2004;22(4):233-41.

257. Koprivica V, Cho K-S, Park JB, Yiu G, Atwal J, Gore B, et al. EGFR activation

mediates inhibition of axon regeneration by myelin and chondroitin sulfate

proteoglycans. Science. 2005;310(5745):106-10.

258. Tanaka S, Kunath T, Hadjantonakis A-K, Nagy A, Rossant J. Promotion of

trophoblast stem cell proliferation by FGF4. Science. 1998;282(5396):2072-5.

259. Bosetti M, Boccafoschi F, Leigheb M, Cannas MF. Effect of different growth

factors on human osteoblasts activities: a possible application in bone regeneration for

tissue engineering. Biomolecular engineering. 2007;24(6):613-8.

260. Yun Y-R, Won JE, Jeon E, Lee S, Kang W, Jo H, et al. Fibroblast growth

factors: biology, function, and application for tissue regeneration. Journal of tissue

engineering. 2010;1(1):218142.

261. Finch PW, Rubin JS, Miki T, Ron D, Aaronson SA. Human KGF is FGF-related

with properties of a paracrine effector of epithelial cell growth. Science.

1989;245(4919):752-5.

262. Thomson A, Cunha G. Prostatic growth and development are regulated by

FGF10. Development. 1999;126(16):3693-701.

263. Tagashira S, Harada H, Katsumata T, Itoh N, Nakatsuka M. Cloning of mouse

FGF10 and up-regulation of its gene expression during wound healing. Gene.

1997;197(1-2):399-404.

132

264. Tsuboi R, Sato C, Kurita Y, Ron D, Rubin JS, Ogawa H. Keratinocyte growth

factor (FGF-7) stimulates migration and plasminogen activator activity of normal

human keratinocytes. Journal of investigative dermatology. 1993;101(1):49-53.

265. Werner S, Weinberg W, Liao X, Peters K, Blessing M, Yuspa S, et al. Targeted

expression of a dominant‐negative FGF receptor mutant in the epidermis of transgenic

mice reveals a role of FGF in keratinocyte organization and differentiation. The EMBO

Journal. 1993;12(7):2635-43.

266. Emmerson PJ, Duffin KL, Wu X. GDF15 and growth control. Frontiers in

physiology. 2018;9:1712.

267. Hirata T, Morii E, Morimoto M, Kasugai T, Tsujimura T, Hirota S, et al. Stem

cell factor induces outgrowth of c-kit-positive neurites and supports the survival of c-

kit-positive neurons in dorsal root ganglia of mouse embryos. Development.

1993;119(1):49-56.

268. Milenkovic N, Frahm C, Gassmann M, Griffel C, Erdmann B, Birchmeier C, et

al. Nociceptive tuning by stem cell factor/c-Kit signaling. Neuron. 2007;56(5):893-906.

269. Sulzbacher I, Träxler M, Mosberger I, Lang S, Chott A. Platelet-derived growth

factor-AA and-α receptor expression suggests an autocrine and/or paracrine loop in

osteosarcoma. Modern Pathology. 2000;13(6):632.

270. Andrae J, Gallini R, Betsholtz C. Role of platelet-derived growth factors in

physiology and medicine. Genes & development. 2008;22(10):1276-312.

271. Baudet M-L, Rattray D, Martin BT, Harvey S. Growth hormone promotes axon

growth in the developing nervous system. Endocrinology. 2009;150(6):2758-66.

272. Bianchi VE, Locatelli V, Rizzi L. Neurotrophic and neuroregenerative effects

of GH/IGF1. International journal of molecular sciences. 2017;18(11):2441.

273. Maina F, Hilton MC, Ponzetto C, Davies AM, Klein R. Met receptor signaling

is required for sensory nerve development and HGF promotes axonal growth and

survival of sensory neurons. Genes & development. 1997;11(24):3341-50.

274. Xiang Y, Ding N, Xing Z, Zhang W, Liu H, Li Z. Insulin-like growth factor-1

regulates neurite outgrowth and neuronal migration from organotypic cultured dorsal

root ganglion. International Journal of Neuroscience. 2011;121(2):101-6.

275. Zhu H, Xue C, Yao M, Wang H, Zhang P, Qian T, et al. miR-129 controls

axonal regeneration via regulating insulin-like growth factor-1 in peripheral nerve

injury. Cell death & disease. 2018;9(7):720.

133

276. Guo C, Cho K-S, Li Y, Tchedre K, Antolik C, Ma J, et al. IGFBPL1 regulates

axon growth through IGF-1-mediated signaling cascades. Scientific reports.

2018;8(1):2054.

277. Wood TL, Brown AL, Rechler MM, Pintar JE. The expression pattern of an

insulin-like growth factor (IGF)-binding protein gene is distinct from IGF-II in the

midgestational rat embryo. Molecular Endocrinology. 1990;4(8):1257-63.

278. Baxter RC. Insulin-like growth factor binding protein-3 (IGFBP-3): Novel

ligands mediate unexpected functions. Journal of cell communication and signaling.

2013;7(3):179-89.

279. Rao SN, Pearse DD. Regulating axonal responses to injury: the intersection

between signaling pathways involved in axon myelination and the inhibition of axon

regeneration. Frontiers in molecular neuroscience. 2016;9:33.

280. Jeon H-J, Park J, Shin J-H, Chang M-S. Insulin-like growth factor binding

protein-6 released from human mesenchymal stem cells confers neuronal protection

through IGF-1R-mediated signaling. International journal of molecular medicine.

2017;40(6):1860-8.

281. Naeve GS, Vana AM, Eggold JR, Verge G, Ling N, Foster AC. Expression of

rat insulin-like growth factor binding protein-6 in the brain, spinal cord, and sensory

ganglia. Molecular brain research. 2000;75(2):185-97.

282. Govind S, Kozma R, Monfries C, Lim L, Ahmed S. Cdc42Hs facilitates

cytoskeletal reorganization and neurite outgrowth by localizing the 58-kD insulin

receptor substrate to filamentous actin. The Journal of cell biology. 2001;152(3):579-

94.

283. Choi J, Ko J, Racz B, Burette A, Lee J-R, Kim S, et al. Regulation of dendritic

spine morphogenesis by insulin receptor substrate 53, a downstream effector of Rac1

and Cdc42 small GTPases. Journal of Neuroscience. 2005;25(4):869-79.

284. McCarthy HS, Williams JH, Davie MW, Marshall MJ. Platelet‐derived growth

factor stimulates osteoprotegerin production in osteoblastic cells. Journal of cellular

physiology. 2009;218(2):350-4.

285. Gutierrez H, Kisiswa L, O'Keeffe GW, Smithen MJ, Wyatt S, Davies AM.

Regulation of neurite growth by tumour necrosis superfamily member RANKL. Open

biology. 2013;3(1):120150.

134

286. Shibuya M. Vascular Endothelial Growth Factor (VEGF) and Its Receptor

(VEGFR) Signaling in Angiogenesis: A Crucial Target for Anti- and Pro-Angiogenic

Therapies. Genes Cancer. 2011;2(12):1097-105.

287. Sondell M, Sundler F, Kanje M. Vascular endothelial growth factor is a

neurotrophic factor which stimulates axonal outgrowth through the flk‐1 receptor.

European Journal of Neuroscience. 2000;12(12):4243-54.

288. Stacker SA, Achen MG. Emerging roles for VEGF-D in human disease.

Biomolecules. 2018;8(1):1.

289. Kolar MK, Itte VN, Kingham PJ, Novikov LN, Wiberg M, Kelk P. The

neurotrophic effects of different human dental mesenchymal stem cells. Scientific

reports. 2017;7(1):12605.

290. Sultan N, Amin LE, Zaher AR, Scheven BA, Grawish ME. Dental pulp stem

cells: Novel cell-based and cell-free therapy for peripheral nerve repair. World Journal

of Stomatology. 2019;7(1):1-19.

291. Mead B, Logan A, Berry M, Leadbeater W, Scheven BA. Concise review:

dental pulp stem cells: a novel cell therapy for retinal and central nervous system repair.

Stem Cells. 2017;35(1):61-7.

292. Martens W, Sanen K, Georgiou M, Struys T, Bronckaers A, Ameloot M, et al.

Human dental pulp stem cells can differentiate into Schwann cells and promote and

guide neurite outgrowth in an aligned tissue-engineered collagen construct in vitro. The

FASEB Journal. 2014;28(4):1634-43.

293. Sünwoldt J, Bosche B, Meisel A, Mergenthaler P. Neuronal culture

microenvironments determine preferences in bioenergetic pathway use. Frontiers in

molecular neuroscience. 2017;10:305.

294. Chimenti I, Gaetani R, Forte E, Angelini F, De Falco E, Zoccai GB, et al. Serum

and supplement optimization for EU GMP‐compliance in cardiospheres cell culture.

Journal of cellular and molecular medicine. 2014;18(4):624-34.

295. Goldberg JL. How does an axon grow? Genes & development. 2003;17(8):941-

58.

296. O'Donovan KJ. Intrinsic axonal growth and the drive for regeneration. Frontiers

in neuroscience. 2016;10:486.

297. Goldberg JL, Espinosa JS, Xu Y, Davidson N, Kovacs GT, Barres BA. Retinal

ganglion cells do not extend axons by default: promotion by neurotrophic signaling and

electrical activity. Neuron. 2002;33(5):689-702.

135

298. Martins LF, Costa RO, Pedro JR, Aguiar P, Serra SC, Teixeira FG, et al.

Mesenchymal stem cells secretome-induced axonal outgrowth is mediated by BDNF.

Scientific reports. 2017;7(1):4153.

299. Tucker KL, Meyer M, Barde Y-A. Neurotrophins are required for nerve growth

during development. Nature neuroscience. 2001;4(1):29.

300. Tuttle R, Matthew WD. Neurotrophins affect the pattern of DRG neurite growth

in a bioassay that presents a choice of CNS and PNS substrates. Development.

1995;121(5):1301-9.

301. Kimpinski K, Campenot R, Mearow K. Effects of the neurotrophins nerve

growth factor, neurotrophin‐3, and brain‐derived neurotrophic factor (BDNF) on

neurite growth from adult sensory neurons in compartmented cultures. Journal of

neurobiology. 1997;33(4):395-410.

302. Barbacid M. The Trk family of neurotrophin receptors. Journal of neurobiology.

1994;25(11):1386-403.

303. Nakano N, Nakai Y, Seo T-B, Yamada Y, Ohno T, Yamanaka A, et al.

Characterization of conditioned medium of cultured bone marrow stromal cells.

Neuroscience letters. 2010;483(1):57-61.

304. Miura‐Yura E, Tsunekawa S, Naruse K, Nakamura N, Motegi M, Nakai‐

Shimoda H, et al. Secreted factors from cultured dental pulp stem cells promoted neurite

outgrowth of dorsal root ganglion neurons and ameliorated neural functions in

streptozotocin‐induced diabetic mice. Journal of diabetes investigation. 2019.

305. Park HW, Lim MJ, Jung H, Lee SP, Paik KS, Chang MS. Human mesenchymal

stem cell‐derived Schwann cell‐like cells exhibit neurotrophic effects, via distinct

growth factor production, in a model of spinal cord injury. Glia. 2010;58(9):1118-32.

306. Fernandes M, Costa M, Carvalho G. Mineralization in serially passaged human

alveolar bone cells. Journal of Materials Science: Materials in Medicine. 1997;8(2):61-

5.

307. Siggelkow H, Benzler K, Atkinson M, Hüfner M. The use of confluence stages

does not decrease the overall variability in primary human osteoblasts but can give

additional information on differentiation in vitro. Experimental and clinical

endocrinology & diabetes. 1998;106(03):217-25.

308. Czekanska EM, Stoddart MJ, Ralphs JR, Richards RG, Hayes JS. A phenotypic

comparison of osteoblast cell lines versus human primary osteoblasts for biomaterials

testing. J Biomed Mater Res A. 2014;102(8):2636-43.

136

309. Billiau A, Edy V, Heremans H, Van Damme J, Desmyter J, Georgiades J, et al.

Human interferon: mass production in a newly established cell line, MG-63.

Antimicrobial agents and chemotherapy. 1977;12(1):11-5.

310. Mesquita-Guimarães J, Ramos L, Detsch R, Henriques B, Fredel MC, Silva FS,

et al. Evaluation of in vitro properties of 3D micro-macro porous zirconia scaffolds

coated with 58S bioactive glass using MG-63 osteoblast-like cells. Journal of the

European Ceramic Society. 2019;39(7):2545-58.

311. Gyorgyey A, Ungvari K, Kecskemeti G, Kopniczky J, Hopp B, Oszko A, et al.

Attachment and proliferation of human osteoblast-like cells (MG-63) on laser-ablated

titanium implant material. Mater Sci Eng C Mater Biol Appl. 2013;33(7):4251-9.

312. Lin L, Hao R, Xiong W, Zhong J. Quantitative analyses of the effect of silk

fibroin/nano-hydroxyapatite composites on osteogenic differentiation of MG-63 human

osteosarcoma cells. J Biosci Bioeng. 2015;119(5):591-5.

313. Verma S, Kumar N. Effect of biomimetic 3D environment of an injectable

polymeric scaffold on MG-63 osteoblastic-cell response. Materials Science and

Engineering: C. 2010;30(8):1118-28.

314. Czekanska EM, Stoddart MJ, Richards RG, Hayes JS. In search of an osteoblast

cell model for in vitro research. Eur Cell Mater. 2012;24:1-17.

315. Pautke C, Schieker M, Tischer T, Kolk A, Neth P, MUTSCHLER W, et al.

Characterization of osteosarcoma cell lines MG-63, Saos-2 and U-2 OS in comparison

to human osteoblasts. Anticancer research. 2004;24(6):3743-8.

316. Staehlke S, Rebl H, Nebe B. Phenotypic stability of the human MG‐63

osteoblastic cell line at different passages. Cell Biology International. 2019;43(1):22-

32.

317. Stein GS, Lian JB, Owen TA. Relationship of cell growth to the regulation of

tissue-specific gene expression during osteoblast differentiation. The FASEB journal.

1990;4(13):3111-23.

318. Lian JB, Stein GS. Concepts of osteoblast growth and differentiation: basis for

modulation of bone cell development and tissue formation. Critical Reviews in Oral

Biology & Medicine. 1992;3(3):269-305.

319. Owen TA, Aronow M, Shalhoub V, Barone LM, Wilming L, Tassinari MS, et

al. Progressive development of the rat osteoblast phenotype in vitro: reciprocal

relationships in expression of genes associated with osteoblast proliferation and

137

differentiation during formation of the bone extracellular matrix. Journal of cellular

physiology. 1990;143(3):420-30.

320. Bianco P, Fisher LW, Young MF, Termine JD, Robey PG. Expression of bone

sialoprotein (BSP) in developing human tissues. Calcified tissue international.

1991;49(6):421-6.

321. Lamour V, Detry C, Sanchez C, Henrotin Y, Castronovo V, Bellahcene A.

Runx2- and histone deacetylase 3-mediated repression is relieved in differentiating

human osteoblast cells to allow high bone sialoprotein expression. J Biol Chem.

2007;282(50):36240-9.

322. Rutkovskiy A, Stenslokken KO, Vaage IJ. Osteoblast Differentiation at a

Glance. Med Sci Monit Basic Res. 2016;22:95-106.

323. van Griensven M, Zeichen J, Tschernig T, Seekamp A, Pape H-C. A modified

method to culture human osteoblasts from bone tissue specimens using fibrin glue.

Experimental and Toxicologic Pathology. 2002;54(1):25-9.

324. Benayahu D, Shur I, Marom R, Meller I, Issakov J. Cellular and molecular

properties associated with osteosarcoma cells. Journal of cellular biochemistry.

2002;84(1):108-14.

325. Perez A, Spears R, Gutmann J, Opperman L. Osteoblasts and MG‐63

osteosarcoma cells behave differently when in contact with ProRoot™ MTA and White

MTA. International Endodontic Journal. 2003;36(8):564-70.

326. Song L, Tuan RS. MicroRNAs and cell differentiation in mammalian

development. Birth Defects Res C Embryo Today. 2006;78(2):140-9.

327. Hu H, Zhang Y, Cai XH, Huang JF, Cai L. Changes in microRNA expression

in the MG-63 osteosarcoma cell line compared with osteoblasts. Oncol Lett.

2012;4(5):1037-42.

328. Johansen JS, Williamson MK, Rice JS, Price PA. Identification of proteins

secreted by human osteoblastic cells in culture. Journal of Bone and Mineral Research.

1992;7(5):501-12.

329. Pierschbacher M, Dedhar S, Ruoslahti E, Argraves S, Suzuki S. An adhesion

variant of the MG‐63 osteosarcoma cell line displays an osteoblast‐like phenotype. Cell

and molecular biology of vertebrate hard tissues. 1988;136:131-41.

330. Tsai S-W, Liou H-M, Lin C-J, Kuo K-L, Hung Y-S, Weng R-C, et al. MG63

osteoblast-like cells exhibit different behavior when grown on electrospun collagen

matrix versus electrospun gelatin matrix. PloS one. 2012;7(2):e31200.

138

331. Shao X, Cao X, Song G, Zhao Y, Shi B. Metformin rescues the MG63

osteoblasts against the effect of high glucose on proliferation. J Diabetes Res.

2014;2014:453940.

332. Torshabi M, Esfahrood ZR, Gholamin P, Karami E. Effects of nicotine in the

presence and absence of vitamin E on morphology, viability and osteogenic gene

expression in MG-63 osteoblast-like cells. J Basic Clin Physiol Pharmacol.

2016;27(6):595-602.

333. Luo X, Liao E, Zhou H. Differentiation and gene expression of human

osteosarcoma cell line MG-63. Hunan yi ke da xue xue bao= Hunan Yike Daxue

Xuebao= Bulletin of Hunan Medical University. 2001;26(2):107-10.

334. Brauer A, Pohlemann T, Metzger W. Osteogenic differentiation of immature

osteoblasts: interplay of cell culture media and supplements. Biotechnic &

Histochemistry. 2016;91(3):161-9.

335. Yang L, Tao T, Wang X, Du N, Chen W, Tao S, et al. Effects of dexamethasone

on proliferation, differentiation and apoptosis of adult human osteoblasts in vitro.

Chinese medical journal. 2003;116(9):1357-60.

336. Orriss IR, Hajjawi MO, Huesa C, MacRae VE, Arnett TR. Optimisation of the

differing conditions required for bone formation in vitro by primary osteoblasts from

mice and rats. International journal of molecular medicine. 2014;34(5):1201-8.

337. Gronowicz G, Woodiel FN, Mccarthy MB, Raisz LG. In vitro mineralization of

fetal rat parietal bones in defined serum‐free medium: Effect of β‐glycerol phosphate.

Journal of bone and mineral research. 1989;4(3):313-24.

338. Harada SI, Matsumoto T, Ogata E. Role of ascorbic acid in the regulation of

proliferation in osteoblast‐like MC3T3‐El cells. Journal of Bone and Mineral Research.

1991;6(9):903-8.

339. Aronow MA, Gerstenfeld LC, Owen TA, Tassinari MS, Stein GS, Lian JB.

Factors that promote progressive development of the osteoblast phenotype in cultured

fetal rat calvaria cells. Journal of cellular physiology. 1990;143(2):213-21.

340. Stein GS, Lian JB, Owen TA. Relationship of cell growth to the regulation of

tissue‐specific gene expression during osteoblast differentiation. The FASEB journal.

1990;4(13):3111-23.

341. Bilbe G, Roberts E, Birch M, Evans D. PCR phenotyping of cytokines, growth

factors and their receptors and bone matrix proteins in human osteoblast-like cell lines.

Bone. 1996;19(5):437-45.

139

342. Kuroda S, TAKEDA S, NAKAMURA M. Effects of six particulate metals on

osteoblast-like MG-63 and HOS cells in vitro. Dental materials journal.

2003;22(4):507-20.

343. Saldana L, Bensiamar F, Bore A, Vilaboa N. In search of representative models

of human bone-forming cells for cytocompatibility studies. Acta Biomater.

2011;7(12):4210-21.

344. Tu Q, Zhang J, Paz J, Wade K, Yang P, Chen J. Haploinsufficiency of Runx2

results in bone formation decrease and different BSP expression pattern changes in two

transgenic mouse models. J Cell Physiol. 2008;217(1):40-7.

345. Liu W, Toyosawa S, Furuichi T, Kanatani N, Yoshida C, Liu Y, et al.

Overexpression of Cbfa1 in osteoblasts inhibits osteoblast maturation and causes

osteopenia with multiple fractures. Journal of Cell Biology. 2001;155(1):157-66.

346. Geoffroy V, Kneissel M, Fournier B, Boyde A, Matthias P. High bone

resorption in adult aging transgenic mice overexpressing cbfa1/runx2 in cells of the

osteoblastic lineage. Molecular and cellular biology. 2002;22(17):6222-33.

347. Li L, Zhu J, Tu Q, Yamauchi M, Sodek J, Karsenty G, et al. An in vivo model

to study osteogenic gene regulation: targeting an avian retroviral receptor (TVA) to

bone with the bone sialoprotein (BSP) promoter. Journal of Bone and Mineral

Research. 2005;20(8):1403-13.

348. Komori T. Regulation of Proliferation, Differentiation and Functions of

Osteoblasts by Runx2. Int J Mol Sci. 2019;20(7).

349. Kumarasuriyar A, Murali S, Nurcombe V, Cool SM. Glycosaminoglycan

composition changes with MG-63 osteosarcoma osteogenesis in vitro and induces

human mesenchymal stem cell aggregation. J Cell Physiol. 2009;218(3):501-11.

350. Kiyoshima T, Yamauchi M, Wong C, Jheon A, Ganss B, Sodek J. An L1

element disrupts human bone sialoprotein promoter: lack of tissue-specific regulation

by distalless5 (Dlx5) and runt homeodomain protein2 (Runx2)/core binding factor a1

(Cbfa1) elements. Gene. 2002;299(1-2):205-17.

351. Adhami MD, Rashid H, Chen H, Clarke JC, Yang Y, Javed A. Loss of Runx2

in committed osteoblasts impairs postnatal skeletogenesis. J Bone Miner Res.

2015;30(1):71-82.

352. Benavides-Castellanos MP, Garzón-Orjuela N, Linero I. Effectiveness of

mesenchymal stem cell-conditioned medium in bone regeneration in animal and human

models: a systematic review and meta-analysis. Cell Regeneration. 2020;9:1-22.

140

353. Walmsley GG, Ransom RC, Zielins ER, Leavitt T, Flacco JS, Hu MS, et al.

Stem cells in bone regeneration. Stem Cell Reviews and Reports. 2016;12(5):524-9.

354. Dimitriou R, Jones E, McGonagle D, Giannoudis PV. Bone regeneration:

current concepts and future directions. BMC medicine. 2011;9(1):66.

355. Seong JM, Kim BC, Park JH, Kwon IK, Mantalaris A, Hwang YS. Stem cells

in bone tissue engineering. Biomed Mater. 2010;5(6):062001.

356. Sun J, Zhou H, Deng Y, Zhang Y, Gu P, Ge S, et al. Conditioned medium from

bone marrow mesenchymal stem cells transiently retards osteoblast differentiation by

downregulating runx2. Cells Tissues Organs. 2012;196(6):510-22.

357. Santos TS, Abuna RP, Castro Raucci LM, Teixeira LN, de Oliveira PT, Beloti

MM, et al. Mesenchymal Stem Cells Repress Osteoblast Differentiation Under

Osteogenic-Inducing Conditions. J Cell Biochem. 2015;116(12):2896-902.

358. El Moshy S, Radwan IA, Rady D, Abbass M, El-Rashidy AA, Sadek KM, et al.

Dental stem cell-derived secretome/conditioned medium: The future for regenerative

therapeutic applications. Stem Cells International. 2020;2020.

359. Katagiri W, Osugi M, Kawai T, Ueda M. Novel cell-free regeneration of bone

using stem cell-derived growth factors. Int J Oral Maxillofac Implants.

2013;28(4):1009-16.

360. Katagiri W, Osugi M, Kinoshita K, Hibi H. Conditioned Medium From

Mesenchymal Stem Cells Enhances Early Bone Regeneration After Maxillary Sinus

Floor Elevation in Rabbits. Implant Dent. 2015;24(6):657-63.

361. Osugi M, Katagiri W, Yoshimi R, Inukai T, Hibi H, Ueda M. Conditioned media

from mesenchymal stem cells enhanced bone regeneration in rat calvarial bone defects.

Tissue Eng Part A. 2012;18(13-14):1479-89.

362. Katagiri W, Sakaguchi K, Kawai T, Wakayama Y, Osugi M, Hibi H. A defined

mix of cytokines mimics conditioned medium from cultures of bone marrow‐derived

mesenchymal stem cells and elicits bone regeneration. Cell proliferation.

2017;50(3):e12333.

363. Ogata K, Osugi M, Kawai T, Wakayama Y, Sakaguchi K, Nakamura S, et al.

Secretomes of mesenchymal stem cells induce early bone regeneration by accelerating

migration of stem cells. Journal of oral and maxillofacial surgery, medicine, and

pathology. 2018;30(5):445-51.

364. Chang W, Kim R, Park SI, Jung YJ, Ham O, Lee J, et al. Enhanced healing of

rat calvarial bone defects with hypoxic conditioned medium from mesenchymal stem

141

cells through increased endogenous stem cell migration via regulation of ICAM-1

targeted-microRNA-221. Molecules and cells. 2015;38(7):643.

365. Linero I, Chaparro O. Paracrine effect of mesenchymal stem cells derived from

human adipose tissue in bone regeneration. PLoS One. 2014;9(9):e107001.

366. Fujio M, Xing Z, Sharabi N, Xue Y, Yamamoto A, Hibi H, et al. Conditioned

media from hypoxic-cultured human dental pulp cells promotes bone healing during

distraction osteogenesis. J Tissue Eng Regen Med. 2017;11(7):2116-26.

367. Seo HJ, Cho YE, Kim T, Shin HI, Kwun IS. Zinc may increase bone formation

through stimulating cell proliferation, alkaline phosphatase activity and collagen

synthesis in osteoblastic MC3T3-E1 cells. Nutr Res Pract. 2010;4(5):356-61.

368. Wergedal J, Baylink D. Fluoride directly stimulates proliferation and alkaline

phosphatase activity of bone-forming cells. Science. 1983;222(4621):330-2.

369. Hawkins D, Abrahamse H. How Should an Increase in Alkaline Phosphatase

Activity Be Interpreted? Laser Chemistry. 2007;2007:1-10.

370. Beloti MM, Rosa AL. Osteoblast differentiation of human bone marrow cells

under continuous and discontinuous treatment with dexamethasone. Brazilian dental

journal. 2005;16(2):156-61.

371. Nagai H, Tsukuda R, Mayahara H. Effects of basic fibroblast growth factor

(bFGF) on bone formation in growing rats. Bone. 1995;16(3):367-73.

372. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth Factors.

2004;22(4):233-41.

373. Yu X, Hsieh S-c, Bao W, Graves DT. Temporal expression of PDGF receptors

and PDGF regulatory effects on osteoblastic cells in mineralizing cultures. American

Journal of Physiology-Cell Physiology. 1997;272(5):C1709-C16.

374. Yang D, Chen J, Jing Z, Jin D. Platelet-derived growth factor (PDGF)-AA: a

self-imposed cytokine in the proliferation of human fetal osteoblasts. Cytokine.

2000;12(8):1271-4.

375. Martinovic S, Borovecki F, Miljavac V, Kisic V, Maticic D, Francetic I, et al.

Requirement of a bone morphogenetic protein for the maintenance and stimulation of

osteoblast differentiation. Archives of histology and cytology. 2006;69(1):23-36.

376. Zhu F, Friedman MS, Luo W, Woolf P, Hankenson KD. The transcription factor

osterix (SP7) regulates BMP6-induced human osteoblast differentiation. J Cell Physiol.

2012;227(6):2677-85.

142

377. Friedman MS, Long MW, Hankenson KD. Osteogenic differentiation of human

mesenchymal stem cells is regulated by bone morphogenetic protein-6. Journal of

Cellular Biochemistry. 2006;98(3):538-54.

378. Yan J, Herzog JW, Tsang K, Brennan CA, Bower MA, Garrett WS, et al. Gut

microbiota induce IGF-1 and promote bone formation and growth. Proceedings of the

National Academy of Sciences. 2016;113(47):E7554-E63.

379. Guo Y, Tang CY, Man XF, Tang HN, Tang J, Zhou CL, et al. Insulin-like

growth factor-1 promotes osteogenic differentiation and collagen I alpha 2 synthesis

via induction of mRNA-binding protein LARP6 expression. Dev Growth Differ.

2017;59(2):94-103.

380. Kassem M, Blum W, Ristelli J, Mosekilde L, Eriksen E. Growth hormone

stimulates proliferation and differentiation of normal human osteoblast-like cells in

vitro. Calcified Tissue International. 1993;52(3):222-6.

381. Kajiya M, Shiba H, Fujita T, Ouhara K, Takeda K, Mizuno N, et al. Brain-

derived neurotrophic factor stimulates bone/cementum-related protein gene expression

in cementoblasts. J Biol Chem. 2008;283(23):16259-67.

382. Xi G, Wai C, DeMambro V, Rosen CJ, Clemmons DR. IGFBP-2 directly

stimulates osteoblast differentiation. J Bone Miner Res. 2014;29(11):2427-38.

383. Palermo C, Manduca P, Gazzerro E, Foppiani L, Segat D, Barreca A.

Potentiating role of IGFBP-2 on IGF-II-stimulated alkaline phosphatase activity in

differentiating osteoblasts. American Journal of Physiology-Endocrinology and

Metabolism. 2004;286(4):E648-E57.

384. Ernst M, Rodan GA. Increased activity of insulin-like growth factor (IGF) in

osteoblastic cells in the presence of growth hormone (GH): positive correlation with

the presence of the GHinduced IGF-binding protein BP-3. Endocrinology.

1990;127(2):807-14.

385. Eguchi K, Akiba Y, Akiba N, Nagasawa M, Cooper LF, Uoshima K. Insulin-

like growth factor binding Protein-3 suppresses osteoblast differentiation via bone

morphogenetic protein-2. Biochem Biophys Res Commun. 2018;507(1-4):465-70.

386. Yan T, Wergedal J, Zhou Y, Mohan S, Baylink DJ, Strong DD. Inhibition of

human osteoblast marker gene expression by retinoids is mediated in part by insulin-

like growth factor binding protein-6. Growth Horm IGF Res. 2001;11(6):368-77.

387. Govoni KE, Baylink DJ, Mohan S. The multi-functional role of insulin-like

growth factor binding proteins in bone. Pediatr Nephrol. 2005;20(3):261-8.

143

388. Carmeliet P. Angiogenesis in life, disease and medicine. Nature.

2005;438(7070):932-6.

389. Maacha S, Sidahmed H, Jacob S, Gentilcore G, Calzone R, Grivel JC, et al.

Paracrine Mechanisms of Mesenchymal Stromal Cells in Angiogenesis. Stem Cells Int.

2020;2020:4356359.

390. Watt SM, Gullo F, van der Garde M, Markeson D, Camicia R, Khoo CP, et al.

The angiogenic properties of mesenchymal stem/stromal cells and their therapeutic

potential. Br Med Bull. 2013;108:25-53.

391. Tao H, Han Z, Han ZC, Li Z. Proangiogenic Features of Mesenchymal Stem

Cells and Their Therapeutic Applications. Stem Cells International. 2016;2016:1-11.

392. Kwon HM, Hur SM, Park KY, Kim CK, Kim YM, Kim HS, et al. Multiple

paracrine factors secreted by mesenchymal stem cells contribute to angiogenesis.

Vascul Pharmacol. 2014;63(1):19-28.

393. Pankajakshan D, Agrawal DK. Mesenchymal stem cell paracrine factors in

vascular repair and regeneration. Journal of biomedical technology and research.

2014;1(1).

394. Gharaei MA, Xue Y, Mustafa K, Lie SA, Fristad I. Human dental pulp stromal

cell conditioned medium alters endothelial cell behavior. Stem Cell Res Ther.

2018;9(1):69.

395. Hilkens P, Fanton Y, Martens W, Gervois P, Struys T, Politis C, et al. Pro-

angiogenic impact of dental stem cells in vitro and in vivo. Stem Cell Res.

2014;12(3):778-90.

396. Abbas OL, Ozatik O, Gonen ZB, Ogut S, Ozatik FY, Salkin H, et al.

Comparative Analysis of Mesenchymal Stem Cells from Bone Marrow, Adipose

Tissue, and Dental Pulp as Sources of Cell Therapy for Zone of Stasis Burns. J Invest

Surg. 2019;32(6):477-90.

397. Nicosia RF. The aortic ring model of angiogenesis: a quarter century of search

and discovery. J Cell Mol Med. 2009;13(10):4113-36.

398. Aplin AC, Fogel E, Zorzi P, Nicosia RF. Chapter 7 The Aortic Ring Model of

Angiogenesis. Angiogenesis - In Vitro Systems. Methods in Enzymology2008. p. 119-

36.

399. Ernens I, Lenoir B, Devaux Y, Wagner DR. Rat Aortic Ring Model to Assay

Angiogenesis ex vivo. 2015.

144

400. Xian X, Gong Q, Li C, Guo B, Jiang H. Exosomes with Highly Angiogenic

Potential for Possible Use in Pulp Regeneration. J Endod. 2018;44(5):751-8.

401. Zhou H, Li X, Yin Y, He XT, An Y, Tian BM, et al. The proangiogenic effects

of extracellular vesicles secreted by dental pulp stem cells derived from periodontally

compromised teeth. Stem Cell Res Ther. 2020;11(1):110.

402. Merckx G, Hosseinkhani B, Kuypers S, Deville S, Irobi J, Nelissen I, et al.

Angiogenic Effects of Human Dental Pulp and Bone Marrow-Derived Mesenchymal

Stromal Cells and their Extracellular Vesicles. Cells. 2020;9(2).

403. Nowak-Sliwinska P, Alitalo K, Allen E, Anisimov A, Aplin AC, Auerbach R,

et al. Consensus guidelines for the use and interpretation of angiogenesis assays.

Angiogenesis. 2018;21(3):425-532.

404. Iqbal F, Szaraz P, Librach M, Gauthier-Fisher A, Librach CL. Angiogenic

potency evaluation of cell therapy candidates by a novel application of the in vitro aortic

ring assay. Stem Cell Res Ther. 2017;8(1):184.

405. Yuen WW, Du NR, Chan CH, Silva EA, Mooney DJ. Mimicking nature by

codelivery of stimulant and inhibitor to create temporally stable and spatially restricted

angiogenic zones. Proc Natl Acad Sci U S A. 2010;107(42):17933-8.

406. Zisa D, Shabbir A, Suzuki G, Lee T. Vascular endothelial growth factor (VEGF)

as a key therapeutic trophic factor in bone marrow mesenchymal stem cell-mediated

cardiac repair. Biochem Biophys Res Commun. 2009;390(3):834-8.

407. Katagiri W, Kawai T, Osugi M, Sugimura-Wakayama Y, Sakaguchi K, Kojima

T, et al. Angiogenesis in newly regenerated bone by secretomes of human mesenchymal

stem cells. Maxillofac Plast Reconstr Surg. 2017;39(1):8.

408. Bhang SH, Lee S, Shin JY, Lee TJ, Jang HK, Kim BS. Efficacious and clinically

relevant conditioned medium of human adipose-derived stem cells for therapeutic

angiogenesis. Mol Ther. 2014;22(4):862-72.

409. Zhang HC, Liu XB, Huang S, Bi XY, Wang HX, Xie LX, et al. Microvesicles

derived from human umbilical cord mesenchymal stem cells stimulated by hypoxia

promote angiogenesis both in vitro and in vivo. Stem Cells Dev. 2012;21(18):3289-97.

410. Han Y, Ren J, Bai Y, Pei X, Han Y. Exosomes from hypoxia-treated human

adipose-derived mesenchymal stem cells enhance angiogenesis through VEGF/VEGF-

R. Int J Biochem Cell Biol. 2019;109:59-68.

145

411. Dogan A, Demirci S, Apdik H, Apdik EA, Sahin F. Mesenchymal Stem Cell

Isolation from Pulp Tissue and Co-Culture with Cancer Cells to Study Their

Interactions. J Vis Exp. 2019(143).

412. Zhang T, Lee YW, Rui YF, Cheng TY, Jiang XH, Li G. Bone marrow-derived

mesenchymal stem cells promote growth and angiogenesis of breast and prostate

tumors. Stem cell research & therapy. 2013;4(3):70.

413. Sasser AK, Mundy BL, Smith KM, Studebaker AW, Axel AE, Haidet AM, et

al. Human bone marrow stromal cells enhance breast cancer cell growth rates in a cell

line-dependent manner when evaluated in 3D tumor environments. Cancer Lett.

2007;254(2):255-64.

414. Akimoto K, Kimura K, Nagano M, Takano S, To'a Salazar G, Yamashita T, et

al. Umbilical cord blood-derived mesenchymal stem cells inhibit, but adipose tissue-

derived mesenchymal stem cells promote, glioblastoma multiforme proliferation. Stem

Cells Dev. 2013;22(9):1370-86.

415. Pasanen I, Pietila M, Lehtonen S, Lehtilahti E, Hakkarainen T, Blanco

Sequeiros R, et al. Mesenchymal stromal cells from female donors enhance breast

cancer cell proliferation in vitro. Oncology. 2015;88(4):214-25.

416. Rodini CO, da Silva PBG, Assoni AF, Carvalho VM, Okamoto OK.

Mesenchymal stem cells enhance tumorigenic properties of human glioblastoma

through independent cell-cell communication mechanisms. Oncotarget.

2018;9(37):24766.

417. Bajetto A, Pattarozzi A, Corsaro A, Barbieri F, Daga A, Bosio A, et al. Different

Effects of Human Umbilical Cord Mesenchymal Stem Cells on Glioblastoma Stem

Cells by Direct Cell Interaction or Via Released Soluble Factors. Front Cell Neurosci.

2017;11:312.

418. Clarke MR, Imhoff FM, Baird SK. Mesenchymal stem cells inhibit breast

cancer cell migration and invasion through secretion of tissue inhibitor of

metalloproteinase-1 and -2. Mol Carcinog. 2015;54(10):1214-9.

419. He N, Kong Y, Lei X, Liu Y, Wang J, Xu C, et al. MSCs inhibit tumor

progression and enhance radiosensitivity of breast cancer cells by down-regulating

Stat3 signaling pathway. Cell death & disease. 2018;9(10):1-14.

420. Kostadinova M, Antonov B, Kinov P, Oreshkova T, Mourdjeva M.

Mesenchymal stem cells inhibit the growth of prostate carcinoma cells in a long-term

cultivation. Biotechnology & Biotechnological Equipment. 2020;34(1):354-60.

146

421. Rhee KJ, Lee JI, Eom YW. Mesenchymal Stem Cell-Mediated Effects of Tumor

Support or Suppression. Int J Mol Sci. 2015;16(12):30015-33.

422. Zhu Y, Sun Z, Han Q, Liao L, Wang J, Bian C, et al. Human mesenchymal stem

cells inhibit cancer cell proliferation by secreting DKK-1. Leukemia. 2009;23(5):925-

33.

423. Takigawa H, Kitadai Y, Shinagawa K, Yuge R, Higashi Y, Tanaka S, et al.

Mesenchymal Stem Cells Induce Epithelial to Mesenchymal Transition in Colon

Cancer Cells through Direct Cell-to-Cell Contact. Neoplasia. 2017;19(5):429-38.

424. Melzer C, Yang Y, Hass R. Interaction of MSC with tumor cells. Cell Commun

Signal. 2016;14(1):20.

425. Kalamegam G, Sait KHW, Anfinan N, Kadam R, Ahmed F, Rasool M, et al.

Cytokines secreted by human Wharton's jelly stem cells inhibit the proliferation of

ovarian cancer (OVCAR3) cells in vitro. Oncol Lett. 2019;17(5):4521-31.

426. Chao KC, Yang HT, Chen MW. Human umbilical cord mesenchymal stem cells

suppress breast cancer tumourigenesis through direct cell-cell contact and

internalization. J Cell Mol Med. 2012;16(8):1803-15.

427. Qiao L, Xu Z, Zhao T, Zhao Z, Shi M, Zhao RC, et al. Suppression of

tumorigenesis by human mesenchymal stem cells in a hepatoma model. Cell Res.

2008;18(4):500-7.

428. Ji X, Zhang Z, Han Y, Song J, Xu X, Jin J, et al. Mesenchymal stem cells derived

from normal gingival tissue inhibit the proliferation of oral cancer cells in vitro and in

vivo. Int J Oncol. 2016;49(5):2011-22.

429. Del Fattore A, Luciano R, Saracino R, Battafarano G, Rizzo C, Pascucci L, et

al. Differential effects of extracellular vesicles secreted by mesenchymal stem cells

from different sources on glioblastoma cells. Expert opinion on biological therapy.

2015;15(4):495-504.

430. Gomes ED, Vieira de Castro J, Costa BM, Salgado AJ. The impact of

Mesenchymal Stem Cells and their secretome as a treatment for gliomas. Biochimie.

2018;155:59-66.

431. Jozan S, Tournier J, Tauber J, Bayard F. Adaptation of the human breast cancer

cell line MCF-7 to serum free medium culture on extracellular matrix. Biochemical and

biophysical research communications. 1982;107(4):1566-70.

432. Barabutis N, Tsellou E, Schally AV, Kouloheri S, Kalofoutis A, Kiaris H.

Stimulation of proliferation of MCF-7 breast cancer cells by a transfected splice variant

147

of growth hormone-releasing hormone receptor. Proceedings of the National Academy

of Sciences. 2007;104(13):5575-9.

433. Sasser AK, Sullivan NJ, Studebaker AW, Hendey LF, Axel AE, Hall BM.

Interleukin‐6 is a potent growth factor for ER‐α‐positive human breast cancer. The

FASEB Journal. 2007;21(13):3763-70.

434. Herheliuk T, Perepelytsina O, Ostapchenko L, Sydorenko M. The Effect of

Multipotent Mesenchymal Stromal Cell Derivatives on the Properties of Breast Cancer

Cells in vitro and in vivo. Cytology and Genetics. 2018;52(4):283-93.

435. Yang C, Lei D, Ouyang W, Ren J, Li H, Hu J, et al. Conditioned media from

human adipose tissue-derived mesenchymal stem cells and umbilical cord-derived

mesenchymal stem cells efficiently induced the apoptosis and differentiation in human

glioma cell lines in vitro. Biomed Res Int. 2014;2014:109389.

436. Kolosa K, Motaln H, Herold-Mende C, Korsic M, Lah TT. Paracrine effects of

mesenchymal stem cells induce senescence and differentiation of glioblastoma stem-

like cells. Cell Transplant. 2015;24(4):631-44.

437. Visweswaran M, Arfuso F, Dilley RJ, Newsholme P, Dharmarajan A. The

inhibitory influence of adipose tissue-derived mesenchymal stem cell environment and

Wnt antagonism on breast tumour cell lines. The International Journal of Biochemistry

& Cell Biology. 2018;95:63-72.

438. Qi J, Zhou Y, Jiao Z, Wang X, Zhao Y, Li Y, et al. Exosomes Derived from

Human Bone Marrow Mesenchymal Stem Cells Promote Tumor Growth Through

Hedgehog Signaling Pathway. Cell Physiol Biochem. 2017;42(6):2242-54.

439. Hanyu S, Sakuma K, Tanaka A. A Study on the Effect of Human Dental Pulp

Stem Cell Conditioned Medium on Human Oral Squamous Cell Carcinoma Cell Lines.

Journal of Hard Tissue Biology. 2019;28(3):281-8.

440. Dasari S, Pandhiri T, Haley J, Lenz D, Mitra AK. A Proximal Culture Method

to Study Paracrine Signaling Between Cells. J Vis Exp. 2018(138).

441. Witwer KW, Van Balkom BWM, Bruno S, Choo A, Dominici M, Gimona M,

et al. Defining mesenchymal stromal cell (MSC)-derived small extracellular vesicles

for therapeutic applications. J Extracell Vesicles. 2019;8(1):1609206.

442. Bronckaers A, Hilkens P, Fanton Y, Struys T, Gervois P, Politis C, et al.

Angiogenic properties of human dental pulp stem cells. PloS one. 2013;8(8).

148

443. Doğan A, Demirci S, Apdik H, Apdik EA, Şahin F. Mesenchymal Stem Cell

Isolation from Pulp Tissue and Co-Culture with Cancer Cells to Study Their

Interactions. Journal of Visualized Experiments. 2019(143).

444. Piva E, Tarle SA, Nor JE, Zou D, Hatfield E, Guinn T, et al. Dental Pulp Tissue

Regeneration Using Dental Pulp Stem Cells Isolated and Expanded in Human Serum.

J Endod. 2017;43(4):568-74.

445. Swanson WB, Gong T, Zhang Z, Eberle M, Niemann D, Dong R, et al.

Controlled release of odontogenic exosomes from a biodegradable vehicle mediates

dentinogenesis as a novel biomimetic pulp capping therapy. J Control Release.

2020;324:679-94.

446. Gervois P, Ratajczak J, Wolfs E, Vangansewinkel T, Dillen Y, Merckx G, et al.

Preconditioning of human dental pulp stem cells with leukocyte-and platelet-rich fibrin-

derived factors does not enhance their neuroregenerative effect. Stem cells


447. Zhang W, Yu L, Han X, Pan J, Deng J, Zhu L, et al. The secretome of human

dental pulp stem cells protects myoblasts from hypoxia‑induced injury via the

Wnt/β‑catenin pathway. International Journal of Molecular Medicine.

2020;45(5):1501-13.

448. Joo KH, Song JS, Kim S, Lee HS, Jeon M, Kim SO, et al. Cytokine Expression

of Stem Cells Originating from the Apical Complex and Coronal Pulp of Immature

Teeth. J Endod. 2018;44(1):87-92 e1.

449. Gervois P, Wolfs E, Dillen Y, Hilkens P, Ratajczak J, Driesen RB, et al.

Paracrine Maturation and Migration of SH-SY5Y Cells by Dental Pulp Stem Cells. J

Dent Res. 2017;96(6):654-62.

450. Ji L, Bao L, Gu Z, Zhou Q, Liang Y, Zheng Y, et al. Comparison of

immunomodulatory properties of exosomes derived from bone marrow mesenchymal

stem cells and dental pulp stem cells. Immunol Res. 2019;67(4-5):432-42.

451. Huang CC, Narayanan R, Alapati S, Ravindran S. Exosomes as biomimetic

tools for stem cell differentiation: Applications in dental pulp tissue regeneration.

Biomaterials. 2016;111:103-15.

452. Iohara K, Murakami M, Nakata K, Nakashima M. Age-dependent decline in

dental pulp regeneration after pulpectomy in dogs. Exp Gerontol. 2014;52:39-45.

453. Murakami M, Hayashi Y, Iohara K, Osako Y, Hirose Y, Nakashima M. Trophic

Effects and Regenerative Potential of Mobilized Mesenchymal Stem Cells From Bone

149

Marrow and Adipose Tissue as Alternative Cell Sources for Pulp/Dentin Regeneration.

Cell Transplant. 2015;24(9):1753-65.

454. Chen T-F, Chen K-W, Chien Y, Lai Y-H, Hsieh S-T, Ma H-Y, et al. Dental Pulp

Stem Cell-Derived Factors Alleviate Subarachnoid Hemorrhage-Induced

Neuroinflammation and Ischemic Neurological Deficits. International journal of

molecular sciences. 2019;20(15):3747.

455. Xian X, Gong Q, Li C, Guo B, Jiang H. Exosomes with Highly Angiogenic

Potential for Possible Use in Pulp Regeneration. Journal of Endodontics.

2018;44(5):751-8.

456. Kano F, Matsubara K, Ueda M, Hibi H, Yamamoto A. Secreted Ectodomain of

Sialic Acid-Binding Ig-Like Lectin-9 and Monocyte Chemoattractant Protein-1

Synergistically Regenerate Transected Rat Peripheral Nerves by Altering Macrophage

Polarity. Stem Cells. 2017;35(3):641-53.

457. Matsubara K, Matsushita Y, Sakai K, Kano F, Kondo M, Noda M, et al.

Secreted ectodomain of sialic acid-binding Ig-like lectin-9 and monocyte

chemoattractant protein-1 promote recovery after rat spinal cord injury by altering

macrophage polarity. J Neurosci. 2015;35(6):2452-64.

458. Fujii H, Matsubara K, Sakai K, Ito M, Ohno K, Ueda M, et al. Dopaminergic

differentiation of stem cells from human deciduous teeth and their therapeutic benefits

for Parkinsonian rats. Brain Res. 2015;1613:59-72.

459. Han Y, Gong T, Zhang C, Dissanayaka WL. HIF-1alpha Stabilization Enhances

Angio-/Vasculogenic Properties of SHED. J Dent Res. 2020;99(7):804-12.

460. Ogasawara N, Kano F, Hashimoto N, Mori H, Liu Y, Xia L, et al. Factors

secreted from dental pulp stem cells show multifaceted benefits for treating

experimental temporomandibular joint osteoarthritis. Osteoarthritis Cartilage.

2020;28(6):831-41.

461. Sakai K, Tsuruta T, Watanabe J, Sugimura Y, Sakaguchi K, Katagiri W, et al.

Peripheral Nerve Regeneration in a Novel Rat Model of Dysphagia. Stem Cells and

Tissue Repair: Springer; 2020. p. 107-13.

462. Zhang Z, Shuai Y, Zhou F, Yin J, Hu J, Guo S, et al. PDLSCs Regulate

Angiogenesis of Periodontal Ligaments via VEGF Transferred by Exosomes in

Periodontitis. Int J Med Sci. 2020;17(5):558-67.

150

463. Wada N, Menicanin D, Shi S, Bartold PM, Gronthos S. Immunomodulatory

properties of human periodontal ligament stem cells. Journal of cellular physiology.

2009;219(3):667-76.

464. Bakopoulou A, Kritis A, Andreadis D, Papachristou E, Leyhausen G, Koidis P,

et al. Angiogenic potential and secretome of human apical papilla mesenchymal stem

cells in various stress microenvironments. Stem Cells and Development.

2015;24(21):2496-512.

465. Zhuang X, Ji L, Jiang H, Liu Y, Liu X, Bi J, et al. Exosomes Derived from Stem

Cells from the Apical Papilla Promote Dentine-Pulp Complex Regeneration by

Inducing Specific Dentinogenesis. Stem Cells Int. 2020;2020:5816723.

466. Yu S, Zhao Y, Fang TJ, Ge L. Effect of the Soluble Factors Released by Dental

Apical Papilla-Derived Stem Cells on the Osteo/Odontogenic, Angiogenic, and

Neurogenic Differentiation of Dental Pulp Cells. Stem Cells Dev. 2020;29(12):795-

805.

467. Yu S, Li J, Zhao Y, Li X, Ge L. Comparative Secretome Analysis of

Mesenchymal Stem Cells From Dental Apical Papilla and Bone Marrow During Early

Odonto/Osteogenic Differentiation: Potential Role of Transforming Growth Factor-

beta2. Front Physiol. 2020;11:41.

468. Kumar A, Kumar V, Rattan V, Jha V, Bhattacharyya S. Secretome proteins

regulate comparative osteogenic and adipogenic potential in bone marrow and dental

stem cells. Biochimie. 2018;155:129-39.

469. Brewer GJ, Torricelli J, Evege E, Price P. Optimized survival of hippocampal

neurons in B27‐supplemented neurobasal™, a new serum‐free medium combination.

Journal of neuroscience research. 1993;35(5):567-76.

151

APPENDIX A: DMSC-CM manufacturing in the literature

We have selected all publications investigating the effects of dental MSC secretome (CM, EV, exosomes) in in vitro and in vivo models of tissue

regeneration by using the PubMed electronic database and the following search terms: “dental stem cells” AND “conditioned medium OR

secretome” / “dental stem cells” AND “extravesicles OR exosomes”. Ninety-height articles meeting the inclusion criteria were published between

2006 and 2020. These articles have studied the DMSC secretome as a therapeutic agent or including experiment(s) that are based on DMSC-CM

or their derivatives (EVs, exosomes) to assess the paracrine activity of DMSCs. Culture conditions and manufacturing characteristics of DMSC-

CM used in the literature were summarized in the tables below.

Reference DMSC type Stem cell

characterization

Donors

Teeth Species Num

ber

Age Gender Notes

(442)

DPSCs

+

Third molars

Human

15 → 20 years

(64) = or >

3

16 → 18 years Healthy donors

(443) 17 → 20 years

(444) 18 → 22 years

(394) 18 → 25 years Healthy donors

(181) 12

18 → 29 years

(209) 19 → 28 years Impacted healthy teeth

(160) 19 → 30 years

(174) 10 22 → 36 years 5 F, 5 M Fully erupted healthy teeth

152

(133)

DPSCs

+

Third molars

Human

(183)

-

4 14 →19 years Immature teeth

(113) 13 14 → 23 years Both Healthy donors

(445) 4 >24

(446) 7 14 →26 years Both

(447) 3 18 → 25 years 2F, 1M Free of caries and/or periodontitis

(179) 18 → 29 years

(129) 20 → 28 years

(156) Permanent teeth 10 14 → 22 years 4 M, 6 F clinically healthy

(448) Immature teeth, supernumerary

teeth, or premolars or third

molars having an immature root

apex

7 12 → 20 years 4F, 3M

(449)

+

14 → 19 years Both

(40) 12 19→30/44→70 years

(175) 5 24 → 41 years 3 F, 2 M 5 periodontally healthy

teeth / 6 periodontitis teeth form

healthy donors

(96) Healthy donors

(176)

-

21 → 45 years

(450) 8 25 → 35 years Caries free teeth, healthy donors

(206), (451)

(152) + Premolars

Porcine

(178)

(153) 4

153

(182)

DPSCs

+

Upper canine

Dogs

8 →10 months

(452) 4

(453) 5 F

(452) 4 5 → 6 years

(188) + Incisors

Rats

6 weeks

M

(189) M

(187)

+

(454) M

(165)

DPCs

Third molars Human 3 16 → 25 years Healthy teeth

(455) Third molars and premolars 18 → 25 years

(166) + Tooth germ Porcine

(161)

Deciduous teeth

Human

3 Healthy teeth

(209) Immortalized

SHEDs

+

6 →12 years

Clinically healthy teeth

(141), (132)

SHEDs

1

(155), (131), (456), (457) 3

(147), (145) Healthy donors

(215) Non-carious teeth

(210), (458), (190) , (140),

(135), (191), (459), (160)

(143), (144)

(97), (142), (139), (136),

(138), (130), (460), (461)

-

(134) Clinically healthy teeth

(207) PDLSCs +

154

(146)

PDLSCs

Premolars and impacted third

molars

Human

15 19 → 29 years

(462) Impacted premolars

(463) PDLSCs, DPSCs + Premolars Healthy teeth

(159) PDLSCs, DPSCs

and SCAPs

+ Maxillary second premolar and

mandibular third molars

2 12 and 18 years F Similar tooth developmental

stage, approximately 70% of root-

formation completed

(464)

SCAPs

+ Third molars 3 15, 17, and 19 years

Healthy donors

(465)

+

Impacted third molars with

immature roots

12 → 25 years

(466) 5 16 → 30 years

(467) -

(150)

SCAPs, DPSCs

and DFSCs

+

12 → 25 years

(211) 5 6 → 25 years

(468) >= 3 6 → 26 years Healthy non-decayed teeth

(184) DFSCs +

Rats

7 days

(185)

DFCs

+

First molars

6 days

(163)

(164)

(162) PAFCs Impacted third molars Human 8 13 → 18 years Teeth at root-developing stage

(171)

TGCs

Tooth germs Pigs / human

fetuses

3 months/ 6 months

of gestational age

(173) Mandibular first molar germ

14-day embryonic

and 1-day postnatal

155

(168)

TGCs

Mandibular first molar germ Rats

2 days

(167) Lower incisor

20

(172) Mice

(170)

ATGCs

Mandibular first molar germ

Rats

20 8 days

(169)

Table A1: Summary of DMSC sources and donor characteristics in studies using DMSC-CM for tissue regeneration. F: female, M: male, + and -

: done or not, empty cells mean that data were not provided, DPSCs: Dental pulp stem cells, SHEDs: stem cells from human exfoliated

deciduous teeth, PDLSCs: periodontal ligament stem cells, SCAPs: stem cells from the apical papilla, DFPCs: dental follicle progenitor cells,

DPCs: dental pulp cells, DFCs: dental follicle cells, PAFCs: periapical follicle cells, TGCs: tooth germ cells, ATGCs: apical tooth germ cells.

156

Reference

Medium

Type Serum Washing before medium replacement

(181), (189), (188), (134), (177), (153), (178), (129), (156), (40), (182),

(191), (190) , (152), (210), (179), (143), (453), (461), (450), (455)

DMEM

Serum-free

(130), (139), (138), (155), (135) Once

(140), (142), (456), (457), (460) Twice

(97), (136), (447), (148) Thrice

(394) Three to five times

(187) 1% FBS

(185), (206), (164), (167), (173) 10% FBS

(208) Exosome-free FBS

(452), (163)

(133) Low-glucose DMEM

Serum-free

(113) Low-glucose DMEM + 2

mM glutamine + 1 mM

Sodium pyruvate

Twice

(443) Low glucose DMEM 10% FBS

(464) Glucose free DMEM 2% FBS

(172)

DMEM/F12

10% FBS

(454)

Serum-free

(466) Twice

(96) KO-DMEM Thrice

(145) DMEM/Ham’s F12

(131) DMEM/HBSS

157

(166) EBM2

(146), (459), (144), (465)

Alpha-MEM

Serum-free

(174), (448), (444) Once

(207), (466) Twice

(175), (211), (468) Thrice

(467) Five times

(442) 0.1% FBS Twice

(64) 0.5% FBS Twice

(463), (161), (169), (170), (171) 10% FBS

(159), (150), (168)

(446) Neurobasal-A

Serum-free

Once

(132), (141) MSC NutriStem XF

(184) Ham’s F-12K

(147) STK2

(449) SH-SY5Y 0.1% FBS

(209) CCM Exosome-free FBS

(462) Vesicle-free medium Vesicle-free serum

(165) Exosome-free medium

(445), (451) Odontogenic media Serum-free With serum-free media

Table A2: Culture medium used for the preparation of DMSC-CM in literature. FBS: fetal bovine serum, empty cells mean that data were not

provided.

158

Reference Microenvironment cues DMSC populations selection

(132) 3D culture

(159) Stimulation with NRG1-beta1, bFGF, PDGF and forskolin

(209)

Lipopolysaccharide (LPS)-preconditioning (207)

(206) Hypoxia (1% O2, 5% CO2, and 94% N2)

(459) Hypoxic preconditioning through stabilization of hypoxia-inducible factor 1α

(HIF-1α)

(464) Oxygen deprivation

(174), (215), (445), (451) Odontogenic induction

(176) Osteo-differentiation CD117, CD34, STRO-1, CD44, OC and

RUNX-2 positive DPSC

(153), (152) CD31¯ side cell populations

(181), (179), (178), (182), (40),

(183), (452), (453)

DPSCs mobilized by G-CSF (MDPSCs)

(166) CD31- ; CD146- subfraction of side

population cells

(161) Single-cell cloning (SDP11 cells)

Table A3: The microenvironmental conditions and DMSC population selections used to prepare CM in the literature. Empty cells mean that data

were not provided.

159

Reference Centrifugation Ultrafiltration Filtration Dilution

(152), (166) Concentration with cutoff of 3 KDa

(189) Concentration 10X with cutoff of 3 kDa

(181), (153), (178), Concentration 25X with cutoff of 3 kDa

(113) At 269×g for 6 min Concentration 25X with cutoff of 3 KDa 0.2 μm

(129), (40) Concentration 40X with cutoff of 3 KDa

(447) At 1000 × g for 3 min, and at 4,000 x g for 25 min after

concentration

Concentration 30X with cutoff of 10 KDa 0.2 μm 2-, 5- and 10-

fold

(144) Concentration 40X with cutoff of 10 KDa

(453) Concentration 80X with cutoff of 3 KDa

(206) Concentration 10X

(188), (187) Concentration 10X with cutoff of 10 kDa

(130) At 1500 rpm for 5 min → 3000 rpm for 3 min Concentration 10X with cutoff of 10 kDa

(146) At 173× g for 5min Concentration 100X with cutoff of 10 kDa 0.2 μm

At 1000 rpm for 10 min Concentration 0.2 μm

(454), (131) At 2500 rpm for 3 min With cutoff of 5 - 30 kDa

(443) At 300 × g for 5 min

0.2 μm

(466) At 130 × g for 10 min

(147) At 310 × g for 6 min

(394), (175) At 1500 rpm for 5 min → 3000 rpm for 3 min

(211), (468) At 3,000 rpm for 5 min

(459) At 1500 rpm

(96) At 250 ×g for 10 min

(464) At 200 ×g for 5 min

(162) At 1000 ×g for 4 min

(176), (207) At 1000 ×g for 5 min

160

(133)

At 1000 ×g for 5 min

(184)

1-fold

(185), (163), (164), (168), (169),

(173)

(150) At 3000 rpm for 5 min

(64) At 200 × g for 5 min

(167), (172) At 2000 × g for 20 min

(170) At 2000 × g for 15 min

(463) 0.45 μm

(143) At 22,140 × g for 5 min → 44,280 × g for 3 min

(210), (160) At 22,140 × g for 4–5 min → brief re-centrifugation

(458), (155), (139), (457) At 440×g for 4–5 min →17,400 ×g for 1 min

(97) At 3,000 ×g for 5 min

(190) , (456), (461) At 440 × g for 5 min →17,400 × g for 3 min

(460) At 440 × g for 3 min

(449) At 300 × g

(136) At 22 140×g twice for 5 min

(134), (156), (191), (177), (138) At 1,500 rpm for 5 min → 3,000 rpm for 3 min

(135), (140), (142), At 440 × g for 3 min → 1,740 × g for 3 min

(145) At 15,000 × g for 5 min

(446) At 300 × g for 6 min

Table A4: Summary of CM purification procedures in studies using DMSC-CM for tissue regeneration. Empty cells mean that data were not

provided.

161

Reference Purification of EVs EV size range (nm)

(132), (462), (207)

Differential centrifugation

(141) 30–70

(465) 120.6

(215) 40 - 140

(445) 135

(455) 87 - 143

(209) 30–150

(175) 30–200

(450) 30–250

(113) 50–300

(97) Ultracentrifugation

(96), (451)

Isolation using exosome isolation reagent

(208) 30–100

(174) 30–150

(165) 45–156

Table A5: Summary of extravesicles (EVs) purification procedures in studies using DMSC-CM derived products for tissue regeneration. Empty

cells mean that data were not provided.

162

Reference Used

fresh

4°C -20°C -30°C -70°C -80°C Protease

inhibitor (463) +

(190) , (461) +

(191), (144) + +

(188), (187), (189), (170), (171) +

(443) + +

(129) + Up to 1

month

+

(145), (141), (148) +

(150) + +

(113), (206), (97), (176), (130), (133), (96), (449), (175),

(462), (185), (64), (394), (442), (146), (446), (184), (464),

(215), (468), (466), (447), (163), (164), (162), (445), (465),

(455), (173)

+

(153), (178), (132) + +

Table A6: Summary of CM storage conditions in studies using DMSC-CM for tissue regeneration. Empty cells mean that data were not

provided. Empty cells mean that data were not provided.

163

Reference Bradford protein

assay

BCA protein

assay

ELISA Antibody array Multiplex

immunoassay

LC-MS/MS

(181), (153), (178), (453), (161) +

(113), (206), (97), (176), (159), (191), (150), (459), (444) +

(179), (140), (139), (134), (209), (174), (456), (450), (445),

(465), (455)

+

(454), (155), (446) + +

(147) +

(394), (442), (464), (184), (448) + +

(146) +

(129) + +

(144) +

(457), (131) + + +

(460), (211) +

(467), (468) + +

Table A7: Summary of CM characterization methods in studies using DMSC-CM for tissue regeneration. BCA: bicinchoninic acid, ELISA:

enzyme-linked immunosorbent assay, LC-MS/MS: liquid chromatography with tandem mass spectrometry. Empty cells mean that data were not

provided.

164

DMSC

passage

number

1 →3 3 1-4 2-4 3-4 →5 2-5 3-5 4-5 2-6 3-6 5-6 6 3-7 5-7 6-7 2-8 3-8 4-8 3-9 4-9 5-9 9 8-10 11-12

Reference

(141) (187) (181)

(189)

(147)

(185)

(131)

(465)

(465)

(159)

(451)

(451)

(443)

(130)

(188) (156) (442)

(462)

(454)

(134)

(177)

(184)

(455)

(466)

(447)

(455)

(153)

(96)

(178)

(129)

(464) (463)

(148)

(40) (144) (113)

(150)

(174)

(211)

(133)

(459)

(183) (449)

(446)

(394)

(468)

(64) (143)

(140)

(139)

(456)

(457)

(138) (142) (155)

(460)

(135) (444)

Table A8: Passage number of DMSCs used to prepare CM in the literature.

165

Reference Cell confluency at the beginning of conditioning Conditioning period

(178), (153) 50%

24h

(181), (129), (40), (453) 60%

(188), (184), (96), (179), 70%

(147), (443), (459) 80%

(162), (445), (451) Full confluence

(206), (207), (189), (187), (444)

(182), (152), (166), (452) 50%

48h

(211), (468) 60-70%

(465) 60-80%

(394), (143), (140), (139), (138), (142), (155), (135), (210), (209), (144), (456), (457), (460), (447) 70-80%

(130), (454), (97), (136), (191), (190) , (146), (448), (461), (450), (455) 80%

(165) Full confluence

(462), (463), (183), (132), (156), (113), (150), (174), (449), (446), (175), (208), (442), (134), (177)

(464), (466) 70-80%

72h

(133), (131), (148) 80%

(145), (170) Full confluence

(141), (176)

(64) 70-80% 96h

(167), (169), (171), (172), (173) Full confluence

Table A9: DMSC confluency and period of medium conditioning in studies using DMSC-CM for tissue regeneration. Empty cells mean that

data were not provided.

166

APPENDIX B: Human Growth Factor Antibody Array results

Quantitative antibody array tests, which target 40 factors, were performed to identify the secreted factors in the different CM studied in this thesis:

(a) ASC-CM, (b) BMSC-CM, (c) DPSC-CM, (d) DPSC-CM obtained from cells in 3D culture, (e) DPSC-CM obtained from cells grown with the

supplement B-27 added to the culture medium at the beginning of conditioning, DPSC-CM obtained from (f) irradiated or (g) non-irradiated cells.

(a), (b), (c), (e), (f) and (g) were obtained from 2D cell cultures. (a), (b), (c), (d), (f), and (g) were obtained without any addition to the culture

medium. The same DPSC cells were used to produce (c), (d), and (e); the cells used to prepare the other CM were isolated from other different

individuals. Serum-free neurobasal media was used to prepare (a), (b), (c), (d), and (e). Serum-free DMEM media was used to prepare (f) and (g).

Data are presented in pg/ml as Means ± SD.

CM

Factors

(a) (b) (c) (d) (e) (f) (g)

ASC-CM BMSC-CM DPSC-CM

2D, neurobasal

medium

2D, neurobasal

medium

2D, neurobasal

medium

3D, neurobasal

medium

DPSCs cultured with B-27,

2D, neurobasal medium

2D, DMEM

medium

Irradiated DPSCs,

2D, DMEM medium

BDNF 13 ± 10 24 ± 18 9 ± 8 18 ± 6 11 ± 8 12 ± 4 21 ± 17

bFGF 2 16 ± 2 8 ± 5 7 ± 4 2 ± 4 8 ± 4 6 ± 1

BMP-4 22 ± 31 5 ± 7 12 ± 17 not detected 84 ± 79 1 ± 1 59 ± 6

BMP-5 143 ± 37 461 ± 219 211 ± 118 94 ± 25 80 ± 32 78 ± 15 70 ± 11

BMP-7 67 ± 80 188 ± 69 137 ± 59 178 ± 18 29 ± 57 67 ± 15 39 ± 39

bNGF not detected 2 ± 16 11 ± 4 not detected 8 ± 12 10 ± 18 8 ± 2

EG-VEGF 5 1 ± 1 1 ± 1 not detected 1 ± 3 not detected not detected

167

EGF not detected not detected not detected not detected not detected not detected not detected

EGF R 11 ± 2 2 ± 2 2 ± 3 not detected 25 ± 2 7 ± 11 22 ± 0.5

FGF-4 205 ± 5 120 180 ± 25 66 ± 72 not detected not detected not detected

FGF-7 13 ± 19 40 ± 19 54 ± 5 32 ± 23 16 ± 19 not detected 1.2 ± 2.5

GDF-15 not detected not detected not detected not detected 12 ± 8 not detected not detected

GDNF not detected not detected 4 ± 5 4 ± 2 not detected not detected not detected

GH 6 ± 10 5 ± 6 31 ± 8 14 ± 15 not detected 0.4 ± 1 0.5 ± 1

HB-EGF not detected not detected not detected not detected 2 ± 4 not detected not detected

HGF 4 ± 1 9 5 ± 5 3 ± 5 459 ± 42 13 ± 8 141 ± 21

IGF-I 94 ± 93 not detected 136 ± 31 1 ± 3 35 ± 47 13 ± 2 226 ± 88

IGFBP-1 5 ± 2 3 ± 4 4 ± 5 not detected 9 ± 4 not detected not detected

IGFBP-2 314 ± 368 136 ± 88 1 ± 2 48 ± 67 683 ± 279 292 ± 79 168 ± 206

IGFBP-3 4 ± 8 not detected 252 ± 87 not detected 1625 ± 382 1632 ± 661 638 ± 61

IGFBP-4 1529 ± 641 not detected 1015 ± 707 not detected 17116 ± 3977 873 ± 1235 1356 ± 1917

IGFBP-6 28458 ± 4991 1677 ± 1249 9724 ± 1669 111 ± 217 134274 ± 14089 701 ± 278 2412 ± 839

Insulin not detected not detected not detected not detected 1627 ± 566 not detected not detected

MCF R 112 ± 93 3 ± 4 44 ± 40 44 ± 47 8 ± 10 not detected not detected

NGF R not detected not detected not detected not detected not detected not detected not detected

NT-3 not detected not detected 101 ± 25 not detected 231 ± 4 not detected 17 ± 23

NT-4 42 ± 48 2 ± 4 25 ± 9 21 ± 20 26 ± 12 12 ± 5 31 ± 20

OPG 17 ± 29 21 ± 3 23 ± 27 not detected 156 ± 25 not detected 80 ± 25

168

PDGF-AA 14 ± 11 7 ± 8 3 ± 6 not detected 60 ± 27 8 ± 14 42 ± 2

PIGF 12 ± 9 2 ± 3 4 ± 1 1 ± 2 4 ± 7 not detected 14 ± 6

SCF not detected not detected not detected not detected not detected not detected not detected

SCF R not detected not detected not detected not detected 381 ± 95 not detected 34 ± 27

TGFα not detected not detected not detected not detected 0.4 ± 0.6 not detected not detected

TGFß1 not detected not detected not detected not detected not detected not detected not detected

TGFß3 not detected 97 ± 15 34 ± 48 not detected 24 ± 33 not detected 50 ± 64

VEGF 14 ± 9 4 ± 6 22 ± 15 not detected 206 ± 59 not detected 120 ± 42

VEGF-D not detected not detected 32 ± 8 not detected not detected not detected not detected

VEGF R2 19 ± 22 not detected 47 ± 19 not detected 48 ± 23 33 ± 47 41 ± 6

VEGF R3 not detected not detected not detected not detected not detected

Table B1: Quantitative Antibody microarray analysis of 40 human growth factors in the different CM studied in the thesis.

169

APPENDIX C: Neurites length results

To confirm the results of the DPSC-CM on neurite growth, the different experiments were reproduced on several mice (Figure C1).

Figure C1: Histograms presenting the quantitative analyses of neurite outgrowth from DRG neurons treated with (a) different concentrations of

DPSC-CM, (b) 72h-CM and frozen DPSC-CM compared to 48h-CM fresh, (c) CM obtained from DPSCs cultured with B-27 (DPSC-CM pre B-

27) and CM where B-27 was added only following conditioning (DPSC-CM post B-27) compared to positive and negative controls. Experiments

in A, B, and C were reproduced in 3, 2, and 6 mice, respectively.

170

APPENDIX D: The composition of B-27 supplement

B-27 Supplement was used to optimize the effect of DPSC-CM on neurite growth. B-27 Supplement (17504044; Gibco) is an optimized serum-

free supplement used to support the growth and viability of embryonic, post-natal, adult, hippocampal, and other central nervous system neurons.

B-27 Supplement is intended to be used with Neurobasal Medium or Neurobasal-A Medium for cell culture of nearly pure populations (<0.5%

Glial cell) of neuronal cells without the need for an astrocyte feeder layer. B-27 Supplement includes a cocktail of antioxidants to reduce reactive

oxygen damage. While its composition has been published Brewer et al. in 1993, the exact concentrations of its components is still unknown

(Table D1).

Components

Transferrin Catalase Glutathione (reduced)

Superoxide Insulin L-Carnitine

Biotin Transferrin Linoleic Acid

DL Alpha Tocopherol Acetate Superoxide Dismutase Progesterone

DL Alpha-Tocopherol (vitamin E) Corticosterone Putrescine

Retinyl acetate D(+)-Galactose Selenium

Albumin, bovine Ethanolamine T3 (triodo-I-thyronine)

Table D1: B-27 composition (469).

171

APPENDIX E: DPSC-CM effect on cancer growth

To assess the effect of DPSCs on MCF7, experiments were done applying five different DPSC cell quantities (500-8000) in co-culture with

spheroid cancer cells. A decrease of MCF7 spheroid size was observed since the early days and for all durations (3, 5, and 7 days) for all doses of

DPSCs. Within the same dose, time kinetics evaluation showed a clear time-dependent inhibition for DPSCs (Figure E1.a). For further

investigation, CM collected from cultured DPSCs was used to evaluate their paracrine-mediated effect on MCF7 cells. The 4h-CM showed an

inhibitory effect (15% ±0.10) of MCF7 viability even in serum-supplemented conditions. When the conditioning period is extended to 48 hours,

the CM demonstrated induction of proliferation in MCF7 cells in serum-free conditions (Figure E1.b).

172

Figure E1: Effect of DPSCs on MCF7 cells. (a) Average of MCF7 spheroid diameters after coculture with DPSCs (1000 to 4000 cells) for 3, 5

and 7 days. (b) Effect of the secretome of DPSCs after 2 days incubation with MCF7 cells. *p<0.05, **p<0.01, ***p<0.001 versus control. ¤:

p<0.05, ¤ ¤: p<0.01-time evolution between days for DPSC cultures. (a) and (b) are obtained from Figures 3.b and 4.c respectively, of the

submitted article (Al-Arag et al., Dental Pulp Stem Cells (DPSCs) primed with paclitaxel inhibit and overcome resistance in breast cancer cells,

2020).

173

SUBMITTED ARTICLES

1 of 19

174

Identification of secreted factors in dental pulp stem cell-1

conditioned medium optimized for neuronal growth 2

B Chouaib1, PY Collart-Dutilleul1, N Blanc-Sylvestre1, R Younes1,2, C Gergely3, C 3

Raoul2, F Scamps2, FJG Cuisinier1, O Romieu1. 4

5 1LBN, Univ. Montpellier, Montpellier, France;2The Neuroscience Institute of Montpellier, 6 Inserm UMR1051, Univ Montpellier, Saint Eloi Hospital, Montpellier, France; 3 Laboratoire 7 Charles Coulomb laboratory, Univ Montpellier, CNRS, Montpellier, France 8

9

Abstract 10

With their potent regenerative and protective capacities, stem cell-derived conditioned 11

media emerged as an effective alternative to cell therapy, and have a prospect to be 12

manufactured as pharmaceutical products for tissue regeneration applications. Our 13

study investigates the neuroregenerative potential of human dental pulp stem cells 14

(DPSCs) conditioned medium (CM) and defines an optimization strategy of DPSC-CM 15

for enhanced neuronal outgrowth. Primary sensory neurons from mouse dorsal root 16

ganglia were cultured with or without DPSC-CM, and the lengths of βIII-tubulin 17

positive neurites were measured. The impact of several manufacturing features as the 18

duration of cell conditioning, CM storage, and preconditioning of DPSCs with some 19

factors on CM functional activity were assessed on neurite length. We observed that 20

DPSC-CM significantly enhanced neurites outgrowth of sensory neurons in a 21

concentration-dependent manner. The frozen storage of DPSC-CM had no impact on 22

experimental outcomes and 48 hours of DPSC conditioning is optimal for effective 23

activity of CM. To further understand the regenerative feature of DPSC-CM, we studied 24

DPSC secretome by human growth factor antibody array analysis and revealed the 25

presence of several factors involved in either neurogenesis, neuroprotection, 26

angiogenesis, and osteogenesis. The conditioning of DPSCs with the B-27 supplement 27

enhanced significantly the neuroregenerative effect of their secretome by changing its 28

composition in growth factors. Here, we show that DPSC-CM significantly stimulates 29

neurite outgrowth in primary sensory neurons. Moreover, we identified secreted protein 30

candidates that can potentially promote this promising regenerative feature of DPSC-31

CM. 32

33

34

2 of 19

175

Introduction 35

The peripheral nervous system is fragile and easily damaged. After an injury, functional 36

recovery depends on the regeneration of peripheral nerve axons. However, the 37

mechanism is slow and the results are often unsatisfactory (1). Unsuccessful 38

regeneration leads to post-traumatic neuropathies, which are mostly resistant to current 39

treatments (2). 40

The current standard of care for peripheral nerve injury is autologous nerve 41

transplantation. Complications include loss of function at the donor site, limited 42

availability of donor nerve tissue, and donor site morbidity (3). The use of stem cells as 43

a regenerative therapy process is an appealing strategy to overcome these limitations. 44

Mesenchymal stem cells (MSCs) have been of particular importance in central and 45

peripheral nervous system repair, due to their regenerative effects (4, 5). Their 46

therapeutic potency is mainly associated with their ability to secrete multiple factors, 47

namely the secretome, that induce survival and regeneration of host neurons (6, 7). 48

These secreted factors can be harvested from the supernatant of cell cultures, referred 49

to as the conditioned medium (CM). Thus, the administration of MSC-CM into injury 50

sites could be used as a better alternative to the grafting of stem cells. Indeed, the use 51

of CM has several advantages compared to the use of stem cells, as it can be 52

manufactured, freeze-dried, packaged, and transported more easily. Moreover, as it is 53

devoid of cells, there is no need to match the donor and the recipient to avoid rejection 54

problems (8). 55

The present study focuses on the secretome of dental pulp stem cells (DPSCs). DPSCs 56

are a population of MSCs present in the dental pulp tissue, described for the first time 57

by Gronthos et al. (Gronthos et al. 2000). One advantage of this source of MSC is the 58

absence of morbidity and the fact that it does not require additional surgical procedures 59

(Alkhalil et al. 2015). DPSCs, originating from the neural crest (Huang et al. 2009), 60

express neuron-related markers (Foudah et al. 2014) and can differentiate into neuron-61

like cells (Mead et al. 2014). The neurotrophic factors secreted by DPSCs are 62

remarkably higher than those of MSCs derived from bone marrow mesenchymal stem 63

cells (BMSCs) and adipose-derived stem cells (ASCs) (9). For all these reasons, DPSCs 64

are considered as an excellent candidate for stem cell-related therapies in nerve diseases 65

(Luo et al. 2018), and the leading role of DPSC-CM in neuroprotection and 66

neuritogenesis was described notably in many in vitro and in vivo studies (10). 67

3 of 19

176

Herein, we use DPSC-CM to enhance the neurite growth of dorsal root ganglia (DRG) 68

sensitive neurons. We study the DPSC-CM potential for axonal growth and we define 69

an optimization strategy of DPSC-CM to aide axonal growth. 70

71

Materials and method 72

Isolation and culture of human DPSCs 73

DPSCs were isolated from extracted wisdom teeth from young healthy patients (15 to 74

23 years of age). Informed consent was obtained from the patients after receiving 75

approval by the local ethics committee (Comité de protection des Personnes, Centre 76

Hospitalier de Montpellier). We used a previously described protocol to recover pulp 77

cells (Collart-Dutilleul et al. 2014; Panayotov et al. 2014). Briefly, after disinfection, 78

teeth were cut along the cementum–enamel junction using a diamond disc and were 79

broken in two pieces. Pulps were then recovered and incubated for 1 hour in a 80

collagenase-dispase solution (3 mg/ml collagenase and 4 mg/ml dispase). Digested 81

pulps were filtered, centrifugated, and recovered cells were incubated in α-MEM 82

(Gibco) with 1% Penicillin-Streptomycin (PS), 10% fetal bovine serum (FBS), and 83

0.02% Recombinant Human FGF basic (R&D System). The medium was changed after 84

24 hours and then changed twice a week. 85

86

Preparation of DPSC-CM 87

When DPSCs (passage number (P) = 3 or 4) reached 80% confluence, two phosphate-88

buffered saline (PBS) washes were carried out and the medium was replaced with a 89

serum-free neurobasal (Gibco), 1% PS. 48 hours later, the medium was collected by 90

centrifugation for 5 min at 1,500 rpm and was centrifuged again for 3 min at 3,000 rpm 91

to remove cell debris. The CM was used fresh or stored at -20°C until use. 92

To optimize DPSC-CM, 1% glutamine (200 mM, Sigma-Aldrich) and 2% B-27 93

(Supplement 50X, serum-free, Gibco) were added to the neurobasal medium, after PBS 94

washing step. 95

96

4 of 19

177

Primary sensory neurons Isolation and Culture 97

All animal protocols were approved by the national ethics committee and all procedures 98

were performed following relevant institutional guidelines and regulations. Adult Swiss 99

mice (6 to 10-week-old, CERJ, Le Genest St Isle, France) were sacrificed by CO2 100

inhalation followed by cervical dislocation, and their DRG were then removed. Ganglia 101

were successively treated by two incubations with collagenase A (1 mg/ml, Roche 102

Diagnostic, France) for 45 min each (37°C) and then with trypsin-EDTA (0.25%, 103

Sigma, St Quentin Fallavier, France) for 30 min. A mechanical dissociation was 104

performed in a neurobasal medium supplemented with 10% FBS and DNase (50 U/ml, 105

Sigma). Isolated cells were collected then by centrifugation and suspended in 106

neurobasal supplemented with 2% B-27, % glutamine, 1% PS. Dissociated neurons 107

were plated on D,L-polyornithine (0.5 mg/ml)-laminin (5 mg/ml)-coated glass 108

coverslips, and incubated in an incubator with a 5% CO2 atmosphere. The culture 109

medium was carefully replaced 4 hours later, according to the experiment, by DPSC-110

CM, neurobasal medium as a negative control (C-), or neurobasal medium enriched 111

with nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and 112

neurotrophin-3 (NT-3) (1:1000, Peprotech, USA) as a positive control (C+). 113

114

Immunocytochemistry 115

After 24 hours of culture, neurons were fixed at room temperature in 4% 116

paraformaldehyde in phosphate-buffered saline (PBS) for 20 minutes, washed two 117

times with PBS and blocked using PBS, 10% of donkey serum and 0.1% of Triton x100. 118

Then, cells were washed twice and incubated with primary antibodies against rat 119

monoclonalβ-tubulin III (1:1000, ab6160, Abcam) overnight at 4°C. Cells were 120

washed three times again, 10 min each, and incubated with Donkey anti-rat Alexa 488 121

secondary antibodies (1:500, ab150153, Abcam) for 1 h, in dark at room temperature. 122

Primary and secondary antibodies were diluted in PBS, 1% of donkey serum (GeneTex, 123

Irvine, CA, USA) and 0.01% of Triton x100. Next, cultures were washed three times, 124

10 min each, and were counterstained with 4,6-Diamidino-2-Phenylindole, Dilactate 125

(DAPI, 1:1000, Sigma). Glass slides were mounted in mounting media, and 126

preparations were cured overnight at +4°C protected from light until microscopy 127

analysis. 128

129

5 of 19

178

Neurites Length Measurements 130

A microscope slide scanner (ZEISS Axio Scan.Z1) was used to scan immunostained 131

glass slides. A 20x objective scan image was obtained for each glass slide, containing 132

tens of neurons. Then, neuron images were separately obtained using the Zen® 133

acquisition software, neurites extensions of each cell were traced and lengths of all the 134

neurites per neuron were measured manually by NeuronJ plugin for ImageJ analyzing 135

software. All cells were considered, except neurons presenting neurites connected to 136

adjacent neurons (for technical reasons). Each experimental condition was replicated in 137

four wells (four glass slides) per mouse. A total of 3898 neurons was measured 138

throughout this study. 139

140

Bicinchoninic Acid Assay (BCA) 141

Total protein content of DPSC-CM samples was determined using Pierce® BCA 142

Protein Assay Kit (Thermo Fisher) in 96-well plates. The assay mixture contained 200 143

μl of the reagent (solution A + B) and 20 μl of the sample containing either CM or BSA 144

standard. Absorbance was read at 540 nm using an Infinite 200 plate reader. 145

146

Growth factors Array for DPSC-CM 147

The profiles of DPSC-CM were screened with Human Growth Factor Antibody Array 148

(40 Targets) – Quantitative (ab197445 Abcam), following the manufacturer's protocol. 149

The slide was then scanned using an InnoScan 300 Microarray Scanner (Innopsys, 150

Carbonne, France). Data extraction and quantification of signal intensities were 151

performed using Mapix software (Innopsys, France). Data analysis was done with 152

GraphPad Prism (GraphPad Software, La Jolla California USA). 153

154

Statistical Analyses 155

Statistical analyses were performed using SigmaPlot version 11.0 (Systat Software, 156

Inc., San Jose California USA). Multiple group comparisons were performed by 157

analysis of variance (ANOVA) followed by Bonferroni’s post hoc test. Comparisons 158

between two groups were performed by Student’s t-test. P < 0.05 was considered 159

statistically significant. Data were presented as mean ± standard deviation (SD). 160

161

6 of 19

179

Results 162

Cell passage number and conditioning period impacts the quantity of secreted 163

proteins 164

We first assessed the efficiency of our protocol to recover secreted proteins, by 165

comparing total protein concentration in DPSC-CM to that without cell conditioning. 166

BCA test was used to determine protein concentration in the supernatant of various 167

culture media. As expected, protein concentration in DPSC-CM was significantly 168

higher compared to the neurobasal medium (402 ± 14µg/ml vs. 52 ± 28µg/ml). The 169

number of cell passage significantly affect the concentration of protein: 438 ± 30 µg/ml 170

with DPSCs at the 3rd passage vs. 330 ± 27 µg/ml with DPSCs at the 5th passage. The 171

impact of secretion duration was also investigated; protein concentration increased 172

significantly and markedly over the first two days, to reach 392 ± 16 µg/ml after 48 h. 173

The kinetics of factors secretion (for up to three days) revealed higher levels of secreted 174

factors over time but did not reveal any significant difference following 48 h of 175

conditioning (Figure 1). 176

177

178 Figure 1: Total protein concentration in DPSC-CM: (a) DPSC-CM compared to the 179

basal medium. (b) CM obtained from DPSCs at passage P3, P4, and P5. (c) CM 180

obtained after 6, 24, 48, and 72 hours of conditioning with DPSCs. Data are presented 181

in μg/ml as mean ± SD. ***P < 0.001, **P < 0.01 and *P < 0.05 indicate significance 182

between conditions as determined by two-tailed Student’s t-tests for (a) and one-way 183

ANOVA followed by Bonferroni post hoc test for (b) and (c). 184

185

DPSC-CM concentration influences sensory neuron outgrowth 186

After 24 hours in culture, neuron growth was mostly in stellar morphology with many 187

ramifications. Neurons were cultured in neurobasal medium complemented or not with 188

either 50%, 75% DPSC-CM or only in DPSC-CM. After fixation and immunostaining,189

7 of 19

180

slides were scanned and neuron ramifications were measured using NeuronJ. Results 190

showed a dose-dependent effect of DPSC-CM on neurites outgrowth. Neurites length 191

per neuron increased from 1018 ± 157 µm (135 neurons from 3 independent 192

experiments) without DPSC-CM to 4128 ± 179 µm (89 neurons from 3 independent 193

experiments) with 100% DPSC-CM (Figure 2). Therefore, DPSC-CM was used 194

directly without any prior dilution for all the next experiments. 195

196

197 Figure 2: Effect of DPSC-CM on neurites growth: (a) After 24 h of incubation, DRG 198

neurons were fixed and stained with DAPI (blue) or βIII-Tubulin (green), then neurites 199

length of each neuron was measured with NeuronJ. (b) Neurites outgrowth of dorsal 200

root ganglion (DRG) neurons when cultured with neurobasal, 50% DPSC-CM + 50% 201

neurobasal, 75% DPSC-CM + 25% neurobasal and 100% DPSC-CM. (c) Box plot 202

diagram presenting the quantitative analyses for neurite outgrowth of DRG neurons. 203

***P < 0.001 indicates significance from other CM concentrations and **P<0.01 204

indicates significance between indicated concentrations, as determined by two-way 205

ANOVA followed by Bonferroni post hoc test. The results represent the mean of 206

triplicate cultures of three independent experiments; n= 3 mice. 207

208

209

8 of 19

181

The effect of DPSC-CM on neurite outgrowth is reproducible between donors 210

Next, we sought to determine the reproducibility of our protocol between donors. We 211

harvested DPSC-CM from 3 different donors (15-23 years old) following the protocol 212

previously described, i.e 4th passage at 80% confluency at the beginning of 213

conditioning. We first showed that secreted protein concentration did not statistically 214

differ between DPSC-CM obtained from the three different donors (Figure 3a). 215

Conditioned medium were also tested on primary sensory neurons isolated from 3 216

different mice: neurons isolated from the various mice were cultured in DPSC-CM and 217

neurobasal as a negative control. No statistically significant difference could be 218

observed between mice (isolated neurons) when considering neurite length per neuron, 219

while a significant impact of DPSC-CM was always present compared to neurobasal 220

(Figure 3b). 221

Taken together, these results showed no significant impact of DPSC donors on the 222

efficiency of their secretomes. However, to avoid variability in our study, we decided 223

to continue the experiments with CM produced from a single donor. 224

225

48 hours of DPSC conditioning is optimal for effective activity of DPSC-CM 226

The impact of the DPSC conditioning period on CM efficiency was investigated. 227

Neurons were cultured in DPSC-CM harvested after 48 or 72 hours. Extending the 228

conditioning time by one more day does not improve the effect of DPSC-CM (3028.5 229

± 358 µm, 86 neurons vs 3238.4 ± 328.3 µm, 100 neurons for 48h-CM and 72h-CM 230

respectively) (Figure 3c). 231

232

Frozen storage does not influence the regenerative properties of DPSC-CM 233

Next, we determine whether the storage conditions of DPSC-CM might influence their 234

regenerative capacities. Neurons were cultured with either freshly harvested DPSC-CM 235

or the same DPSC-CM frozen at -20°C for a few hours. Frozen storage of DPSC-CM 236

did not affect its positive effect on total neurite length per neuron (Figure 3d). 237

Therefore, for the next experiments, multiple volumes of DPSC-CM were prepared at 238

once, aliquoted, and frozen until use (after one month).239

240

9 of 19

182

241 Figure 3:(a) Total protein concentration in DPSC-CM obtained from 3 different 242

donors. Results are the Means ± SD. (b) Impact of the recipient on the effect of CM. 243

DRG neurons of three mice (M1, M2, and M3) were treated with unconditioned or 244

DPSC-conditioned medium. (c) Effect of time conditioning elongation (72 hours 245

compared to 48 hours) on neurites length. (d) Effect of frozen DPSC-CM on neurites 246

length. The results in (c) and (d) represent the mean of triplicate cultures of two 247

independent experiments; n= 2 mice. Box plot diagrams in (b), (c), and (d) presenting 248

the quantitative analyses for neurite outgrowth of DRG neurons. ***P< 0.001 in (b) 249

indicate significance between CM and control for each mouse as determined by one-250

way ANOVA followed by Bonferroni post hoc test. One-way Anova and two-ways Anova 251

tests were used in (a) and (c; d) respectively. 252

253

254

Impact of conditioning of DPSC-CM with B27 supplement on neurites growth 255

Further, we investigated whether the conditioning of DPSC-CM with B-27 culture 256

supplement could influence neuronal outgrowth. We, therefore, compared DPSC-CM 257

conditioned or not with the B-27 culture supplement with a neurogenic medium 258

containing BDNF, NGF-ß, NT-3 (10 ng/ml each) and containing B-27 (positive control, 259

C+). Following media conditioning of DPSC cultured with B-27 (DPSC-CM pre B-260

27), this supplement could still be partially present in the medium. As an additional 261

control, we, therefore, added B-27 directly in the CM obtained with DPSC cultured 262

without B-27 (DPSC-CM post B-27). The use of the neurobasal medium with B-27263

10 of 19

183

only served a negative control (C-). We observed that CM was more effective when B-264

27 was added to DPSCs than when it was added after CM production: 2714 ± 97 µm 265

(809 neurons) vs 1630 ± 95 µm (883 neurons) for DPSC-CM pre B-27 and DPSC-CM 266

post B-27, respectively. Both CM were more effective than negative control C- (1147 267

± 11 µm, 727 neurons) but less effective than positive control C+, which induced the 268

longest neurites (3563 ± 115 µm, 681 neurons) (Figure 4). 269

270

271 Figure 4: (a) Illustration of neurites outgrowth from DRG neurons treated with an 272

unconditioned neurobasal medium but supplemented with B-27 (C-); CM obtained from 273

DPSC cultured with media containing B-27 (DPSC-CM Pre B-27), DPSC-CM where 274

B-27 was added only following conditioning (DPSC-CM Post B-27); Neurobasal 275

containing B-27 and NTFs served as a positive control (C+). (b) Box plot diagram 276

presenting the quantitative analyses for neurites outgrowth of DRG neurons with these 277

different mediums. ***P < 0.001 indicates significance from other treatments and 278

**P<0.01 indicates significance between indicated treatments, as determined by two-279

way ANOVA followed by Bonferroni post hoc test. The results represent the mean of 280

quadruplicate cultures of six independent experiments; n= 6 mice. 281

282

283

DPSCs produce a complex combination of neurotrophic and growth factors 284

We aimed at identifying the secreted factors that potentially promote the neurite 285

outgrowth effect of DPSC-CM in sensory neurons. An antibody arrays test, which 286

targets 40 factors, was performed for the CM obtained from DPSCs cultured in the 287

11 of 19

184

presence or absence of B-27 supplement. A total of 34 factors was above the detection 288

threshold. 289

The expression levels of NT-3, PDGF-AA, HGF, IGFBP (1-6), EGF R, OPG, and 290

VEGF were significantly higher in CM obtained from DPSCs cultured with B-27 291

supplement. GDF-15, SCF R, and Insulin were significantly detected only in this CM. 292

However, some factors (BMP-7, FGF-7, and IGF-1) were significantly higher when 293

DPSCs were cultured without B-27, and FGF-4, GH, and VEGF-D were significantly 294

detected only in that CM. 295

This total of factors is involved in cellular proliferation and migration, neurogenesis, 296

neuroprotection, angiogenesis, and osteogenesis (Table 1). The levels of other factors 297

were not significantly modified by the presence of B-27 during the cell conditioning, 298

or they were below the detection limit. The results are summarized in Figure 5. 299

300 Figure 5: Quantitative Antibody microarray analysis of 40 human growth factors in 301

CM obtained from DPSCs cultured with or without B-27 supplement. The array was 302

scanned, and the intensities of signals were quantified. The relative expression levels 303

are displayed as subtraction between DPSC-CM obtained with B-27 supplement (black 304

bars) and DPSC-CM obtained without B-27 (grey bars). Data are presented in pg/mL 305

as Means ± SD. ***P < 0.001, **P<0.01, *P<0.05 indicate significance between both 306

CM, as determined by two-tailed Student’s t-test.307

12 of 19

185

Growth

factors

(pg/mL)

Functions

NT-3 Neurotrophins

BMP-7 BMPs induce the formation of both cartilage and bone (13)

EGF-R EGF-R Activation Mediates Inhibition of Axon Regeneration (14)

FGF-4 FGF4 induces cell proliferation (15) (16) and has angiogenic properties (17)

FGF-7 FGF7 induces cell growth (18-20), migration (20, 21), and differentiation (22)

GDF-15 GDF15 is a stress-induced cytokine released in response to tissue injury (23)

SCF R SCF induces the outgrowth of c-kit-positive neurites from DRGs (24). 20% of all DRG neurons expressed c-

Kit (SCFR) (25)

PDGF-AA PDGF-AA may function to regulate bone formation (26). PDGF-AA myelinate nerve fibers throughout the

CNS (27). PDGF-AA is important for neuroprotection (9)

GH GH promotes axon growth (28, 29)

HGF HGF cooperates with NGF to enhance axonal outgrowth from cultured DRG neurons (30)

IGF-1 IGF-1 promotes neurite outgrowth of DRG neurons (31, 32)

IGFBP-1 IGFBPL1 promotes axon growth (33)

IGFBP-2 IGFBP-2 participates in some aspect of axonal growth (34)

IGFBP-3 IGFBP-3 has a role in cell death and survival in response to a variety of stimuli (35)

IGFBP-4 IGFBP-4 was shown to inhibit IGF1 action (36)

IGFBP-6 IGFBP‑6 is an important neuronal survival factor secreted from hMSCs (37). The BP6 labeled cells

represent approximately only 10%–20% of the total neuronal population in a DRG (38)

Insulin Insulin receptor signaling has a role in regulating neurite growth (39, 40)

OPG OPG inhibits osteoclastogenesis and bone resorption (41, 42). It prevents the neurite growth-inhibitory

signal in sympathetic and sensory neurons (42)

VEGF VEGF is an angiogenic factor (43). It stimulates axon outgrowth from DGR (44)

VEGF-D VEGF-D can control the length and complexity of dendrites (45)

Table 1: Physiological effects of the human growth factors in DPSC-CM, significantly 308

modified when DPSCs were cultured with B-27 supplement. 309

310

Discussion 311

Previous studies have shown that DPSCs significantly enhance axon regeneration, with 312

neuroprotective effects on DRG neurons (46). DPSCs release neurotrophic factors that 313

enhance neurite guidance, promote neuronal growth both in vivo and in vitro, stimulate 314

rescue survival of neurons, and induce neurogenesis at the site of injury (47).315

316

13 of 19

186

The field of paracrine-mediated processes involving secreted trophic factors is 317

increasingly studied, with a specific interest in optimizing neurotrophic factors 318

production (48). Altering DPSCs culture conditions to prime and/or to pre-differentiate 319

the cells is a way to improve secreted factors production. Thus, it has been demonstrated 320

that following pre-differentiation into Schwann-like glial cells, DPSCs secreted 321

significantly more neurotrophins and were able to further stimulate neurite outgrowth 322

in an in vitro model of spinal cord injury as compared to nondifferentiated cells (49). 323

In another study, DPSC stimulation with neuregulin1-β1, basic fibroblast growth factor, 324

platelet-derived growth factor, and forskolin significantly increased protein levels of 325

neurotrophic factors compared to unstimulated controls (46). In this work, we defined 326

the optimal preconditioning of DPSCs to enhance neurites outgrowth of DRG sensory 327

neurons. 328

B-27 used to stimulate DPSCs, is the most cited neuronal cell culture supplement and 329

it is serum-free. While its composition has been published (50), the exact concentrations 330

of its components are not known (51) (Appendix). B-27 is commercially available as 331

GMP-grade and has been already used in clinical-scale cell productions (52), which 332

does not alter the GMP character of our CM. 333

The levels of DPSC secreted factors, in our study, are similar to that of many other 334

studies that show a neuroregenerative potential of mesenchymal stem cell-conditioned 335

medium: NGF, BDNF, NT-3.., with concentration levels varying between 0 and 70 336

pg/ml (53). However, differences in CM preparation procedures may explain why some 337

factors present in CM of some studies are not present in ours and inversely. Some 338

studies used fetal bovine serum or other supplements as human platelet lysate, while 339

we used serum-free media (8). The washing step before adding a serum free medium is 340

important to remove any trace of the serum. Moreover, MSC might be cultured in 341

different kind of basal medium, which affect the secretory potential of MSC (54). 342

Furthermore, in our study, we did not concentrate CM before use. 343

A great variety of extracellular signals are already known to induce axon growth. For 344

instance, a family of peptide trophic factors called neurotrophins, which in mammals 345

include NGF, BDNF, NT-3, and NT-4/5, has been thoroughly studied (55). The effects 346

of neurotrophins on neuronal outgrowth have been well described in different types 347

of neuron populations in both the central (56-59) and the peripheral nervous system 348

(59-61). The DRG sensory neurons from adult mice in primary culture express the 349

cognate receptors of the neurotrophins NGF, BDNF, NT4, and NT3, which are350

14 of 19

187

members of the tropomyosin-related kinase (TrkA, B, and C) receptor tyrosine kinase 351

family and probably account for part of CM effects (62). 352

In addition to neurotrophins, some other factors like VEGF (44), HGF (30), IGF-1 (31) 353

have been known for their neurotrophic action and shown to promote DRG neurites 354

growth. The results of microarrays suggest that NTF might not be the only effective 355

growth factors on DRG sensory neurons, since they are almost present equally in CM 356

with and without stimulation of DPSCs, except for NT-3 which increased significantly 357

with stimulated DPSCs, but it acts only on 10% of DRG neurons. 358

Other than HGF and VEGF, various factors present in stimulated DPSC-CM may be 359

involved in its promoted neuro-potential. Further studies are needed to confirm whether 360

this effect is attributed to the release of these factors, not yet studied for this effect, such 361

as IGFBP (3-6), GDF-15, PDGF-AA… 362

Other studies investigating mesenchymal stem cells secretome effect on neurites 363

growth predicted as well the existence of undetermined factors responsible for the 364

neurite outgrowth, other than the well-known neurotrophic factors (63, 64). Park et al. 365

asked whether this effect is attributed to the release of paracrine acting factors, such as 366

IGFBP-4 and -6, secreted at high levels by stimulated hMSC (65). IGFBP‑6 is already 367

indicated as an important neuronal survival factor secreted from hMSCs (37), but its 368

potential for neurites growth is not yet studied. Additional work must be done to 369

determine the factors secreted by stimulated DPSCs that are responsible for this 370

regenerative effect. 371

372

Conclusion 373

In this study, we demonstrate that DPSC-CM enhances axonal outgrowth of primary 374

sensory DRG neurons in vitro. We identified several growth-promoting factors in the 375

secretome of DPSCs and we show that the B-27 supplement drastically changes the 376

secretome’s profile, further stimulating neurite outgrowth. Importantly, our work points 377

towards promising avenues for the application of dental pulp stem cell-conditioned 378

media to aide neuronal regeneration.379

380

381

382

15 of 19

188

Acknowledgments 383

This research was possible thanks to Lebanese University for research award (Ref.: 384

decision # 162) granted to Ph.D. student B. Chouaib. The work was mainly funded by 385

the association Fondations des “Gueules Cassées”. 386

387

Author Contributions 388

Batoul Chouaib: Coordinated the study, performed the experiments, analyzed the data, 389

interpreted the data, and wrote the paper. 390

Pierre-Yves Collart-Dutilleul: Coordinated the study, interpreted the data and edited the 391

final manuscript. 392

Nicolas Blanc-Sylvestre: Performed the experiments, and analyzed the data. 393

Richard Younes: Analyzed the data. 394

Csilla Gergely: Conceived and designed the experiments, and edited the final 395

manuscript. 396

Cedric Raoul: Interpreted the Data, and edited the final manuscript. 397

Frederique Scamps: Interpreted the Data, and edited the final manuscript. 398

Frederic Cuisinier: Conceived and designed the experiments, interpreted the data, and 399

edited the final manuscript. 400

Olivier Romieu: Conceived and designed the experiments, performed the experiments. 401

interpreted the data and edited the final manuscript. 402

All authors gave their final approval and agree to be accountable for all aspects of the 403

work. 404

405

References 406

1. Scheib J, Höke A. Advances in peripheral nerve regeneration. Nature Reviews 407

Neurology. 2013;9(12):668. 408

2. Martin M, Benzina O, Szabo V, Végh A-G, Lucas O, Cloitre T, et al. 409

Morphology and nanomechanics of sensory neurons growth cones following peripheral 410

nerve injury. Plos one. 2013;8(2):e56286. 411

3. Grasman JM, Kaplan DL. Human endothelial cells secrete neurotropic factors 412

to direct axonal growth of peripheral nerves. Scientific reports. 2017;7(1):4092. 413

4. Gögel S, Gubernator M, Minger S. Progress and prospects: stem cells and 414

neurological diseases. Gene therapy. 2011;18(1):1. 415

5. Teixeira FG, Carvalho MM, Sousa N, Salgado AJ. Mesenchymal stem cells 416

secretome: a new paradigm for central nervous system regeneration? Cellular and 417

Molecular Life Sciences. 2013;70(20):3871-82.418

16 of 19

189

6. Blurton-Jones M, Kitazawa M, Martinez-Coria H, Castello NA, Müller F-J, 419

Loring JF, et al. Neural stem cells improve cognition via BDNF in a transgenic model 420

of Alzheimer disease. Proceedings of the National Academy of Sciences. 421

2009;106(32):13594-9. 422

7. Crigler L, Robey RC, Asawachaicharn A, Gaupp D, Phinney DG. Human 423

mesenchymal stem cell subpopulations express a variety of neuro-regulatory molecules 424

and promote neuronal cell survival and neuritogenesis. Experimental neurology. 425

2006;198(1):54-64. 426

8. Pawitan JA. Prospect of stem cell conditioned medium in regenerative 427

medicine. BioMed research international. 2014;2014. 428

9. Mead B, Logan A, Berry M, Leadbeater W, Scheven BA. Paracrine-mediated 429

neuroprotection and neuritogenesis of axotomised retinal ganglion cells by human 430

dental pulp stem cells: comparison with human bone marrow and adipose-derived 431

mesenchymal stem cells. PloS one. 2014;9(10):e109305. 432

10. Kichenbrand C, Velot E, Menu P, Moby V. Dental pulp stem cell-derived 433

conditioned medium: An attractive alternative for regenerative therapy. Tissue 434

Engineering Part B: Reviews. 2019;25(1):78-88. 435

11. Collart-Dutilleul P-Y, Secret E, Panayotov I, Deville de Périère D, Martín-436

Palma RlJ, Torres-Costa V, et al. Adhesion and proliferation of human mesenchymal 437

stem cells from dental pulp on porous silicon scaffolds. ACS applied materials & 438

interfaces. 2014;6(3):1719-28. 439

12. Panayotov IV, Collart‐Dutilleul PY, Salehi H, Martin M, Végh A, Yachouh J, 440

et al. Sprayed cells and polyelectrolyte films for biomaterial functionalization: the 441

influence of physical PLL–PGA film treatments on dental pulp cell behavior. 442

Macromolecular bioscience. 2014;14(12):1771-82. 443

13. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth factors. 444

2004;22(4):233-41. 445

14. Koprivica V, Cho K-S, Park JB, Yiu G, Atwal J, Gore B, et al. EGFR activation 446

mediates inhibition of axon regeneration by myelin and chondroitin sulfate 447

proteoglycans. Science. 2005;310(5745):106-10. 448

15. Tanaka S, Kunath T, Hadjantonakis A-K, Nagy A, Rossant J. Promotion of 449

trophoblast stem cell proliferation by FGF4. Science. 1998;282(5396):2072-5. 450

16. Bosetti M, Boccafoschi F, Leigheb M, Cannas MF. Effect of different growth 451

factors on human osteoblasts activities: a possible application in bone regeneration for 452

tissue engineering. Biomolecular engineering. 2007;24(6):613-8. 453

17. Yun Y-R, Won JE, Jeon E, Lee S, Kang W, Jo H, et al. Fibroblast growth 454

factors: biology, function, and application for tissue regeneration. Journal of tissue 455

engineering. 2010;1(1):218142. 456

18. Finch PW, Rubin JS, Miki T, Ron D, Aaronson SA. Human KGF is FGF-related 457

with properties of a paracrine effector of epithelial cell growth. Science. 458

1989;245(4919):752-5. 459

19. Thomson A, Cunha G. Prostatic growth and development are regulated by 460

FGF10. Development. 1999;126(16):3693-701. 461

20. Tagashira S, Harada H, Katsumata T, Itoh N, Nakatsuka M. Cloning of mouse 462

FGF10 and up-regulation of its gene expression during wound healing. Gene. 463

1997;197(1-2):399-404. 464

21. Tsuboi R, Sato C, Kurita Y, Ron D, Rubin JS, Ogawa H. Keratinocyte growth 465

factor (FGF-7) stimulates migration and plasminogen activator activity of normal 466

human keratinocytes. Journal of investigative dermatology. 1993;101(1):49-53.467

17 of 19

190

22. Werner S, Weinberg W, Liao X, Peters K, Blessing M, Yuspa S, et al. Targeted 468

expression of a dominant‐negative FGF receptor mutant in the epidermis of transgenic 469

mice reveals a role of FGF in keratinocyte organization and differentiation. The EMBO 470

Journal. 1993;12(7):2635-43. 471

23. Emmerson PJ, Duffin KL, Wu X. GDF15 and growth control. Frontiers in 472

physiology. 2018;9:1712. 473

24. Hirata T, Morii E, Morimoto M, Kasugai T, Tsujimura T, Hirota S, et al. Stem 474

cell factor induces outgrowth of c-kit-positive neurites and supports the survival of c-475

kit-positive neurons in dorsal root ganglia of mouse embryos. Development. 476

1993;119(1):49-56. 477

25. Milenkovic N, Frahm C, Gassmann M, Griffel C, Erdmann B, Birchmeier C, et 478

al. Nociceptive tuning by stem cell factor/c-Kit signaling. Neuron. 2007;56(5):893-906. 479

26. Sulzbacher I, Träxler M, Mosberger I, Lang S, Chott A. Platelet-derived growth 480

factor-AA and-α receptor expression suggests an autocrine and/or paracrine loop in 481

osteosarcoma. Modern Pathology. 2000;13(6):632. 482

27. Andrae J, Gallini R, Betsholtz C. Role of platelet-derived growth factors in 483

physiology and medicine. Genes & development. 2008;22(10):1276-312. 484

28. Baudet M-L, Rattray D, Martin BT, Harvey S. Growth hormone promotes axon 485

growth in the developing nervous system. Endocrinology. 2009;150(6):2758-66. 486

29. Bianchi VE, Locatelli V, Rizzi L. Neurotrophic and neuroregenerative effects 487

of GH/IGF1. International journal of molecular sciences. 2017;18(11):2441. 488

30. Maina F, Hilton MC, Ponzetto C, Davies AM, Klein R. Met receptor signaling 489

is required for sensory nerve development and HGF promotes axonal growth and 490

survival of sensory neurons. Genes & development. 1997;11(24):3341-50. 491

31. Xiang Y, Ding N, Xing Z, Zhang W, Liu H, Li Z. Insulin-like growth factor-1 492

regulates neurite outgrowth and neuronal migration from organotypic cultured dorsal 493

root ganglion. International Journal of Neuroscience. 2011;121(2):101-6. 494

32. Zhu H, Xue C, Yao M, Wang H, Zhang P, Qian T, et al. miR-129 controls 495

axonal regeneration via regulating insulin-like growth factor-1 in peripheral nerve 496

injury. Cell death & disease. 2018;9(7):720. 497

33. Guo C, Cho K-S, Li Y, Tchedre K, Antolik C, Ma J, et al. IGFBPL1 regulates 498

axon growth through IGF-1-mediated signaling cascades. Scientific reports. 499

2018;8(1):2054. 500

34. Wood TL, Brown AL, Rechler MM, Pintar JE. The expression pattern of an 501

insulin-like growth factor (IGF)-binding protein gene is distinct from IGF-II in the 502

midgestational rat embryo. Molecular Endocrinology. 1990;4(8):1257-63. 503

35. Baxter RC. Insulin-like growth factor binding protein-3 (IGFBP-3): Novel 504

ligands mediate unexpected functions. Journal of cell communication and signaling. 505

2013;7(3):179-89. 506

36. Rao SN, Pearse DD. Regulating axonal responses to injury: the intersection 507

between signaling pathways involved in axon myelination and the inhibition of axon 508

regeneration. Frontiers in molecular neuroscience. 2016;9:33. 509

37. Jeon H-J, Park J, Shin J-H, Chang M-S. Insulin-like growth factor binding 510

protein-6 released from human mesenchymal stem cells confers neuronal protection 511

through IGF-1R-mediated signaling. International journal of molecular medicine. 512

2017;40(6):1860-8. 513

38. Naeve GS, Vana AM, Eggold JR, Verge G, Ling N, Foster AC. Expression of 514

rat insulin-like growth factor binding protein-6 in the brain, spinal cord, and sensory 515

ganglia. Molecular brain research. 2000;75(2):185-97.516

18 of 19

191

39. Govind S, Kozma R, Monfries C, Lim L, Ahmed S. Cdc42Hs facilitates 517

cytoskeletal reorganization and neurite outgrowth by localizing the 58-kD insulin 518

receptor substrate to filamentous actin. The Journal of cell biology. 2001;152(3):579-519

94. 520

40. Choi J, Ko J, Racz B, Burette A, Lee J-R, Kim S, et al. Regulation of dendritic 521

spine morphogenesis by insulin receptor substrate 53, a downstream effector of Rac1 522

and Cdc42 small GTPases. Journal of Neuroscience. 2005;25(4):869-79. 523

41. McCarthy HS, Williams JH, Davie MW, Marshall MJ. Platelet‐derived growth 524

factor stimulates osteoprotegerin production in osteoblastic cells. Journal of cellular 525

physiology. 2009;218(2):350-4. 526

42. Gutierrez H, Kisiswa L, O'Keeffe GW, Smithen MJ, Wyatt S, Davies AM. 527

Regulation of neurite growth by tumour necrosis superfamily member RANKL. Open 528

biology. 2013;3(1):120150. 529

43. Shibuya M. Vascular Endothelial Growth Factor (VEGF) and Its Receptor 530

(VEGFR) Signaling in Angiogenesis: A Crucial Target for Anti- and Pro-Angiogenic 531

Therapies. Genes Cancer. 2011;2(12):1097-105. 532

44. Sondell M, Sundler F, Kanje M. Vascular endothelial growth factor is a 533

neurotrophic factor which stimulates axonal outgrowth through the flk‐1 receptor. 534

European Journal of Neuroscience. 2000;12(12):4243-54. 535

45. Stacker SA, Achen MG. Emerging roles for VEGF-D in human disease. 536

Biomolecules. 2018;8(1):1. 537

46. Kolar MK, Itte VN, Kingham PJ, Novikov LN, Wiberg M, Kelk P. The 538

neurotrophic effects of different human dental mesenchymal stem cells. Scientific 539

reports. 2017;7(1):12605. 540

47. Sultan N, Amin LE, Zaher AR, Scheven BA, Grawish ME. Dental pulp stem 541

cells: Novel cell-based and cell-free therapy for peripheral nerve repair. World Journal 542

of Stomatology. 2019;7(1):1-19. 543

48. Mead B, Logan A, Berry M, Leadbeater W, Scheven BA. Concise review: 544

dental pulp stem cells: a novel cell therapy for retinal and central nervous system repair. 545

Stem Cells. 2017;35(1):61-7. 546

49. Martens W, Sanen K, Georgiou M, Struys T, Bronckaers A, Ameloot M, et al. 547

Human dental pulp stem cells can differentiate into Schwann cells and promote and 548

guide neurite outgrowth in an aligned tissue-engineered collagen construct in vitro. The 549

FASEB Journal. 2014;28(4):1634-43. 550

50. Brewer GJ, Torricelli J, Evege E, Price P. Optimized survival of hippocampal 551

neurons in B27‐supplemented neurobasal™, a new serum‐free medium combination. 552

Journal of neuroscience research. 1993;35(5):567-76. 553

51. Sünwoldt J, Bosche B, Meisel A, Mergenthaler P. Neuronal culture 554

microenvironments determine preferences in bioenergetic pathway use. Frontiers in 555

molecular neuroscience. 2017;10:305. 556

52. Chimenti I, Gaetani R, Forte E, Angelini F, De Falco E, Zoccai GB, et al. Serum 557

and supplement optimization for EU GMP‐compliance in cardiospheres cell culture. 558

Journal of cellular and molecular medicine. 2014;18(4):624-34. 559

53. Sugimura-Wakayama Y, Katagiri W, Osugi M, Kawai T, Ogata K, Sakaguchi 560

K, et al. Peripheral nerve regeneration by secretomes of stem cells from human 561

exfoliated deciduous teeth. Stem cells and development. 2015;24(22):2687-99. 562

54. Sagaradze G, Grigorieva O, Nimiritsky P, Basalova N, Kalinina N, Akopyan Z, 563

et al. Conditioned Medium from Human Mesenchymal Stromal Cells: Towards the 564

Clinical Translation. International journal of molecular sciences. 2019;20(7):1656.565

19 of 19

192

55. Goldberg JL. How does an axon grow? Genes & development. 2003;17(8):941-566

58. 567

56. O'Donovan KJ. Intrinsic axonal growth and the drive for regeneration. Frontiers 568

in neuroscience. 2016;10:486. 569

57. Goldberg JL, Espinosa JS, Xu Y, Davidson N, Kovacs GT, Barres BA. Retinal 570

ganglion cells do not extend axons by default: promotion by neurotrophic signaling and 571

electrical activity. Neuron. 2002;33(5):689-702. 572

58. Martins LF, Costa RO, Pedro JR, Aguiar P, Serra SC, Teixeira FG, et al. 573

Mesenchymal stem cells secretome-induced axonal outgrowth is mediated by BDNF. 574

Scientific reports. 2017;7(1):4153. 575

59. Tucker KL, Meyer M, Barde Y-A. Neurotrophins are required for nerve growth 576

during development. Nature neuroscience. 2001;4(1):29. 577

60. Tuttle R, Matthew WD. Neurotrophins affect the pattern of DRG neurite growth 578

in a bioassay that presents a choice of CNS and PNS substrates. Development. 579

1995;121(5):1301-9. 580

61. Kimpinski K, Campenot R, Mearow K. Effects of the neurotrophins nerve 581

growth factor, neurotrophin‐3, and brain‐derived neurotrophic factor (BDNF) on 582

neurite growth from adult sensory neurons in compartmented cultures. Journal of 583

neurobiology. 1997;33(4):395-410. 584

62. Barbacid M. The Trk family of neurotrophin receptors. Journal of neurobiology. 585

1994;25(11):1386-403. 586

63. Nakano N, Nakai Y, Seo T-B, Yamada Y, Ohno T, Yamanaka A, et al. 587

Characterization of conditioned medium of cultured bone marrow stromal cells. 588

Neuroscience letters. 2010;483(1):57-61. 589

64. Miura‐Yura E, Tsunekawa S, Naruse K, Nakamura N, Motegi M, Nakai‐590

Shimoda H, et al. Secreted factors from cultured dental pulp stem cells promoted 591

neurite outgrowth of dorsal root ganglion neurons and ameliorated neural functions in 592

streptozotocin‐induced diabetic mice. Journal of diabetes investigation. 2019. 593

65. Park HW, Lim MJ, Jung H, Lee SP, Paik KS, Chang MS. Human mesenchymal 594

stem cell‐derived Schwann cell‐like cells exhibit neurotrophic effects, via distinct 595

growth factor production, in a model of spinal cord injury. Glia. 2010;58(9):1118-32. 596

1 of 25

193

Research Article 1

Dental Pulp Stem Cells (DPSCs) primed with 2

paclitaxel inhibit and overcome resistance in breast 3

cancer cells 4

Siham Al-Arag 1,*, Batoul Chouaib 1, Orsolya Pàll 1, Csilla Gergely 2, Valerie Orti 1, Frédéric 5

Cuisinier 1, Hamideh Salehi 1 6 1 LBN, Univ Montpellier, Montpellier, France 7 2 L2C, Univ Montpellier, CNRS, Montpellier, France 8 * Correspondence: [email protected] 9

10

Abstract: Dental pulp stem cells (DPSCs) can be employed as cellular drug reservoirs and 11 transporters for cellular targeted chemotherapy. We hereby study DPSCs, pre-loaded or not 12 with paclitaxel (PTX), in co-culture with MCF7 cancer cells. We assessed the effect of different 13 mixing ratios on 2D/3D MCF7 cell proliferation and used a drug-resistant cancer subline for 14 a highly pathological 3D model. Paracrine signaling was lastly studied via minimal 15 interacting models (transwell and spheroid dissemination assays) followed by a conditioned 16 medium (CM) study. Additional analyses were performed via fluorescence cytometry and 17 confocal imaging. Significant inhibition of MCF7 cell proliferation, in a dose- and time- 18 dependent manner, was observed after direct 2D/ 3D co-culture of both DPSC±PTX, and also 19 on PTX-resistant cancer spheroids. DPSCsPTX secretome could inhibit cancer proliferation 20 and spheroid cell dissemination. Early DPSC factors (4h-CM) induced inhibition and pro-21 apoptosis, while the 48h-CM and 5-day transwell testing revealed proliferative effects. DPSCs 22 therapeutic efficacy is directly associated to their direct interaction with cancer cells. Cell 23 protrusions developed by DPSCsPTX in direct co-culture and the extracellular vesicles (EVs) 24 observed near MCF7 cells have key roles in the cancer inhibition. We conclude for the 25 promising application of co-injected DPSCsPTX for combined cancer therapy to overcome 26 treatment resistance. 27

Keywords: Dental pulp stem cells, paclitaxel, MCF7 cells, breast cancer, PTX-resistance, 28

targeted chemotherapy, MSC secretome 29

1. Introduction 30

In addition to cell replacement and potent paracrine functions, mesenchymal stem cells 31 (MSCs) are known for their migration ability and relative resistance to cytotoxic 32 chemotherapeutic agents, which open new ways in their use for targeted drug delivery [1]. 33 These cells are especially compatible with different delivery methods and formulations, being 34 able to home to sites of injured tissue and having strong immunosuppressive properties 35 exploited for successful autologous/ heterologous transplantations. The application of MSCs as 36 cell-based drug delivery vectors directly to the target tissue would significantly increase 37 therapeutic effect and limit the toxicity to peripheral off-target sites. 38

Stem cells derived from the dental pulp (DPSCs) have been described as a population of 39 MSCs, which display several similarities with bone marrow-derived mesenchymal stem cells 40 in terms of surface markers, phenotype, and multipotent differentiation capacity [2-4]. The 41 minimally invasive isolation from adult third molars (or supernumerary teeth) and further 42 processing technologies can yield abundant numbers of viable pluripotent DPSCs for cell-43 based therapy. Though usually discarded as medical waste, DPSCs could serve as an excellent 44 source of mesenchymal stem cells. They can be used in patient-specific bioimplants, modeling45

46

mailto:[email protected]

2 of 25

194

of diseases, and the development of personalized diagnostic/ drug screening tools for cancer 47 treatments, along with their role for biological replacement and autologous cell-based 48 regeneration of complex tissues. Studies also suggest that dental stem cells could have a 49 promising role especially in head and neck cancer therapies [5]. 50

Taxanes are one of the most common and widespread classes of anti-cancer drugs, used 51 for many types of cancer including breast, colorectal, ovarian, lung, head and neck tumors, and 52 unknown primary cancers [6-9]. Paclitaxel (PTX) is a drug currently applied for cancer 53 treatment at variable doses (15-825 mg/m2) and infusion times; included in both weekly and 3-54 weeks dosing cycles. The most widely used dose of paclitaxel monotherapy is 175 mg/m2 given 55 as a 3-h infusion and leads typically to a value of maximum plasma concentration (Cmax) of 5µM 56 [10]. Thus, the administered dose of paclitaxel that we chose to use for our experiments is 175 57 mg/m2, being the clinical equivalent concentration, calculated for an average female patient as 58 10µM paclitaxel [11]. Consequently, for this study, we will measure up our treatment to the 59 most widely used paclitaxel dose, where a maximum concentration to target cancer cells -5 µM 60 PTX- is considered as the positive control. 61

Our previous attempt to maximize paclitaxel efficacy in DPSC (primed at 10µM for 12h) 62 showed that PTX could be internalized and released by the cells over the following 4 hours. 63 Moreover, the cytotoxic effect of conditioned medium (CM) from PTX-loaded DPSCs on MCF7 64 breast cancer cells, already for a short incubation time, was previously reported [12]. According 65 to our earlier results and the scientific literature: we hypothesize that dental pulp stem cells 66 may act as a reservoir that subsequently releases the drug when co-cultured with tumor cells, 67 leading to cancer inhibition. On the other hand, there is a controversy over the effect of MSCs 68 themselves regarding their paracrine and cell-cell interaction effects on cancer [13, 14]. It is not 69 clear whether this effect is predominantly tumor promoting or suppressive, therefore this poses 70 an important safety question concerning the application of these cells [13, 14]. When examining 71 the impact of MSC on tumor biology, the source and specific ratios of MSC to tumor cells are 72 crucial aspects to consider [15]. Our work addresses the need for further investigation of 73 DPSCs’ application against cancer especially with regards to the efficacy of these stem cells 74

combined to PTX delivery in an in vivo-like setting. For this, we developed three-dimensional 75 spheroid models, where cancer cells’ growth mimics the physiological environment of tumor 76 tissue, allowing a natural cell response and improved cell-cell interactions, providing 77 superiority and the highest complexity amongst the in-vitro models [16]. Furthermore, 78 chemotherapy resistance is one of the major reasons responsible for poor therapy outcomes. 79 The in-vitro experimental models which reflect the in-vivo condition of chemo-resistant breast 80 cancer are highly desirable to evaluate therapy outcomes [17]. To address this, a more 81 pathologically- relevant, three-dimensional (3D) culture of human breast cancer cells was 82 evaluated by using a resistant subline model with acquired PTX resistance. 83

Breast cancer in young-aged women is often diagnosed in its late stages and tends to be 84

more aggressive [18]. This means the survival rate is lower (30% more likely to die from breast 85

cancer compared to aged women) and a higher recurrence rate [19]. MSCs, in particular, are an 86

important tool in cancer therapy, since they can act as a powerful cell-based delivery vehicle 87

for releasing site-specific chemotherapy and contributing to specific biological factors [20]. A 88

minimal-invasive approach combined with vigorous efficacy and minimal side effects would 89

contribute to decreased morbidity and improved quality of life for these patients. This study 90

aims to explore, firstly, the influence of DPSC loaded or not with PTX (DPSC±PTX) on cancer 91

cells. Protocols were optimized with the objective to study the cytotoxicity of MCF7 breast 92

cancer cells co-cultured with different DPSC cell numbers (assessed by dose-dependent anti-93

proliferation tests), applying minimal-interactive (dissemination and transwell assays), in-94

direct by CM, and direct 2D/3D co-cultures. Secondly, the close interaction and the effect of95

3 of 25

195

their long-term co-culture were studied. The assessment of effector cells, DPSCs and PTX-96

loaded DPSCs, on tumor models was performed by fluorescent-based (flow cytometry, plate-97

based live imaging) assays. Additional morphological analyses of the co-cultured cells were 98

performed by cytogram scatter analysis and confocal imaging to realize this objective. An 99

overview of all the performed tests (category and description) is available in the appendix 100

(summary table A1). In the current research paper, we show, for the first time, the potential use 101

of human DPSC model as a targeted anti-cancer drug vector, with a focus on the specific 102

interaction between DPSC and MCF7 cancer cells, which have not yet been investigated. 103

2. Results 104

2.1 DPSC±PTX inhibits MCF7 cell proliferation in direct 2D co-culture 105

The interaction between DPSCs±PTX and MCF7 depended on the ratio among the two 106 cell types, and varied at day 7 from 30% to almost 90% cell number decrease (lowest to highest 107 ratio respectively) compared to the control -no treatment conditions (Fig. 1a). Higher 108 prominence (>70% inhibition rate) was observed with 4000 and 8000 DPSCsPTX (p<0.001) 109 compared to all lower cell numbers. There was a significant difference also in MCF7 cell 110 proliferation when co-cultured with 4000 or 8000 DPSCsPTX (p=0.002), indicating a strong 111 dose-dependent inhibition. This assay was also performed at 5 days where less cell numbers 112 were observed when compared to day 7 (Fig. S1), confirming cell proliferation. A time-113 dependent anti-proliferation was evident only for the two highest doses of DPSCsPTX, where 114 the inhibition rate was maintained through days 5 and 7 (Fig. S1- a). In parallel, the results of 115 co-cultures with unloaded DPSC showed a significant decrease, more than 30% inhibition rate, 116 in cell proliferation for the highest DPSC number on days 5 and 7 (Fig. 1; S1- b). This allowed 117 us to calculate an arbitrary value (Rx%) expressed as the ratio of DPSCsPTX/ MCF7 that 118 produced 50% (1:2 ratio) and 90% (almost 2:1 ratio) inhibition of proliferation after 7 days. We 119 have therefore selected the ratio R90 for DPSCsPTX (or R30 for DPSCs), corresponding to two 120 DPSCs for one MCF7 cell, to further investigate the underlying interactions. 121

In a second setting, co-cultures at the (2:1) selected ratio were evaluated by using labeled 122 cells. A 3-day co-culture of MCF7 with DPSC±PTX was performed. Figure 1b shows 96.1% ±0.02 123 of cancer cell inhibition upon treatment with DPSCsPTX, on day 3, versus no treatment. On the 124 other hand, unloaded DPSCs caused a mild anti-proliferative effect, with a 20% ±0.05 inhibition 125 rate on day 3. Notably, co-culturing with DPSCsPTX showed also a time-dependent increased 126 inhibition from day 1 through day 3. 127

128

129

4 of 25

196

Figure 1. Effect of direct 2D co-culture of DPSCs±PTX and MCF7. (a) Primed DPSCsPTX mixed 130 at different ratios with MCF7 showed dose-dependent inhibition capacity on cancer cells 131 proliferation evaluated by MTT test at day 7. The y-axis shows the cell number, expressed as a 132 percentage of the non-treated control (medium alone). *p<0.05, **p<0.01, ***p<0.001 versus no 133 treatment. (b) Cytometry counts of MCF7 after co-culture with DPSCs±PTX at R90 ratio, for 1 134 and 3 days. The results in (b) represent the mean ±SD of two independent experiments. *p<0.05, 135 **p<0.01, ***p<0.001. 136

2.2 Direct contact induces morphological changes for DPSC and MCF7 cells 137

The expression of green fluorescence of labeled GFP-MCF7 was detected by flow 138 cytometry after co-culture with DPSCs ±PTX for 3 days. Data, expressed as the relative count 139 for DPSC±PTX -treated MCF7, revealed a remarkable decrease in the cancer cell count (Fig. 2a), 140 noticed even as short as 24h following co-culture. Although cells were initially seeded at 2:1 141 ratio (DPSC:MCF7), MCF7 cell number in the culture decreased to 18.7%, 9.8%, and 3.3% for 142 24h- 48h- 72h respectively. For better insight, we followed by a qualitative morphological 143 analysis of the treated cancer cells. 144

By advanced flow analysis, we remarked significant changes in the mean values of side 145 scatter (SSA) of the analyzed MCF7 in co-culture between the two groups (culture with 146 DPSCsPTX and unloaded DPSC) as shown by the cytograms in figure 2b. The median side 147 scatters varied the most from about 100K to 144K for unloaded versus the loaded DPSC 148 treatment condition, respectively (p<0.05, data not shown). This change is represented by an 149 increase of intracytoplasmic granularity in line with PTX incorporation and changed MCF7 cell 150 form. This was apparent in the light microscope images revealing differences in the co-culture 151 with unloaded DPSC, with small round uniform morphology and only a few apoptotic cancer 152 cells, while those cultured with DPSCsPTX showing altered cancer cell form with multiple 153 dead cells (Fig. 2c, red arrows). Microscopy images of fluorescent co-culture (after 24h) of green 154 MCF7 with red DPSCs±PTX evidenced an inhibitory effect on the co-cultured MCF7, leading 155 to altered morphology and reduction in green fluorescence compared to co-culturing with 156 unloaded DPSC (Fig. 2d). Furthermore, magnified confocal fluorescence images (Fig. 2e and 157 2f) of 12h and 48h co-culture of DPSCsPTX (in red) and MCF7 cells (in green) revealed the 158 initiation of direct cell-cell communications. DPSCs showed the formation of long membrane 159 protrusions when in co-culture with MCF7 (Fig. 2f, yellow arrows) and seemingly the 160 mobilization of microvesicles in a closer view (Fig. 2f). 161 162

163

5 of 25

197

Figure 2. Cytometry and morphology analysis of MCF7 cancer cells co-cultured with loaded 164 and unloaded DPSCs. (a) Histogram showing flow cytometry data expressed as relative counts 165 of fluorescent DPSCsPTX-treated MCF7 and the DPSC-treated MCF7 after 1-2-3 days co-166 culture. The results represent the mean ±SD of two experiments. *p<0.05, **p<0.01, ***p<0.001. 167 (b) Flow cytometry analysis of side and forward scatter of the treated (red) and control (black) 168 cancer cells in co-culture for 24, 48, and 72h respectively, indicating a change in the FSA/SSA 169 wherein the form of MCF7 cells after treatment. (c) Phase-contrast optical images showing 170 differences in MCF7 cell morphology co-cultured with unloaded DPSC (red circle, left panel), 171 and those cultured with DPSCsPTX (red arrows, right panel). (d) Microscopy images of 172 fluorescent co-culture of green MCF7 with red DPSCs±PTX after 24h, 1x objective. DPSCsPTX 173 had an inhibitory effect on the co-cultured MCF7, leading to altered morphology and reduction 174 in green fluorescence (right) compared to co-culturing with unloaded DPSC (left). (e) Confocal 175 fluorescence images of the early co-culture after 12h showing the start of nano-connections, 176 and (f) magnified view at co-culture after 48h, recorded with 16x and 20x objectives, 177 respectively. The formation of membrane extensions for DPSCs (yellow arrows) indicates the 178 inter-cellular interaction with the MCF7 cells. Notice the red microvesicles in close proximity 179 to green cell180

6 of 25

198

2.3 DPSC±PTX inhibits MCF7 spheroid growth in direct 3D co-culture 181

By using ultra low-adhesive microwell plates, reproducible spheroids with a complete 3D 182 organization were generated, enabling quantitative evaluation in a 3D setting (Fig. 3c). 183 Spheroid’s diameter increased for negative control (medium) from day 3 to 7 (p=0.001), 184 whereas an inhibitory effect of PTX-alone positive control started on day 5, ranging from 12% 185 ±0.06 to 25% ±0.03 for days 5 and 7 respectively (p<0.05), for all independent experiments (Fig. 186 S2). We remark the resistance of 3D spheroids to high 5µM PTX dose (>20% inhibition starting 187 only on day 7). 188

To assess the inhibition effect of DPSCsPTX cells, experiments were done applying five 189 different DPSC cell quantities (500-8000). A decrease of MCF7 spheroid size was observed for 190 all time points (3- 5- 7 days) (Fig. 3d) for all doses of DPSC or DPSCsPTX (Fig. 3a; b). Within 191 the same dose, a clear time-dependent inhibition was observed for DPSCsPTX and DPSCs (Fig. 192 3a; 3b), which was more prominent for the two highest DPSCsPTX doses (p<0.05). Dose-193 dependent inhibition was also significant on day 7 and more prominent for DPSCsPTX cultures 194 (p<0.05). 195

DPSCsPTX show superior inhibition effect compared to PTX monotherapy 196

Importantly, greatly reduced spheroid diameters were obtained with 4000 and 8000 197 DPSCsPTX cultures, where both doses caused significantly higher inhibition compared to high 198 dose PTX mono-treatment. The maximum inhibition rate of spheroids growth (30% ±0.03) was 199 obtained with the use of 8000 DPSCsPTX for 7 days (Fig. 3d), which was higher than the 200 inhibition obtained with PTX alone (25% ±0.03) or with unloaded DPSCs (14% ±0.06). On 201 representative fluorescent images of spheroids, the yellow part indicates RFP-DPSCs ±PTX 202 penetration within the GFP-MCF7 cell spheroid (Fig. 3c). 203 The results in figure 3d show that for early treatment (days 3 and 5), DPSC cultures were even 204 more inhibitive than PTX alone, for all independent experiments, indicating that the extrinsic 205 PTX resistance (from MCF7 cells spheroidal aggregation) was overcome by the DPSCs secreted 206 factors. The superiority of DPSCsPTX was evident on day 7 (Fig. 3c; 3d) against all other 207 conditions. 208 209

210

7 of 25

199

Figure 3. MCF7 cancer cell spheroids proliferation after several days of treatment: (a) Average 211 spheroid proliferation after injection of DPSCsPTX (500 to 8000 cells) for 3- 5- 7 days. (b) 212 Average spheroid diameters after co-culture with DPSCs (1000 to 4000 cells) for 3- 5- 7 days. 213 (c) Light microscopy images of MCF7 spheroids on day7 co-cultured with 8000 DPSCs ±PTX, 214 with independent fluorescence microscopy images showing significant diameter decrease for 215 8000 DPSCsPTX condition. (d) Cultures with 8000 DPSCs±PTX cells significantly decreased 216 MCF7 spheroid diameter compared to untreated control starting from day3, whereas in the 217 presence of DPSCsPTX cancer cell spheroids are significantly smaller than those incubated 218 with PTX alone. *p<0.05, **p<0.01, ***p<0.001 in (a) and (b) versus no treatment. ¤: p<0.05, ¤ ¤: 219 p<0.01 time-inhibition for DPSCs cultures. 220

221

2.4 DPSCs induces MCF7 cell proliferation through paracrine interaction 222

To investigate whether the effect demonstrated in the direct co-culture assay is due to the 223 DPSC secretome in addition to the direct cell contact, paracrine signaling was studied. 224 Transwell indirect co-culture under clinical conditions (at an average time and cell ratio), 225 showed a mild inhibition of MCF7 due to DPSCsPTX (21% ±0.04). Unloaded DPSC, without 226 cell-cell contact, increased cancer cell proliferation by 148% ±0.13 after 5 days (Fig. 4a). The 227 density of MCF7 cancer cells cultured in wells (green fill) is represented for the four conditions 228 in figure 4b, indicating the decrease in MCF7 cells in presence of PTX, but their proliferation in 229 presence of DPSC. The assay was re-performed also for 7 days (Fig. A1) confirming the same 230 effect. 231

Short-term medium conditioning by DPSCs inhibits MCF7 cell viability 232

To further test the activity of DPSCs secreted factors on MCF7 cancer cell proliferation, 233 CM collected from cultured DPSCs±PTX was used to evaluate the paracrine-mediated effect. 234 Four hours of medium conditioning were enough to elucidate an inhibitory capacity of 235 DPSCsPTX-CM. On day 2, a strong inhibition of cancer cell viability of 75% ±0.05 was observed 236 (Fig. 4c). Unexpectedly, the 4h conditioned medium from unloaded DPSC showed an 237 inhibitory effect (15% ±0.10) of MCF7 viability even in serum-supplemented conditions (Fig. 238 4c). MCF7 cell apoptosis was detected following only 3h incubation with the 4h-CM from both 239 DPSC±PTX (Fig. A2). When the conditioning period is extended, the 48h-CM of DPSC 240 demonstrated induction of proliferation in MCF7 cells in supplement-free conditions, already 241 on day 2, confirming the transwell effect.242

8 of 25

200

243

Figure 4. Effect of indirect co-culture of DPSCs±PTX and MCF7. (a) Paracrine effect of DPSC 244 ±PTX on breast cancer cell line after 5 days, quantified using Celigo plate cytometer. ***p<0.001 245 between all conditions except #p<0.05 between DPSCsPTX and CTR. (b) Whole well images of 246 cancer cells in each of the conditions, segmented and presented by green fill. (c) Effect of the 247 secretome of DPSCs ±PTX after 2 days incubation with MCF7 cells. * p<0.05, **p<0.01, 248 ***p<0.001 versus no treatment. 249

2.5 Minimal interaction between DPSCs and MCF7 spheroids enhances cancer dissemination 250

A study of MCF7 cell spheroid dissemination was carried out by the outgrowth of the 251 whole cell monolayer, giving rise to symmetrical collective expansion surrounding the 252 spheroid base (Fig. 5a). In the co-culture model, a very minimal DPSC number is present in 253 close vicinity to the spheroid cells, while the main contribution of DPSC cells is through a 254 paracrine communication. The large discrepancy of the localized area of MCF7 spheroid-255 derived cells compared to the DPSCs’ well-plate attachment area (around 20x higher), in 256 addition to the very limited direct intercellular interaction (only outer MCF7 monolayer), make 257 this model relevant for studying the effect in “minimal-interactive” state. 258

DPSCsPTX significantly reduced the dissemination area of spheroids. The attenuation 259 rate of spheroid dissemination caused by DPSCsPTX reached up to 65% compared to no 260 treatment. Conversely, a significant increase of spheroids dissemination and proliferation 261 resulted from the paracrine effect of unloaded DPSCs (Fig. 5b; 5c). Images taken at each time-262 point (Fig. 5c) clearly reveal the remarkable effect of the loaded DPSCs on spheroids 263 dissemination sustained till 7 days. Here, a maximum effect with eradication of most of the 264 spheroid attachment by the DPSCsPTX cultures was observed. This effect was also observed 265 for PTX alone treatment (data not shown). Oncolysis of one-sided cell attachment was 266 occasionally noticed for DPSCsPTX group, leading to detachment of the primary spheroid 267 body (Fig. 5c day7). 268

269

9 of 25

201

Figure 4. Paracrine effect of DPSCs±PTX on the dissemination of MCF7 spheroids. (a) Schema 270 of optical images representing the three geometries of MCF7 tested as 2D MCF7 cells, 3D MCF7 271 spheroids, and disseminated MCF7 spheroid cells (from left to right). Note the collective 272 dissemination trait of the reattached spheroid cells in a zoomed view. (b) MCF7 cells were 273 seeded to form spheroids, transferred to adherent culture to attach and disperse for 12 days, 274 and then DPSCs±PTX was added. Histogram showing the evolution of the MCF7 cell 275 dissemination area (DA) for treatment and control conditions. *p<0.05, **p<0.01, ***p<0.001 276 versus no treatment. (c) Optical phase-contrast images of reattached MCF7 spheroids captured 277 at 3-, 5- and 7-days after treatment addition. DPSCsPTX shows as the most effective to 278 attenuate cell dissemination for all reattached spheroids. Scale bar: 500µm. 279

2.6 Direct contact with DPSCs±PTX inhibits PTX-resistant MCF7TAX19 proliferation 280

MCF7TAX19 subline expresses 4-fold acquired resistance to paclitaxel drug compared to 281 the MCF7 parent cell line [21]. When maintaining transwell co-culture for a 5-days period, 282 DPSC’s paracrine activity induced mild proliferative effect for the resistant cells. Non-283 significant anti-proliferation effect was observed for DPSCsPTX cultures on day 5 (Fig. 6a), 284 confirming resistance of low PTX doses on these cells. When the test was prolonged for 7 days 285 (Fig. A3), a significant inhibition for the DPSCsPTX cultures was revealed. 286

In direct co-culture, all ratios of DPSCsPTX have decreased the diameters of resistant 287 spheroids, in a comparable way to PTX high dose, starting on day 7 (Fig. 6b). However, no 288 effect was detected for either treatment on days 3 and 5; both PTX alone and DPSCsPTX started 289 reacting on day 7. Unloaded DPSCs showed a significant mild inhibition (around 10%) of 290 spheroids growth only for the highest tested ratios. 291

Results of efficacy of the inhibitive CM (4-h conditioning) from DPSCs±PTX showed an 292 inhibitive pattern of resistant cells’ proliferation, where interestingly a potent role of DPSC-CM 293 is seen after day 3 (Fig. S3). Except for the DPSCsPTX-CM, presenting high-dose combined 294 treatment, a time-delayed response for MCF7TAX19 was noticed throughout all the given 295

therapeutic interactions: transwell (Fig. 6a), DPSC-CM (Fig. S3), and the direct co-culture 296 results (Fig. 6b). 297

10 of 25

202

Figure 6. Effect of co-culture of DPSCs±PTX and MCF7 resistant-to-PTX. (a) Paracrine effect of 298 DPSC ±PTX on MCF7TAX19 cells after 5 days, quantified using Celigo cytometer. ***p<0.001 299 between all conditions except (#) non-significant between DPSCsPTX and CTR. (b) Average 300 spheroid diameters after 7 days of co-culture with DPSCsPTX (500 to 8000 cells). *p<0.05, 301 **p<0.01, ***p<0.001 versus no treatment. 302

3. Discussion 303

Chemotherapy drugs in their current clinical forms are delivered in untargeted variable 304 doses, resulting in unpredictable and often unwanted damage of non-diseased tissues, leading 305 sometimes to life-threatening clinical side effects. Though delivery systems have been 306 investigated extensively, still, further exploration of the best targeting strategies is needed in 307 order to curb the side effect profile and improve the efficacy of chemotherapy treatment. We 308 hereby address the ability of MSCs to inherently resist to cytotoxic agents and innately home 309 to cancer tissues [22, 23]. Here, the search for new, easily accessible sources of MSCs of high 310 multipotent abilities for cell therapy applications is of utmost importance. 311

Still, the interactions between MSCs and tumor cells are not fully understood, with 312 contradictory results frequently observed regarding their effects on cancer proliferation and 313 invasion, whether they are predominantly tumor supportive [24-29] or suppressive [30-33]. 314 Explanations that could account for conflicting results in the literature include inter-study 315 differences in various experiments [15]. The origin and pre-treatment of the applied MSCs, as 316 well as the studied cancer cell type, might strongly influence their interaction. Moreover, the 317 ratio of MSCs and cancer cells, duration of cells contact, and other factors as the 318 microenvironment composition means of injection of cells (simultaneous/ sequential) and of 319 MSC delivery (local/ systemic), or the kinetics of carcinogenesis may also affect the MSC-tumor 320 cell interaction [13, 14]. While the interactions of different MSCs with the cancer environment 321 have been well-documented in the literature, scarce are the studies concerning the contact 322 processes between the dental pulp stem cells (DPSCs) and cancer cells [24, 34]. In this study, 323 we investigated the capacity of DPSCs application from two points of view: their potential as 324 PTX delivery vector, as well as, their effect on cancer growth being one type of MSCs. An 325 overview of all our results is available in the appendix (summary table A1) that we discuss here 326 below.327

11 of 25

203

Our results from 2D and 3D direct co-cultures with cancer cells showed an anti-328 proliferative effect of DPSCs, whether loaded or not with PTX. This effect was dose- and time- 329 dependent and was far more prominent for DPSCsPTX. One advantage of 3D cultures, is that 330 cells can be cultured for long periods (weeks to months) without intervention, favoring for the 331 chronic exposure in toxicity studies [35]. It provides clinically relevant data, more 332 representative of the in-vivo condition and, in many instances, comparable with animal studies, 333 especially to study the treatment resistance. Cells of a 3D model form in more natural cell 334 shape, geometry, and morphology with better intra- and intercellular communication [35], 335 thus it could be highly relevant in cell-based therapy testing. This justifies the higher inhibitory 336 effect observed on spheroid size by both DPSC±PTX cells when injected in low ratios; the 337 enhanced DPSCs-MCF7 cell interactions in a 3D spatial arrangement is suggested for the better 338 exhibition of therapeutic effect and to overcome treatment resistance. 339 To decipher whether the inhibitory effect of DPSCs is mainly due to the DPSC secretome or the 340 direct contact between cells or both, paracrine signaling was studied. A moderate inhibition 341 from DPSCsPTX paracrine activity, while an increased cancer cell proliferation by that of 342 unloaded DPSCs was shown by transwell assay. This urged for further assessment of cell 343 viability kinetics under the influence of CM. We found that paracrine factors by DPSCs at the 344 early stage revealed an inhibition and pro-apoptotic effect on MCF7 cancer cells. This suggests 345 that the cells themselves play a dual role as pro- and anti- tumorigenic, and the overall DPSC-346 mediated effect may depend upon the balance of the secreted factors in the environment. 347 Accordingly, we proved that this altered effect is not due to the tumor stage of development. 348 The different DPSC paracrine functions at different stages on the 2-day 2D monolayer of MCF7 349 cells gives evidence that this is directly related to the overall balance of the DPSC secreted 350 factors, the supportive and inhibitive ones. This could be similarly suggested to explain the 351 also confirmed divergent effects in the direct/ indirect cancer cell co-cultures with DPSC. 352

In addition, we deduced that the tumor environment without direct cell contact, although 353 may have an influence [36], was not enough to inverse the effect of DPSC secretome on cancer 354 cells. This was well-confirmed by our minimal interacting co-culture models. For the transwell 355 test, delimitating membranes were used to prevent physical cell movement of DPSCs, while in 356 the dissemination assay, a localized geometry of the two cell types contributed to minimal 357 DPSC-MCF7 interaction. In both models, in-direct interaction was generated where the DPSC 358 cells were not in close vicinity to cancer cells. A predominated DPSCs’ paracrine activity, 359 involving the secreted factors and extracellular vesicles released at distance, was responsible 360 for the increase in cancer cell proliferation and dissemination. The trait observed under the 361 dissemination assay strongly correlates with the migration produced during metastasis [37-39]. 362 Consequently, DPSCsPTX even in least-interaction can totally attenuate the spheroid cell 363 dissemination and migration, as observed in the oncolytic effect associated with the PTX 364 release. 365

In a study of Zheng et al. (2016), opposite effects were found in the same breast cancer 366 model for co-injection compared to distant human bone marrow MSC injections [40]. Later, in 367

a study by Bajetto et al. (2017), human umbilical cord MSCs in direct co-culture with 368 glioblastoma cancer stem cells inhibited their proliferation, while the separately secreted MSC 369

factors have increased glioblastoma proliferation rate [30]. Successively, Rodini et al. 2018 370 performed a comparative secretome analysis and demonstrated changes in the proteomic 371 profiles of secretions from MSC single cultures versus MSC+cancer cells' direct 2D/ 3D co-372 cultures [29]. The interaction between MSCs and glioblastoma cells was capable of modulating 373 136 proteins, inducing particular secretome changes to correlate with the tumor [29]. This 374 confirms a sort of independence of the secretome function in direct cell-cell contact compared 375 to the indirect paracrine effect, as was partially evidenced also by other studies [41, 42]. Taken 376 together, our results suggest that the MSCs would play anti-tumorigenic anti-metastatic roles 377 in tumor development, dependent upon the balance of secreted molecules that can be378

12 of 25

204

influenced by time-related dynamics [31] as well as by contact-dependent interaction 379 with the tumor [29]. This is apparent by our results from the divergent DPSC paracrine 380 functions at early/ late stage on the same cancer cells, confirming the similar possibility of 381 secretome modulation in the direct interactive state. 382

The effect of longer DPSCs medium conditioning periods with and without direct co-383 culture on cancer cells, more than 7 days, may not necessarily follow linear kinetics. As our 384 findings suggest perpetual inhibition by DPSC in direct co-culture that is increased with time 385 (Fig. 3b), we propose that direct co-culture modulates the secretome toward retrieving the early 386 factors’ effect -having potent antitumor functions- rather than the late factors causing a pro-387 tumorigenic effect. Previously it was reported that tumor cell dissemination changes with 388 spatio-temporal variation of soluble molecules’ concentrations, such as growth factors or 389 cytokines [43]. We predict a likewise anti-migration anti-metastatic effect on cancer cells after 390 modulation of the secretome function, as confirmed by the observed anti-proliferation effect in 391 the case of predominated direct co-culture with DPSCs. 392

In our previous studies, we have reported that, without any direct contact, the secretome 393 (4-h CM) of DPSCsPTX has triggered cytotoxicity and pro-apoptotic state in MCF7 cells, by 394 released cytochrome-C following 3 hours incubation [12], while the direct 10 µM PTX was not 395 able to induce this effect [44]. The MCF7 uptake of the PTX-microvesicles was confirmed by 396 drug spectral tracing [12]. A current investigation of the unloaded DPSC-CM confirms that the 397 apoptotic inhibitory effect is predominantly due to the DPSCs secretome (Fig. S2) and 398 specifically extravesicles, with the released PTX being a minor factor in that small period. The 399 literature revealed that although MSCs loaded with PTX show a changed phenotype [45], the 400 ability to display their functions was maintained or might even be increased by PTX [46]. In a 401

study conducted by Cocce et al. (2019), only a small modulation of cytokine production was 402 observed for gingival papilla MSCs primed with PTX compared to the unloaded cells [5]. 403 Therefore, the priming of DPSCs with PTX has made them acquire an anti-proliferative effect 404 that is dose- and time- dependent, as proved by our tests. This is confirmed by our transwell 405 study performed on sensitive and PTX-resistant cell lines. 406

Qualitative-wise, more advanced analysis was led to decipher the long-effect of co-culture 407 on cells’ level. Fluorescence images evidenced nanotube structures as cellular protrusions 408 mainly contributed to the DPSC cells, and extracellular vesicles released in close vicinity to the 409 MCF7 cells. This suggests that the cytotoxic effect could be mainly provoked by the 410 components secreted from the vesicles. Extracellular vesicles (EVs), being the main component 411 of MSC secretome, play important roles in intercellular signaling and tissue repair in close or 412 distant target cells [47]. EVs can be incorporated into cancer cells leading to the transfer of MSCs 413 content [48] and contributing to cancer growth modification [49]. In addition, earlier studies 414 have revealed an important contribution of exosomal delivery in the MSC-cancer cell 415 communication [29], contributing to the therapeutic (proliferative or apoptotic) effects of the 416 MSCs [47, 50]. PTX secretion from loaded MSC was related also to their EVs [5, 51]. On the 417

other hand, Caicedo et al. (2015) have clearly described close cell-cell contact with an approved 418 “cell bridging” and metabolite transfer from MSC to breast cancer cells, at only 24h co-culture 419 [52]. This bridging mechanism by the formation of membrane extensions is also considered a 420 cellular mechanism of migration [43]. Several other direct and/or indirect mechanisms of 421 interaction contribute to MSC-mediated effect on cancer cell growth, which may include the 422 Notch signaling, nanotubes, gap-junctional communication, and/or the effect of 423 cyto/chemokines, extracellular vesicles and exosomes [20]. 424

Concerning the interaction of PTX and DPSCs leading to their potent action, previous 425 studies contributed with two main suggestions. It was previously confirmed that a small dose 426

of PTX chemotherapy causes notable alterations in MCF7 surface protein expression, in vitro 427

and in vivo, modifying the tumor phenotype to be more sensible to heterocell cytotoxicity [53], 428 hereby the DPSC inhibitory effect. Other studies have suggested that MSC-cancer cell contact 429

13 of 25

205

increases the local effects of the PTX released from MSC exosomes [51, 54]. 430 Interchangeable mechanisms may justify the substantial effect from DPSCsPTX as compared 431 to DPSCs alone cultures. A synergistic mechanism of two distinct agents with limited 432 therapeutic potential has been also reported in the literature, exhibiting a considerably higher 433 effect when appropriately combined [55, 56]. In a recent study, for example, the use of Wnt/-434 catenin inhibitor alone was not effective against breast cancer, while a combined approach 435 using a low PTX dose plus that antagonist exerted a comparable therapeutic effect on MCF-7 436 cell line relative to paclitaxel with a high dose [57]. Although not fully understood, it is 437 presumed also that the anti-tumor mechanisms of MSCs are attributed to paracrine signaling 438 inhibiting the Wnt proliferation-related pathway [58, 59]. A role of synergism with PTX is 439 suggested to regulate the molecular events leading to suppression of tumor growth, metastasis, 440 and angiogenesis in breast cancer [57]. Such understanding, or other molecular mechanisms, 441 can be proposed to explain the resulting cytotoxicity due to low ratios of “DPSCsPTX” 442 combination, that cannot be obtained by each of them alone. In clinical relevance, high 443 DPSCsPTX ratios are not needed to explicit huge cytotoxicity. 444

Our results including the pathologically- relevant resistant cancer spheroids confirm the 445 theory of synergism, with low doses of combined therapy having an equivalent effect of high 446 PTX concentration. These are a model for paclitaxel-resistance cells driven by a time-delayed 447

response, as confirmed by Merlin et al. [21]. This may indicate the need for higher time-448 accumulation of therapeutics, compared to the sensitive cells. A higher effect that surpasses 449 PTX monotherapy is thus expected at more than 7 days for these low doses, leading to 450 overcome drug resistance with high efficacy. Our treatment approach can aim for sparing high 451 chemotherapy doses and their related collateral side effects. An increase of PTX dose 452 administration causes the development of more resistant cancer phenotypes [60], causing high 453 treatment failures. Furthermore, higher doses of DPSCsPTX can induce a faster response, 454 without the need for chemotherapy doses, offering high importance in the clinical setting. 455

Finally, the particular advantage of MSCs over the use of drug-only treatment is their 456 capability to secrete different bioactive factors in response to their local environment, and this 457 flexibility bypasses several difficulties with drug dosing [61]. However, although drug-primed 458 DPSCs have always inhibited cancer cell proliferation, our findings largely confirmed that this 459 therapeutic efficacy is directly linked to their presence in close and in direct contact with the 460 cancer cells. The various spatio-geometrical direct/ indirect co-culture models with different 461 studied ratios have revealed the dependence of DPSCs interaction mechanisms (including 462 number and quality of contact) with cancer cells. Cancer cells aggregation in spheroidal 3D 463 structure, a model closer to the in-vivo condition, have proved more resistant to chemo-drug 464 cytotoxicity than 2D cell monolayer [62], closer to the in-vivo condition. In this regard, 465 cytotherapy using DPSCs has shown high efficacy on cancer when placed in comparison with 466 conventional drug chemotherapy. The therapeutic effect of low doses of unloaded DPSCs was 467 significant against 3D spheroids. Our findings stress also on the importance of paracrine effect 468 testing, in conjugation to direct co-cultures, to define the efficacy and the specific protocol for 469 cell-based delivery. It is also imperative to investigate the inhibition effect of unloaded MSCs, 470 as MSCsPTX usually fully/ partially recover their function within a period after drug release 471 [63, 64]. Hence, appropriate techniques must be appealed to develop a successful systemic cell 472 therapy [65]. Depending on our in-vitro findings, we propose DPSCsPTX administration by co-473 injection into the primary breast tumor mass, as opposed by distant injection, to effectively 474 employ the DPSCs therapeutic factors together with the drug cargo “vehicling” property. 475

4. Conclusions 476

Inspired by our previous promising results on the use of dental pulp MSCs as drug 477 delivery vector, our work investigates for the first time the interactions of these cells with breast 478

14 of 25

206

cancer cells and their potential application in combined cancer therapy. The current 479 results constitute the proof of principle for the efficacy of DPSCsPTX, that exceeded PTX 480 monotherapy, in inhibition of both 2D and 3D cancer cell cultures. Furthermore, DPSCsPTX 481 revealed an ability to overcome the extrinsic PTX resistance (induced by cancer cell spheroid 482 aggregation) in addition to the intrinsic PTX-resistant cancer phenotype. Results suggest that 483 both DPSCsPTX and DPSCsPTX-CM have always inhibited MCF7 cell proliferation as well as 484 dissemination/ metastasis, and may represent potential new therapies based on non-485 engineered drug-primed DPSCs. 486

Our findings suggest that DPSCsPTX would migrate in close proximity to the cancer cells. 487 The direct contact between the two cell types leads to the therapeutic recruitment of DPSCs, 488 including their EVs, inducing cancer growth inhibition. EVs aid cellular communications 489 between DPSCsPTX and cancer cells and carry a cargo that consists of released PTX and other 490 biological components. To get evidence, a secretome analysis of DPSCs±PTX in indirect/ direct 491 contact with MCF7 should be further performed. Anticancer drug-loaded DPSCs emerge as an 492 effective combined targeted cancer therapy and open the way for the delivery of other 493 therapeutic agents, including other drugs or nanoparticles [66]. This finding awaits for in-vivo 494 confirmation in order to demonstrate the efficacy of the treatment on tumor progression for 495 future application in advanced cell therapy. 496

5. Materials and Methods 497

5.1 Cell culture 498

Human wisdom teeth extracted for orthodontic reasons were recovered from healthy 499 patients (15-18 years old). Written informed consent was obtained from the parents of the 500 patients. This protocol was approved by the local ethical committee (Comité de Protection des 501 Personnes, Montpellier hospital, France). DPSCs were isolated and characterized as previously 502 described [12, 67]. DPSCs were cultured in αMEM (Modified Eagle’s Medium, Gibco) 503 supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich), 100 μg/mL penicillin and 504 streptomycin (PS, ThermoFisher), with the addition of 1 ng/mL bFGF (basic fibroblast growth 505 factor, R&D system) at 37°C and 5% CO2. DPSCs used for all experiments were obtained from 506 young female donors and were used between passages 2 and 8, to include for autograft 507 possibility to the breast cancer treatment. 508

The MCF7 (ATCC- HTB-22), derived from a metastatic breast cancer patient, is a standard 509 cell line model to use for cancer research [68]. Paclitaxel-resistant subline MCF7TAX19 (offered 510 from IRCM, Montpellier) was previously established [21] by the selection of a sub-population 511 under pressure of increasing chemotherapy, which afterwards was maintained in paclitaxel-512 free medium. MCF7TAX19 have 4-fold drug resistance compared to parental MCF7, but do not 513 express neither P-gp nor MDR1 mRNA [21]. MCF7 and MCF7TAX19 were both grown in DMEM 514 media (Dulbecco’s MEM, Gibco), containing 10% FBS and 1% PS. Accordingly, in direct co-515 culture experiments, the medium was changed gradually in two steps that, subsequently, the 516 cells were cultivated in αMEM. 517

5.2 Priming with paclitaxel 518

To prime MSCs, sub-confluent cultures of 1×105 DPSC/mL (or 6×105 cells/ 25 cm2 flask) 519 were exposed to 10µM of PTX (Taxol®, Teva Pharmaceutical Ind.) diluted in complete medium, 520 as for the clinical chosen dose. After 12h incubation time, the cells were washed twice with 521 phosphate buffered saline (PBS 1x) to remove non-internalized compound, then were 522 trypsinized for subsequent experiments. In another setting, fresh complete medium (10% FBS 523 and 1% PS) was added directly after PBS washing, and the cell conditioned media (DPSCsPTX-524

15 of 25

207

CM) was collected after 4 hours and tested for its in vitro anti-proliferative activity. For 525 positive control, MCF7 were incubated with dilution of 5 µM PTX (the Cmax value) wherever 526 needed. 527

5.3 Lentiviral transfection and sorting of DPSC and MCF7 cells 528

Viral transduction of cells is a well-established method to transduce them with fluorescent 529 proteins. Prior to lentiviral infection, the transduction conditions were optimized for each cell 530 line and each plasmid. In addition, a puromycin titration was performed to identify the 531 minimum concentration of puromycin that caused complete cell death after 3-5 days. Lentiviral 532 transduction of RFP-DPSCs and GFP-MCF7 was done based on manufacturer’s protocol 533 (Qiagen) (details in supplementary materials). For accuracy in quantification experiments, 534 Infected/ transduced cells were analyzed by FACS for the presence of fluorescence proteins 535 after the last infection cycle (supplementary materials). Afterwards, GFP/ RFP expression were 536 analyzed, and the purity of the subpopulations was confirmed by evaluating post-sort samples 537 in the sorter again, reaching a purity > 95%. 538

5.4 Direct 2D and 3D co-culture of DPSCs±PTX and MCF7 539

5.4.1 Direct co-culture of DPSCs±PTX and MCF7 in 2D model 540

In a first step, we aimed to inspect the influence of different mixing ratios of DPSCs±PTX 541 and MCF7 on their interaction. A co-culture system was applied by mixing 4000 tumor cells 542 with different amounts of DPSCs (8000 to 250 cells in 6 dilutions) in order to have final 543 DPSCs/MCF7 ratios of 1:16, 1:8, 1:4, 1:2, 1:1, 2:1. The cell proliferation assay was performed at 544 days 5 and 7 in 96 multi-well plates in three experimental conditions: (i) mixing MCF7 and 545 unloaded DPSCs; (ii) mixing MCF7 with DPSCsPTX; (iii) MCF7 alone (4000 cells/well) and 546 DPSCs±PTX alone at the above mentioned six different concentrations. After 5 and 7 days of 547 culture at 37°C, 5% CO2, cell proliferation was evaluated by Thiazolyl Blue Tetrazolium 548 Bromide assay (MTT, Euromedex) as previously described [12, 69]. 549

Tests of optical densities (OD) were standardized to their respective control (non-treated 550 MCF7 mixed with the respective number of DPSC) considered as 100%, to provide highly 551 indicative results on cancer cell proliferation. Each test and control were studied in triplicate 552 for at least two independent experiments. The cytotoxic effects of the treatment were described 553 in terms of growth inhibition percentage and expressed as R50/ R90 which is the ratio of co-554 culture which reduces the absorbance of treated cells by 50% and 90%, respectively, with 555 reference to the no treatment condition. Percent cancer cell growth inhibition of respective 556 control was calculated as follows: %Inhibition= 100 – [(OD of test – OD blank)/ (OD nontreated 557 – OD blank)] x100. 558

In a second step, we opted to assess the interaction of DPSCs±PTX and MCF7 depending 559 on the R90 ratio. For this aim, another model of co-culture was performed with fluorescent cells. 560 In 6-well plates mounted with glass slides, 1×105 MCF7 cells were seeded in 5 mL of complete 561 culture medium. At the same time, in each well respectively, we added: (i) 2×105 RFP-DPSCs, 562 (ii) 2×105 RFP-DPSCsPTX, or (iii) normal medium as a control condition. Live cell imaging and 563 counting of adherent cells, at day1 and day3, was performed using a Celigo cytometer 564 (Nexcelom Bioscience). The counts of GFP-MCF7 in each well were determined. Two 565 independent experiments of three triplicate wells per condition were performed. 566

5.4.2 Flow cytometry analysis 567

Cancer cells were co-cultured with DPSC with and without PTX for 1, 2, and 3 days, at the 568 determined R90 value (2 DPSC:1 MCF7): 1x106 DPSC ±PTX and 5x105 cancer cells in 10-cm petri 569

16 of 25

208

dishes (10mL solution). Cells were collected through trypsinization, fixed with 4% PFA, 570 and suspended with cold PBS. A single-cell suspension was prepared by filtering through a 40-571 μm cell strainer (Corning Falcon). GFP cells were detected by their intrinsic signals. The cell 572 suspensions were analyzed (at 4°C) using MACSQuant Analyzer10 flow cytometer (Miltenyi 573 Biotec). These results were graphed to depict the percentage of surviving cancer cells. 574 Suspensions of treated and control MCF7 cells were also analyzed for size assessment by using 575 forward and side light-scatter measurements. Cytograms were customized by FlowJoTM 576 software. 577

5.4.3 Direct co-culture of DPSCs±PTX and MCF7 in 3D model 578

Round-bottomed, 96-well ultra-low attachment spheroid microplates (Corning) were 579 used for spheroid formation. MCF7 or MCF7TAX19 cells were seeded at a density of 5×104 580 cells/mL by adding 200 µL/well. Cells aggregated and merged in 3D spheroids within 72 h, 581 where spheroid diameter reached an average of 600 µm. On day 4 after initial seeding, 582 treatments were directly added to spheroids in microwells, and proliferation was monitored 583 for an additional 3-5-7 days period. The co-culture was performed by mixing established cancer 584 spheroids with six different amounts (500-8000 cells) of RFP-labeled DPSCs ±PTX. For control 585 experiment complete medium or 5µM PTX was added to the wells. Experiments lasted for at 586 least 12 days after initial seeding. Half-volume of the culture medium was carefully changed 587 for spheroids maintenance every two days. Images of wells in four main conditions were 588 captured with Celigo™ imaging cytometer (Nexcelom, Bioscience). The main spherical body 589 was selected using always the same chosen analysis parameters at all the time-points, with 590 average diameters (long to short axis) being calculated. Diameters of spheroids were 591 represented as an indication of cancer cell proliferation in three dimensions. 592

5.4.4 Co-culture of DPSCs±PTX with reattached MCF7 spheroids: Tumor spheroid 593 dissemination assay 594

A 5×104 cells/mL dilution of MCF7 cells was prepared for hanging drop (HD) cultures. 595 Forty drops (20 µL volume) of cells were pipetted into the cover lids of each 10-cm dish, with 596 5 mL sterile PBS added into the petri dish, and the lid was carefully inverted. After 72h of 597 spheroid generation, compact spheroids (average diameter of 300 µm) were collected, using a 598 micropipette by carefully pooling media [70], and were then transferred to be cultured in flat-599 bottomed 6-well plates (Corning). Each petri dish created enough material for two independent 600 3D cultures (two wells). The spheroids in plates were allowed to disseminate until reaching an 601 overall diameter around 1-mm, by carefully changing medium every 3 days. 602

We use spheroid reattachment to model metastasis formation due to the adhesion of 603 spheroids to secondary sites. The established “primary” spheroids were allowed to reattach 604 and disperse on culture surface forming viable monolayer for an additional 12 days. On day 605 12, four study conditions were tested. An average dose of 1x105 DPSC±PTX, only medium, or 606 only PTX were added to reattached MCF7 spheroids in 6-well tissue culture plates, after which 607 spheroidal dissemination was monitored for an additional 3-5-7 days period. Images of 608 spheroids were taken on treatment days 0, 3, 5, and 7 using a phase-contrast microscope with 609 a 5x objective (Zeiss), and the cellular dissemination area (DA) was derived by measuring the 610 total cellular area and subtract it from the initial area at day 0. Measurements were derived 611 from average-axis diameters evaluated by ImageJ software (NIH, version 1.51a). Percent 612 attenuation of spheroid cell dissemination is defined as: %Dissemination attenuation= (test DA/ 613 nontreated DA) x100. The PTX-alone condition was maintained for the qualitative comparison 614 assessment. Two independent experiments with a minimum of three spheroids per condition 615 were analyzed.616

17 of 25

209

5.5 Indirect co-culture of DPSCs±PTX and MCF7 617

5.5.1 MCF7 culture in DPSCs±PTX conditioned medium 618

After 12h PTX priming or not, DPSC±PTX cells were washed twice with PBS. The medium 619 was replaced by a complete fresh medium without drug, and collected after 4 hours (time was 620 chosen according to previous results [12]). For extending the testing period, another CM was 621 tested after 48 hours of conditioning with unloaded DPSCs, giving longer time for the release 622 of cells’ secretome. This time, CM was prepared without serum to avoid any possible effect of 623 serum on MCF7 proliferation and was collected by centrifugation for 5 min at 1500 rpm and 624 centrifuged again for 3 min at 3000 rpm to remove cell debris. 625

The effect of CM from DPSC±PTX on cancer cell proliferation was studied in 96 multi-well 626 plates. Briefly, the CM (100% v/v) was added to 4000 MCF7 (4h and 48h CM), MCF7TAX19 (4h 627 CM only) per well, and cell viability/ proliferation was tested for up to 7 days of culture by 628 MTT assay. Data of both experiments were represented as cancer cell proliferation percentage 629 expressed as the ratio of the optical density of the treated wells (MCF7 treated with the CM) to 630 the optical density of control (un-treated MCF7), as previously formulated [12]. For verifying 631 the presence of apoptosis, the activity of apoptosis-related proteases (caspase 7) was examined. 632 MCF7 were incubated for three hours with the 4h-CM from DPSCs±PTX or normal medium, 633 then labeled with 7.5 μM CellEvent™ Caspase-3/7 Green detection reagent (Invitrogen) for 30 634 minutes at 37°C. 635

5.5.2 Transwell assay of indirect co-culture of DPSCs±PTX and MCF7 636

6000 MCF7 or MCF7TAX19 cells were seeded into 24 multi-well plates in a 600 µL culture 637 medium. RFP-DPSCs ±PTX were seeded (2000 cells in 100 µL culture medium) on transwell 638 inserts consisting of polyethylene terephthalate PET membrane (0.4 µm pore size; BD Falcon). 639 The co-culture ratio is 1 DPSC: 3 MCF7, chosen as the median of all the ratios tested for the 640 direct co-culture assay. The plates were incubated at 37 ⁰C under 5% CO2 in a humidified 641 environment. In control wells, tumor cells were cultured either alone or in the presence of drug. 642 PTX at 5 µM was added after 6h to adherent culture. After 5 days, the wells were transferred 643 to the Celigo cytometer (Nexcelom Bioscience) for live-cell imaging and counting. On an 644 independent experiment, the same test was performed after 7 days by MTT assay for MCF7/ 645 MCF7TAX19 relative count, as described earlier. 646

5.6 Fluorescence imaging, processing, and analysis 647

For fluorescence imaging, cells were grown on tissue culture glass coverslips, washed 648 with cold PBS and fixed with 4% PFA for 15 mins at 4°C, then stained with DAPI 4′,6-649 diamidino-2-phenylindole 1μg/mL (Sigma-Aldrich) to visualize nuclei at several time-points 650 during the 2D co-culture period, or to visualize the nuclei of negative cells in the MCF7 caspase 651 apoptosis assay. The glass coverslips were mounted with Fluoromount-G mounting medium 652 (Invitrogen). The fluorescent samples were observed with an inverted epi-fluorescence 653 microscope (Nikon TE2000-E) with blue (ex 340/80, em 450), green (ex 465/95, em 515/55) and 654 red (ex 540/80, em 600/60) filter sets. 655

High magnification images were taken through an inverted confocal microscope (Zeiss 656 LSM780) with Hoechst, GFP, and CY3 filter sets. Image processing was done using Zen 2.5 657 (blue edition, Zeiss, 2018) software. Settings were standardized for all images. For Celigo live 658 imaging, whole images of wells were taken under LED- fluorescence excitation: green filter (ex 659 483/32, em 536/40) and a red filter (ex 531/40, em 629/53). Representative images for transwell 660 and 3D fluorescence experiments were taken. Image scans were obtained using the “Target” or 661

18 of 25

210

“Tumorosphere” application and analyzed by Celigo® Software (version 3.0) for size 662 measurement and cell quantification 663

5.7 Statistical analysis 664

Experiments described above were all performed as two or three independent 665 experiments, and are presented as the mean ± standard deviation of triplicate cultures from 666 one representative experiment unless mentioned otherwise. Statistical analyses were 667 performed using the SigmaPlot (Systat software, version 11.0), with the least significant 668 difference correction for one-way analysis of variance (ANOVA) for multiple comparisons, and 669 student t-test for two-value comparisons. When applied, differences between groups were 670 evaluated with the Benferroni test. For all experiments, statistically significant values were 671 defined as p<0.05. For experiments concerning spheroids, some exclusion criteria were applied. 672 Generally, SD values -in the same condition- rounded to 50 µm were the maximum selected 673 (very different spheroids were excluded), and incorrect software thresholding that cannot be 674 manually corrected were excluded for the reason of software error. Paired and unpaired t-tests 675 were used to evaluate growth change for the control and test groups, respectively. One-way 676 ANOVA followed by a t-test was used for time- and dose- relation evaluation. 677

Supplementary Materials: The following are available online at www.mdpi.com/xxx/s1, Detailed 678 method S1: Lentiviral transfection and sorting of DPSC and MCF7 cells. Figure S1: Effect of direct 2D co-679 culture of DPSCsPTX and MCF7 for 5 and 7 days. Figure S2: Effect of indirect co-culture of DPSCs±PTX 680 and MCF7. Figure S3: Apoptosis detection in MCF7 cells incubated for only 3 hours with the short-term 681 (4-h) DPSC± conditioned medium. Figure S4: Effect of indirect co-culture of DPSCs±PTX and 682 MCF7TAX19. Figure S5: Effect of the inhibitive DPSC±PTX -CM on paclitaxel-resistant cancer cells. 683

Author Contributions: Conceptualization, F.C. and S.A.; data curation, S.A.; formal analysis, S.A. and 684 B.C.; investigation, S.A. and B.C.; methodology, S.A. and O.P.; project administration, H.S. and F.C.; 685 resources, V.O.; supervision, H.S.; validation, S.A., C.G. and O.P.; visualization, S.A. and B.C.; writing- 686 original draft preparation, S.A.; writing- review and editing, B.C., O.P. and C.G. All authors have read 687 and agreed to the published version of the manuscript. 688

Funding: This research received no external funding. 689

Acknowledgments: The authors acknowledge the imaging facility MRI, member of the national 690 infrastructure France-BioImaging infrastructure supported by the French National Research Agency 691 (ANR-10-INBS-04, «Investments for the Future»). The authors thank Dr. Peter Coopman (Institute of 692 Research in Cancer of Montpellier, IRCM) for providing the resistant MCF7 subline. The authors thank 693 Dr. Bela Varga and Elodie Middendorp for guidance in transduction and fluorescence studies. Dr. Siham 694 Al-Arag thanks the University of Jordan and Campus France and for her Ph.D. grants. 695

Ethical Statement: For primary DPSCs, human wisdom teeth extracted for orthodontic reasons were 696 recovered from healthy patients (15-18 years old). Written informed consent was obtained from the 697 parents of the patients. This protocol was approved by the local ethical committee (Comité de Protection 698 des Personnes, Montpellier hospital, France). The MCF7TAX19 was obtained from Dr. Peter Coopman 699 (IRCM, Montpellier). 700

Conflicts of Interest: The authors declare no conflict of interest. 701

702

References 703

1. Nawab K, Bhere D, Bommarito A, Mufti M, Naeem A. Stem cell therapies: A 704

way to promising cures. Cureus. 2019;11(9).705

19 of 25

211

2. Stanko P, Kaiserova K, Altanerova V, Altaner C. Comparison of human 706

mesenchymal stem cells derived from dental pulp, bone marrow, adipose tissue, and 707

umbilical cord tissue by gene expression. Biomed Pap Med Fac Univ Palacky Olomouc 708

Czech Repub. 2014;158(3):373-7. 709

3. Isobe Y, Koyama N, Nakao K, Osawa K, Ikeno M, Yamanaka S, et al. 710

Comparison of human mesenchymal stem cells derived from bone marrow, synovial 711

fluid, adult dental pulp, and exfoliated deciduous tooth pulp. International journal of 712

oral and maxillofacial surgery. 2016;45(1):124-31. 713

4. Jin Q, Yuan K, Lin W, Niu C, Ma R, Huang Z. Comparative characterization of 714

mesenchymal stem cells from human dental pulp and adipose tissue for bone 715

regeneration potential. Artificial cells, nanomedicine, and biotechnology. 716

2019;47(1):1577-84. 717

5. Coccè V, Franzè S, Brini AT, Giannì AB, Pascucci L, Ciusani E, et al. In vitro 718

Anticancer Activity of Extracellular Vesicles (EVs) Secreted by Gingival 719

Mesenchymal Stromal Cells Primed with Paclitaxel. Pharmaceutics. 2019;11(2):61. 720

6. Jose WM. Taxanes–The backbone of medical oncology. Indian Journal of 721

Medical and Paediatric Oncology. 2020;41(2):221. 722

7. Abu Samaan TM, Samec M, Liskova A, Kubatka P, Büsselberg D. Paclitaxel’s 723

Mechanistic and Clinical Effects on Breast Cancer. Biomolecules. 2019;9(12):789. 724

8. Ichikawa Y OR, Haruyama T, et al. Carcinoma of Unknown Primary Site: A 725

Mini-Review on Chemotherapy and the Expectation for Treatment with Nab-Paclitaxel 726

Plus Carboplatin. Japan Journal of Medicine. 2019;2(3):375 - 727

81.10.31488/jjm.1000145. 728

9. Lv C, Qu H, Zhu W, Xu K, Xu A, Jia B, et al. Low-dose paclitaxel inhibits 729

tumor cell growth by regulating glutaminolysis in colorectal carcinoma cells. Frontiers 730

in pharmacology. 2017;8:244. 731

10. Stage TB, Bergmann TK, Kroetz DL. Clinical pharmacokinetics of paclitaxel 732

monotherapy: an updated literature review. Clinical pharmacokinetics. 2018;57(1):7-733

19. 734

11. Salehi H, Derely L, Vegh A-G, Durand J-C, Gergely C, Larroque C, et al. Label-735

free detection of anticancer drug paclitaxel in living cells by confocal Raman 736

microscopy. Applied Physics Letters. 2013;102(11):113701.737

20 of 25

212

12. Salehi H, Al-Arag S, Middendorp E, Gergely C, Cuisinier F, Orti V. Dental pulp 738

stem cells used to deliver the anticancer drug paclitaxel. Stem cell research & therapy. 739

2018;9(1):1-10. 740

13. Gomes E, de Castro JV, Costa B, Salgado A. The impact of Mesenchymal Stem 741

Cells and their secretome as a treatment for gliomas. Biochimie. 2018;155:59-66. 742

14. Stamatopoulos A, Stamatopoulos T, Gamie Z, Kenanidis E, Ribeiro RDC, 743

Rankin KS, et al. Mesenchymal stromal cells for bone sarcoma treatment: Roadmap to 744

clinical practice. Journal of bone oncology. 2019:100231. 745

15. Ridge SM, Sullivan FJ, Glynn SA. Mesenchymal stem cells: key players in 746

cancer progression. Molecular cancer. 2017;16(1):31. 747

16. Edmondson R, Broglie JJ, Adcock AF, Yang L. Three-dimensional cell culture 748

systems and their applications in drug discovery and cell-based biosensors. Assay and 749

drug development technologies. 2014;12(4):207-18. 750

17. Ding Y, Liu W, Yu W, Lu S, Liu M, Kaplan DL, et al. Three‐dimensional tissue 751

culture model of human breast cancer for the evaluation of multidrug resistance. Journal 752

of Tissue Engineering and Regenerative Medicine. 2018;12(9):1959-71. 753

18. Brandt J, Garne JP, Tengrup I, Manjer J. Age at diagnosis in relation to survival 754

following breast cancer: a cohort study. World journal of surgical oncology. 755

2015;13(1):33. 756

19. Partridge AH, Hughes ME, Warner ET, Ottesen RA, Wong Y-N, Edge SB, et 757

al. Subtype-dependent relationship between young age at diagnosis and breast cancer 758

survival. Journal of Clinical Oncology. 2016;34(27):3308-14. 759

20. Melzer C, Yang Y, Hass R. Interaction of MSC with tumor cells. Cell 760

Communication and Signaling. 2016;14(1):20. 761

21. Merlin J-L, Bour-Dill C, Marchal S, Bastien L, Gramain M-P. Resistance to 762

paclitaxel induces time-delayed multinucleation and DNA fragmentation into large 763

fragments in MCF-7 human breast adenocarcinoma cells. Anti-cancer drugs. 764

2000;11(4):295-302. 765

22. Shah K. Mesenchymal stem cells engineered for cancer therapy. Advanced drug 766

delivery reviews. 2012;64(8):739-48. 767

23. Wang Q, Cheng H, Peng H, Zhou H, Li PY, Langer R. Non-genetic engineering 768

of cells for drug delivery and cell-based therapy. Advanced drug delivery reviews. 769

2015;91:125-40.770

21 of 25

213

24. Doğan A, Demirci S, Apdik H, Apdik EA, Şahin F. Mesenchymal Stem Cell 771

Isolation from Pulp Tissue and Co-Culture with Cancer Cells to Study Their 772

Interactions. JoVE (Journal of Visualized Experiments). 2019(143):e58825. 773

25. Zhang T, Lee YW, Rui YF, Cheng TY, Jiang XH, Li G. Bone marrow-derived 774

mesenchymal stem cells promote growth and angiogenesis of breast and prostate 775

tumors. Stem cell research & therapy. 2013;4(3):70. 776

26. Sasser AK, Mundy BL, Smith KM, Studebaker AW, Axel AE, Haidet AM, et 777

al. Human bone marrow stromal cells enhance breast cancer cell growth rates in a cell 778

line-dependent manner when evaluated in 3D tumor environments. Cancer letters. 779

2007;254(2):255-64. 780

27. Akimoto K, Kimura K, Nagano M, Takano S, To'a Salazar G, Yamashita T, et 781

al. Umbilical cord blood-derived mesenchymal stem cells inhibit, but adipose tissue-782

derived mesenchymal stem cells promote, glioblastoma multiforme proliferation. Stem 783

cells and development. 2013;22(9):1370-86. 784

28. Pasanen I, Pietilä M, Lehtonen S, Lehtilahti E, Hakkarainen T, Sequeiros RB, 785

et al. Mesenchymal stromal cells from female donors enhance breast cancer cell 786

proliferation in vitro. Oncology. 2015;88(4):214-25. 787

29. Rodini CO, da Silva PBG, Assoni AF, Carvalho VM, Okamoto OK. 788

Mesenchymal stem cells enhance tumorigenic properties of human glioblastoma 789

through independent cell-cell communication mechanisms. Oncotarget. 790

2018;9(37):24766. 791

30. Bajetto A, Pattarozzi A, Corsaro A, Barbieri F, Daga A, Bosio A, et al. Different 792

effects of human umbilical cord mesenchymal stem cells on glioblastoma stem cells by 793

direct cell interaction or via released soluble factors. Frontiers in Cellular Neuroscience. 794

2017;11:312. 795

31. Clarke MR, Imhoff FM, Baird SK. Mesenchymal stem cells inhibit breast 796

cancer cell migration and invasion through secretion of tissue inhibitor of 797

metalloproteinase‐1 and‐2. Molecular carcinogenesis. 2015;54(10):1214-9. 798

32. He N, Kong Y, Lei X, Liu Y, Wang J, Xu C, et al. MSCs inhibit tumor 799

progression and enhance radiosensitivity of breast cancer cells by down-regulating 800

Stat3 signaling pathway. Cell death & disease. 2018;9(10):1-14. 801

33. Kostadinova M, Antonov B, Kinov P, Oreshkova T, Mourdjeva M. 802

Mesenchymal stem cells inhibit the growth of prostate carcinoma cells in a long-term 803

cultivation. Biotechnology & Biotechnological Equipment. 2020;34(1):354-60.804

22 of 25

214

34. Hanyu S, Sakuma K, Tanaka A. A Study on the Effect of Human Dental Pulp 805

Stem Cell Conditioned Medium on Human Oral Squamous Cell Carcinoma Cell Lines. 806

Journal of Hard Tissue Biology. 2019;28(3):281-8. 807

35. Calitz C, Hamman JH, Fey SJ, Wrzesinski K, Gouws C. Recent advances in 808

three-dimensional cell culturing to assess liver function and dysfunction: from a drug 809

biotransformation and toxicity perspective. Toxicology mechanisms and methods. 810

2018;28(5):369-85. 811

36. Park K-S, Bandeira E, Shelke GV, Lässer C, Lötvall J. Enhancement of 812

therapeutic potential of mesenchymal stem cell-derived extracellular vesicles. Stem cell 813

research & therapy. 2019;10(1):288. 814

37. Kuo C-T, Wang J-Y, Lin Y-F, Wo AM, Chen BP, Lee H. Three-dimensional 815

spheroid culture targeting versatile tissue bioassays using a PDMS-based hanging drop 816

array. Scientific reports. 2017;7(1):1-10. 817

38. Kuo C-T, Liu H-K, Huang G-S, Chang C-H, Chen C-L, Chen K-C, et al. A 818

spatiotemporally defined in vitro microenvironment for controllable signal delivery and 819

drug screening. Analyst. 2014;139(19):4846-54. 820

39. Boussommier-Calleja A, Li R, Chen MB, Wong SC, Kamm RD. Microfluidics: 821

a new tool for modeling cancer–immune interactions. Trends in cancer. 2016;2(1):6-822

19. 823

40. Zheng H, Zou W, Shen J, Xu L, Wang S, Fu Y-X, et al. Opposite effects of 824

coinjection and distant injection of mesenchymal stem cells on breast tumor cell 825

growth. Stem cells translational medicine. 2016;5(9):1216-28. 826

41. Arrigoni C, De Luca P, Gilardi M, Previdi S, Broggini M, Moretti M. Direct but 827

not indirect co-culture with osteogenically differentiated human bone marrow stromal 828

cells increases RANKL/OPG ratio in human breast cancer cells generating bone 829

metastases. Molecular cancer. 2014;13(1):238. 830

42. Yang Y, Otte A, Hass R. Human mesenchymal stroma/stem cells exchange 831

membrane proteins and alter functionality during interaction with different tumor cell 832

lines. Stem cells and development. 2015;24(10):1205-22. 833

43. Gagliardi PA, Puliafito A, Di Blasio L, Chianale F, Somale D, Seano G, et al. 834

Real-time monitoring of cell protrusion dynamics by impedance responses. Scientific 835

reports. 2015;5:10206. 836

44. Salehi H, Middendorp E, Panayotov I, Dutilleul P-YC, Vegh A-G, 837

Ramakrishnan SK, et al. Confocal Raman data analysis enables identifying apoptosis 838

23 of 25

215

of MCF-7 cells caused by anticancer drug paclitaxel. Journal of biomedical optics. 839

2013;18(5):056010. 840

45. Bosco DB, Kenworthy R, Zorio DA, Sang Q-XA. Human mesenchymal stem 841

cells are resistant to Paclitaxel by adopting a non-proliferative fibroblastic state. PloS 842

one. 2015;10(6). 843

46. Conforti A, Biagini S, Starc N, Proia A, Pessina A, Alessandri G, et al. Human 844

mesenchymal stromal cells primed with paclitaxel, apart from displaying anti-tumor 845

activity, maintain their immune regulatory functions in vitro. Cytotherapy. 846

2014;16(6):868-70. 847

47. Casado S, Lobo MdVT, Paíno CL. Dynamics of plasma membrane surface 848

related to the release of extracellular vesicles by mesenchymal stem cells in culture. 849

Scientific reports. 2017;7(1):1-9. 850

48. Alcaraz MJ, Compañ A, Guillén MI. Extracellular Vesicles from Mesenchymal 851

Stem Cells as Novel Treatments for Musculoskeletal Diseases. Cells. 2020;9(1):98. 852

49. Van Niel G, d'Angelo G, Raposo G. Shedding light on the cell biology of 853

extracellular vesicles. Nature reviews Molecular cell biology. 2018;19(4):213. 854

50. Del Fattore A, Luciano R, Saracino R, Battafarano G, Rizzo C, Pascucci L, et 855

al. Differential effects of extracellular vesicles secreted by mesenchymal stem cells 856

from different sources on glioblastoma cells. Expert opinion on biological therapy. 857

2015;15(4):495-504. 858

51. Pascucci L, Coccè V, Bonomi A, Ami D, Ceccarelli P, Ciusani E, et al. 859

Paclitaxel is incorporated by mesenchymal stromal cells and released in exosomes that 860

inhibit in vitro tumor growth: a new approach for drug delivery. Journal of Controlled 861

Release. 2014;192:262-70. 862

52. Caicedo A, Fritz V, Brondello J-M, Ayala M, Dennemont I, Abdellaoui N, et 863

al. MitoCeption as a new tool to assess the effects of mesenchymal stem/stromal cell 864

mitochondria on cancer cell metabolism and function. Scientific reports. 2015;5:9073. 865

53. Hodge JW, Garnett CT, Farsaci B, Palena C, Tsang KY, Ferrone S, et al. 866

Chemotherapy‐induced immunogenic modulation of tumor cells enhances killing by 867

cytotoxic T lymphocytes and is distinct from immunogenic cell death. International 868

journal of cancer. 2013;133(3):624-36. 869

54. Bonomi A, Ghezzi E, Pascucci L, Aralla M, Ceserani V, Pettinari L, et al. Effect 870

of canine mesenchymal stromal cells loaded with paclitaxel on growth of canine glioma 871

and human glioblastoma cell lines. The Veterinary Journal. 2017;223:41-7.872

24 of 25

216

55. Seyhoun I, Saieh Hajighasemlou JA, Hosseinzadeh F, Mirmoghtadaei M, 873

Seyhoun SM, Parseh B, et al. Novel Combination of Mesenchymal Stem Cell-874

Conditioned Medium with Sorafenib Have Synergistic Antitumor Effect of 875

Hepatocellular Carcinoma Cells. Asian Pacific Journal of Cancer Prevention: APJCP. 876

2019;20(1):263. 877

56. Galluzzi L, Buque A, Kepp O, Zitvogel L, Kroemer G. Immunological effects 878

of conventional chemotherapy and targeted anticancer agents. Cancer cell. 879

2015;28(6):690-714. 880

57. Shetti D, Zhang B, Fan C, Mo C, Lee BH, Wei K. Low dose of paclitaxel 881

combined with XAV939 attenuates metastasis, angiogenesis and growth in breast 882

cancer by suppressing Wnt signaling. Cells. 2019;8(8):892. 883

58. Wu N, Zhang Y-L, Wang H-T, Li D-W, Dai H-J, Zhang Q-Q, et al. 884

Overexpression of hepatocyte nuclear factor 4α in human mesenchymal stem cells 885

suppresses hepatocellular carcinoma development through Wnt/β-catenin signaling 886

pathway downregulation. Cancer biology & therapy. 2016;17(5):558-65. 887

59. Qiao L, Xu Z-l, Zhao T-j, Ye L-h, Zhang X-d. Dkk-1 secreted by mesenchymal 888

stem cells inhibits growth of breast cancer cells via depression of Wnt signalling. 889

Cancer letters. 2008;269(1):67-77. 890

60. Tsou S-H, Chen T-M, Hsiao H-T, Chen Y-H. A critical dose of doxorubicin is 891

required to alter the gene expression profiles in MCF-7 cells acquiring multidrug 892

resistance. PloS one. 2015;10(1):e0116747. 893

61. Murphy MB, Moncivais K, Caplan AI. Mesenchymal stem cells: 894

environmentally responsive therapeutics for regenerative medicine. Experimental & 895

molecular medicine. 2013;45(11):e54-e. 896

62. Souza AG, Silva IBB, Campos-Fernandez E, Barcelos LS, Souza JB, 897

Marangoni K, et al. Comparative assay of 2D and 3D cell culture models: Proliferation, 898

gene expression and anticancer drug response. Current pharmaceutical design. 899

2018;24(15):1689-94. 900

63. Harris WM, Zhang P, Plastini M, Ortiz T, Kappy N, Benites J, et al. Evaluation 901

of function and recovery of adipose-derived stem cells after exposure to paclitaxel. 902

Cytotherapy. 2017;19(2):211-21. 903

64. Liang W, Xia H, Li J, Zhao RC. Human adipose tissue derived mesenchymal 904

stem cells are resistant to several chemotherapeutic agents. Cytotechnology. 905

2011;63(5):523.906

25 of 25

217

65. Nitzsche F, Müller C, Lukomska B, Jolkkonen J, Deten A, Boltze J. Concise 907

review: MSC adhesion cascade—insights into homing and transendothelial migration. 908

Stem Cells. 2017;35(6):1446-60. 909

66. Gulka M, Salehi H, Varga B, Middendorp E, Pall O, Raabova H, et al. 910

Simultaneous label-free live imaging of cell nucleus and luminescent nanodiamonds. 911

Scientific reports. 2020;10(1):1-9. 912

67. Collart-Dutilleul P-Y, Secret E, Panayotov I, Deville de Périère D, Martín-913

Palma RlJ, Torres-Costa V, et al. Adhesion and proliferation of human mesenchymal 914

stem cells from dental pulp on porous silicon scaffolds. ACS applied materials & 915

interfaces. 2014;6(3):1719-28. 916

68. Levenson AS, Jordan VC. MCF-7: the first hormone-responsive breast cancer 917

cell line. Cancer research. 1997;57(15):3071-8. 918

69. Mosmann T. Rapid colorimetric assay for cellular growth and survival: 919

application to proliferation and cytotoxicity assays. Journal of immunological methods. 920

1983;65(1-2):55-63. 921

70. Foty R. A simple hanging drop cell culture protocol for generation of 3D 922

spheroids. JoVE (Journal of Visualized Experiments). 2011(51):e2720.923

Batoul CHOUAIB, 2020. Thèse de doctorat de l’Université de Montpellier - Laboratoire de

Bioingénierie et Nanosciences LBN.

Milieux conditionnés de cellules souches pulpaires dentaires pour la régénération tissulaire.

Le sécrétome des cellules souches mésenchymateuses ou milieu conditionné (MSC-CM), est une

combinaison de biomolécules et de facteurs de croissance sécrétés par les cellules souches

mésenchymateuses (MSCs) dans un milieu de croissance cellulaire. Les MSC-CM apparaissent

comme une alternative efficace à la thérapie cellulaire pour les applications de régénération tissulaire.

Cependant, plusieurs questions telles que les protocoles de fabrication doivent être abordées avant

l'application clinique de ces produits prometteurs. Dans cette thèse, nous nous sommes concentrés sur

les cellules souches de la pulpe dentaire humaine (DPSCs). Après avoir évalué l'impact de plusieurs

paramètres de fabrication sur les sécrétomes des DPSCs, nous avons étudié les potentiels des DPSC-

CM pour la croissance neuronale, la régénération osseuse, l'angiogenèse et la thérapie contre le cancer.

Ensemble, nos travaux ont permis d'identifier des conditions de culture standardisées fournissant des

DPSC-CM riches en facteurs, et ont indiqué des pistes prometteuses pour l'application des DPSC-CM,

afin de favoriser la régénération neuronale et la réparation des tissus osseux. Cette thèse contribue aux

contrôles qualitatifs et quantitatifs des produits dérivés des DPSC-CM nécessaires à leur production

selon les bonnes pratiques de fabrication, et à leur développement clinique en médecine régénérative.

Mots clés : Cellules souches pulpaires dentaires, milieux conditionnés, régenération tissulaire.

Dental pulp stem cell-conditioned medium for tissue regeneration.

Mesenchymal stem cell secretome or conditioned medium (MSC-CM), is a combination of

biomolecules and growth factors secreted by mesenchymal stem cells (MSCs) in cell growth medium.

MSC-CM emerge as an effective alternative to cell therapy for tissue regeneration applications.

However, several issues such as manufacturing protocols must be addressed before the clinical

application of these promising products. In this thesis, we focused on human dental pulp stem cells

(DPSCs). After evaluating the impact of several manufacturing parameters on DPSC secretomes, we

investigated DPSC-CM potentials for neuronal growth, bone regeneration, angiogenesis, and cancer

therapy. Importantly, our work allowed to identify standardized culture conditions providing factor-

rich DPSC-CM, and pointed towards promising avenues for the application of DPSC-CM to aide

neuronal regeneration, and bone tissue repair. This thesis contributes to the qualitative and quantitative

controls of DPSC-CM derived products necessary for their GMP-grade production, and their clinical

translation in regenerative medicine.

Key words: Dental pulp stem cells, conditioned medium, tissue regeneration.

Dental pulp stem cell-conditioned medium for tissue ...

Documents