Deciphering the Molecular Events Necessary for Synergistic ...€¦ · Bim, Bik, Bmf, Noxa, Puma, Hrk, Bad); and (iii) multidomain proapoptotic proteins (Bax, Bak, Bok; ref. 13).

Therapeutics, Targets, and Chemical Biology

Deciphering the Molecular Events Necessary for SynergisticTumor Cell Apoptosis Mediated by the Histone DeacetylaseInhibitor Vorinostat and the BH3 Mimetic ABT-737

Adrian P. Wiegmans1,2, Amber E. Alsop1, Michael Bots1, Leonie A. Cluse1, Steven P. Williams1, Kellie-Marie Banks1,Rachael Ralli1, Clare L. Scott3, Anna Frenzel4, Andreas Villunger5, and Ricky W. Johnstone1,2

AbstractThe concept of personalized anticancer therapy is based on the use of targeted therapeutics through in-depth

knowledge of the molecular mechanisms of action of these agents when used alone and in combination. We haveidentified the apoptotic proteins and pathways necessary for synergistic tumor cell apoptosis and in vivoantitumor responses seen when the HDAC inhibitor vorinostat is combined with the BH3-mimetic ABT-737 inlymphomas overexpressing Bcl-2. Vorinostat "primes" tumors overexpressing Bcl-2 for rapid ABT-737–mediatedapoptosis by inducing expression of the BH3-only gene bmf. Moreover, these synergistic effects of vorinostat/ABT-737 were blunted in cells with an inactive p53 pathway or in cells lacking expression of the p53 target gene,noxa. These studies show the important and complex functional interaction between specific proapoptotic BH3-only proteins and the BH3-mimetic compound ABT-737 and provide the most comprehensive functional linkbetween tumor genotype and the apoptotic and therapeutic effects of HDACi combined with ABT-737. CancerRes; 71(10); 3603–15. �2011 AACR.

Introduction

Histone deacetylase inhibitors (HDACi) can induce tumorcell apoptosis, inhibit cell proliferation by blocking progres-sion through the G1/S or G2/M cell cycle checkpoints, inducecellular differentiation, suppress angiogenesis, and modulateantitumor immunity (1). Using genetic mouse models ofcancer, we and others have showed that direct tumor cellkilling by these agents is essential for their antitumorresponses in vivo (2, 3). Some studies have indicated thatapoptosis mediated by HDACi proceeds through the extrinsic(death receptor) pathway following transcriptional upregula-tion of tumor necrosis factor superfamily ligands and/orreceptors (2, 4–7). However, in the majority of cases includingall studies that we have performed, activation of the intrinsic

(mitochondrial) apoptosis pathway plays a fundamental rolein mediating HDACi-induced cell death (3, 8–12).

The intrinsic apoptosis pathway is regulated by pro- andantiapoptotic Bcl-2 family proteins that consists of 3 majorsubgroups: (i) multidomain prosurvival proteins (Bcl-2, Bcl-xL,Bcl-w, Mcl-1, A1); (ii) BH3-only proapoptotic proteins (Bid,Bim, Bik, Bmf, Noxa, Puma, Hrk, Bad); and (iii) multidomainproapoptotic proteins (Bax, Bak, Bok; ref. 13). ABT-737 is aBH3 mimetic compound developed to specifically inhibit theactivity of prosurvival Bcl-2 family proteins (14). Using com-petitive fluorescence polarization assays and recombinantBcl-2 family proteins, ABT-737 was shown to bind withrelatively high affinity to Bcl-2, Bcl-xL, and Bcl-w and to havemuch lower capacity to bind to and inhibit Mcl-1 and A1 (14).Our subsequent cell-based assays confirmed that ABT-737 wasa potent inhibitor of Bcl-2 and Bcl-xL, and a poor inhibiter ofMcl-1 and A1, but surprisingly was only a weak inhibitor ofoverexpressed Bcl-w in Eu-myc lymphoma cells (15).

Although HDACi show great promise as cancer therapeu-tics, given their diverse molecular and biological antitumoractivities and their manageable clinical side effects, theseagents may be best utilized in the clinic in combination withexisting chemotherapeutics or with novel small molecule orbiological agents in a targeted manner (16). We previouslyshowed that overexpression of prosurvival Bcl-2 proteinsinhibits the apoptotic and therapeutic activities of HDACi(3, 17) and combination treatment with ABT-737 restored theefficacy of HDACi against tumors overexpressing Bcl-2 andBcl-xL (15). Although these studies clearly established thatcombining HDACi and ABT-737 resulted in more potentantitumor activities in vitro and in vivo, the molecular events

Authors' Affiliations: 1Gene Regulation Laboratory, Cancer TherapeuticsProgram, The Peter MacCallum Cancer Institute, East Melbourne, Victoria,Australia; 2University of Melbourne; 3Walter and Eliza Hall Institute, Park-ville, Victoria, Australia; 4Department of Microbiology, Tumor and CellBiology, Karolinska Institute, Stockholm, Sweden; and 5Division ofDevelopmental Immunology, Biocenter, Innsbruck Medical University,Innsbruck, Austria

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: Ricky Johnstone, Gene Regulation Laboratory,Cancer Therapeutics Program, The Peter MacCallum CancerInstitute, St. Andrews Place, East Melbourne 3002 Victoria, Australia.Phone: þ61-3-9656-3727; Fax: þ61-3-9656-1411;E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-10-3289

�2011 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 3603

Research. on February 2, 2021. © 2011 American Association for Cancercancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 11, 2011; DOI: 10.1158/0008-5472.CAN-10-3289

http://cancerres.aacrjournals.org/

necessary for synergistic tumor cell apoptosis mediated by thecombination treatment had not been elucidated.

Herein we show that the HDACi, vorinostat, "primes" tumorcells overexpressing Bcl-2 for rapid apoptosis following treat-ment with ABT-737 by inducing expression of certain BH3-onlygenes.We determined that upregulation of bmf, but not bim, byvorinostat was functionally critical to prime cells for apoptosismediated by ABT-737 in vitro and in vivo. Highly expressed Bmfwas bound by Bcl-2 at baseline, however, the addition of ABT-737, which avidly binds to Bcl-2, resulted in release of Bmf fromBcl-2, allowing subsequent interaction betweenBmf andMcl-1.Synergistic apoptosis induced by vorinostat and ABT-737 wassuppressed in cellswithmutated p53, although the induction ofBH3-only genes by vorinostat in the absence of a functional p53pathway was unaffected. The functional importance of Bmfand p53 inmediating a robust response to vorinostat and ABT-737 was shown in cells with knockout or knockdown of bmfandmutated p53 that displayed a severely attenuated responseto the vorinostat/ABT-737 combination.We showed that basalexpression of the p53 target gene, noxa, and to a lesser extent,puma, was reduced in cells with mutant p53. Finally, knockoutof noxa in p53-competent, Bcl-2–overexpressing cells alsosuppressed the apoptotic response to the combination ofvorinostat and ABT-737.

These studies provide important mechanistic insight intothemolecular events thatunderpin synergistic tumor cell deathmediated by HDACi combined with ABT-737. Bmf was acommon transcriptional target of structurally diverse HDACiand induction of this gene was critical for the combined effectsof vorinostat and ABT-737. This defines a novel functionalrelationship between Bmf and ABT-737 in killing cells over-expressing Bcl-2 and highlights the concept of "apoptoticpriming" of tumor cells by an anticancer agent for deathmediated by a second agent. In this instance, vorinostat-induced induction of bmf "primed" tumor cells overexpressingBcl-2, for subsequentdeathmediatedbyABT-737.However, thecells were additionally sensitized to ABT-737–mediated apop-tosis through the expressionofwild-typep53, likely through themaintenance of adequate basal levels of noxa and puma.

Materials and Methods

Drugs and compoundsVorinostat (Merck), panobinostat (Novartis), romidepsin

(Gloucester), VPA (Sigma-Aldrich), etoposide, taxol, vincris-tine (Peter MacCallum Cancer Centre), ABT-737 (AbbottPark), were dissolved in dimethyl sulfoxide (DMSO). For invivo experiments vorinostat and ABT-737 were prepared aspreviously described (15).

Cell culture and Western blottingDevelopment of Em-myc, Em-myc/bcl-2, Em-myc/mcl-1,

Em-myc/bim�/�, Em-myc/bmf�/�, Em-myc/noxa�/�, Em-myc/apaf-1�/�, and Em-myc/p53�/� lymphomas has been pre-viously described (3, 15, 18–20). MSCV retroviral plasmidsfor expression of Bcl-2 and A1 were described previously(15). For gene knockdown studies, shRNAmirs in the pLMPvector directed against p53 (kindly provided by Dr Ross

Dickens, Walter and Eliza Hall Institute), bmfshRNA1(sense—AGCAAGCCAGGGTGAAACTTAA), bmfshRNA2(sense—CGCCCAGAGTAAGGAATGTCTT), and IFI16(sense—CTCATATCAGATTATTTGGAAT) were used. Retro-viral transduction of Em-myc lymphoma cells and Westernblotting was performed as previously described (3). Blots wereprobed with a-Bcl-2 (BD Sydney), a-Bim (Stressgen), a-Bmf(Alexis), a-p53 (Novocastra), a-acetylated-Histone H3(Upstate), and a-ß-actin (Sigma) used as a control. Lympho-mas were also analyzed for p53 pathway status by treatmentwith 20 nmol/L etoposide Western blotting with a-p53 (Novo-castra) and a-p19ARF Invitrogen and cell death as measured bypropidium iodide (Sigma-Aldrich) uptake and annexin V-APC(DB Biosciences) binding.

Synergistic cell death and colony formationEm-myc/bcl-2 (1 � 106 cells) were incubated for 8, 16 hours

with 2.5 mmol/L vorinostat then washed with media andincubated and for a further 1, 2, 4, and 8 hours with 0.1mmol/L ABT-737 or 0.1 mmol/L ABT-737e (an enantiomer ofABT-737) or 4 and 8 hours with ABT-737 or ABT-737e treat-ment alone. Em-myc lymphoma cells (1 � 106 cells/mL) werealso incubated in the presence of the indicated compounds for24 hours. Cell death was analyzed by propidium iodide (Sigma-Aldrich) uptake and annexin V-APC (BD Biosciences) asdescribed (3, 15). Colony assays were performed as previouslydescribed (17). Synergy was calculated using the BiosoftCalcuSyn program based on the Chou-Talalay method (21).

Immunoprecipitation assaysFor immunoprecipitation, Bcl-2 and Mcl-1 antibodies were

bound to Protein G Sepharose 4 Fast Flow-beads (Amersham)and cross-linked using 40 mmol/L dimethyl pimedilate in 0.1M borate (pH 9). Em-myc/bcl-2 cells were treated with 0.5mmol/L ABT-737 for 8 hours. Lysates were prepared on ice inlysis buffer (20 mmol/L Tris-HCl pH 7.4, 135 mmol/L NaCl, 1.5mmol/L MgCl2, 1 mmol/L EGTA, 1 mmol/L EDTA, 1% TritonX-100) supplemented with Complete protease inhibitors(Roche). Equilibrated antibody-bound beads were incubatedwith 500 mg protein at 4�C over night. After 4 washes with lysisbuffer, the beads were boiled in SDS-sample buffer andanalyzed by Western blotting.

RNA isolation, cDNA, and quantitative real time-PCRanalysis

1 � 106 cells were harvested in 250 mL of TRIzol reagent(Invitrogen), RNA was isolated using an Invitrogen isolationmethod and cDNA synthesis was performed according tomanufacturers instructions (Promega). Quantitative PCR ana-lysis of samples was performed on ABI7900 light cycler withSYBER-green ROX mix (Thermo Scientific-Abgene) with pri-mers spanning exons of the BH3-only family of proteins utilizingribosomal housekeeping gene RPL32. Primer sequences for thecomplete BH3 family set can be requested from the author.

In vivo apoptosis analysis and therapyApproximately 5 � 104 Em-myc/bcl-2 cells were injected

intravenously (i.v.) into the tail veins of 5-week-old male

Wiegmans et al.

Cancer Res; 71(10) May 15, 2011 Cancer Research3604




C57Bl/6 mice. Mice were monitored and treated when anaverage total white cell blood count of over 13 � 106/mL asassessed by Bayer ADVIA 120 hematology analyzer (GMIRamsey) showed leukemia. Therapy consisted of adminis-tration of vorinostat (200 mg/kg) for 12 hours and ABT-737(100 mg/kg) for 4 hours later or each drug independentlyalong with a 16-hour vehicle control.Vorinostat and ABT-737 combination therapy was per-

formed on 7 � 104 4T1 breast carcinoma cells were har-vested and injected subcutaneously (s.c.) into the flanks of4-week-old female Balb/c mice. Once the tumor reached9 mm2, daily simultaneous intraperitoneal (i.p.) adminis-tration of 200 mg/kg vorinostat and 150 mg/kg ABT-737began. The mice were treated and monitored for 14 days.Em-myc/bcl-2 tumors from the lymph nodes of treatedmice were subjected to immunohistological staining withhematoxylin/eosin and TUNEL analysis as previouslydescribed (17).

Chromatin immunoprecipitation assayThe chromatin immunoprecipitation (ChIP) assay was

performed as per the manufacturer's instructions using a cellsignaling EZ ChIP kit (Upstate). Cross-linked protein/DNAwas incubated with either 1 mg of isotype control antibody or 5mg of antiacetylated histone H3 (Upstate) for 16 to 24 hours at4�C. The immuno-precipitated DNAwas analyzed by PCRwithprimers targeting the promoter regions of specific BH3-onlygenes (available from author).

Results

Synergistic tumor cell apoptosis mediated by vorinostatand ABT-737Previously we showed that coincubation of HDACi and

ABT-737 induced apoptosis in Bcl-2–overexpressing lympho-mas derived from Em-myc transgenic mice (Em-myc/bcl-2;ref. 15). We hypothesized that HDACi may sensitize or "prime"cells for ABT-737–induced apoptosis. Treatment with vorino-stat (2.5 mmol/L) alone for 24 hours had little or no effect onthe viability of Em-Myc/bcl-2 lymphomas whereas treatmentwith ABT-737 (0.5 mmol/L) caused less than 20% of thelymphoma cells to undergo apoptosis (SupplementaryFig. S1A–D). However, pretreatment of Em-Myc/bcl-2 lympho-mas with vorinostat (2.5 mmol/L) potently sensitized thetumor cells to ABT-737–induced apoptosis (SupplementaryFig. S1A–D). The synergistic effects of vorinostat and ABT-737required effective inhibition of Bcl-2, as an enantiomer of ABT-737 with significantly less Bcl-2-inhibitory activity (14) did notsynergize with vorinostat (Fig. 1A). We confirmed that asecond independently derived Em-Myc/bcl-2 lymphoma wasalso sensitized to ABT-737–induced apoptosis following pre-treatment with vorinostat (2.5 mmol/L) for 16 hours (Supple-mentary Fig. S1E).

Vorinostat induces expression of a subset ofproapoptotic BH3-only genesWe hypothesized that vorinostat primed Em-Myc/bcl-2

lymphomas for ABT-737–mediated apoptosis by increasing

the expression of proapoptotic BH3-only genes. Treatmentof Em-myc/bcl-2 lymphomas with vorinostat alone or vor-inostat and ABT-737 resulted in induction of 3 BH3-onlygenes, bmf, bim, and noxa, more than 2-fold above baseline(Fig. 1B and C). Interestingly, bmf (�12-fold), noxa, and bim(both �3.5-fold) were induced to maximal levels followingsingle agent treatment with vorinostat (Fig. 1B). In contrast,hrk was maximally induced (�100-fold) after 16 hours pre-treatment with vorinostat followed by 8 hours incubationwith ABT-737 (Fig. 1C). Only moderate induction of hrk(6-fold) was observed when Em-myc/bcl-2 lymphoma cellswere treated with ABT-737 alone for 8 hours and none ofthe other Bcl-2 family genes showed consistent changesin expression following single agent ABT-737 treatment(Fig. 1B and C). Changes in the expression of Bmf, Bim,and Hrk protein mimicked the magnitude and kinetics oftheir transcriptional profiles (Fig 1D). All detectable Bmfisoforms showed increased expression following treatmentwith vorinostat (Fig. 1D, lanes 1–3), although there was a1 hour delay in maximal protein expression compared to thekinetic change in bmf mRNA (compare with Fig. 1B). Incontrast, there was no observable change in Bmf levelsfollowing treatment with ABT-737 alone (Fig. 1D). Similarly,the expression of BimEL, BimL, and BimS protein isoformsincreased over time in response to vorinostat in the presenceand absence of ABT-737 (Fig. 1D). Densitometric analysisrevealed that Bmf protein levels were induced maximally11-fold above baseline, whereas BimL was induced 8-foldabove baseline. Maximal levels of Hrk were observed fol-lowing pretreatment with vorinostat for 16 hours and anadditional incubation with ABT-737 for 4 to 8 hours (Fig. 1D,lanes 6 and 7). Changes in Noxa protein could not beevaluated by Western blotting, as a suitable antibody spe-cific for endogenous mouse Noxa is not currently available.Expression of the BH3-only family member Bad and multi-domain proapoptotic member Bax did not change duringtreatment with vorinostat and/or ABT-737 (Fig 1D). Theseresults indicate that bmf, bim, and noxa are genes that areup-regulated during pretreatment with vorinostat andhence the protein products of these genes may "prime"Em-Myc/bcl-2 lymphoma cells for rapid apoptosis mediatedby ABT-737.

To determine if bmf, bim, noxa, and hrk levels were alteredfollowing treatment with vorinostat in vivo, tumor and normalcells were harvested from the same lymph nodes of vorinostat-treated C57BL/6 mice bearing GFPþve Em-Myc lymphomas.Vorinostat induced a robust and early induction of bmf inEm-Myc lymphomas whereas little or no change was observedin normal cells (Supplementary Fig. S2A). More modest tumorcell-specific induction of bim and noxa was also observedfollowing treatment of mice bearing Em-Myc lymphomas(Supplementary Fig. S2B and C). Maximal induction of hrkwas observed at later time points (Supplementary Fig. S2D),consistent with the notion that transcriptional activation ofthis gene occurs as a consequence of apoptosis. Westernblot analysis confirmed expression of Bmf in Em-myc/bcl-2lymphomas isolated from the lymph nodes of vorinostat-treated tumor-bearing mice (Supplementary Fig. S2E).

Mechanism of Tumor Cell Death by HDACi and ABT-737

www.aacrjournals.org Cancer Res; 71(10) May 15, 2011 3605




Vorinostat-induced upregulation of bmf, bim, and noxaoccurs independently of apoptosis

To confirm that vorinostat-mediated upregulation ofBH3-only genes was not a response to induction of apop-tosis, Em-myc/bcl-2 cells were treated with vorinostat andABT-737 in the presence of the pan-caspase inhibitor zVAD-fmk. Apoptosis mediated by vorinostat/ABT-737 was inhib-ited by zVAD-fmk (Supplementary Fig. S3A), however bmf,bim, and noxa mRNA still increased following treatmentwith vorinostat (Supplementary Fig. S3B). Of note, theinduction of hrk following treatment with vorinostat andABT-737 was suppressed compared to the level of geneinduction seen in cells that underwent apoptosis followingexposure to both agents (compare Figs. 1C and S3B). Similarresults were obtained using Em-myc lymphomas overexpres-sing the prosurvival family member Bcl-2A1 (A1) that we hadpreviously shown to be resistant to vorinostat/ABT-737combination treatment (15), as ABT-737 does not inhibit

A1 (refs. 22, 23; Supplementary Fig. S3C and D). Takentogether these results suggest that vorinostat primes cellsfor ABT-737–mediated death by specifically inducing expres-sion of certain BH3-only genes, namely bmf and to a lesserextent bim and noxa. In contrast, the upregulation of hrkfollowing treatment with vorinostat and ABT-737 appears tobe a secondary response triggered by apoptotic signalingand hrk is therefore unlikely to be important for vorinostat-mediated priming for death by ABT-737.

Vorinostat induces histone acetylation within thepromoter region of BH3-only target genes

To determine if the transcriptional activation of selectiveBH3-only genes by vorinostat was due to drug-inducedhyperacetylation of their promoter regions, ChIP assays wereperformed. Em-myc/bcl-2 cells were treated with vorinostatfor 16 hours and ChIP assays were performed using an anti-acetylated-histone H3 antibody. Treatment with vorinostat

A 100

80

60

% A

nnex

in V

/PI–

posi

tive

Fol

d ex

pres

sion

cha

nge

Fol

d ex

pres

sion

cha

nge

40

ABT-737ABT-737e

20

0Vorinostat (h)

15

10

5

0

Hrk

Bmf

Bad

Noxa

Bik

Puma

Bax Bid

Bim

0 8– –

16p16p16p16 p16

****

****, P < 0.001

–– 1 2 4 48 8

–ABT-737 (h)

Vorinostat (h) 0

120

100

80

60

40

20

0

8– –

16p16p16p16 p16 –– 1 2 4 48 8

–ABT-737 (h)

Hrk

Bmf

Bad

Noxa

Bik

Puma

Bax Bid

Bim

Vorinostat (h) 0 8– –

16p16p16p16 p16 –– 1 2 4 48 8

–ABT-737 (h)

Vorinostat (h) 0 8 16 p16– – – 1

p162

p164

p168 8

– –4ABT-737 (h)

Acetyl H4

Bmf

Hrk

BimEL

BimLBimS

Bad

Bax

Actin

B

C D

Figure 1. Vorinostat and ABT-737 induce synergistic death of Em-myc/bcl-2 cells in vitro. A, a synergistic cell death assay was performed with 2.5 mmol/Lvorinostat and 0.1 mmol/L ABT-737 or 0.1 mmol/L ABT-737e, an enantiomer of ABT-737 with 100-fold less activity in combination. Em-myc cells werepretreated with vorinostat for 16 hours then washed and "primed" (p16) cells were exposed to ABT-737 for 1 to 8 hours. As a control, cells were exposedto ABT-737 or ABT-737e for 4 and 8 hours in the absence of vorinostat pretreatment. Cell death was assessed by FACS and displayed as percentageannexinV and PI double-positive cells. Data shown are the mean of 3 independent experiments �SEM. B, qRT-PCR was performed on cDNA samplesprepared from vorinostat and ABT-737 treated samples from the synergistic cell death assay in A. Results shown are expressed as fold increase relativeto a non-HDACi–regulated control gene RPL32. C, the data from B were rescaled to show the full extent of hrk induction. Data shown in B and C are themean of 6 independent experiments �SEM. D, protein lysates were prepared from vorinostat and ABT-737 treated samples from the synergistic cell deathassay in A. On a single membrane, Western blotting was performed and the samples were probed multiple times with antibodies targeting acetylatedH4, 4 BH3-only family members (Bmf, Hrk Bim and Bad), the multidomain Bax, and b-actin as a loading control.

Wiegmans et al.





resulted in very strong induction of histone H3 acetylation atthe bmf promoter and weaker acetylation of histone H3 atthe bim promoter (Supplementary Fig. S4A and B). Thissuggests that up-regulation of bmf and bim following treat-ment with vorinostat occurs as a direct consequence ofchanges in the levels of acetylation at the promoters ofthese target genes. Additional studies showed that vorino-stat-mediated induction of bmf, bim, and noxa mRNA wasnot inhibited by continuous cotreatment of cells with cyclo-hexamide to inhibit de novo protein synthesis (data notshown). Together, these data indicate that vorinostatinduces direct hyperacetylation of histone H3 within thepromoter regions of genes such as bmf and bim resulting intheir transcriptional upregulation.

Vorinostat-mediated induction of bmf is important tosensitize cells for ABT-737–mediated apoptosisTo determine the functional importance of Bmf and Bim for

the synergistic killing of cells overexpressing Bcl-2 by vorino-stat and ABT-737, we generated Em-myc/bim�/� (3) andEm-myc/bmf�/� (19) lymphoma cells with overexpression ofBcl-2. Exposure of Em-myc/bcl-2, Em-myc/bim�/�/bcl-2, andEm-myc/bmf�/�/bcl-2 lymphomas to the vorinostat/ABT-737combination revealed that Em-myc/bim�/�/bcl-2 cells were assensitive as Em-myc/bcl-2 cells whereas Em-myc/bmf�/�/bcl-2lymphomas displayed significantly less apoptosis (Fig. 2A). To

confirm the important role of bmf in mediating the synergisticapoptotic effects of vorinostat and ABT-737, Em-myc/bcl-2lymphomaswere transducedwith retroviral vectors expressing2 different short hairpinRNAs (shRNA) directed towards bmforan shRNA against the human Ifi16 gene as a control. BothshRNAs targeting bmf robustly inhibited the expression of theproapoptotic Bmf I protein isoform (Supplementary Fig. S5).Exposure of Em-myc/bcl-2 lymphomas expressing the IfI16shRNA (Em-myc/bcl-2/Ifi16shRNA) to vorinostat and ABT-737 resulted in apoptosis in these cells that was very similarin magnitude and kinetics to that observed in Em-myc/bcl-2cells (Fig. 2B). In contrast, knockdown of Bmf by 2 differentshRNAs in Em-myc/bcl-2/bmfshRNA1 and Em-myc/bcl-2/bmfshRNA2 cells resulted in resistance to the combinationtreatment (Fig. 2B). These results confirm that Bmf plays animportant role in mediating robust apoptosis of Em-myc/bcl-2lymphomas upon treatment with vorinostat and ABT-737.

Given the important functional role of Bmf in primingvorinostat-treated cells for ABT-737–induced apoptosis, wewished to determine if other HDACi also specifically up-regulated bmf. Treatment of Em-myc/bcl-2 cells with theHDACi panobinostat (LBH589), valproic acid (VPA), romidep-sin (depsipeptide), and vorinostat resulted in a robust increasein bmfmRNA that was substantially greater than the responseof any other BH3-only gene assessed (Fig. 2C). In contrast,other apoptotic stimuli did not significantly induce bmf

A 100

80

60

% A

nnex

in V

/PI–

posi

tive

40

Eµ-myc/bcl-2Eµ-myc/bim-/-/bcl-2Eµ-myc/bmf-/-/bcl-2

20

0

Vorinostat (h) 0 8– –

16 p16 p16 p16 p16

**

**, P < 0.05

–– 1 2 4 48 8

–

ABT-737 (h)

100

80

60

% A

nnex

in V

/PI–

posi

tive

40

Eµ-myc/bcl-2Eµ-myc/bcl-2/bmfshRNA1

Eµ-myc/bcl-2/bmfshRNA2

Eµ-myc/bcl-2/IFI-16shRNA

20

15

10

5

0Untreated

Bmf

Fol

d ex

pres

sion

cha

nge Bim Hrk Noxa Puma

Panobinostat Romidepsin VPA Vorinostat

15

10

5

0Untreated

Bmf

Fol

d ex

pres

sion

cha

nge

Bim Hrk Noxa Puma

Etoposide Serum Taxol Vincristine UV

0Vorinostat (h) 0 8

– –16 p16 p16 p16 p16

***

**

**, P < 0.05***, P < 0.005

–– 1 2 4 48 8

–

ABT-737 (h)

B

C D

Figure 2. Loss of Bmf but not Bim attenuates synergistic apoptosis mediated by vorinostat and ABT-737. A, a synergistic cell death assay was performed with2 independently derived lymphomas; Em-myc/bmf�/�/bcl-2 lymphoma and Em-myc/bim�/�/bcl-2. Cell death was assessed by FACS analysis of positiveannexinV/PI staining with Em-myc/bmf�/�/bcl-2 cells being significantly less sensitive to combination treatment (**, P < 0.05). B, Em-myc/bcl-2 lymphomacells transduced with retroviral constructs expressing 2 different short hairpin RNAs directed toward bmf and a control construct directed toward the humanIFI 16 gene were treated as described in A. Cell death was assessed by FACS analysis of positive annexinV/PI staining (**, P < 0.05). Data shown arethe mean of 3 independent experiments �SEM. C and D, Em-myc/bcl-2 lymphoma cells were incubated in the presence of indicated compound or conditionsfor 24 hours and qRT-PCR was performed on cDNA samples. Results shown are expressed as fold increase relative to a non-HDACi–regulated control geneRPL32 and are the mean �SEM of 3 independent experiments.






(Fig. 2D). Consistent with previous reports (24, 25), treatmentwith the DNA damaging agent etoposide, exposure to UVirradiation, and deprivation of serum resulted in enhancedexpression of the p53-response gene puma (Fig. 2D) whereasnoxa was induced following etoposide treatment (Fig. 2D) aspreviously showed (26). Interestingly, treatment of Em-myc/bcl-2 lymphomas with concentrations of taxol or vincristinecapable of mediating�50% death of Em-myc lymphomas (datanot shown) did not cause any substantial increase in any of theBH3-only genes studied.

Bmf is required for the antitumor responses tovorinostat and ABT-737 in vivo

We next determined if the requirement for vorinostat-mediated bmf induction for synergistic apoptosis of Em-myc/bcl-2 lymphomas in vitro was maintained in the in vivosetting. C57BL/6 mice bearing Em-myc/bcl-2, Em-myc/bcl-2/bmfshRNA1, Em-myc/bmf�/�/bcl-2, and Em-myc/bcl-2/IFI-16shRNA tumors were treated with vehicle, vorinostat,ABT-737, or a combination of vorinostat and ABT-737. Inmice bearing Em-myc/bcl-2 or Em-myc/bcl-2/IFI-16shRNAlymphomas, treatment with vorinostat or ABT-737 alonecaused a slight decrease in WBC numbers and spleen weight(Fig. 3A). The single agent effect on WBC numbers and spleenweights was significantly enhanced following combinationtreatment with vorinostat and ABT-737 (Fig. 3A). Enhancedinduction of apoptosis in mice bearing Em-myc/bcl-2 lympho-mas treated with the vorinostat/ABT-737 combination com-pared to single agent treatment was confirmed by TUNELstaining on lymph node tissue (Fig. 3B). The synergistic effectof vorinostat/ABT-737 was almost completely abrogatedin mice bearing Em-myc/bcl-2/bmfshRNA1 and Em-myc/bmf�/�/bcl-2 lymphomas (Fig. 3A).

Vorinostat increases Bmf expression and inducessynergistic apoptosis in tumor cells that constitutivelyexpress high levels of Bcl-2

Having showed that in tumor cells engineered to over-express Bcl-2, treatment with vorinostat increased the levelsof Bmf and this was important to "prime" cells for subsequentkilling by ABT-737, we wanted to confirm that vorinostatcould act in the same manner in a tumor where endogenousBcl-2 was highly expressed. We previously determined that themouse breast carcinoma cell line 4T1.2 was relatively resistantto apoptosis induced by single agent vorinostat treatment invitro and in vivo (27). Western blot analysis revealed that 4T1.2cells expressed levels of Bcl-2 comparable to the expressionlevel seen in Em-myc/bcl-2 lymphomas (Fig. 4A). Treatment of4T1.2 cells with vorinostat or ABT-737 alone for 24 hoursinduced minimal apoptosis however synergistic tumor celldeath was apparent following combination treatment withABT-737 and vorinostat (Fig. 4B). Moreover, a time courseassay showed that pretreatment of 4T1.2 cells for 16 hourswith vorinostat sensitized the cells to ABT-737–induced apop-tosis with similar kinetics andmagnitude of cell death to thoseobserved in Em-myc/bcl-2 lymphomas (Fig. 4C). Bmf mRNAand protein was strongly induced following treatment of4T1.2 cells with vorinostat with kinetics of gene induction

that mirrored those observed in Em-myc cells (Fig. 4D and E).Finally, we showed that the combination of vorinostat andABT-737 was superior in vivo for the treatment of 4T1.2tumors compared to single agent treatment (Fig. 4F). Thesedata are consistent with the notion that high levels of endo-genous Bcl-2 may confer a level of resistance to vorinostat-mediated apoptosis, which can be overcome with priorincubation of cells in vorinostat, followed by the additionof a BH3-mimetic. Effects of tumor microenvironment and/ordifferences in local drug concentrations in subcutaneousversus lymphoid may account for the combination effect ofvorinostat and ABT-737 being less robust in the 4T1.2 systemcompared to that seen against Em-myc/bcl-2 lymphomas.

Bmf interacts with Bcl-2 and binds Mcl-1 upon additionof ABT-737

Bmf was originally identified in a yeast 2-hybrid screenusing Mcl-1 as bait and co-immunoprecipitated with over-expressed Bcl-2, Bcl-xL, Mcl-1, and Bcl-w in HEK-293 cells (28).BIOCORE analysis using recombinant proteins and Bmf-BH3peptides indicated that the binding affinity of Bmf was higherfor Bcl-2 and Bcl-xL than for Mcl-1 (29). Consistent with thesedata, we showed that Bmf co-immunoprecipitated with Bcl-2whereas little or no Bmf was detected following immunopre-cipitation of Mcl-1 (Supplementary Fig. S6). Interestingly,treatment of cells with ABT-737 resulted in a decrease inthe amount of Bmf that co-immunoprecipitated with Bcl-2and detectable Bmf that co-immunoprecipitated with Mcl-1(Supplementary Fig. S6). This shows that Bmf preferentiallybinds Bcl-2 over Mcl-1. However, ABT-737, which can func-tionally interact with Bcl-2 but not Mcl-1 (14, 15, 22, 23)appears to effectively compete with Bmf for binding to Bcl-2, resulting in release of Bmf that is subsequently free tointeract with Mcl-1.

Role of the p53 pathway in mediating potent tumor cellapoptosis by vorinostat and ABT-737

During the course of our experiments we identified anEm-myc/bcl-2 lymphoma (designated *Em-myc/bcl-2) thatdisplayed considerable resistance to apoptosis induced bythe vorinostat/ABT-737 combination (Fig. 5A). Bmf was up-regulated in vorinostat-treated *Em-myc/bcl-2 cells indicat-ing that a lack of bmf induction was not responsible for theobserved resistance to vorinostat/ABT-737 (Fig. 5B). Theparental *Em-myc lymphoma retained sensitivity to vorino-stat-induced apoptosis (Supplementary Fig. S7A), however,these cells were relatively resistant to apoptosis mediated byetoposide (Supplementary Fig. S7B). Em-myc lymphomashave a propensity to inactivate the p53 pathway throughalterations of the ARF, mdm2, and p53 loci resulting inchemoresistance in these tumors (30, 31). In comparisonto etoposide-sensitive Em-myc cells, *Em-myc cells expressedsignificant levels of a higher molecular weight form of p53that was not induced by etoposide (Supplementary Fig. S7C).Moreover, the *Em-myc lymphoma expressed constitutivelyhigh levels of p19ARF, a phenotype consistent with deletionor functional mutation of p53 (31, 32). We subsequentlysequenced p53 from *Em-myc cells and identified an

Wiegmans et al.





insertion of 33 nucleotides resulting in an 11 amino acidinsertion within the C-terminal, oligomerization domain ofthe protein.

To definitively show that wild-type p53 was required formaximal apoptosis mediated by the ABT-737/vorino-stat combination we developed Em-myc/p53�/�/bcl-2 and

Figure 3. Knockdown or knockoutof bmf suppresses the combinedtherapeutic effects of vorinostatand ABT-737 in vivo. A, C57BL/6mice (3–5 mice per group) weretransplanted with Em-myc/bcl-2,Em-myc/bcl-2/IFI 16shRNA,Em-myc/bcl-2/bmfshRNA1, orEm-myc/bmf�/�/bcl-2 lymphomacells and monitored for leukemiadevelopment (white blood cellcounts above 13 � 106 cell/mL).Leukemic mice were treated withvehicle, vorinostat (200 mg/kg) orABT-737 (150 mg/kg) alone for16 hours, or a combination ofvorinostat for 12 hours followed bytreatmentwithABT-737 for 4hours(vþABT). White blood cell counts(WBC) were analyzed before andafter treatment (left). The resultswere plotted as the mean totalWBC count �SEM of 3 to5 mice per treatment group(***,P < 0.005).Micewere analyzedfor spleen weight as a measure ofleukemic cell load (right). The datashown are themean spleen weightper treatment group (**, P < 0.05).B, brachial lymph nodes fromC57BL/6 mice bearing Em-myc/Bcl-2 lymphomas treated withvehicle, 200 mg/kg vorinostat, 150mg/kg ABT-737, or a combinationof vorinostat and ABT-737 wereresected and analyzed byhematoxylin/eosin and TUNELstaining.

Vehicle Vorinostat ABT-737Vorinostat +

ABT-737

80A

B

60

40

20

0

50 400

300

200

100

0

40

30

20

10

0

Vehicle Vorinostat

Pretreatment

Posttreatment

PretreatmentPosttreatment



**, P < 0.05***, P < 0.005

Eµ-myc/bcl-2

Eµ-myc/bcl-2/lfi16shRNA

Eµ-myc/bcl-2/bmfshRNA

Eµ-myc/bcl-2/bmf-/-Eµ-myc/bcl-2/bmf-/-

Eµ-myc/bcl-2/bmfshRNA

Eµ-myc/bcl-2/lfi16shRNA

Eµ-myc/bcl-2

ABT-737 v+ABT

Vehicle Vorinostat ABT-737 v+ABT Vehicle Vorinostat ABT-737 v+ABT

Vehicle Vorinostat ABT-737 v+ABTVehicle Vorinostat ABT-737 v+ABT

Vehicle Vorinostat ABT-737 v+ABT Vehicle Vorinostat ABT-737 v+ABT

800

600

400

200Wei

ght (

mg)

Wei

ght (

mg)

0

800

600

400

200Wei

ght (

mg)

0

800

600

400

200Wei

ght (

mg)

0

Vehicle Vorinostat ABT-737 v+ABTW

BC

x 1

06 /mL

WB

C x

106 /m

L

50

40

30

20

10

0

WB

C x

106 /m

L

100

80

60

40

20

0

WB

C x

106 /m

L






Em-myc/bcl-2/p53shRNA lymphomas (SupplementaryFig. S7C). Apoptosis mediated by the combination of vor-inostat and ABT-737 was significantly compromised in Em-myc/p53�/�/bcl-2 and Em-myc/bcl-2/p53shRNA lymphomascompared to control Em-myc/bcl-2 and Em-myc/bcl-2/IFI16shRNA cells (Fig. 5C). However, robust induction ofbmf by vorinostat was retained in Em-myc/p53�/�/bcl-2(Fig. 5D) and Em-myc/bcl-2/p53shRNA cells (Fig. 5E) con-firming that an intact p53 pathway was not necessary forvorinostat to induce expression of this functionally impor-tant BH3-only gene.

To determine if the combination of loss of bmf and p53 hada more pronounced effect on apoptosis induced by the

vorinostat/ABT-737 combination than loss of either genealone, we identified a rare Em-myc/bmf�/� lymphoma (termed*Em-myc/bmf�/�) with a defect in the p53 pathway as evi-denced by loss of detectable p53 protein (in the presence orabsence of exposure to etoposide) and increased expression ofp19ARF protein (Fig. 6B and C). These cells were relativelyresistant to etoposide-induced apoptosis (Fig. 6A) consistentwith these cells being defective in p53 function. We subse-quently expressed Bcl-2 in *Em-myc/bmf�/� cells and deter-mined the effect of vorinostat combined with ABT-737. Asexpected, Em-myc/bcl-2 lymphomas were highly sensitive tothe combination of vorinostat and ABT-737 while *Em-myc/bmf�/�/bcl-2 lymphomas with knockout of bmf and loss of

100A B C

D

F

E

100

80

60

40

20

6

4

2

Fol

d E

xpre

ssio

n C

hang

e

0

Bmf

Vorinostat + ABT-737ABT-737vorinostatvehicle

Hrk Noxa Bim

0

60

40Tu

mor

vol

ume

(mm

2 )

20

00 5 10

Days15

0

–

8

–

16

–

p16

1

p16

2

p16

4

p16

8

–

4

–

8

0

–

8

–

16

–

p16

1

p16

2

p16

4

p16

8

–

4

–

8

0

–

8

–

16

–

p16

1

p16

2

p16

4

p16

8

–

4

–

8

80 ***

***, P < 0.005

**, P < 0.05

60

40

20

% A

nnex

in V

/PI–

posi

tive

% A

nnex

in V

/PI–

posi

tive

0 Vorinostat (h)ABT-737 (h)

Vorinostat (h)ABT-737 (h)


Vehi

cleVo

rinos

tat

ABT-

737

Vorin

osta

t + A

BT-7

37

Eµ-m

yc/b

cl-2

Eµ-m

yc

4T1.

2

Bcl-2

Acetyl H4

Bmf

Hrk

BimEL

BimS

Bad

Bax

Actin

BimL

Actin

Figure 4. Vorinostat and ABT-737 induce synergistic death of 4T1.2 cells that constitutively express high levels of Bcl-2. A, the level of Bcl-2 expressionin 4T1.2 breast cancer cells compared to Em-myc/bcl-2 lymphoma cells was determined by Western blot. Expression of b-actin was used as a loadingcontrol. B, 4T1.2 cells were incubated in media supplemented with DMSO, 1 mmol/L ABT-737 or 10 mmol/L vorinostat for 24 hours, or were pretreatedwith 10 mmol/L vorinostat for 16 hours and further incubated with 1 mmol/L ABT-737 for 8 hours. Cell death was assessed by FACS and displayed aspercentage annexinV and PI double-positive cells (***, P < 0.005). C, a synergistic cell death assay was performed with 4T1.2 cells with 10 mmol/L vorinostatand 1 mmol/L ABT-737. Cell death was assessed by FACS and displayed as annexinV and PI double-positive cells. D, qRT-PCR was performed oncDNA samples prepared from 4T1.2 cells incubated under the conditions described in C. Results shown are expressed as fold increase relative to anon-HDACi–regulated control gene RPL32. All data shown are the mean of 3 independent experiments �SEM. A statistically significant increase in Bmf wasobserved at the 16-hour timepoint (Pþ 0.012). E, western blotting was performed on samples incubated under the conditions described in C and were probedmultiple times with antibodies targeting acetylated H4, 4 BH3-only family members (Bmf, Hrk, Bim, and Bad), the multidomain Bax, and actin was used asa loading control. F, BALB/c mice with established subcutaneous 4T1.2 tumors (>6 mm2) were treated with vehicle alone, 200 mg/kg vorinostat, 150 mg/kgABT-737, or a combination of vorinostat and ABT-737. Ten mice per group were monitored from day 1 of therapy for tumor growth over 15 days(**, P < 0.05). The data shown is the mean �SEM.

Wiegmans et al.





function of p53 were highly resistant to combination treat-ment (Fig. 6D).We confirmed that optimum apoptosis induced by vorino-

stat/ABT-737 required both bmf and p53 using sensitiveclonogenic assays. As expected, treatment of Em-myc/bcl-2or Em-myc/bcl-2/IFI16shRNA lymphomas with vorinostat andABT-737 resulted in almost complete loss of clonogenicpotential (Fig. 6E). In contrast, the clonogenic potential waspartially rescued in Em-myc lymphomas with knockdownof bmf (Em-myc/bcl-2/bcl-2shRNA) or mutation of p53

(*Em-myc/bcl-2) and this rescue was further enhanced in*Em-myc/bmf�/�/bcl-2 lymphomas with knockout of bmfand functional inactivation of p53 (Fig. 6E). These dataindicate that both bmf and p53 play important functionalroles in mediating robust tumor cell apoptosis followingcombination treatment with vorinostat and ABT-737.

The BH3-only genes puma and noxa are direct transcrip-tional targets of p53 (33–35) and both genes are elevated inpremalignant B cells from Em-myc mice (20). As shown inFigure 7A, the expression of noxa mRNA was significantly

A

C D

E

B100

80

60

% A

nnex

in V

/PI–

posi

tive

% A

nnex

in V

/PI–

posi

tive

40

Eµ-myc/bcl-2

Eµ-myc/bcl-2

*Eµ-myc/bcl-2

Eµ-myc/b53-/-/bcl-2Eµ-myc/bcl-2/p53shRNAEµ-myc/bcl-2/IFI-16shRNA

20

0

100

80

60

40

20

0

12

10

8

6

4

2

0

25

20

15

10

Fol

d ex

pres

sion

cha

nge

Fol

d ex

pres

sion

cha

nge

12

10

8

6

4

2

0

Fol

d ex

pres

sion

cha

nge

5

Bmf Bim Hrk Noxa

Bmf BimHrk Noxa

Bmf BimHrk Noxa

0





Vorinostat (h)ABT-737 (h)0 8

– –16 p16 p16 p16 p16

**

*, P < 0.01

***, P < 0.005

–– 1 2 4 48 8

–

0 8– –

16 p16 p16 p16 p16 –– 1 2 4 48 8

– 0 8– –

16 p16 p16 p16 p16 –– 1 2 4 48 8

–

0 8– –

16 p16 p16 p16 p16 –– 1 2 4 48 8

–

0 8– –

16 p16 p16 p16 p16 –– 1 2 4 48 8

–

Figure 5. Vorinostat and ABT-737 do not exhibit synergy against *Em-myc/bcl-2 lymphoma cells. A, a synergistic cell death assay was performed withEm-myc/bcl-2 and *Em-myc/bcl-2 lymphomas. Cell death was assessed by FACS and displayed as percentage annexinV and PI double-positive cells(*, P < 0.01). B, qRT-PCR was performed on cDNA samples prepared from *Em-myc/Bcl-2 lymphomas incubated under the conditions described in A. Resultsshown are expressed as fold increase relative to a non-HDACi–regulated control gene RPL32. C, Em-myc/bcl-2, Em-myc/p53�/�/bcl-2, Em-myc/bcl-2/p53shRNA, and Em-myc/bcl-2/IFI 16shRNA lymphomas were incubated as described in A. Cell death was assessed by annexinV/PI positive staining(***, P < 0.005). D, qRT-PCR was performed on cDNA samples prepared from Em-myc/p53�/�/bcl-2 lymphoma cells. E, Em-myc/bcl-2/p53shRNA lymphomacells incubated under the conditions described in A. Results shown are expressed as fold increase relative to a non-HDACi–regulated control geneRPL32. Thedata shown in A to C are the mean of 3 independent experiments �SEM and D and E are the mean of 3 replicates of the same experiment �SEM.






diminished in p53-defective *Em-myc/bcl-2 lymphomaswhereas expression of puma was decreased to a lesserextent. In contrast, expression of bmf and bad was notaffected in *Em-myc/bcl-2 lymphomas (Fig. 7A). As we hadobserved that noxa was induced following vorinostat treat-ment (Figs. 1–3) and given that noxa expression was sup-pressed in *Em-myc lymphomas, we sought to determine theeffect of knockout of noxa on apoptosis mediated by thevorinostat/ABT-737 combination. Em-myc/noxa�/� lympho-mas (20) transduced to overexpress Bcl-2 displayed bio-chemical features of wild-type p53 activity (Fig. 7B).Treatment of Em-myc/bcl-2 and Em-myc/noxa�/�/bcl-2 lym-phomas with vorinostat and ABT-737 in a time-course assayshowed that the Em-myc/noxa�/�/bcl-2 displayed a signifi-cant level of resistance to the combination treatment com-parable to that observed in Em-myc/p53�/�/bcl-2 lymphoma

cells (Fig. 7C). This indicates that like bmf, noxa plays animportant role in mediating tumor cell apoptosis followingcombined treatment with vorinostat and ABT-737.

Discussion

HDACi are a promising class of new anticancer drugs thatshow single agent clinical activity against a range of hema-tological malignancies, most notably cutaneous T-cell lym-phoma (36). Using syngeneic mouse models of cancer we haveshown that overexpression of prosurvival Bcl-2 family proteinsinhibits the apoptotic and therapeutic activities of diverseHDACi, including vorinostat, panobinostat, romidepsin, andvalproic acid (3, 15, 37, 38). Moreover, we showed that theresistance to vorinostat-induced apoptosis mediated by Bcl-2or Bcl-xL could be reversed using ABT-737, a small molecule

100

80

60

% A

nnex

in V

/PI–

posi

tive

40

Eµ-myc/Bcl-2

Eµ-myc Eµ-myc

Bmf p53

p19ARF

ActinActin

– ++ – + vorinostat– – + – + Etoposide

*Eµ-myc/bmf-/- Eµ-myc/p53-/- *Eµ-myc/bmf-/-

*Eµ-myc/Bmf-/-/Bcl-2

Eµ-myc*Eµ-myc/bmf-/-

20

0

100

80

60

% C

olon

ies

40

20

Eµ-myc

Eµ-myc/

mcl-1

Eµ-myc/

bcl-2/IF

i16shRNA

Eµ-myc/

bcl-2/bmfsh

RNA1

*Eµ-m

yc

*Eµ-m

yc/bmf-/

- /bcl-2

0

100

80

60

% A

nnex

in V

/PI–

posi

tive

40

20

Vehicle Etoposide(0.02 µmol/L)

0


0 8

– –

16 p16 p16 p16 p16

***

**

***, P < 0.005 ***, P < 0.005

**, P < 0.05

********

**** *** ***, P < 0.001

–

– 1 2 4 48 8

–

D E

A B C

Figure 6. The combined loss of Bmf and p53 function causes resistance to the combination of vorinostat and ABT-737. A, the p53 pathway status of *Em-myc/bmf�/� and Em-myc lymphoma cells was compared by incubation with 20 nmol/L etoposide for 24 hours (**, P < 0.05). B, western blot analysis of Bmfexpression in Em-myc/bcl-2 and *Em-myc/bmf�/�/bcl-2 lymphomas in response to incubation with 2.5 mmol/L vorinostat for 16 hours was performed. Aspecific antibody against Bmf was used and expression of b-actin served as a loading control. C, the functional status of the p53 pathways in Em-myc, Em-myc/p53�/�, and Em-myc/bmf�/� lymphoma cells was assessed by determining expression of p53 and p19ARF. Cells were incubated for 24 hours �20 nmol/Letoposide and Western blotting was performed using specific antibodies against p53 and p19ARF. Expression of b-actin served as a loading control. D,a synergistic cell death assay was performed with Em-myc/bcl-2 and *Em-myc/bmf�/�/bcl-2 lymphomas (***, P < 0.005). For data in A and D, cell deathwas assessed by annexinV/PI positive staining and is the mean of 3 independent experiments�SEM. E, long-term assays were performed on various Em-myclymphoma cells pretreated with 2 mmol/L vorinostat for 16 hours followed by further incubation with 0.1 mmol/L ABT-737 for 8 hours. Samples were takenand incubated in soft agar for 7 days. Colony counts are expressed as a percentage of untreated samples. The data shown are the mean �SEM of atleast 4 independent experiments.

Wiegmans et al.





inhibitor of Bcl-2 proteins (15). Herein, we have used mousegenetics to decipher the apoptotic proteins and pathwaysnecessary for vorinostat and ABT-737 to kill tumor cellsoverexpressing Bcl-2.ABT-737 often has weak single agent activity against a

range of tumor cell lines even though these cells frequentlyexpress high levels of Bcl-2/Bcl-xL (39). Such cells may beinsensitive to ABT-737 due to concomitantly high levels ofthe prosurvival protein Mcl-1, which is very poorly inhibited

by ABT-737, or due to other events such as phosphorylationof Bcl-2 (22, 23). Moreover, it has been recognized that themere presence of high levels of Bcl-2 or Bcl-xL does notnecessarily mean that such cells are dependent or "addicted"to the activity of these proteins. Indeed, the concept of"apoptotic priming" has been used to explain why certaincells may be either inherently sensitive or resistant to ABT-737 treatment (40). As activation of the intrinsic apoptoticpathway is regulated by the functional interaction betweenprosurvival Bcl-2 and proapoptotic BH3-only proteins, cellsin which prosurvival Bcl-2 family proteins are largely boundby BH3-only proteins are considered to be "primed" forapoptosis mediated by ABT-737 (40). Cells that expressprosurvival Bcl-2 proteins at levels that exceed the capacityof endogenous BH3-only proteins to bind them may beconsidered to be "unprimed" and therefore less sensitiveto single agent ABT-737 treatment (40). It therefore followsthat an agent capable of increasing the expression or activityof BH3-only proteins, and/or decreasing the expression/activity of prosurvival Bcl-2 family members, may sensitize"unprimed" tumor cells to ABT-737–mediated apoptosis(Supplementary Fig. S8A). Consistent with this model, com-bining ABT-737 with proapoptotic stimuli such as conven-tional chemotherapeutic drugs, g-irradiation and novel"targeted" small molecule and biological agents can inducesynergistic apoptosis in tumor cells that are relatively resis-tant to single agent treatment (39).

HDACi and ABT-737 used in combination can inducesynergistic tumor cell apoptosis (15, 41). We have showedthat vorinostat-mediated induction of bim may be importantfor the single agent apoptotic and therapeutic activity ofvorinostat (3) and bim was important for the combinedactivities of suberoyl bis-hydroxamic acid (SBHA) and ABT-737 in human tumor cell lines (41). However, as we clearlyshowed herein, knockout of bim had no effect on the ability ofthe vorinostat/ABT-737 combination to kill Em-myc/bcl-2lymphomas even though bim was induced by vorinostat atboth the mRNA and protein level. In contrast, knockout orknockdown of bmf impaired synergistic tumor cell apoptosisinduced by vorinostat and ABT-737. In Em-myc/bcl-2 lympho-mas, Bmf was robustly sequestered by Bcl-2 however, uponaddition of ABT-737, Bmf was rapidly released from Bcl-2,presumably as a result of avid binding of ABT-737 to Bcl-2.Bmf was then free to interact with Mcl-1 and possibly otherprosurvival Bcl-2 proteins (see Supplementary Fig. S8A). AsABT-737 is relatively ineffective against tumors expressinghigh levels of Mcl-1 (15), the ability of free Bmf to interact withthis prosurvival Bcl-2 family member likely plays an importantand unexpected role in mediating the rapid death of vorino-stat-primed Em-myc/bcl-2 lymphomas following addition ofABT-737.

Expression of wild-type p53 was important for tumor celldeath mediated by the vorinostat/ABT-737 combination.Loss of function of p53 did not affect vorinostat-inducedexpression of BH3-only genes, however, the basal level expres-sion of p53-target genes puma, and in particular noxa, wassignificantly reduced. Noxa has exquisite binding specificityforMcl-1whereas Pumahas been showed tomore broadly bind

100

Actin

p19ARF

p53

Bmf0.001

Fol

d ex

pres

sion

cha

nge

0.01

0.1

1

10

Bad Puma Noxa

Etoposide+–+–+–

80

60

% A

nnex

in V

/PI–

posi

tive

40

Eµ-myc bcl-2

Eµ-myc/bcl-2*Eµ-myc/bcl-2

*Eµ-myc bcl-2Eµ-myc/noxa-/-/bcl-2

20

0Vorinostat (h)ABT-737 (h)

0 8

– –

16 p16 p16 p16 p16

**

**

**, P < 0.05

–

– 1 2 4 48 8

–

C

B

AEµ-m

yc/b

cl-2

*Eµ-m

yc/b

cl-2

Eµ-myc

/nox

a-/- /b

cl-2

Figure 7. Knockout of noxa inhibits robust apoptosis induced by thecombination of vorinostat and ABT-737. A, qRT-PCR analysis wasperformed on cDNA prepared from untreated Em-myc/bcl-2 and *Em-myc/bcl-2 cells using primers against the p53-regulated genes bad, noxa, andpuma. The bmf primer set served as a control. Results shown areexpressed as fold increase relative to a non-HDACi–regulated control geneRPL32 and is the mean of 3 independent experiments �SEM. B, Em-myc/bcl-2, *Em-myc/bcl-2, and Em-myc/noxa�/�/bcl-2 lymphoma cells wereincubated �20 nmol/L etoposide for 24 hours and assessed for p53pathway status by Western blotting using specific antibodies towards p53and p19ARF. Expression of b-actin served as a loading control. C, asynergistic cell death assay with Em-myc/Bcl-2, *Em-myc/Bcl-2, and Em-myc/noxa�/�/bcl-2 lymphoma cells was analyzed for sensitivity tovorinostat and ABT-737 in combination. Cell death was assessed by FACSanalysis of positive annexinV/PI staining (**, P < 0.05).






numerous prosurvival Bcl-2 proteins and additionally interactwith, and directly activate, Bax and Bak (40). Accordingly, weposit that decreased expression of puma and noxa through lossof p53 functionwould likely raise the "apoptotic threshold" thatis mediated primarily through the intrinsic pathway (Supple-mentary Fig. S8B). Clearly p53 has tumor suppressor andapoptotic functions that are independent of puma and/or noxa(42), however, in the context of synergistic apoptosis mediatedby vorinostat and ABT-737, loss of noxa alone was sufficient toblunt the apoptotic effects of the combination. The ability ofNoxa to selectively interact with Mcl-1 with high affinity (29)likely underpins the important role of noxa in mediatingoptimal tumor cell death by vorinostat and ABT-737. Indeed,it appears that noxa plays an important role in synergisticapoptosis mediated by ABT-737 and a range of other antic-ancer agents. For example, NOXA but not BIM was importantfor synergistic death of human melanoma cells mediated byABT-737 combined with antimelanoma drug imiquimod eventhough both BH3-only genes were induced by imiquimod (43).

The requirement for both bmf and p53 to mediate the mostpotent apoptotic response to the vorinostat/ABT-737 combi-nation was showed using Em-myc/Bcl-2 lymphomas withknockout or knockdown of bmf and a concomitant loss ofp53 function. Our data are consistent with a model wherebyBmf induction is important for vorinostat to "prime" cells forapoptosis mediated by ABT-737, whereas p53 activity lowersthe "apoptotic threshold" by maintaining elevated levels ofnoxa and possibly puma. These data provide importantmechanistic insight into the molecular events necessary forvorinostat to function synergistically with ABT-737. Moreover,our finding that Bmf was more important than was Bim, forpriming of Em-myc/Bcl-2 lymphoma cells by vorinostat forABT-737–induced apoptosis was unexpected, given that Bimhas broader binding specificity for prosurvival Bcl-2 proteinsthan does Bmf and, unlike Bmf, Bim has been reported todirectly activate Bax and Bak (40). This indicates that it is notsimply induction of any BH3-only gene that "primes" cells forapoptosis mediated by ABT-737, but rather specific BH3-onlyproteins, or combinations of BH3-only proteins may berequired for this process. This hypothesis is in agreementwith recent studies by Letai and colleagues that described"priming" as specific competitive interactions between 2 sub-classes of BH3-only proteins based on their ability to directlybind Bak and Bax (activators) or compete for binding ofprosurvival Bcl-2 family members (sensitizers). Letai andcolleagues suggested that primed cells undergo apoptosisvia specific release of activator BH3-only members allowingoligomerization of Bax and/or Bak (40).

Different ABT-737–sensitizing agents likely engage speci-fic BH3-only proteins to synergize with ABT-737, presumably

in a cell-type specific manner. Thus, in different cell typesacross and within species there are particular requirementsfor expression of activator BH3-only members such as Bimor sensitizer BH3-only members such as Bmf, with therelative number and levels of expression of BH3-only mem-bers from each subclass determining the state of cellularpriming. This was apparent when comparing our resultswith those of Chen and colleagues who showed a require-ment for Bim in mediating synergistic apoptosis by ABT-737and SBHA (41), whereas we showed that Bim was dispen-sable for apoptosis induced by the vorinostst/ABT-737combination. In addition, knockdown of NOXA attenuatedthe combined apoptotic effects of CPT-11 and ABT-737 inHCT16 cells but not in HT-29 cells whereas knockdown ofNOXA equivalently suppressed the synergistic effects ofbortezomib and ABT-737 in both cell lines (44).

These preclinical studies provide the most comprehensivefunctional link between tumor genotype and the apoptoticand therapeutic effects of HDACi combined with ABT-737.Our work provides the basis for the rational use of thiscombination in the clinic and identifies potential biomarkerssuch as HDACi-mediated induction of bmf and p53 status toputatively predict likely therapeutic efficacy.

Disclosure of Potential Conflicts of Interest

R.W. Johnstone: commercial research grant, Merck and Co. The otherauthors declared no potential conflicts of interest.

Acknowledgments

We thank Drs David Huang, Andreas Strasser, Jerry Adams, PhilippeBouillet and Suzanne Cory from the Walter and Eliza Hall Institute forhelpful advice and Eu-myc mice and cells. We thank Drs Scott Lowe, RossDickins, Saul Rosenberg, Steve Elmore, Alex Shoemaker and Victoria Richonfor helpful advice and providing reagents. Vorinostat was kindly provided byMerck, ABT-737 was kindly provided by Abbott Laboratories. We would liketo thank Dr Jessica Bolden, Ralph Rossi and Claudia Soratroi for discussionsand technical help.

Grant Support

R.W. Johnstone is a Principal Research Fellow of the National Health andMedical Research Council of Australia (NHMRC) and supported by NHMRCProgram and Project Grants, the Susan G. Komen Breast Cancer Foundation,the Prostate Cancer Foundation of Australia, Cancer Council Victoria, VictorianBreast Cancer Research Consortium, and the Australian Rotary Health Founda-tion. A. Villunger is supported by the AICR (grant no. 06-440) and the AustrianScience Fund (FWF). R.W. Johnstone received a collaborative research grantfrom Merck and Co. for research involving vorinostat.

The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received September 8, 2010; revised February 25, 2011; accepted March 3,2011; published OnlineFirst March 11, 2011.

References1. Bolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone

deacetylase inhibitors. Nat Rev Drug Discov 2006;5:769–84.2. Insinga A, Monestiroli S, Ronzoni S, Gelmetti V, Marchesi F, Viale A,

et al. Inhibitors of histone deacetylases induce tumor-selective apop-tosis through activation of the death receptor pathway. Nat Med2005;11:71–6.

3. Lindemann RK, Newbold A, Whitecross KF, Cluse LA, Frew AJ, Ellis L,et al. Analysis of the apoptotic and therapeutic activities of histonedeacetylase inhibitors by using a mouse model of B cell lymphoma.Proc Natl Acad Sci USA 2007;104:8071–6.

4. Kwon SH, Ahn SH, Kim YK, Bae GU, Yoon JW, Hong S, et al. Apicidin,a histone deacetylase inhibitor, induces apoptosis and Fas/Fas ligand

Wiegmans et al.





expression in human acute promyelocytic leukemia cells. J Biol Chem2002;277:2073–80.

5. Imai T, Adachi S, Nishijo K, Ohgushi M, Okada M, Yasumi T, et al.FR901228 induces tumor regression associated with induction of Fasligand and activation of Fas signaling in human osteosarcoma cells.Oncogene 2003;22:9231–42.

6. Nebbioso A, Clarke N, Voltz E, Germain E, Ambrosino C, Bontempo P,et al. Tumor-selective action of HDAC inhibitors involves TRAILinduction in acute myeloid leukemia cells. Nat Med 2005;11:77–84.

7. Sutheesophon K, Nishimura N, Kobayashi Y, Furukawa Y, Kawano M,Itoh K, et al. Involvement of the tumor necrosis factor (TNF)/TNF recep-tor system in leukemic cell apoptosis induced by histone deacetylaseinhibitor depsipeptide (FK228). J Cell Physiol 2005;203:387–97.

8. Vrana JA, Decker RH, Johnson CR, Wang Z, Jarvis WD, Richon VM,et al. Induction of apoptosis in U937 human leukemia cells by sub-eroylanilide hydroxamic acid (SAHA) proceeds through pathways thatare regulated by Bcl-2/Bcl-XL, c-Jun, and p21CIP1, but independentof p53. Oncogene 1999;18:7016–25.

9. Peart MJ, Tainton KM, Ruefli AA, Dear AE, Sedelies KA, O'Reilly LA,et al. Novel mechanisms of apoptosis induced by histone deacetylaseinhibitors. Cancer Res 2003;63:4460–71.

10. Ruefli AA, AusserlechnerMJ, BernhardD, Sutton VR, Tainton KM,KoflerR, et al. The histone deacetylase inhibitor and chemotherapeutic agentsuberoylanilide hydroxamic acid (SAHA) induces a cell-death pathwaycharacterized by cleavage of Bid and production of reactive oxygenspecies. Proc Natl Acad Sci USA 2001;98:10833–8.

11. Rosato RR, Almenara JA, Dai Y, Grant S. Simultaneous activation ofthe intrinsic and extrinsic pathways by histone deacetylase (HDAC)inhibitors and tumor necrosis factor-related apoptosis-inducingligand (TRAIL) synergistically induces mitochondrial damage andapoptosis in human leukemia cells. Mol Cancer Ther 2003;2:1273–84.

12. Mitsiades N, Mitsiades CS, Richardson PG, McMullan C, Poulaki V,Fanourakis G, et al. Molecular sequelae of histone deacetylase inhibi-tion in human malignant B cells. Blood 2003;101:4055–62.

13. Cory S, Adams JM. The Bcl2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2002;2:647–56.

14. Oltersdorf T, Elmore SW, Shoemaker AR, Armstrong RC, Augeri DJ,Belli BA, et al. An inhibitor of Bcl-2 family proteins induces regressionof solid tumours. Nature 2005;435:677–81.

15. Whitecross KF, Alsop AE, Cluse LA, Wiegmans A, Banks KM, Coo-mans C, et al. Defining the target specificity of ABT-737 and syner-gistic antitumor activities in combination with histone deacetylaseinhibitors. Blood 2009;113:1982–91.

16. BotsM, Johnstone RW. Rational combinations using HDAC inhibitors.Clin Cancer Res 2009;15:3970–7.

17. Ellis L, Bots M, Lindemann RK, Bolden JE, Newbold A, Cluse LA, et al.The histone deacetylase inhibitors LAQ824 and LBH589 do notrequire death receptor signaling or a functional apoptosome to med-iate tumor cell death or therapeutic efficacy. Blood 2009;114:380–93.

18. Scott CL, Schuler M, Marsden VS, Egle A, Pellegrini M, Nesic D, et al.Apaf-1 and caspase-9 do not act as tumor suppressors in myc-induced lymphomagenesis or mouse embryo fibroblast transforma-tion. J Cell Biol 2004;164:89–96.

19. Frenzel A, Labi V, Chmelewskij W, Ploner C, Geley S, Fiegl H, et al.Suppression of B-cell lymphomagenesis by the BH3-only proteinsBmf and Bad. Blood 2010;115:995–1005.

20. Michalak EM, Jansen ES, Happo L, Cragg MS, Tai L, Smyth GK, et al.Puma and to a lesser extent Noxa are suppressors of Myc-inducedlymphomagenesis. Cell Death Differ 2009;16:684–96.

21. Chou TC, Talalay P. Quantitative analysis of dose-effect relationships:the combined effects of multiple drugs or enzyme inhibitors. AdvEnzyme Regul 1984;22:27–55.

22. Konopleva M, Contractor R, Tsao T, Samudio I, Ruvolo PP, Kitada S,et al. Mechanisms of apoptosis sensitivity and resistance to the BH3mimetic ABT-737 in acute myeloid leukemia. Cancer Cell 2006;10:375–88.

23. van Delft MF, Wei AH, Mason KD, Vandenberg CJ, Chen L, CzabotarPE, et al. The BH3 mimetic ABT-737 targets selective Bcl-2 proteinsand efficiently induces apoptosis via Bak/Bax if Mcl-1 is neutralized.Cancer Cell 2006;10:389–99.

24. Zhang Y, Xing D, Liu L. PUMA promotes Bax translocation by bothdirectly interacting with Bax and by competitive binding to Bcl-X Lduring UV-induced apoptosis. Mol Biol Cell 2009;20:3077–87.

25. Han J, Flemington C, Houghton AB, Gu Z, Zambetti GP, Lutz RJ, et al.Expression of bbc3, a pro-apoptotic BH3-only gene, is regulated bydiverse cell death and survival signals. Proc Natl Acad Sci USA2001;98:11318–23.

26. Yakovlev AG, Di Giovanni S, Wang G, Liu W, Stoica B, Faden AI. BOKand NOXA are essential mediators of p53-dependent apoptosis. J BiolChem 2004;279:28367–74.

27. Frew AJ, Lindemann RK, Martin BP, Clarke CJ, Sharkey J, AnthonyDA, et al. Combination therapy of established cancer using a histonedeacetylase inhibitor and a TRAIL receptor agonist. Proc Natl AcadSci USA 2008;105:11317–22.

28. Puthalakath H, Villunger A, O'Reilly LA, Beaumont JG, Coultas L,Cheney RE, et al. Bmf: a proapoptotic BH3-only protein regulated byinteraction with the myosin V actin motor complex, activated byanoikis. Science 2001;293:1829–32.

29. Chen L, Willis SN, Wei A, Smith BJ, Fletcher JI, Hinds MG, et al.Differential targeting of prosurvival Bcl-2 proteins by their BH3-onlyligands allows complementary apoptotic function. Mol Cell 2005;17:393–403.

30. Schmitt CA, McCurrach ME, de Stanchina E, Wallace-Brodeur RR,Lowe SW. INK4a/ARF mutations accelerate lymphomagenesis andpromote chemoresistance by disabling p53. Genes Dev 1999;13:2670–7.

31. Eischen CM, Weber JD, Roussel MF, Sherr CJ, Cleveland JL. Dis-ruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced lymphomagenesis. Genes Dev 1999;13:2658–69.

32. Schmitt CA, Fridman JS, Yang M, Lee S, Baranov E, Hoffman RM,et al. A senescence program controlled by p53 and p16INK4acontributes to the outcome of cancer therapy. Cell 2002;109:335–46.

33. Oda E, Ohki R, Murasawa H, Nemoto J, Shibue T, Yamashita T, et al.Noxa, a BH3-only member of the Bcl-2 family and candidate mediatorof p53-induced apoptosis. Science 2000;288:1053–8.

34. Nakano K, Vousden KH. PUMA, a novel proapoptotic gene, is inducedby p53. Mol Cell 2001;7:683–94.

35. Yu J, Zhang L, Hwang PM, Kinzler KW, Vogelstein B. PUMA inducesthe rapid apoptosis of colorectal cancer cells. Mol Cell 2001;7:673–82.

36. Rasheed W, Bishton M, Johnstone RW, Prince HM. Histone deace-tylase inhibitors in lymphoma and solid malignancies. Expert RevAnticancer Ther 2008;8:413–32.

37. Ellis L, Pan Y, Smyth GK, George DJ, McCormack C, Williams-TruaxR, et al. Histone deacetylase inhibitor panobinostat induces clinicalresponses with associated alterations in gene expression profiles incutaneous T-cell lymphoma. Clin Cancer Res 2008;14:4500–10.

38. Newbold A, Lindemann RK, Cluse LA, Whitecross KF, Dear AE,Johnstone RW. Characterisation of the novel apoptotic and thera-peutic activities of the histone deacetylase inhibitor romidepsin. MolCancer Ther 2008;7:1066–79.

39. Cragg MS, Harris C, Strasser A, Scott CL. Unleashing the power ofinhibitors of oncogenic kinases through BH3 mimetics. Nat RevCancer 2009;9:321–6.

40. Letai AG. Diagnosing and exploiting cancer's addiction to blocks inapoptosis. Nat Rev Cancer 2008;8:121–32.

41. Chen S, Dai Y, Pei XY, Grant S. Bim upregulation by histone deace-tylase inhibitors mediates interactions with the Bcl-2 antagonist ABT-737: evidence for distinct roles for Bcl-2, Bcl-xL, and Mcl-1. Mol CellBiol 2009;29:6149–69.

42. Zilfou JT, Lowe SW. Tumor suppressive functions of p53. Cold SpringHarb Perspect Biol 2009;1:a001883.

43. Weber A, Kirejczyk Z, Potthoff S, Ploner C, Hacker G. Endogenousnoxa determines the strong proapoptotic synergism of the BH3-mimetic ABT-737 with chemotherapeutic agents in human melanomacells. Transl Oncol 2009;2:73–83.

44. Okumura K, Huang S, Sinicrope FA. Induction of Noxa sensitizeshuman colorectal cancer cells expressing Mcl-1 to the small-mole-cule Bcl-2/Bcl-xL inhibitor, ABT-737. Clin Cancer Res 2008;14:8132–42.






2011;71:3603-3615. Published OnlineFirst March 11, 2011.Cancer Res Adrian P. Wiegmans, Amber E. Alsop, Michael Bots, et al. Inhibitor Vorinostat and the BH3 Mimetic ABT-737Tumor Cell Apoptosis Mediated by the Histone Deacetylase Deciphering the Molecular Events Necessary for Synergistic

Updated version

10.1158/0008-5472.CAN-10-3289doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2011/03/11/0008-5472.CAN-10-3289.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/71/10/3603.full#ref-list-1

This article cites 44 articles, 24 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/71/10/3603.full#related-urls

This article has been cited by 12 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/71/10/3603To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-10-3289

http://cancerres.aacrjournals.org/content/suppl/2011/03/11/0008-5472.CAN-10-3289.DC1

http://cancerres.aacrjournals.org/content/71/10/3603.full#ref-list-1

http://cancerres.aacrjournals.org/content/71/10/3603.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/71/10/3603


Deciphering the Molecular Events Necessary for Synergistic ...€¦ · Bim, Bik, Bmf, Noxa, Puma, Hrk, Bad); and (iii) multidomain proapoptotic proteins (Bax, Bak, Bok; ref. 13).

Documents