CSE182-L12 Gene Finding
Jan 30, 2016
CSE182-L12
Gene Finding
Silly Quiz
• Who are these people, and what is the occasion?
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
Gene Features
ATG
5’ UTR
intron
exon3’ UTR
AcceptorDonor splice siteTranscription start
Translation start
DNA Signals
• Coding versus non-coding• Splice Signals• Translation start
ATG
5’ UTR
intron
exon3’ UTR
AcceptorDonor splice siteTranscription start
Translation start
PWMs
• Fixed length for the splice signal.• Each position is generated independently
according to a distribution• Figure shows data from > 1200 donor
sites
321123456321123456AAGAAGGTGTGAGTGAGTCCGCCGGTGTAAGTAAGTGAGGAGGTGTGAGGGAGGTAGTAGGTGTAAGGAAGG
MDD
• PWMs do not capture correlations between positions• Many position pairs in the Donor signal are correlated
MDD method
• Choose the position i which has the highest correlation score.
• Split sequences into two: those which have the consensus at position i, and the remaining.
• Recurse until <Terminating conditions>
MDD for Donor sites
Gene prediction: Summary
• Various signals distinguish coding regions from non-coding
• HMMs are a reasonable model for Gene structures, and provide a uniform method for combining various signals.
• Further improvement may come from improved signal detection
How many genes do we have?
Nature
Science
Alternative splicing
Comparative methods
• Gene prediction is harder with alternative splicing.• One approach might be to use comparative
methods to detect genes• Given a similar mRNA/protein (from another
species, perhaps?), can you find the best parse of a genomic sequence that matches that target sequence• Yes, with a variant on alignment algorithms that penalize
separately for introns, versus other gaps.
Comparative gene finding tools
• Genscan/Genie• Procrustes/Sim4: mRNA vs. genomic• Genewise: proteins versus genomic• CEM: genomic versus genomic• Twinscan: Combines comparative and
de novo approach.
Databases
• RefSeq and other databases maintain sequences of full-length transcripts.
• We can query using sequence.
De novo Gene prediction: Summary
• Various signals distinguish coding regions from non-coding
• HMMs are a reasonable model for Gene structures, and provide a uniform method for combining various signals.
• Further improvement may come from improved signal detection
How many genes do we have?
Nature
Science
Alternative splicing
Comparative methods
• Gene prediction is harder with alternative splicing.• One approach might be to use comparative
methods to detect genes• Given a similar mRNA/protein (from another
species, perhaps?), can you find the best parse of a genomic sequence that matches that target sequence• Yes, with a variant on alignment algorithms that penalize
separately for introns, versus other gaps.
Comparative gene finding tools
• Procrustes/Sim4: mRNA vs. genomic• Genewise: proteins versus genomic• CEM: genomic versus genomic• Twinscan: Combines comparative and
de novo approach.
Course
• Sequence Comparison (BLAST & other tools)• Protein Motifs:
– Profiles/Regular Expression/HMMs
• Protein Sequence Identification via Mass Spec.• Discovering protein coding genes
– Gene finding HMMs– DNA signals (splice signals)
Genome Assembly
DNA Sequencing
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
• DNA is double-stranded
• The strands are separated, and a polymerase is used to copy the second strand.
• Special bases terminate this process early.
• A break at T is shown here.
• Measuring the lengths using electrophoresis allows us to get the position of each T
• The same can be done with every nucleotide. Color coding can help separate different nucleotides
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
• Automated detectors ‘read’ the terminating bases.
• The signal decays after 1000 bases.
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
Sequencing Genomes: Clone by Clone
• Clones are constructed to span the entire length of the genome.
• These clones are ordered and oriented correctly (Mapping)
• Each clone is sequenced individually
Shotgun Sequencing
• Shotgun sequencing of clones was considered viable
• However, researchers in 1999 proposed shotgunning the entire genome.
Library
• Create vectors of the sequence and introduce them into bacteria. As bacteria multiply you will have many copies of the same clone.
Sequencing
Questions
• Algorithmic: How do you put the genome back together from the pieces? Will be discussed in the next lecture.
• Statistical? How many pieces do you need to sequence, etc.?– The answer to the statistical questions had
already been given in the context of mapping, by Lander and Waterman.
Lander Waterman Statistics
G
L€
G = Genome LengthL = Clone LengthN = Number of ClonesT = Required Overlapc = Coverage = LN/Gα = N/Gθ = T/Lσ = 1-θ
Island
LW statistics: questions
• As the coverage c increases, more and more areas of the genome are likely to be covered. Ideally, you want to see 1 island.• Q1: What is the expected number of islands?
• Ans: N exp(-c)• The number
increases at first, and gradually decreases.
Analysis: Expected Number Islands
• Computing Expected # islands.• Let Xi=1 if an island ends at position i,
Xi=0 otherwise.• Number of islands = ∑i Xi
• Expected # islands = E(∑i Xi) = ∑i E(Xi)
Prob. of an island ending at i
• E(Xi) = Prob (Island ends at pos. i)
• =Prob(clone began at position i-L+1
AND no clone began in the next L-T positions)
iL
T
€
E(X i) =α 1−α( )L−T
=αe−cσ
€
Expected # islands = E(X i) =i
∑ Gαe−cσ = Ne−cσ
LW statistics
• Pr[Island contains exactly j clones]?• Consider an island that has already begun. With
probability e-c, it will never be continued. Therefore• Pr[Island contains exactly j clones]=
€
(1− e−cσ ) j−1e−cσ
• Expected # j-clone islands
€
=Ne−cσ (1− e−cσ ) j−1e−cσ
Expected # of clones in an island
€
ecσ
Why?
Expected length of an island
€
Lecσ −1
c
⎛
⎝ ⎜
⎞
⎠ ⎟+ (1−σ )
⎡
⎣ ⎢
⎤
⎦ ⎥