Pyrosequencing™ is an established genetic analysis method based on the principle of sequencing by synthesis. It is the only genetic analysis method capable of delivering explicit sequence information within minutes. Pyrosequencing is an ideal choice for genetic analysis in clinical research. The output data from Pyrosequencing is the gold standard of genetic information: real sequence data. This is the best possible assurance of a correct genetic test. Pyrosequencing is brought to you by Biotage, a global company focused on life sciences. More information at www.biotage.com Chemistry PYROSEQUENCING – ONE HOUR TO EXPLICIT SEQUENCE DATA Pyrosequencing TM for quantitative analysis of CpG methylation G C A T CpG Methylation Analysis Among the numerous technologies for methylation analysis, Pyrosequencing represents a breakthrough by combining the processivity of PCR-based technologies with the ability to analyze all the individual CpGs of a given region. Pyrosequencing gives an unprecedented level of resolution in CpG methylation analysis, faster and easier than by tradi- tional methods. • High resolution quantification of individual sites • Built-in QC for bisulfite treatment • Flexible assays analyse almost any CpG site • Sensitive to less than 10% methylation • Results available 30 minutes after PCR Measure methylation at individual CpG sites Jean-Michel Dupont, Jörg Tost, Hélène Jammes, and Ivo Glynn Gut, Centre National de Genotypage, Evry, France. (Extracted from “De novo quantitative bisulfite sequencing using the pyrosequencing technology”, Analytical Biochemistry 333 (2004) 119-127). AGTCAGTCTAGTGATCAGTCTGATGAGTCTG 37.5 0.0 35.1 36.6 35.9 Pos 1 QC for Bisulfite treatment Pos 2 Pos 3 Pos 4 High level of reproducibility Figure 1. High resolution, highly reproducible CpG methylation analysis
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Pyrosequencing™ is an established genetic analysis method based on the principle of sequencing by synthesis. It is the only genetic analysis method capable of
delivering explicit sequence information within minutes. Pyrosequencing is an ideal choice for genetic analysis in clinical research. The output data from
Pyrosequencing is the gold standard of genetic information: real sequence data. This is the best possible assurance of a correct genetic test.
Pyrosequencing is brought to you by Biotage, a global company focused on life sciences. More information at www.biotage.com
Chemistry
P YRO S E Q U E N C I N G – O N E H O U R TO E X P L I C I T S E Q U E N C E DATA
PyrosequencingTM for quantitative analysis of CpG methylation
GCA TCpG Methylation Analysis
Among the numerous technologies for methylation analysis, Pyrosequencing represents a breakthrough by combining the processivity of PCR-based technologies with the ability to analyze all the individual CpGs of a given region.
Pyrosequencing gives an unprecedented level of resolution in CpG methylation analysis, faster and easier than by tradi-tional methods.
• High resolution quantification of individual sites
• Built-in QC for bisulfite treatment
• Flexible assays analyse almost any CpG site
• Sensitive to less than 10% methylation
• Results available 30 minutes after PCR
Measure methylation at individual CpG sites
Jean-Michel Dupont, Jörg Tost, Hélène Jammes, and Ivo Glynn Gut, Centre National de Genotypage, Evry, France. (Extracted from “De novo quantitative bisulfite sequencing using the pyrosequencing technology”, Analytical Biochemistry 333 (2004) 119-127).
A G T C A G T C T A G T G A T C A G T C T G A T G A G T C T G
37.5 0.0 35.1 36.6 35.9
Pos 1QC for Bisulfitetreatment
Pos 2 Pos 3 Pos 4High level of reproducibility
Figure 1. High resolution, highly reproducible CpG methylation analysis
Introduction
Pyrosequencing offers a powerful sequence-based analysis method to determine the level of methylation at CpG sites. Exploiting
Pyrosequencing’s unique combination of sequencing and quantification, CpG sites are rapidly analysed to give the individual degree of
methylation, which is then presented in the context of the underlying DNA sequence. Pyrosequencing improves virtually every aspect of
CpG methylation analysis: resolution, speed, accuracy and ease of use, and makes it possible to easily communicate and compare
methylation data. The application of the technology for CpG methylation analysis has been verified by several independent scientific
publications (see references).
Principle of Analysis Using the standard treatment of genomic DNA with
bisulfite (Clark et al, Figure 2), unmethylated Cytosine (C)
is converted to Uracil (U), whereas methylated Cytosine (mC)
remains unchanged. Using PCR, Uracil (U) is amplified to
Thymine (T), whereas methylated Cytosine (mC) is amplified
to Cytosine (C). Discrimination between mC and C is thereby
achieved by transforming mC and C to appear as a C/T SNP
(Figure 3).
Figure 2. Schematic diagram of the bisulfite conversion reaction (from Clark et al, 1994)
Figure 3. An example of a DNA sequence and its conversion by bisulfite treatment and further amplification by PCR. By Pyrosequencing, unmethylated Cytosine, C is measured as the relative content of T at the CpG site, and methylated Cytosine, mC, is measured as the relative content of C at the CpG site.
Preparation of DNA for PyrosequencingThe PCR reaction is performed with one biotinylated PCR primer, which facilitates the conversion of the PCR product to a single-stranded
DNA template suitable for Pyrosequencing. A sequencing primer is added, which anneals to the single stranded DNA template. The time
taken to prepare the DNA for Pyrosequencing is about 15 minutes and can be performed in parallel on 96 samples.
PyrosequencingPyrosequencing can quantify the ratio C/T accurately and reproducibly by sequential addition of the nucleotides (Figure 4). Cytosine is
dispensed to the DNA templates. If incorporation occurs, the intensity of emitted light is proportional to the quantity of incorporated
Cytosine. Then, the same reaction is carried out, this time dispensing Thymine and measuring the intensity of light produced (see Technical
Note 101 “The Principle of Pyrosequencing” for a full description of the detection process).
Figure 4. The Pyrosequencing reaction cascade generates light for every incorporated nucleotide, the intensity of which is proportional to the number of bases incorporated.
Pyrosequencing of the PCR product generates a so-called Pyrogram™, a pictorial representation of sequential nucleotide dispensations plot-
ted against the resultant measured light intensity (Figures 1 and 3). The Pyrogram displays both the nucleotide sequence (as peak sequence)
as well as a quantitative representation of the incorporation events (as peak heights). The degree of methylation is calculated from the peak
heights of C and T:
Workflow of Analysis of CpG methylation by Pyrosequencing
Assay ResultsResults of a typical CpG methylation analysis are presented in Figure 5.
This particular assay is designed to analyse methylation in Prader-Willi
(PWS) and Angelman (AS) Syndromes, genetic disorders caused by
deletions of an imprinted region on chromosome 15. Different degrees
of methylation distinguish PWS and AS from normal individuals. If the
maternal chromosome region is deleted, methylation is close to 0%,
and if the paternal chromosome region is deleted, methylation is close
to 100%. The orange shaded regions highlight the peaks resulting from
sequential dispensations of C and T from which methylation is
assessed.
Inbuilt Quality ControlsThe data generated by Pyrosequencing contain unique features that act
as quality controls. Firstly, the sequence data gives confirmation that
the analysis was made at the correct sites. Secondly, when the assay
includes analysis of a C not followed by a G, that C should be fully con-
verted to T (T =100 %). This acts as a useful quality control for the full
conversion of unmethylated C to T by the bisulfite treatment and PCR
reaction (blue columns in Figure 5).
ReferencesClark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res. 1994; 22(15): 2990-2997.
Explains the principle of bisulfite treatment and PCR amplification of DNA to differentiate between methylated and unmethylated cytosines.
Colella S, Shen L, Baggerly KA, Issa J-PJ, Krahe R. Sensitive and quantitative universal Pyrosequencing methylation analysis of CpG sites. BioTechniques,
Jul 2003; 35: 146-150.
Shows the use of a universal primer for CpG methylation, making the application inexpensive to use.
Dupont JM, Tost J, Jammes H, and Gut IG. De novo quantitative bisulfite sequencing using the pyrosequencing technology. Anal Biochem, Oct 2004;
333(1): 119-27.
Describes Pyrosequencing as a breakthrough for methylation analysis since it combines the processivity of PCR-based methods with resolving power for
individual quantification of CpG sites.
Tost J, Dunker J, Gut IG. Analysis and quantification of multiple methylation variable positions in CpG islands by PyrosequencingTM. BioTechnigues. Jul
2003; 35: 152-156. Proof statement of Pyrosequencing for CpG methylation, illustrating accuracy and the possibility to analyse multiple CpG sites
Uhlmann K, Brinckmann A, Toliat MR, Ritter H, Nürnberg P. Evaluation of a potential epigenetic biomarker by quantitative methyl-single nucleotide poly-
morphism analysis. Electrophoresis. 2002; 23: 4072-4079. Pioneering application of Pyrosequencing in CpG methylation analysis.
Yang AS, Estecio MR, Doshi K, Kondo Y, Tajara EH, Issa JP. A simple method for estimating global DNA methylation using bisulfite PCR of repetitive DNA
elements. Nucleic Acids Res. Feb 2004; 32(3): e38.
Pyrosequencing is applied to the analysis of repetitive DNA elements to assess global methylation content.
Prader Willi/Angelman
Figure 5. Methylation in normal DNA compared to individuals with Prader-Willi and Angelman syndromes
PyrosequencingTM systems are designed for Laboratory Use Only which means that they may be used for either research purposes or by high complexity CLIA certified labs.