Cooperative Regulation of Bovine Leukaemia Virus Gene Expression by Two Overlapping Open Reading Frames in the XBL Region

J. gen. Virol. (1988), 69, 797-804. Printed in Great Britain

Key words: BL V/en v gene expression/trans-activation

797

Cooperative Regulation of Bovine Leukaemia Virus Gene Expression by Two Overlapping Open Reading Frames in the XBL Region

By S. ITOHARA, T. TOMIYAMA, C. USHIMI AND K. SEKIKAWA*

Laboratory o f Biophysics, National Institute o f Animal Health, 3-1-1, KannondaL Tsukuba, Ibaraki 305, Japan

(Accepted 4 January 1988)

SUMMARY

Bovine leukaemia virus (BLV) induces syncytia in productively infected ovine and bovine monolayer cells. Expression of the env gene directly determines the syncytium- forming activity, since the expression of a cloned env gene directed by the simian virus 40 (SV40) early promoter efficiently induced syncytia in transfected ovine embryonic (OE) cells. However a BLV 10ng terminal repeat (LTR)-directed expression plasmid (pLTRenv) failed to induce syncytia in transfected OE cells, suggesting insufficient promoter activity of the LTR sequences. To assess the role of the XBL genes, which are located in the 3' distal region of the genome, in viral gene expression we constructed SV40 early promoter-directed expression plasmids. These contained open reading frames (ORFs) in the XBL region, and were examined for syncytium-inducing activity by cotransfection with pLTRenv. The results suggest that both XBL-I (the longest ORF: x-lor) and XBL-II (a shorter overlapping ORF: x-sot) are trans-acting genes which cooperatively activate LTR-directed viral gene expression.

INTRODUCTION

Bovine leukaemia virus (BLV) is the causal agent of enzootic lymphoproliferative diseases in cattle (Burny et al., 1980). The proviral genome structure of BLV is similar to that of human T cell leukaemia virus-I (HTLV-I), the causal agent of adult T cell leukaemia/lymphoma, and HTLV-II (Wong-Staal & Gallo, 1985). These viruses are characterized by the presence of novel overlapping open reading frames (ORFs) between the env gene and the Y long terminal repeat (LTR) region designated X (Seiki et al., 1983; Haseltine et al., 1984; Shimotohno et al., 1984; Sagata et al., 1985c).

The X region of these viruses is transcribed into subgenomic transcripts (XmRNA) by double- splicing mechanisms (Seiki et al., 1985; Sagata et al., 1985 b; Wachsman et al., 1985 ; Rice et al., 1987). The XmRNA encodes at least two distinct polypeptides using overlapping ORFs (x-lor: XBL-I and x-sor: XBL-II) (Sagata et al., 1985 a; Nagasbima et al., 1987; Rice et al., 1987). The X region contains transcriptional activator genes which are essential for sufficient expression from specific viral LTRs (Cann et al., 1985; Felber et al., 1985; Sodroski et aL, 1985; Rosen et al., 1986). The x-lor products of HTLV-I and BLV are sufficient for the LTR-directed expression of the bacterial chloramphenicol acetyltransferase (CAT) gene (Seiki et al., 1986; Katoh et al., 1987). However, a recent study by Inoue et al. (1987) suggested that the gene products of x-sor (p27 x-m) and x-lor (p40 x) of HTLV-I are both required for detectable expression of the viral gag gene. The XBL ORE-mediated regulation of BLV expression has not been fully characterized.

Ovine embryonic (OE) monolayer cells form syncytia on transfection with infectious molecular clones of BLV (Itohara & Sekikawa, 1987). By using the transfection-syncytium formation system, we have investigated the XBL ORF-dependent regulatory mechanisms.

0000-8044 © 1988 SGM

798 S. I T O H A R A A N D O T H E R S

( a )

V [ ~.~ t& 4, l kb I

1 + 4 I

pSVfsX-I

2+ C\6x" "~/O~ " ' t + 4

I '+-z. ~ pSVfsX-I-I1 ' l)

pSVX-IIfsX-I

(b)

pSVX-I-II pSVX-I

t ~ - OO

TGGGTTCCCTGGCGTTTGCTGAAAGCCTTCAAATGCCTAAAGAA ( ) . . . . . .

XBL-II(env) Met Pro Lys Glu

Sd I

CGACGGTCCCGAAGACGTCCACAA CCGATCATCAGATGGGTAA

Arg Arg Ser Arg Arg Arg Pro Gin Pro Ile lie Arg Trp XBL-I Met(Ala)

Fig. 1. Schematic representation of expression plasmids for the env gene and XBL ORFs (a). BLV sequences are indicated as open boxes with nucleotide numbers at each end and translation initiation and termination codons are marked, as well as Sd and Sa sites. Shaded boxes indicate SV40-derived sequences. Unique E c o R I and ClaI sites of pSVX-I and pSVX-I-II were used to generate frameshift mutations within XBL-I and XBL-1I. (b) Nucleotide sequences of the 5' end of ORFs in pSVX-I and pSVX-I-II. Deleted sequences are shown in parentheses.

Regulation o f B L V expression 799

METHODS

Construction of expression plasmids of the env gene and ORFs in the XBL region. To construct the env gene and XBL ORF expression plasmids, plasmid pSV2neo (Southern & Berg, 1982) was used as a vector. The BLV sequences were prepared from an infectious molecular clone (pB6490; Itohara & Sekikawa, 1987). All plasmid construction procedures were as described by Maniatis et al. (1982), and the structures were confirmed by extensive restriction endonuclease analysis and partial nucleotide sequencing. The enzymes used were purchased from Toyobo (Osaka, Japan).

The structures of the expression plasmids are schematically presented in Fig. 1. In plasmid pSVenv nucleotides 4789 to 6446 were inserted between the HindlII and Sinai sites of pSV2neo in the sense orientation by blunt end ligation. The nucleotide numbering corresponded to that of a completely sequenced BLV (Sagata et al., 1985c). This plasmid uses simian virus 40 (SV40)-derived sequences of the early promoter, the splicing junction and the transcription terminator. In plasmid pLTRenv, nucleotides 7925 to 1152 (EcoRI to Sail) containing LTR sequences and nucleotides 4118 to 6823 (HindlII to XbaI) containing the env gene were joined together with a Sall- HindlII linker and inserted in the sense orientation between the PvulI and HpaI sites of pSVneo-d by blunt end ligation. Plasmid pSV2neo-d is a derivative of pSV2neo in which the sequence from the BamHI site to the EcoRI site has been deleted. Plasmid pLTRenv uses an SV40-derived terminator. In plasmid pSVX-I-II nucleotides 4789 to 5087 (BgilI), containing initiation codons for the XBL-I and XBL-II reading frames and the splice donor site (Sd), and 7203 to 8247 (BamHI to PvulI), containing the coding region for XBL-I and XBL-II and the splice acceptor site (Sa), were joined at the BgilI and BamHI ends, and inserted in the sense orientation between the HindIII and HpaI sites of plasmid pSV2neo-d by blunt end ligation. The resultant plasmid uses the SV40-derived early promoter and terminator, and has intact sequences of both XBL-I (x-lor) and XBL-II (x-sor). The structure of plasmid pSVX-I was essentially the same as that of pSVX-I-II, but nucleotides 4789 to 4827, containing an initiation codon for the XBL-II frame, have been deleted (Fig. 1 b). Hence, pSVX-I has intact XBL-I sequences but lacks the initiation codon for XBL-II (Sagata et al., 1985b; Rice et al., 1987).

To create an XBL-I-specific mutation, the EcoRI site (nucleotide position 7294) of pSVX-I-II and pSVX-I was cleaved, a blunt end was formed by Klenow fragment treatment and the plasmids were religated. The resultant plasmids pSVX-II-fsX-I and pSVfsX-I have frameshift mutations in XBL-I caused by insertion of four base pairs. To mutagenize both XBL-I and XBL-II, the ClaI site (nucleotide position 7319) of pSVX-I-II was cleaved, a blunt end was formed by Klenow fragment treatment, and the plasmid was religated. The resultant plasmid pSVfsX-I-II has frameshift mutations of both XBL-I and XBL-II caused by the insertion of two base pairs.

Closed circular DNA of the plasmids was purified twice by caesium chloride-ethidium bromide centrifugation and stored at 4 °C until it was used for transfection assays.

DNA transfection assay. Ovine embryonic kidney cells (3.5 x l0 s) (Itohara & Sekikawa, 1987) were seeded in a 60 mm culture dish with growth medium (Dulbecco's modified Eagle's medium pH 7.2, 10 ~ foetal calf serum). On the next day, semi-confluent monolayers were transfected with 5 to 10 ~tg of DNA by the calcium phosphate coprecipitation method (Graham & Van der Eb, 1973) and incubated for 4 h in a 5 ~ COz incubator at 37 °C. Then the monolayers were washed once with serum-free medium, treated for 3 min with 25~ DMSO (Stow & Wilkie, 1976) at room temperature, washed three times with a medium containing 5 ~ foetal calf serum, and incubated with the growth medium at 37 °C in a 5~ COz incubator. On the next day, the monolayers were trypsinized and distributed into two 60 mm dishes containing an assay medium (Dulbecco's modified Eagle's medium pH 7.4, 10 foetal calf serum, 1 ~ DMSO, 4 gg of polybrene per ml) and then cultured for an additional 3 to 5 days. The monolayers were then stained with Giemsa solution, and examined under the microscope for the appearance of syncytia containing five or more nuclei.

RESULTS

The env gene directly determines syncytium-forming activity

In order to ident i fy the gene(s) responsible for the syncy t ium-forming ac t iv i ty o f BLV, we init ial ly cons t ruc ted a series o f defec t ive proviruses f rom plasmid pB6490 which carr ies an infect ious c i rcular provi ra l genome, and e x a m i n e d t h e m for syncy t ium-forming ac t iv i ty by D N A t ransfec t ion assay using O E cells. A l though a gag-pol dele t ion mu tan t showed syncyt ium- fo rming act iv i ty wi th an efficiency equ iva len t to that o f the wi ld- type genome, mutan t s hav ing a dele t ion or insert ion wi th in the env gene o r X B L region comple te ly lost the ac t iv i ty (data no t shown). The results suggest tha t the t r ans fec t ion - syncy t ium fo rmat ion system is sui table as a sensi t ive assay to de t e rmine the m e c h a n i s m s regula t ing express ion o f viral genes invo lved in syncyt ium format ion.

W e cons t ruc ted a series o f i ndependen t env and X B L O R F express ion plasmids as shown in Fig. 1. W h e n O E cells were t ransfec ted wi th these plasmids, s ignif icant syncyt ium fo rma t ion

800 S. ITOHARA AND OTHERS

Table 1. Trans-activation by the XBL ORF expression plasmids*

Plasmids No. of syncytia/dish A A r n f

Donor Test Expt. 1 Expt. 2 Expt.

pLTRenv None 0 ND~ ND pSVenv None 2055 ND ND None pSVX-I 0 ND ND N o n e pSVX-I-II 0 ND ND N o n e pSVfsX-I 0 ND ND N o n e pSVX-IlfsX-I 0 ND ND N o n e pSVfsX-I-II 0 ND ND pLTRenv pUC18 0 0 2 pLTRenv pSVX-I 1400 1250 3428 pLTRenv pSVX-I-II 1900 2580 6110 pLTRenv pSVfsX-I 0 0 2 pLTRenv pSVX-IlfsX-I 25 88 145 p L T R e n v pSVfsX-I - I I ND 0 0

pSVenv pUC18 3735 ND 5990 pSVenv pSVX-I 3550 ND 5910 pSVenv pSVX-I-II 3410 ND 5435

* OE cells were cotransfected with 5 Ixg each of donor and test plasmids per 60 mm dish. The transfected cells were cultured for 4 days in experiments (expt.) 1 and 2, and for 6 days in expt. 3.

t Average number of syncytia in two to four dishes. :~ ND, No data were obtained.

was observed in cells transfected with pSVenv (Table 1, Fig. 2a), but not with any ORF expression plasmids (Table 1, Fig. 2 c). The results clearly demonstrate that the env gene directly determines the syncytium-forming activity of BLV. However, pLTRenv, which is an LTR- directed env gene expression plasmid, failed to induce syncytia (Table 1, Fig. 2b); this failure could be due to insufficient activity of the LTR sequence as a promoter.

Both XBL-I and XBL-H encode trans-acting genes that activate LTR-directed expression of the env gene

To determine the role of XBL ORFs in env gene expression directed by the LTR, OE cells were cotransfected with the plasmid pLTRenv (5 ~tg/dish) and equal amounts of various ORF expression plasmids. As shown in Table 1, pSVX-I, which has only an intact XBL-I reading frame, and pSVX-I-II, which has intact XBL-I and XBL-II reading frames, induced efficient syncytium-forming activity of pLTRenv, pSVfsX-I, which has a frameshift mutation in XBL-I, and pSVfsX-I-II, which has frameshift mutations in XBL-I and XBL-II, failed to induce syncytia. However pSVX-IlfsX-I, which has an intact XBL-II sequence and a frameshift mutation in XBL-I, induced a small but significant number of syncytia. These results suggest that both XBL-I and XBL-II reading frames encode trans-acting genes which induce and/or enhance LTR-detected env gene expression. The number of syncytia produced by 5 ktg of pSVenv was slightly increased by the addition of pUC 18 as a carrier DNA in the precipitation mixture (Table 1, expt. 1). If XBL-I, or XBL-I and XBL-II were expressed by the SV40 promoter, the syncytium-forming activity of pSVenv was not influenced by cotransfection (Table 1), suggesting specificity of the trans-activation by these genes for the LTR.

Kinetics of trans-activation by XBL-I and XBL-H

To determine the modes of action of the trans-acting genes, we determined the dose-responses of the XBL ORF expression plasmids. Fig. 3 (a) shows the results of cotransfection with a constant amount of pLTRenv (5 p.g/dish) and various amounts of XBL ORF expression plasmids (50 pg to 500 ng/dish). The dose-response of pSVenv (50 ng to 5 ktg/dish) was also determined as a control. Plasmid pSVenv showed significant activity at 50 ng per dish and the

Regulation o f BL V expression 801

Fig. 2. Morphology of OE cells transfected with pSVenv (a), pLTRenv (b), pSVX-I-II (c) and salmon sperm DNA (d). The cells were fixed and stained with Giemsa solution 4 days after transfection. Bar marker represents 500 ktm.

activity increased linearly up to 5 I~g per dish. On the other hand, XBL ORF expression plasmids showed significant activity at very low concentrations. The number of syncytia induced increased linearly with increasing amounts of pSVX-I, pSVX-IlfsX-I and pSVX-I-II up to approximately 50 ng per dish, and reached a plateau. Plasmid pSVfsX-I-II did not show significant activity at any concentration.

Since pSVX-I-II showed higher activity than pSVX-I and pSVX-IlfsX-I, it is likely that XBL- I and XBL-II cooperatively activate the env gene expression directed by the LTR. To confirm the cooperative nature of the XBL-I and XBL-II genes, we conducted a cotransfection experiment with a constant amount of pSVX-I or pSVX-IlfsX-I (150 ng/dish, a concentration that caused maximum activity), and various amounts of pSVX-IlfsX-I or pSVX-I (0 to 500 ng/dish). As shown in Fig. 3(b), the basal activities of pSVX-I and pSVX-IlfsX-I were significantly increased by the addition of pSVX-IlfsX-I and pSVX-I, respectively. The activity of 1-5 ng of pSVX-I in the presence of pSVX-IlfsX-I was equivalent to that of 150 ng of pSVX-I without XBL-II. The maximum numbers of syncytia obtained by using the respective combinations were equivalent to those obtained by using pSVX-I-II. These results strongly suggest that XBL-I and XBL-II cooperatively activate LTR-directed env gene expression.

802 S. ITOHARA AND OTHERS

10 4

10 ~

e-

~ 10~'

d Z

I0'

~<10°? I 0.05

I ] I ' ] ' I ' I ' I

*/+/ , /

,(~) / / ' I ' I ' I

/ , , .o D - - " ~

I I I I I I t I i I ~ / / 1 I I I I I 0.5 5 50 500 5000 0 5 50 500

Test DNA added (ng/dish)

Fig. 3. Kineticana•ysis•ftrans-activati•nbyXBL-•andXBL-••.(a)•Ece••swerec•transfectedwitha constant amount of pLTRenv (5 lag/dish) and serially diluted pSVX-I (O), pSVX-II-fsX-I (O), pSVX-I- II ( I ) or pSVfsX-I-II (I-q). Plasmid pSVenv (A) was serially diluted (50 ng to 5 ~tg/dish) and used for transfection. (b) Plasmid pLTRenv (5 ~tg/dish) was used for cotransfection with pSVX-I (150 ng/dish) and serially diluted pSVX-IlfsX-I (0 to 500 ng/dish) (0). Plasmid pLTRenv (5 lag/dish) was used for cotransfection with pSVX-IlfsX-I (150 ng/dish) and serially diluted pSVX-I (0 to 500 ng/dish) (O). The final concentration Of the precipitation mixture was adjusted by adding pUC 18 DNA. Each point and small vertical bar represent the average number of syncytia from four dishes and the standard deviation.

DISCUSSION

An initial observation in this study was that transient expression of the env gene is sufficient to cause syncytium formation during BLV infection in the absence of viral spreading. This result clearly demonstrates that syncytium formation by BLV in OE cells is mediated by fusion from within. This syncytium-forming activity of the env gene used in the context of transfection experiments provides a sensitive, quantitative and simple assay, which does not require nucleic acid or protein extraction and secondary assay, to evaluate viral gene expression. Using the transfection-syncytium formation system, we investigated the mechanisms of regulation of viral gene expression mediated by ORFs in the XBL region. The reliable quantitative range of the assay system is zero to approximately 10000.

The expression of the env gene from pLTRenv is markedly enhanced by pSVX-I, which is expected to express only intact XBL-I products (38K protein; Sagata et al., 1985a), but not by pSVfsX-I, which has a + 4 frameshift mutation in XBL-I. The results demonstrate that XBL-I ( x - l o t ) is a t rans-ac t ing gene which is essential for the transient LTR-directed expression of the viral env gene and agree with results obtained for the CAT gene expression assay system in BLV (Katoh et al., 1987) and HTLV (Felber et al., 1985; Seiki et al., 1986). Furthermore, whereas pSVfsX-I and pSVfsX-I-II were completely unable to induce syncytium formation, pSVX-IlfsX- I, which has an intact XBL-II sequence and a frameshift mutation in the XBL-I sequence, showed a low but significant enhancing effect on syncytium formation (approximately one-tenth the activity of pSVX-I in Fig. 3 a). This suggests that XBL-II encodes a second t rans-ac t ing gene which enhances viral gene expression directed by the LTR. The product of this gene (a 19K phosphoprotein) has been detected in BLV-infected cells (Rice et al., 1987).

Regulation of BL V expression 803

The results of two series of kinetic analysis (Fig. 3 a, b) of the trans-activation system suggest that XBL-I is a major trans-activator gene, and that its activity is significantly enhanced by cooperation of a minor trans-activator gene (XBL-II). The XBL-II products enhanced the activity of the XBL-I products approximately fivefold.

It has been suggested that p40 x (x-lor) and p27 x-nl (x-sor) of HTLV are transcriptional and post-transcriptional activators respectively, and are both required for detectable expression of the gag gene of HTLV-I (Inoue et al., 1987). In their case, independent expression of p40 x or p27 x-m was not sufficient for detectable expression of the gag gene. In contrast, our results demonstate that independent expression ofXBL-I (x-lor) and XBL-II (x-sor) is able to induce or enhance env gene expression significantly. The discrepancy between the two experiments may be due to the difference in sensitivity of the assay systems used.

In any case, our results suggest that expression and replication of BLV is regulated by two trans-activator genes. Further analysis is necessary to elucidate the fine regulatory mechanisms of the BLV-coded trans-activator genes in the virus replication cycle.

We thank Dr T. Koyama for his comments on the manuscript . This work was partly supported by a grant from the Ministry of Agriculture, Forestry and Fisheries, and by special coordination funds for cancer research of the Science and Technology Agency.

R E F E R E N C E S

BURNY, A., BRUCK, C., CHANTRENNE, H., CLEUTER, Y., DEKEGEL, D., GHYSDAEL, J., KETTMANN, R., LECLERCQ, M., MAMMERICKX, M. & PORTETELLE, D. (1980). Bovine leukemia virus: molecular biology and epidemiology. In Viral Oncology, pp. 231-289. Edited by G. Klein. New York: Raven Press.

CANN, A. J., ROSENBLATT, J. D., WACHSMAN, W., SHAH, N. P. & CHEN, I. S. Y. (1985). Identification of the gene responsible for h u m a n T-ceU leukaemia virus transcriptional regulation. Nature, London 318, 571-574.

FELBER, B. K., PASKALIS, rL, KLEI~N-EWINO, C., WONG-ST~L, r. & PAVL~a, ZIS, G. N. (1985). The pX protein of HTLV-1 is a transcriptional activator of its long terminal repeats. Nature, London 229, 675-679.

GR~qAM, V. L. & VAN DER EB, A. J. (1973). A new technique for the assay of infectivity of h u m a n adenovirus 5 DNA. Virology 52, 456-467.

HASELTINE, W. A., SODROSKI, J., PATARCA, R., BRIGGS, D., PERKINS, D. & WONG-STAAL, F. (1984). Structure of 3'- terminal region of type II h u m a n T lymphotropic virus: evidence for new coding region. Science 225, 419--421.

INOUE, J., YosnIDA, M. & SEIKI, M. (1987). Transcriptional (p40 x) and post-transcriptional (p27 x-m) regulators are required for the expression and replication of h u m a n T-cell leukemia virus type I genes. Proceedings of the National Academy of Sciences, U.S.A. 84, 3653-3657.

ITon.~do, S. & SEKIKAWA, K. (1987). Molecular cloning of infectious proviral genomes of bovine leukemia virus. Virology 159, 158-160.

KATOH, I., YOSHINAKA, Y., SAGATA, N. & IKAWA, Y. (1987). The bovine leukemia virus X region encodes a trans- activator of its long terminal repeat. Japanese Journal of Cancer Research (Gann) 78, 93-98.

MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory.

NAGASHIMA, g., YosmoA, M. & SEIKI, M. (1987). A single species o f p X m R N A of h u m a n T-cell leukemia virus type I encodes tram-activator p40 x and two other phosphoproteins. Journal of Virology 60, 394-399.

RICE, N. R., SIMEK, S. L., DUBOIS, G. C., SHOWALTER, S. D., GILDEN, R. V. & STEPHENS, R. M. (1987). Expression of the bovine leukemia virus X region in virus-infected cells. Journal of Virology 61, 1577-1585.

ROSEN, C. A., SODROSKI, J. G., WILLEMS, L., KETTMANN, R., CAMPBELL, K., ZAYA, R., BURNY, A. & HASELTINE, W. A. (1986). The Y region of bovine leukemia virus genome encodes a trans-activator protein. EMBO Journal 5, 2585-2589.

SAGATA, N., TSUZUKU-KAWAMURA, J., NAGAYOSHI-AIDA, M., SHIMIZU, F., IMAGAWA, K-I. & IKAWA, Y. (1985a). Identification and some biochemical properties of the major XBL gene product of bovine leukemia virus. Proceedings of the National Academy of Sciences, U.S.A. 82, 7879-7883.

SAGATA, N., YASUNAGA, Y. & IKAWA, Y. (1985b). Two distinct polypeptides may be translated from a single spliced m R N A of the X genes of human T-cell leukemia and bovine leukemia viruses. FEBS Letters 192, 37-42.

SAGATA, N., YASUNAGA, Y., TSUZUKU-KAWAMURA, J., OHISHI, K., OGAWA, Y. & IKAWA, Y. (1985c). Complete nucleotide sequence of the genome of bovine leukemia virus: its evolutionary relationship to other retroviruses. Proceedings of the National Academy of Sciences, U.S.A. 82, 677-681.

SEIKI, M., HATTORI, S., HIRAYAMA, Y. & YOSHIDA, M. (1983). H u m a n adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proceedings of the National Academy of Sciences, U.S.A. 80, 3618-3622.

SEIKI, M., HIKIKOSHI, A., TANIGUCHI, T. & YOSHIDA, M. (1985). Expression of the pX gene of HTLV-1 : general splicing mechan i sm in the HTLV family. Science 228, 1532-1534.

SEIKX, M., INOUE, J., TAKEDA, T. & YOSHIDA, M. (1986). Direct evidence that p40 x of h u m a n T-cell leukemia virus type I is a trans-acting transcriptional activator. EMBO Journal 5, 561-565.

804 S. ITOHARA AND OTHERS

SHIMOTOHNO, K., W&CHSMAN, W., TAKAHASHI, V., GOLDE, D. W., MIWA, M., SUGIMURA, T. & CHEN, I. S. Y. (1984). Nucleotide sequence of the 3' region of an infectious human T-cell leukemia virus type II genome. Proceedings of the National Academy of Sciences, U.S.A. 81, 6657-6661.

SODROSKI, J., ROSEN, C., GOH, W. C. & HASELTINE, W. A. (1985). A t r ansc r ip t iona l ac t iva to r p ro te in encoded by the x- lor region of the human T-cell leukemia virus. Science 228, 1430-1434.

SOUTHERN, P. J. & BERG, P. (1982). Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. Journal of Molecular and Applied Genetics 1, 327 341.

STOW, N. D. & WlLKIE, N. M. (1976). An improved technique for obtaining enhanced infectivity with herpes simplex virus type 1 DNA. Journal of General Virology 33, 447-458.

WACHSMAN, W., GOLDE, D. W., TEMPLE, P. A., ORR, E. C., CLARK, S. C. & CHEN, 1. S. Y. (1985). H T L V x-gene p roduc t : requirement for the env methionine initiation codon. Science 228, 1534-1537.

WONG-STAAL, F. & GALLO, R. C. (1985). Human T-lymphotropic retroviruses. Nature, London 317, 395-403.

(Received 8 September 1987)