Cooperation between Aspirin-triggered lipoxin and nitric ...jpet.aspetjournals.org/content/jpet/early/2004/02/... · 2/4/2004 · generation experiments, 2.105 HUVEC were pre-incubated

Fiorucci et al. - 1

JPET/2003/063651

Cooperation between Aspirin-triggered lipoxin and nitric oxide (NO) mediates anti-adhesive properties of NCX-4016 (NO-aspirin) on

neutrophil-endothelial cell adherence

Stefano Fiorucci1, Eleonora Distrutti1, Andrea Mencarelli1, Giovanni Rizzo1, Anna Rita Di Lorenzo1, Monia Baldoni1, Piero del Soldato2, Antonio Morelli1 and John L. Wallace3

1Clinica di Gastroenterologia ed Epatologia, Dipartimento di Medicina Clinica e Sperimentale; Università degli Studi di Perugia, Perugia, Italy.

2Nicox SA, Sophia Antipolis, France; 3 Mucosal Inflammation Research Group, Faculty of Medicine, University of Calgary, Calgary, Alberta, T2N N1 Canada,

JPET Fast Forward. Published on February 4, 2004 as DOI:10.1124/jpet.103.063651

Copyright 2004 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651

at ASPE

T Journals on February 1, 2021

jpet.aspetjournals.orgD

ownloaded from

http://jpet.aspetjournals.org/

Fiorucci et al. - 2

Running title NO and ATL modulate anti-adhesive effect of NCX-4016

Address correspondence to Stefano Fiorucci, M.D. Clinica di Gastroenterologia ed Endoscopia Digestiva Policlinico Monteluce 06100 Perugia Italy FAX 011-39-075-5783687 Email address: [email protected] Number of text pages 27 Number of tables 0 Number of Figures 7 Number of references 41 Number of words in the Abstract 248 Number of words in the Introduction 550 Number of words in the Discussion 1073 Abbreviations ATL, Aspirin-triggered lipoxin or 15-epi-LXA4; COX-1 and COX-2, cyclooxygenase-1 and 2; HUVEC, human umbilical vein endothelial cells; LXA4, lipoxin A4; PMN, polymorphonuclear neutrophils; Recommended section Inflammation and immunopharmacology


at ASPE



ownloaded from


Fiorucci et al. - 3

NCX-4016 is nitric oxide (NO)-releasing derivative of aspirin that inhibits cyclo-oxygenase (COX) activity and releases NO. Acetylation of COX-2 by aspirin activates a transcellular biosynthetic pathway that switches eicosanoid biosynthesis from prostaglandin E2 to 15-epi-lipoxin (LX)A4 or Aspirin-Triggered Lipoxin (ATL). Here we demonstrate that exposure of neutrophil (PMN)/ human umbilical vein endothelial cell (HUVEC) co-cultures to aspirin and NCX-4016 triggers ATL formation and inhibits cell-to-cell adhesion induced by endotoxin (LPS) and interleukin (IL)-1β by 70-90%. However, while selective and non selective COX-2 inhibitors (celecoxib, rofecoxib and naproxen) or Boc-1, a LXA4 receptor antagonist, reduced the anti-adhesive properties of aspirin by ≈70%, anti-adhesive effects of NCX-4016 were only marginally affected (≈30%) by COX inhibitors and Boc-1, implying that COX-independent mechanisms mediates the anti-adhesive properties of NCX-4016. Indeed, NCX-4016 causes a long-lasting (up to 12 h) release of NO and cGMP accumulation in HUVEC. Scavenging NO with 10 mM haemoglobin, in the presence of celecoxib, reduced the anti-adhesive properties of NCX-4016 by ≈80%. Confirming a role for NO, the NO-donor DETA-NO also inhibited PMN/HUVEC adhesion by ≈80%. NCX-4016, but not aspirin, decreased DNA binding of NF-κB on gel shift analysis and HUVEC’s over-expression of CD54 and CD62E induced by LPS/IL-1β. Reduction of binding of the two NF-κB subunits, p50-p50 and p50-p65, was reversed by dithiothreitol, implying S-nitrosylation as mechanism of inhibition. In summary, our results support the notion that ATL and NO are formed at the PMN/HUVEC interface following exposure to NCX-4016 and mediate the anti-adhesive properties of this compound. Key words Aspirin-triggered lipoxin, cycloxygenase-2, Nitric oxide, nuclear factor (NF)-κB, CD54, CD62E


at ASPE



ownloaded from


Fiorucci et al. - 4

Adhesive interactions between leukocytes and endothelial cells and transmigration

through the endothelium junctions represent early events in physiological (e.g.

innate immune response) as well as pathological responses, such as

ischemia/reperfusion injury, atherosclerosis, transplant rejection and various

inflammatory disorders (Cotran and Mayadas-Norton, 1998). Adhesion of

polymorphonuclear leukocyte (PMN) to the endothelium increases vascular

permeability and favours cell transmigration into surrounding tissues (Carlos and

Harlan, 1994; Gimbrone et al., 1995). Cyclo-oxygenase (COX)-derived lipid

mediators regulate many aspects of adhesive interactions in vascular

inflammation and represent a major target for the therapeutic actions of

aspirin and non-steroidal anti-inflammatory drugs (NSAIDs) (Alpin et al., 1998;

FitGerald and Patrono, 2001; Patrono, 1994; Pillinger et al., 1998). In contrast to

NSAIDs, aspirin not only inhibits prostaglandin (PG) generation but can also

trigger lipoxin (LX) production (Claria and Serhan,1995). Thus, COX-2

acetylation by aspirin modifies its activity to generate 15R-hydroxyeicosatetraenoic

acid (15R-HETE), which can be oxygenated to produce 15(R) -epi-Lipoxin (LX)A4,

also termed aspirin-triggered LX or ATL (Claria and Serhan, 1995; Serhan, 2002;

Serhan and Oliw, 2001). Similarly to LXA4, ATL, exerts potent anti-inflammatory

actions acting as a braking signal to limit PMN chemotaxis and transmigration

across endothelial cell layers (Schottelius et al., 2002; Serhan, 2002; Serhan and

Oliw, 2001).

Nitric oxide (NO), synthesized from L-arginine by a family of constitutive

and inducible NO synthases, is a small, diffusible, highly reactive molecule that


at ASPE



ownloaded from


Fiorucci et al. - 5

serves a variety of functions in the cardiovascular system and accounts for most of

the endothelium-dependent vasodilation (Ignarro, 1990). In addition to controlling

vascular tone, NO also regulates adhesive interactions at the endothelium

surface (Ignarro, 1990). Thus, exposure of endothelial cells to NO inhibits E-

selectin, intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion

molecule-1 (VCAM-1) expression (De Caterina et al., 1995; Khan et al., 1996;

Kubes et al., 1994; Spiecker et al., 1997), limits the release of secretable

cytokines, IL-6 and IL-8 (Persoons et al., 1996), and prevents nuclear

translocation of nuclear factor (NF)-κB (De Caterina et al., 1995, Dela Torre et al.,

1997), suggesting that similar to LXA4 and ATL, NO might act as a braking

signal in regulating vascular inflammation.

NCX-4016 (2-(acetyloxy)benzoic acid 3-(nitrooxymethyl)phenyl ester) is

the prototype of a new class of anti-platelet and anti-inflammatory drugs obtained

by coupling a NO-releasing moiety to acetylsalicylic acid (Fiorucci and Del

Soldato, 2003; Fiorucci et al., 2000a; Fiorucci et al., 2002b; Fiorucci et al.,

2003; Wallace et al., Wallace et al., 2002). NCX-4016 inhibits COX-1 and COX-2

activity (Fiorucci and Del Soldato, 2003; Fiorucci et al., 2002a; Wallace et al.,

1999; Wallace et al., 2002) and triggers ATL formation in vivo (Fiorucci et al.,

2003). Previous studies in rodents have shown that NCX-4016 is more effective

than aspirin in preventing myocardial infarction and restenosis after carotid

angioplasty (Wallace et al., 2002). In contrast to aspirin, but similarly to NO

donors, NCX-4016 modulates the expression of tissue factor on monocytes

(Fiorucci et al., 2002a) as well as cytokine secretion from activated macrophages


at ASPE



ownloaded from


Fiorucci et al. - 6

(Fiorucci et al., 2000), thereby suggesting that both the aspirin and the NO

moiety contribute to its pharmacological activity.

The present study was designed to investigate whether NCX-4016

modulates endothelial cell/PMN interaction and identify molecular intermediates

of this effect. Since NO modulates NF-κB activity, we have examined whether

NCX-4016 has the ability to interfere with the binding of this transcription factor to

DNA in activated endothelial cells.


at ASPE



ownloaded from


Fiorucci et al. - 7

Methods

Materials. Aspirin, 1,4-dithio-D,L-threitol (DTT) lipopolysaccharide (LPS;

Escherichia coli 0111:B4 serotype), Nϖ-nitro-L-arginine methyl ester (L-NAME) and

Boc1 (N-t-butoxycarbonyl-methionine-leucine-phenylalanine) were from Sigma

Chemical (St. Louis, MO). Celecoxib was synthesized as previously described

(Fiorucci et al., 2003a). Rofecoxib (Nicoll-Griffith et., 2000) was synthesized by

Dr. Stefan Laufer (Department fur Pharmazie-Zentrum fur Pharmaforschung,

University of Tubingen, Germany) (Fiorucci et al., 2003a). Culture media and fetal

bovine serum were from GIBCO (Milan, Italy). Mouse anti-human monoclonal

antibodies anti-CD62E and anti-CD54 were from Immmunotech (Marseille,

France). Interleukin 1β from R&D Systems (Minneapolis, MN). DETA-NO, (z)-

1-[2-(2-aminoethyl)-N-(2-ammonioethyl)amino] diazen-1-ium-1,2 diolate and 1H-

[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ), were from Alexis (Milan, Italy).

HUVEC. Primary cultures of human umbilical endothelial cells (HUVEC) were

from Istituto Zooprofilattico of Brescia (Brescia, Italy). HUVEC were grown in

endothelial basal medium supplemented with bovine brain extract (12 µg/ml),

human epithelial growth factor (10 ng/ml), hydrocortisone (1 µg/ml), penicillin (100

units/ml), streptomycin (100 µg/ml), and gentamycin (5 µg/ml), at 37°C in a

humidified atmosphere containing 5% and 2% fetal bovine serum. Cells were used

between passages 2 to 5 as described previously (Fiorucci et al., 2003a).


at ASPE



ownloaded from


Fiorucci et al. - 8

PMN Isolations. Fresh peripheral blood was isolated from healthy donors who

had refrained from taking anti-inflammatory drugs or other medications for at

least 2 weeks. Neutrophils (PMN) were isolated using standard dextran

sedimentation and gradient separation on Histopaque-1077 (Sigma Chemical Co.

St Louis, MO) as described previously. This procedure yields a PMN population

that is 95-98% viable (trypan blue exclusion) and 98% pure (acetic acid-crystal

violet staining).

PMN-HUVEC Co-Cultures. HUVECs were seeded on gelatin-coated, 24-well

plates for 48 hours. Confluency was confirmed by microscopical inspection before

each experiment. Confluent cells were then incubated for 24 h in the presence of

10 ng/ml IL-1β and 10 ng/ml LPS (Claria and Serhan, 1996). For eicosanoid

generation experiments, 2.105 HUVEC were pre-incubated with 100 µM aspirin

or NCX-4016 for 5 hours and then for 30 minutes with 5 µM A23187 and 20 µM

arachidonic acid (AA) and then coincubated with 2.106 PMN for further 30 min

(Claria and Serhan, 1996). To inhibit COX-2 activity, 100 µM celecoxib, 10 µM

rofecoxib and 100 µM naproxen were added directly to HUVEC, and cells pre-

incubated for 20 minutes before addition of PMN. In experiments were Boc-1,

was used, this agent was added directly to PMN/HUVEC co-cultures (Fiorucci et

al., 2003a; Perretti et al., 2001).

PMN-HUVEC Adhesion Assay. Freshly isolated PMN were washed twice with

labelling medium (RPMI 1640 plus 1% FBS) and then incubated for 1 h (37°C; 5%


at ASPE



ownloaded from


Fiorucci et al. - 9

CO2) with 51CrO4 (sodium salt; DuPont NEN, Boston, MA; 3-5 µCi/5 × 107 cells).

The labelled leukocytes were washed four times with labelling medium and then

resuspended in fresh labelling medium. For static adhesion assays, 50 µl of

labelled neutrophil suspension (1 × 107 cells) were added to each well of

endothelial cells (10:1 ratio of leukocytes to endothelial cells) and incubated for

30 minutes at 37°C on an orbital shaker at 90 rpm in the presence of aspirin or

NCX-4016. At the end of the incubation period, the medium from each well was

aspirated and saved for radioactive counting. The monolayer was gently washed

three times with cold PBS to remove loosely adherent or unattached neutrophils;

collected washes were combined with medium and counted, yielding a measure of

nonadherent leukocytes. After the final wash, monolayers were lysed for 1 h with

1 M NaOH; counting of the lysate [in counts/min (cpm)] yielded a measure of

adherent leukocytes. Adhesion was quantified as follows: %PMN

adherence = lysate (cpm)/[supernatant (cpm) + wash (cpm) + lysate (cpm)].

CD54 (ICAM-1) and CD62E (E-selectin) Expression. Surface expression of

adhesion molecules was quantified by flow cytometry. To investigate the

expression of CD54 and CD62E, activated HUVEC (18 hr in culture with

LPS/IL-1β) were incubated for 5 h aspirin or NCX-4016 with or without Hb, while

celecoxib was added 30 min cell harvesting by extensive wash and culture

trypsinization (Fiorucci et al., 2003a). HUVEC were identified by size (forward

and side scatter). After staining with specific antibodies, cells were washed twice

and incubated with FITC-conjugated sheep anti-mouse F(ab')2 secondary Ab


at ASPE



ownloaded from


Fiorucci et al. - 10

(1:400 dilution; Sigma Chemical Co.) for 45 min at 4°C. Stained cells were washed

once and fixed in 1% (v/v) formaldehyde in PBS. Flow cytometry was performed

on a Epics XL instrument (Coulter-Beckman, Milan, Italy). After gating out small

sized (i.e. noncellular) debris, 50,000 events were collected for each analysis. The

levels of CD54 and CD62E for each experiment were normalized against the

value of the isotype-matched control antibody (background).

15-epi-LXA4 (ATL) and PGE2 Assay. ATL concentrations were measured

using a commercially available assay (Neogen Corporation, Lansing MI)

following manufacturer’s instructions. The antibody used in this assay specifically

recognizes 15(R)-epi-LXA4, and has been characterized previously by us and

others (Chiang et al., 1998; Fiorucci et al., 2002b). The PGE2 assay of cell

supernatants was carried out in duplicate using a commercially available ELISA kit

(Cayman Chemical Co, Milan, Italy).

NO generation and Nitrite/nitrate Assay. NO formation was measured using a

2 mm NO-sensitive electrode connected to the ISO-NO Mark II meter (World

Precision Instruments, Inc. Sarasota, FL). The NO electrode was calibrated by

addition of known concentrations of NaNO2 under reducing conditions (Kl/H2SO4).

The nitrite/nitrate concentrations in cell supernatants was measured using a

commercially available EIA kit (Cayman Chemical, Co.)

Preparation of Nuclear Extracts. After stimulation with LPS, cells were washed

three times with ice-cold PBS, harvested, and resuspended in 0.5 ml of buffer A


at ASPE



ownloaded from



(20 mM HEPES pH 7.4, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 1

mM PMSF) and protease inhibitors: 5 µg/ml aprotinin, 5 µg/ml pepstatin A, 5 µg/ml

leupeptin or 1x Protease inhibitor cocktail (Roche, Milan, Italy). After 10 min

incubation on ice, 23 µl of 10% Nonidet P-40 was added and vigorously mixed for

15 s. Nuclei were separated from cytosol by centrifugation at 13,000 x g for 10 s.

The cytosolic proteins contained in the supernatant fraction were separated from

membrane by centrifugation 10’ at 13,000 x g (Haglund and Rothblum, 1987). The

pellet containing a nuclear proteins fraction has resuspended in 50 µl of buffer B

(20 mM HEPES pH 7.4, 1.5 mM MgCl2, 0.42 M NaCl, 1 mM EDTA, 1 mM DTT, 1

mM PMSF, 10% glicerol) and 1x Protease inhibitor cocktail (Roche). After 30 min

at 4°C, lysates were separated by centrifugation (13,000 x g, 30 s), and

supernatant containing nuclear proteins were transferred to new vials. The protein

concentration was measured using a protein dye reagent (Bio-Rad, Richmond,

CA) with BSA as standard, and samples used directly or stored at -80°C.

Electrophoretic Mobility Shift Analysis (EMSA). Probes used for EMSAs were

radiolabeled by [γ-32P]ATP end labeling with T4 polynucleotide kinase. Briefly, 10

pM of double strand oligonucleotide CAGTTGAGGGGACTTTCCCAGGC was end

labeled with [γ-32P]ATP for 60 min at room temperature before the kinase was

inactivated at 95 °C for 5 min. The labeled probe was purified from unincorporated

nucleotides by using a QuickSpin column (G-25, Gibco) following the

manufacturer's instructions. The specific activities of 32P-labeled oligoprobe were

measured by beta counter. For EMSAs, 6-10 µg of nuclear extracts were


at ASPE



ownloaded from



incubated in a total volume of 20-25 µl of binding buffer (50 mM NaCl, 10 mM Tris

pH 7.4, 0.5 mM EDTA, 1 mM PMSF, 1 µg of poly(dI-dC), and 5% glycerol) for 20

min at room temperature with 50,000 cpm (50 fmoli) of labeled probe. For

competition assays, 20X excess of unlabeled oligonucleotides were pre-incubated

for 15 min prior to the addition of the radiolabeled probe. For antibody-mediated

supershift assays, extracts were pre-incubated with 5 µl of NF-kB subunit anti-p50

(Santa Cruz Biotechnology, Santa Cruz, CA) at room temperature for 10 min

before the addition of the radiolabeled probe. The reactions were loaded on a 6%

polyacrylamide non denaturing gel in 0.5× Tris-borate-EDTA, electrophoresed for 2

h at 170 V before drying (1 h at 80 °C) and exposed to autoradiographic film.

Statistical Analysis. All data are presented as the mean ± SEM. Comparisons

of groups of data were performed using a one-way analysis of variance (ANOVA)

followed by the Tukey post-hoc test. An associated probability (P value) of less

than 5% was considered significant.


at ASPE



ownloaded from



Results

As illustrated in Figure 1a, exposure of LPS/IL-1β-primed HUVEC

to aspirin and NCX-4016 for 5 h resulted in a concentration-dependent inhibition

of PMN/HUVEC adhesion. At the dose 100 µM, aspirin and NCX-4016 reduced

adhesive interactions by 70-90% (n=8; P<0.001 versus LPS/IL-1β). To dissect

mediators involved in the inhibitory effect of aspirin and NCX-4016, HUVEC were

incubated with celecoxib and rofecoxib, two selective COX-2 inhibitors, or

naproxen, a non selective COX-2 inhibitor, and PMN adhesion assessed. As

shown in Figure 1b, 100 µM celecoxib, 10 µM rofecoxib and 100 µM naproxen

each caused a 60-70% reversion of antiadhesive properties of aspirin (n=8;

P<0.001 versus aspirin). In contrast, celecoxib, rofecoxib and naproxen,

caused 20-30% inhibition of the anti-adhesive activity of NCX-4016 (Figure 1b;

n=8; P<0.05 versus NCX-4016), suggesting that COX-independent mechanisms

are also involved in the anti-adhesive properties of this drug.

Exposure of HUVEC to LPS/IL-1β for 24 h induced COX-2 expression

as assessed by RT-PCR (Figure 2a) and significantly enhanced generation of

PGE2 in comparison with untreated cells (n=8; P<0.001). Aspirin and NCX-

4016 (100 µM reduced PGE2 concentrations by ≈80% and triggered the

formation of ATL (Figure 2b and c; n=8; P<0.01 versus LPS/IL-1β alone).

Treatment of the PMN/ HUVEC co-culture with 100 µM celecoxib, 10 µM

rofecoxib or 100 µM naproxen abrogated ATL generation induced by aspirin

and NCX-4016 (n=8, P<0.01 versus aspirin and NCX-4016 alone) and further

inhibited PGE2 synthesis (n=8, P<0.01 versus aspirin and NCX-4016 alone).


at ASPE



ownloaded from



The role of ATL in mediating anti-adhesive effects of NCX-4016 and apsirin was

further investigated using Boc-1, a LXA4 receptor antagonist (Fiorucci et al.,

2002b; Fiorucci et al., 2003a; Perretti et al., 2001). Thus, as shown in Figure 2d,

exposure of PMN/HUVEC co-cultures to Boc-1 reduced anti-adhesive effect of

aspirin by ≈ 60% (n=8, P<0.01 versus aspirin alone), while was only partiallt

effective in modulating anti-adhesive properties of NCX-4016 (n=8, P<0.05 versus

NCX-4016 alone).

As shown in Figure 3a-c, culturing HUVEC with LPS/IL-1β, increased

NO2/NO3 release in cell supernatants, a measure of NO formation, as well as

intracellular cGMP concentrations (n=8; P<0.01 versus basal). While 5 h

incubation with 100 µM aspirin had no effect on the rate of NO formation, addition

of 100 µM NCX-4016 significantly enhanced NO2/NO3 generation (Figure 3a and

b; n=8; P<0.01 versus LPS/IL-β). This finding was further confirmed by assessing

NO formation with a NO-sensitive electrode. Thus, as shown in Figure 3c,

exposure to 100 µM NCX-4016 resulted in a long-lasting (up to 12 h) release of

NO (n=8; P<0.01 versus LPS/IL-β).

Figure 4a demonstrates that exposure to L-NAME, a non-selective NOS

inhibitor, and to a lesser extent to ODQ, a guanylyl-cyclase inhibitor, enhanced

adhesion of PMN to LPS/IL-1β-primed HUVEC, suggesting that endogenous NO

provides an anti-adhesive background in this experimental setting (n=8; P<0.01

versus LPS/IL-1β). While inhibition of endogenous NO with L-NAME slightly,

≈20%, reduced anti-adhesive effects of aspirin (n=8, P>0.05 versus aspirin alone),

ODQ was not effective (n=8, P>0.05 versus aspirin alone). L-NAME and ODQ


at ASPE



ownloaded from



also failed to reverse inhibition of PMN/HUVEC adhesion caused by NCX-4016

(n=8, P>0.05 versus NCX-4016 alone), indicating that cGMP is not involved. In

contrast, Figure 4b, hemoglobin, 10 mM, a NO scavenger, significantly,

≈50%, attenuated the anti-adhesive properties of NCX-4016, but not of aspirin, and

when added in combination with celecoxib, or Boc-1 (Figure 4c), it reversed the

anti-adhesive properties of NCX-4016 by ≈70% (n=8, P<0.01 versus NCX-4016

alone). Confirming a role for NO, DETA-NO, 100 µM, also reversed in a Hb-

dependent manner PMN/HUVEC adhesion triggered by LPS/IL-1β (Figure 4d;

n=6;P<0.01 versus LPS/IL-1β).

Exposure of HUVEC to LPS/IL-1β significantly up-regulated the

expression of CD54 and CD62E (Figure 5a; n=8; P<0.01 versus control cells). This

effect was curtailed by 100 µM NCX-4016 (n=8, P<0.01 versus LPS/IL-1β). In

contrast to NCX-4016, aspirin was effective in reducing CD54 expression, but not

CD62E (n=8; P<0.05 versus LPS/IL-1β). Data shown in Figure 5b and c,

demonstrated that celecoxib abrogates the effect of aspirin on CD54 expression

(n=8; P<0.05 versus aspirin). Once again, scavenging NO with 10 mM

hemoglobin, in the presence of celecoxib, reversed the effect of NCX-4016 on

LPS/IL-β-induced CD54 and CD62E expression by 70-80% (n=8, P<0.05 versus

NCX-4016). As shown in Figure 6a, NCX-4016, but not aspirin, reduced CD54

and CD62E mRNA up-regulation induced by LPS/IL-1β, suggesting that

modulation of CD54 and CD62E expression was, at least partially, due to the

inhibition of gene transcription.


at ASPE



ownloaded from



Since the involvement of NF-κB in regulating the expression of CD54 and

CD62E is well established (Roebuck, and Finnegan, 1999), we then examined

whether aspirin and NCX-4016 modulates NF-κB activation induce by LPS/IL-

1β. As shown in figure 6b, treatment of HUVEC with LPS/IL-1β alone induced the

specific NF-κB DNA binding activity of the p50-p50 homodimer and the p50-p65

heterodimer. This effect was inhibited by treating HUVEC with 100 µM NCX-

4016, while aspirin at this concentration was ineffective. We have then examined

whether the NCX-4016-induced suppression of the NF-κB binding activity cells

could be reversed by the thiol-reducing agent dithiothreitol (DTT), and, as shown

in Figure 6c, we found that incubation of the NCX-4016-treated nuclear extract with

10 mM DTT gave ≈70% recovery of DNA binding activity of the p50-p50

homodimer under the experimental conditions used (n=4; P<0.01 versus NCX-

4016 alone). In contrast, DTT has no effect on aspirin-treated cells (Figure 6c).


at ASPE



ownloaded from



Discussion

ATL, a tetraene-containing eicosanoid, structurally related to LXA4, is

emerging as an endogenous braking signal for neutrophil function. Similarly to

glucocorticoids and NSAIDs it exerts potent anti-inflammatory activity with

significantly less, if any, side effects (Schottelius et al., 2002). ATLs exert

inhibitory effects on several inflammatory mechanisms, including cytokine and

chemokine generation (Gronert et al., 1998; Serrhan 2002; Serhan and Oliw,

2001), leukocyte responses to cytokines or to microbial stimulation (Gewirtz et

al., 1998; Takano et al., 1997), neutrophil and eosinophil migration, and cell

surface expression of adhesion molecules P selectin and LFA-1 (Filep et al.

1999). ATL is generated by PMN and endothelial cells in response to aspirin,

particularly after these cells have been exposed to IL-1β, TNF-α or endotoxin

(Claria & Serhan 1995; Serhan 2002, Serhan and Oliw, 2001). In this pro-

inflammatory setting, aspirin acethylates while aspirin acetylates both COX-1

and COX-2 (Patrono 1994), and COX-1 acetylation results in irreversible

inhibition, acetylation of COX-2 leads to an enzyme that performs an incomplete

reaction transforming arachidonic acid into 15R-HETE (Figure 7), which is

released and transformed via transcellular routes to form ATL by leukocytes in

close proximity (Clarià and Serhan 1995; Serhan 2002; Serhan and Oliw, 2001).

In the present study we have demonstrated that, similar to aspirin, NCX-4016

inhibits cell-to-cell adhesion and triggers the formation of ATL from human

PMN/HUVEC co-cultures. Thus, despite the fact that NCX-4016 carries an ester


at ASPE



ownloaded from



substitution at its carboxylic acidic moiety, this molecule maintains the ability to

acetylate COX-2.

We have previously shown that selective COX-2 inhibitors, celecoxib

and rofecoxib, abrogate ATL synthesis (Fiorucci et al., 2003) and reverse

anti-adhesive effects of aspirin. We now demonstrated that not only celecoxib

and rofecoxib, but also naproxen, a non-selective COX-2 inhibitor, block ATL

formation confirming that selective and non-selective NSAIDs are equally

effective in inhibiting the acetylated and the non-acetylated form of COX-2

(Mancini et al., 1997). In parallel with inhibition of ATL formation, selective and

non-selective COX-2 inhibitors reduced by 60-70% the anti-adhesive activity of

aspirin, establishing a mechanistic link between ATL formation and anti-

adhesive properties of aspirin. Consistent with this view, Boc-1, a selective

LXA4 receptor antagonist (Perretti et al.,2001), also markedly attenuated the

anti-adhesive effects of aspirin.

In contrast to aspirin, COX-2 inhibition and ATL antagonism failed to

inhibit the adhesive properties of NCX-4016, suggesting that inhibition of that

COX-independent, NO-mediated, mechanisms are operational in cells exposed to

this drug. Indeed, the findings that exposure of HUVEC to NCX-4016 results in

NO formation and that anti-adhesive properties of NCX-4016 were significantly

reduced by hemoglobin, support this view (Fiorucci and Del Soldato, 2003;

Wallace et al., 2002). Anti-adhesive properties of NCX-4016 were insensitive to

L-NAME and ODQ suggesting that endogenously formed NO and cGMP were

not involved. In contrast, L-NAME partially reduced the anti-adhesive properties


at ASPE



ownloaded from



of aspirin, supporting the notion that NO is released by activated endothelial cells

providing an anti-adhesive background to limit cell-to-cell adhesion. NCX-4016

contains two active moieties, i.e. an aspirin-like and an NO-releasing moiety, that

contribute to its activity (reviewed in Wallace et al., 2002) However, the

finding that Hb, reverses anti-adhesive properties of NCX-4016, while celecoxib

did not, indicates that most of the anti-adhesive effects it exerts are mediated by

its NO-releasing moiety. Although, our data support the notion that NCX-4016

causes COX-2 acetylation (as measured by ATL formation), in vitro data

indicate that the kinetic of acetylation differs from that of aspirin suggesting

that NCX-4016 requires an extensive metabolism to generate free acetyl

salicylic acid (Del Soldato, unpublished).

Similarly to NO, NCX-4016 reduces the expression of adhesion

molecules on endothelial cells (De Caterina et al., 1995; Khan et al., 1996; Kubes

et al., 1994; Spiecker et al., 1997; Zampoli et al., 2000), and downregulates the

expression of CD54 and CD62E on activated HUVEC. This effect was only

partially reversed by celecoxib, but fully inhibited by the combination of a coxib with

hemoglobin, suggesting an NO-mediated pathway. The mechanisms through

which NO regulates adhesion molecule expression has not been completely

elucidated. Experimental evidence suggest that NO may inhibit the expression of

adhesion molecules through its interaction with NF-κB (De Caterina et al., 1995;

DeLatorre et al., 1997). NF-κB is a transcription factor involved in inflammation

that regulates synthesis of cytokines, cytokine receptors, and adhesion molecules

(Barnes and Karin, 1997). NF-κB transcription is sensitive to oxidative and


at ASPE



ownloaded from



nitrosative stress (Stamler et al., 1992). An oxidizing cytoplasmic environment is

typically associated with NF-κB activation, yet oxidation or nitrosation of the NF-κB

heterodimer (p50-p65) prevents DNA binding (Stamler et al., 1992; Marshall et al.,

2000). Matthews et al. have found that S-nitrosylation of the redox-sensitive

NF-κB p50 C62 residue is associated with inhibition of p50 homodimer and p50-

p65 heterodimer binding to their consensus DNA target sequence, resulting in a 4-

fold decrease in the equilibrium binding constant. We have now provided

evidence that, similar to NO, NCX-4016 inhibits NF-κB activity. At 100 µM, a

concentration that can be reached in vivo after a therapeutic dose of this

compound (Fiorucci et al., 2003b), NCX-4016 reduce p50-p65 and p50-p50

binding to DNA, suggesting that modulation of CD54 and CD62E expression could

be, at least in part, mediated by NF-κB inhibition. Inhibition of p50-p50 DNA

binding is due to S-nitrosylation, as demonstrated by the fact that removing NO by

incubation of nuclear extract with the thiol reducing agent DTT abrogates the

inhibitory effect of NCX-4016 (Fiorucci et al., 2000). Aspirin has previously been

shown to inhibit NF-κB binding to DNA (Kopp and Ghosh, 1994; Pillinger et al.,

1998) at millimor concentrations (5-10 mM). Thus the observation that NCX-

4016 inhibits NF-κB binding at micromolar concentrations adds to the concept

that NO and/or NO cooperating with ATL mediates the effect of NCX-4016 on the

transcription factor.

The expression of adhesion molecules after cytokine stimulation is

time dependent, requiring 2-4 h for CD62E and 6-8 h for ICAM-1 (De Caterina

et al., 1995). Thus, one might expect that prolonged NO release is necessary


at ASPE



ownloaded from



for an effective inhibition of gene transcription for such molecules. Indeed, we

demonstrated that exposure to NCX-4016 results in a prolonged release of

NO, which generates a lost-lasting “clamp” of NO at the endothelial cell

interface.

In conclusion, this study demonstrates that NCX-4016 acetylates COX-2

and switches prostanoid metabolism from PGE2 to ATL. NCX-4016 inhibits

nuclear binding of NF-κ B and suppresses CD54 and CD62E expression on

activated HUVEC. We propose that the ability of NCX-4016 to limit endothelial

activation is due to COX-dependent and -independent, NO-mediated,

mechanisms.


at ASPE



ownloaded from



References

Alpin AE, Howe S, Alahari SK & Juliano RL (1998) Signal transduction and signal modulation by cell adhesion receptors: The role of integrins, cadherins, immunoglobulin-cell adhesion molecules, and selectins. Pharmacol Rev 50: 197-263 Barnes P., and Karin, M. (1997) NF-κB: a pivotal transcription factor in chronic inflammatory disease. N. Engl. J. Med. 336:1066-1071 Carlos T, & Harlan J. (1994) Leukocyte-endothelial adhesion molecules. Blood. 84:2068-2101. Chiang, N., T. Takano, C. B. Clish, N. A. Petasis, H.-H. Tai, & C. N. Serhan. (1998). Aspirin-triggered 15-epi-lipoxin A4 (ATL) generation by human leukocytes and murine peritonitis exudates: development of a specific 15-epi-LXA4 ELISA. J. Pharmacol. Exp. Ther. 287: 779-790 Clària, J., & C. N. Serhan. (1995). Aspirin triggers previously unrecognized bioactive eicosanoids by human endothelial cell-leukocyte interactions. Proc. Natl. Acad. Sci. USA 92: 9475-9479. Cotran,R.S. and Mayadas-Norton,T. (1998) Endothelial adhesion molecules in health and disease. Pathol. Biol. (Paris), 46, 164–170. De Caterina R, Libby P, Peng H-B, Thannickal VJ, Rajavashisth TB, Gimbrone MA, Jr, Shin WS and Liao JK (1995) Nitric oxide decreases cytokine-induced endothelial activation. J Clin Invest 96: 60-68 DelaTorre A, Schroeder RA and Kuo PC (1997) Alteration of NF-kappa B p50 DNA binding kinetics by S-nitrosylation. Biochem Biophys Res Commun 238: 703-706 Filep JG, Zouki C, Petasis NA, Hachicha M, & Serhan CN. (1999). Anti-inflammatory actions of lipoxin A4 stable analogs are demonstrable in human whole blood: modulation of leukocyte adhesion molecules and inhibition of neutrophil-endothelial interactions. Blood 94: 4132-4142 Fiorucci S, and Del Soldato P. (2003) NO-aspirin: mechanism of action and gastrointestinal safety. Dig Liver Dis. 35 Suppl 2:S9-19. Fiorucci S, Distrutti E, Mencarelli A, Morelli A, Laufor SA, Cirino G, and Wallace JL. (2003a) Evidence that 5-lipoxygenase and acetylated cyclooxygenase 2-derived


at ASPE



ownloaded from



eicosanoids regulate leukocyte-endothelial adherence in response to aspirin. Br J Pharmacol. 139:1351-9. Fiorucci S, Mencarelli A, Meneguzzi A, Lechi A, Morelli A, del Soldato P, Minuz P. (2002a) NCX-4016 (NO-aspirin) inhibits lipopolysaccharide-induced tissue factor expression in vivo: role of nitric oxide. Circulation 106:3120-5. Fiorucci, S., Mendes De Lima, O., Mencarelli, A., Palazzetti, B., Distrutti, E., Mcknight, W., Dicay, M., Ma, L., Romano, M., Morelli, A., & Wallace, J.L. (2002b) COX-2 derived Lipoxin A4 increases gastric resistance to aspirin-induced damage. Gastroenterology 123:1598-1606. Fiorucci,S., Santucci, L., Cirino, G., Mencarelli, A., Familiari, L., Soldato, P.D., Morelli, A. (2000). IL-1 beta converting enzyme is a target for nitric oxide-releasing aspirin: new insights in the antiinflammatory mechanism of nitric oxide-releasing nonsteroidal antiinflammatory drugs. J Immunol. 165:5245-54 Fiorucci S, Santucci L, Wallace JL, Sardina M, Romano M, del Soldato P, and Morelli A. (2003b). Interaction of a selective cyclooxygenase-2 inhibitor with aspirin and NO-releasing aspirin in the human gastric mucosa. Proc Natl Acad Sci U S A. 100:10937-41. Fitzgerald Ga, & Patrono C. (2001). The coxibs, selective inhibitors of cyclooxygenase-2. N Engl J Med. 345:433-42. Gimbrone MA, Jr. (1995). Vascular endothelium in health and disease, in Molecular Cardiovascolar Medicine (Habers E ed) pp 49-61, Scientific American Medicine, New York. Gronert K, Martinsson-Niskanen T, Ravasi S, Chiang N, Serhan CN. (2001). Selectivity of recombinant human leukotriene D4, leukotriene B4, and lipoxin A4 receptors with aspirin-triggered 15-epi-LXA4 and regulation of vascular and inflammatory responses. Am J Pathol 158:3-9. Haglund RE, Rothblum LI. (1987). Isolation, fractionation and reconstitution of a nuclear extract capable of transcribing ribosomal DNA. Mol Cell Biochem. 73:11-20

Ignarro L. (1990). Biosynthesis and metabolism of endothelium-derived nitric oxide. Annu Rev Pharmacol Toxicol 30: 535-560


at ASPE



ownloaded from



Khan BV, Harrison DG, Olbrych MT, Alexander RW and Medford RM. (1996). Nitric oxide regulates vascular cell adhesion molecule-1 gene expression and redox-sensitive transcriptional events in human vascular endothelial cells. Proc Natl Acad Sci USA 93: 9114-9119

Kopp E,and Ghosh S. (1994). Inhibition of NF- B by sodium salicylate and aspirin. Science 265:956-959 Kubes, P., I. Kurose, D. N. Granger. (1994). NO donors prevent integrin-induced leukocyte adhesion but not P-selectin-dependent rolling in postischemic venules. Am. J. Physiol. 267:H931 Lecomte, M., Laneuville, O., Ji, C., Dewitt, D. L., & Smith W.L. (1994). Acetylation of human prostaglandin endoperoxide synthase-2 (cyclooxygenase-2) by aspirin. J. Biol. Chem. 269: 13207-13215. Mancini, J.A., Vickers, P.J., O'neill, G.P., Boily, C., Falgueyret, J.P., & Riendeau, D. (1997). Altered sensitivity of aspirin-acetylated prostaglandin G/H synthase-2 to inhibition by nonsteroidal anti-inflammatory drugs. Mol Pharmacol. 51: 52-60. Matthews JR, Nicholson J, Jaffray E, Kelly SM, Price NC, Hay RT. (1995). Conformational changes induced by DNA binding of NF-kappa B. Nucleic Acids Res. 23:3393-402. Nicoll-Griffith DA, Yergey JA, Trimble LA, Silva JM, Li C, Chauret N, Gauthier, JY, Grimm E, Leger S, Roy P, Therien M, Wang Z, Prasit P, Zamboni R, Young RN, Brideau C, Chan CC, Mancini J, Riendeau D. (2000). Synthesis, characterization, and activity of metabolites derived from the cyclooxygenase-2 inhibitor rofecoxib (MK-0966, Vioxx). Bioorg Med Chem Lett 10:2683-6 Patrono, C. (1994). Aspirin as an antiplatelet drug. N Engl J Med 330:1287-94.

Persoons JH, Schornagel K, Tilders FF, De Vente J, Berkenbosch F, Kraal G. (1996). Alveolar macrophages autoregulate IL-1 and IL-6 production by endogenous nitric oxide. Am J Respir Cell Mol Biol. 14:272- Perretti M, Getting Sj, Solito E, Murphy Pm, & Gao Jl. (2001). Involvement of the receptor for formylated peptides in the in vivo anti-migratory actions of annexin 1 and its mimetics. Am J Pathol 158:1969–1973. Pillinger MH, Capodici C, Rosenthal P, Kheterpal N, Hanft S, Philips MR & Weissmann G. (1998). Modes of action of aspirin-like drugs: Salicylates inhibit erk activation and integrin-dependent neutrophil adhesion. Proc Natl Acad Sci USA 95:14540–14545.


at ASPE



ownloaded from



Roebuck,K.A. and Finnegan,A. (1999). Regulation of intercellular adhesion molecule-1 (CD54) gene expression. J. Leukoc. Biol., 66, 876–888 Schottelius AJ, Giesen C, Asadullah K, Fierro IM, Colgan SP, Bauman J, Guilford W, Perez HD, Parkinson JF. (2002) An aspirin-triggered lipoxin A4 stable analog displays a unique topical anti-inflammatory profile. J Immunol. 169: 7063-70.

Serhan C. (2002). Lipoxins and aspirin-triggered 15-epi-lipoxin biosynthesis: an update and role on anti-inflammation and pro-resolution. Prostaglandins and Other Lipid Mediators 68-69: 433-455.

Serhan, C.N., & Oliw, E. Unorthodox routes to prostanoid formation: new twists in cyclooxygenase-initiated pathways. (2001). J. Clin. Invest. 107:1481-1489 Spiecker M, Peng HB and Liao JK (1997). Inhibition of endothelial vascular cell adhesion molecule-1 expression by nitric oxide involves the induction and nuclear translocation of IkappaBalpha. J Biol Chem 272: 30969-30974 Stamler JS, Simon DI, Osborne JA, Mullins ME, Jaraki O, Michel T, Singel DJ and Loscalzo J. (1992). S-Nitrosylation of proteins with nitric oxide: Synthesis and characterization of biologically active compounds. Proc Natl Acad Sci USA 89: 444-448 Takano, T., S. Fiore, J. F. Maddox, H. R. Brady, N. A. Petasis, & C. N. Serhan. (1997). Aspirin-triggered 15-epi-lipoxin A4 (LXA4) and LXA4 stable analogues are potent inhibitors of acute inflammation: evidence for anti-inflammatory receptors. J. Exp. Med. 185: 1693-704. Zampolli, A., G. Basta, G. Lazzerini, M. Feelisch, R. De Caterina. (2000). Inhibition of endothelial cell activation by nitric oxide donors. J. Pharmacol. Exp. Ther. 295:818 Wallace JL, Ignarro LJ, Fiorucci S. (2002). Potential cardioprotective actions of no-releasing aspirin. Nat Rev Drug Discov. 1:375-82 Wallace JL, Muscara MN, McKnight W, Dicay M, Del Soldato P, Cirino G. (1999). In vivo anti-thrombotic effects of NCX-4016: a nitric oxide-releasing aspirin derivative. Thromb Res. 93: 43-50.


at ASPE



ownloaded from



Figure legends

Figure 1. Panel a. Structure of NCX-4016. Panel b. NCX-4016 and aspirin

causes a concentration-dependent inhibition of cell-to-cell adhesion in

PMN/HUVEC co-cultures stimulated with 10 µg/ml LPS and 10 ng/ml IL-1β for 24

hr. Data are mean ± SE of 6 experiments. * P<0.001 versus LPS/IL-1β alone.

Panel c. COX-2-derived eicosanoids are required for anti-adhesive effects of

aspirin but not for the anti-adhesive properties of NCX-4016. Exposure of

PMN/HUVEC co-cultures to 100 µM celecoxib and naproxen or 10 µM rofecoxib,

abrogates anti-adhesive activities of NCX-4016 and aspirin. Data are mean ± SE

of 6 experiments. * P<0.001 versus control; ** P<0.0001 versus LPS/IL-1β alone.

Figure 2. COX-2 inhibition blocks ATL formation in PMN/HUVEC co-cultures.

Panel a. RT-PCR analysis of COX-1 and COX-2 expression in HUVEC

exposed to LPS and IL-1β. Symbols are: “bp” base pairs; Lane 1, positive

control (i.e. COX-1 or COX-2 positive cDNA); Lane 2, negative control (water);

Lane 3, control HUVEC; and Lane 4, HUVEC treated with 10 µg/ml LPS and 10

ng/ml IL-1β for 24 hr. The RT-PCR shown is representative of three others

showing the same pattern.

Panel b. Aspirin and NCX-4016 inhibits PGE2 generation in HUVEC/PMN co-

cultures. Data are mean ± 8 experiments. * P<0.01 versus cells incubated with

medium alone;** P<0.01 versus cells incubated with LPS/IL-1β.ψ P<0.01 versus

cells incubated with aspirin (ASA) or NCX-4016.


at ASPE



ownloaded from



Panel c. Aspirin (ASA) and NCX-4016 trigger ATL formation in HUVEC/PMN co-

cultures. Data are mean ± 8 experiments. * P<0.01 versus cells incubated with

medium alone or LPS/IL-1β;** P<0.01 versus cells incubated with aspirin or NCX-

4016.

Panel d. Boc-1 a selective LXA4 receptor antagonist reverses the anti-adhesive

activities of aspirin (ASA) but not of NCX-4016. Data are mean ± SE of 8

experiments. *P<0.001 versus control. ** P<0.01 versus LPS/IL-1β. ψ P<0.01

versus aspirin (ASA) and NCX-4016.

Figure 3 . Exposure of HUVEC to NCX-4016 (100 µM) results in NO formation

(panel a) and increased intracellular concentrations of cGMP (panel b). Data are

mean ± SE of 8 experiments. *P<0.01 versus control. **P<0.05 versus LPS/IL-1β.

Panel c. Time course of NO formation in HUVEC exposed to 100 µM NCX-4016.

Data are mean ± SE of 8 experiments. . *P<0.01 versus baseline. **P<0.01 versus

LPS/IL-1β.

Figure 4. Panel a. L-NAME and ODQ fail to reverse inhibition of PMN/HUVEC

adhesion induced by aspirin (ASA) and NCX-4016. Data are mean ± SE of 8

experiments. *P<0.01 versus medium. **P<0.05 versus LPS/IL-1β.ψ P<0.051

versus LPS/IL-1β.

Panel b. NO scavenging with Hb (10 mM) in the presence of celecoxib (100 µM)

reverses the anti-adhesive effect of NCX-4016. Data are mean ± SE of 8

experiments. *P<0.01 versus medium alone. **P<0.01 versus LPS/IL-1β.ψ P<0.05

versus aspirin (ASA) and NCX-4016.


at ASPE



ownloaded from



Panel c. NO scavenging with Hb (10 mM) in the presence of Boc-1 reverses the

anti-adhesive effect of NCX-4016. Data are mean ± SE of 8 experiments. *P<0.01

versus medium alone. **P<0.01 versus LPS/IL-1β.ψ P<0.05 versus NCX-4016 ;

and ψψ P<0.05 versus NCX-4016 plus Boc-1.

Panel d. DETA-NO, causes a Hb-sensitive, inhibition of PMN/HUVEC adhesion

induced by LPS/IL-1β. HUVEC were incubated for 3 h with 100 µM DETA-NO

before addition of PMN. Data are mean ± SE of 5 experiments. *P<0.01 versus

medium alone. **P<0.01 versus LPS/IL-1β.ψ P<0.05 versus DETA-NO.

Figure 5. Panel a. NCX-4016 down-regulates the expression of CD54 and

CD62E on LPS/IL-1β stimulated HUVEC. Activated HUVEC were incubated for 5h

aspirin or NCX-4016 with or without Hb, while celecoxib was added 30 min before

assessment of CD54 and CD62E expression by flow cytometry. Data are mean ±

SE of 8 experiments. *P<0.01 versus medium. **P<0.01 versus LPS/IL-1β.

Panel b and c. Celecoxib and the NO scavenger Hb abrogate the effect of NCX-

4016 on CD54 and CD62E induction caused by LPS/IL-1β. Data are mean ± SE of

8 experiments. *P<0.01 versus medium. **P<0.01 versus LPS/IL-1β. ψ P<0.05

versus aspirin (ASA) and NCX-4016

Figure 6. Panel a. NCX-4016 abrogates induction of CD54 and CD62E mRNA in

HUVEC monolayer exposed to LPS/IL-1β. Symbols are: “bp” base pairs; Lane 1,

positive control (i.e. CD54 and CD62E positive cDNAs); Lane 2, negative control

(water); Lane 3, HUVEC treated with 10 µg/ml LPS and 10 ng/ml IL-1β for 24 hr.;


at ASPE



ownloaded from



Lane 4, HUVEC treated with aspirin 100 µM; Lane 5, HUVEC treated with NCX-

4016 100 µM. The RT-PCR shown is representative of three others showing the

same pattern.

Panel b. NCX-4016 inhibits NF-κB binding to DNA. NF-κB DNA binding activity

was assayed in nuclear lysates of HUVEC after 6 h of treatment with LPS/IL-1β

alone or with aspirin (ASA) or NCX-4016 100 µM by EMSA (see Materials and

Methods). Treatment with LPS/IL-1β alone induces the specific NF-κB (p50-p50;

p50-65) DNA binding activity. This induction was partially reduced by aspirin

(ASA) but is almost completely abrogated with NCX-4016. Cells treated with

medium alone were used as control. The specificity of binding was examined by

competition with the addition of unlabeled/cold oligonucleotides, in 20X excess.

The EMSA shown is representative of three others showing the same pattern.

Lanes are: 1, LPS alone; 2, LPS plus ASA ; 3, LPS + NCX-4016; 4 control, 20 x

unlabelled/cold oligonucleotiode; 5, LPS plus anti-p50 mAb.

Panel c. DTT reverses inhibition of p50-p50 binding caused by NCX-4016. Data

are mean ± SE of 4 experiments. *P<0.01 versus medium. **P<0.01 versus

LPS/IL-1β. ψ P<0.05 versus NCX-4016.

Figure 7. Biosynthetic pathways involved in ATL formation.


at ASPE



ownloaded from


Fiorucci et al. Figure 1

0

2000

4000

6000

8000

10000 *

****

HU

VE

C/P

MN

adh

esio

n(c

pm

)

Medium LPS/IL-1β

Alone ASA NCX4016

0

5000

10000

15000

* **

**

**

Agent aloneCelecoxibRofecoxib

Medium LPS/IL-1β

Alone ASA NCX4016

ψ ψ

ψ ψ

Naproxen

ψ

ψ

*

PM

N/

HU

VE

C a

dhes

ion

(cpm

)

O

O

O

OONO2

a

b c

This article has not been copyedited and form

atted. The final version m

ay differ from this version.

JPET

Fast Forward. Published on February 4, 2004 as D

OI: 10.1124/jpet.103.063651

at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from



COX-2

COX-1

β-actin

Bp 1 2 3 4

0

100

200

300

400

500

600

700

800

*

**

*

Agent alone

Celecoxib

**

Medium LPS/IL-1 β

Alone ASA NCX4016

Rofecoxib

Naproxen

* *

ψ ψPG

E2

conc

entr

atio

n (p

g/m

l)

0

100

200

300

400

500

600

700

800

900

Medium LPS/IL-1 β

Alone ASA NCX4016

**

****

15R

-epi

-LX

A4

(pg/

mg)

0

2500

5000

7500

10000Agent alone Boc-1

* *

****

ψ

ψ

Medium LPS/IL-1β

Alone ASA NCX-4016

PM

N/H

UV

EC

adh

eren

ce(c

pm)

a

b

c

d




JPET


OI: 10.1124/jpet.103.063651




0

4

8

12

16

20 **

NO

2/N

O3

(µM

105 H

UV

EC

)

* *

0

100

200

300

400

500

**

*

Medium LPS/IL-1β

Alone ASA NCX-4016cG

MP

con

cent

rati

on(f

M 1

06 cel

ls)

0 2 4 6 8 10 120

100

200

300

400

500

600

700

800

NCX-4016 IL-1β/LPS ASA

Time (hr)

**

*

Intr

acel

lula

r N

O(a

rbit

rary

un

it)

a

b

c




JPET


OI: 10.1124/jpet.103.063651




0

5000

10000

Agent alone

Celecoxib

Celecoxib + Hb

Hb

**

**

Medium LPS/IL-1β

Alone ASA NCX-4016

**

ψ

****

ψψ

ψ

**

PM

N/H

UV

EC

adh

esio

n(c

mp)

0

5000

10000

15000 Agent alone L-NAME

Medium LPS/IL-1β

Alone ASA NCX-4016

*

**

ψψ

ψ

ODQ

ψ ψ

*

ψ

PM

N/ H

UV

EC

adh

esio

n(c

pm)

a b

0

2500

5000

7500

10000

PM

N/

HU

VE

C a

dhes

ion

(cpm

)

Medium LPS/IL-1β

Alone DETA-NO DETA-NO + Hb

*

**

ψ

d

0

2500

5000

7500

10000

Medium + + + + +LPS/IL-1β - + + + +NCX4016 - - + + +Boc-1 - - - + +Hb - - - - +

*

**

ψ

ψψ

PM

N/

HU

VE

C a

dhes

ion

(cpm

)

c




JPET


OI: 10.1124/jpet.103.063651



0

25

50

75

CD54 CD62E

*

**

0

10

20

30

40

50*

** ** **

Medium LPS/IL-1β

Alone ASA NCX-4016

CD

54

expr

essi

on(%

of p

ositi

ve H

UV

EC

) CD

62E expression

(% of positive H

UV

EC

)

0 10 20 30 40 50 60 70 80

CD54

CD62E

Control

LPS/IL-1β

Aspirin

Aspirin + celcoxib

Aspirin + Hb

Aspirin + celcoxib + Hb

ψ

ψ

**

**

**

0 10 20 30 40 50 60 70 80

Control

LPS/IL-1β

NCX-4016

NCX-4016 + celcoxib

NCX-4016 + Hb

NCX-4016 + celcoxib + Hb

CD54/CD62E expression(% of positive HUVEC)

**

****

ψψ

ψψ

ψψ

a

b

c





JPET


OI: 10.1124/jpet.103.063651



Bp 1 2 3 4 5


p50/p65

p50/p50

ba

0

250

500

750

1000

Alone DTT 20 mM

Medium LPS/IL-1β

Alone ASA NCX-4016

**

**

ψ

P50

/p50

bin

ding

(OD

)

c

CD54

CD62

β-actin

1 2 3 4 5




JPET


OI: 10.1124/jpet.103.063651



COOH

11 15

13

Arachidonic Acid

Cyclooxygenase

ASPIRIN or NCX-4016

PGH Synthase 15-R oxygenation

X

Prostaglandins

Aspirin-Triggered Lipoxin15-epi-LXA415-epi-LXA4

COX-1COX-1 COX-2COX-2

MembraneLipid Storage

Lipoxygenases

Lipoxins,Leukotrienes

1513

SH HR

1513

SH HR

Lipoxygenases




JPET


OI: 10.1124/jpet.103.063651



Cooperation between Aspirin-triggered lipoxin and nitric ...jpet.aspetjournals.org/content/jpet/early/2004/02/... · 2/4/2004 · generation experiments, 2.105 HUVEC were pre-incubated

Documents