Constitutive expression of high-affinity sulfate transporter (HAST) gene in Indian mustard showed enhanced sulfur uptake and assimilation

ORIGINAL ARTICLE

Constitutive expression of high-affinity sulfate transporter(HAST) gene in Indian mustard showed enhanced sulfuruptake and assimilation

M. Z. Abdin & M. Akmal & M. Ram & T. Nafis & P. Alam &

M. Nadeem & M. A. Khan & A. Ahmad

Received: 23 July 2010 /Accepted: 23 September 2010# Springer-Verlag 2010

Abstract Lycopersicon esculantum sulfate transporter gene(LeST 1.1) encodes a high-affinity sulfate transporter(HAST) located in root epidermis. In this study, the LeST1.1 gene was constitutively expressed in Indian mustard(Brassica juncea cv. Pusa Jai Kisan). Transgenic as well asuntransformed plants were grown in sulfur-insufficient (25and 50 μM) and sulfur-sufficient (1,000 μM) conditions for30 days. Two-fold increase was noticed in the sulfateuptake rate of transgenic plants grown in both sulfur-insufficient and -sufficient conditions as compared tountransformed plants. The transgenic B. juncea plants wereable to accumulate higher biomass and showed improvedsulfur status even in sulfur-insufficient conditions whencompared with untransformed plants. Chlorophyll content,ATP sulfurylase activity and protein content were alsohigher in transgenic plants than untranformed plants undersulfur-insufficient conditions. Our results, thus, clearlyindicate that constitutive expression of LeST 1.1 gene inB. juncea had led to enhanced capacity of sulfur uptake and

assimilation even in sulfur-insufficient conditions. Thisapproach can also be used in other crops to enhance theirsulfate uptake and assimilation potential under S-insufficientconditions.

Keywords Brassica juncea (L.) Czern. and Coss. .

Transgenic plants . Genetic transformation . Lycopersiconesculantum L. . Sulfate transporter . Sulfate uptake

Introduction

Sulfur (S) is an essential macronutrient for crops, used byplants in the form of sulfate. In recent years, S-deficiencyhas become a global problem resulting in a decrease in cropyield (Ahmad et al. 1999a). Generally, plants acquiresulfate from soil solution by their roots and then it isdistributed to different plant parts for assimilation. Appli-cation of fertilizers always is not a remedy for this problem(Hawkesford 2000). Oilseed rape has a high demand of Sfor incorporation in proteins and glucosinolates. Thedeficient S supplies can alter oil content and its fatty acidcomposition in the seeds of this crop (Ahmad and Abdin2000a). Several experiments have shown that variousspecies grown at suboptimal levels of S supply produceseeds with a modified storage protein composition. Theseseeds show a decrease in the S-rich proteins (Spencer et al.1990; Imsande and Schmidt 1998; Hitsuda et al. 2004).

The main targets to improve S utilization efficiency maysplit into two levels; the first level is aimed at improvingresource capture by enhancing S-uptake and assimilationsystem. The second level is aimed at efficient utilization ofthe S accumulated through increased uptake (Hawkesford2000). Hence, the sulfate uptake can be enhanced byimproving sulfate transporter system.

Handling Editor: Bhumi Nath Tripathi

Authors M. Z. Abdin and M. Akmal contributed equally to this work.

M. Z. Abdin :M. Akmal :M. Ram : T. Nafis : P. Alam :M. Nadeem :M. A. KhanDepartment of Biotechnology, Faculty of Science,Jamia Hamdard,New Delhi 110062, India

A. AhmadDepartment of Botany, Faculty of Science, Jamia Hamdard,New Delhi 110062, India

M. Z. Abdin (*)Centre for Transgenic Plant Development,Department of Biotechnology, Jamia Hamdard,New Delhi 110062, Indiae-mail: [email protected]

ProtoplasmaDOI 10.1007/s00709-010-0216-7

Phylogenetically, the plant sulfate transporter genefamily may be divided into four distinct subgroups assuggested by transport activity measurements using yeastcomplementation (Hawkesford 2003). Group 1 is bestcharacterized by their transport activity measurements.The transporters belonging to this group have Km lessthan 12 μM and high substrate affinity. They are mainlylocalized in roots and are responsible for the uptake ofsulfate from soil solution. They are up-regulated duringsulfur starvation. Group 2 sulfate transporters have Kmvalues of 0.41 mM and greater. They are responsible forvascular sulfate transport and up regulated at sulfurdeprivation like group 1 sulfate transporters. Group 3sulfate transporters are localized in leaf tissue. Group 4 ischaracterized by a c-terminal plastidial transit peptide, andit seems that these are directed to the vacuolar membrane(Smith et al. 1995, 1997; Takahashi et al. 1997, 1999, 2000;Yoshimoto et al. 2002).

Indian mustard, Brassica juncea L. is one of the world'smost important crops of vegetable oil and protein-rich meal.It is also used in food industry, condiments, hair industry,lubricants, bio-diesel, and, in some countries, as a substitutefor olive oil. Seed residues are used as cattle feed and infertilizers (Aoun et al. 2008). Researchers have workedtowards the development of canola-quality B. juncea sincethe early 1980s due to a number of advantages. Theadvantages of B. juncea over B. napus include morevigorous seedling growth, early maturing, high yield,quicker ground covering ability, and greater tolerance toheat and drought (Woods et al. 1991; Burton et al. 1999), aswell as for phytoremediation project, as it can effectivelyaccumulate heavy metals (Clemente et al. 2005; Qadir et al.2004). The sulfate transport system in Brassica split intotwo parts: nutritionally regulated and non-regulated parts.The regulated system is represented by the group 1, 2, and4 transporters and the non-regulated system by the group3 transporter. During sulfate deprivation, the group 1, 2,and 4 sulfate transporters up regulated to maximizeduptake, vacuole efflux, and vacuole transport of sulfate tothe growing shoot (Buchner et al. 2004). The mainproblem with B. juncea L. cv. Pusa Jai Kisan, however,is that, despite having low-affinity sulfate transporters, itsrequirement of sulfur for growth and yield is very high(Heiss et al. 1999; Ahmad et al. 2005). So it needs a high-affinity sulfate transporter (HAST), which can work alongwith other sulfate transporters during various growthstages of the crop to enhance sulfur uptake and assimila-tion. This study was, therefore, designed to constitutivelyexpress the LeST 1.1 gene encoding a high-affinity sulfatetransporter (HAST) in B. juncea cv. Pusa Jai Kisan so as todetermine its impact on sulfate uptake and assimilationpotential under both the S-insufficient and S-sufficientconditions.

Materials and methods

Transformation of B. juncea L. cv. Pusa Jai Kisan

Hypocotyl segments from in vitro germinated seedlings ofB. juncea L. cv. Pusa Jai Kisan were used as explant source.Surface-sterilized seeds were inoculated into 21×150 mmtubes (Borosil ) containing 12 ml of half-strength MS basalmedium (Murashige and Skoog 1962), supplemented with15 gL−1 sucrose and solidified with 7 gL−1 agar (Himedia,India) for germination. The cultures were incubated in anautomated culture room at 25±2°C, under dark conditionsfor 5 days. The hypocotyl portions of seedlings were cuttransversally into 0.5–0.8-cm segments and used in trans-formation experiments.

Agrobacterium tumefaciens strain LBA 4404 was main-tained on a selection plate containing solid YEM mediumsupplemented with 50 mgL−1 kanamycin at 4°C. Theplasmid pBin19, containing the nptII gene under thecontrol of nos promoter for selection on kanamycincontaining medium and LeST1.1 sulfate transporter(AF347613.1) representing group 1 type of sulfur trans-porter having high affinity for sulfate uptake (cloned fromtomato Lycopersicon esculentum Mill. line GCR218 byHowarth et al. 2003), was used to transform A. tumefaciensstrain LBA 4404 by freeze–thaw method (Hofgen andWillmitzer 1988) (Fig. 1). One single colony of transformedbacteria was inoculated into liquid YEM medium containing50 mgL−1 kanamycin for bacterial selection, and grownovernight at 28°C on an orbital shaker at 200 rpm. Bacteria(OD600 1.0) were harvested by centrifugation at 3,500 rpmfor 5 min and resuspended in filter sterilized liquid MS basalmedium.

Transgenic B. juncea lines were obtained via transfor-mation of hypocotyls through co-cultivation with A.tumefaciens LBA 4404 harboring pBin 19 containing LeST1.1 and nptII genes as described by Barfield and Pua(1991).

Molecular analysis of transgenic lines

Transgenic lines carrying LeST 1.1 gene were identifiedthrough PCR. The PCR primers used were as follows: theforward primer for npt II 5′GAGGCTATTCGGCTATGACTG3′ and reverse primer 5′ATCGGGAGCGGCGATACCGTA3′ and the forward primer for LeST1.1 5′CCCGGGGGATGAGTCATCGTGTGAATGAC3′ and reverse primer 5′GTCGACGGTCAAGGCTCCATTTTTGGAGC3′.

The PCR was performed in a reaction mixture (50 μL)consisting of 1× reaction buffer, 0.2 mM dNTPs, 20 pmolof each primer DNA, 0.5 μg template DNA and one unit ofTaq DNA polymerase (MBI Fermentas). The reactionmixture was heated at 94°C for 4 min for melting of

M.Z. Abdin et al.

template, followed by 32 cycles at 94°C for 1 minannealing at 57°C for 1 min and extension at 72°C for1 min. At the end of 32 cycles, an additional final extensionat 72°C for 5 min was carried out to extend any prematuresynthesis of DNA.

For Southern blot analysis, genomic DNA (10 μg)samples from transgenic and untransformed lines weredigested with salI, resolved on 0.8% agarose gel andblotted on a nylon membrane (Roche Diagnostics, USA).The blot was hybridized with digoxigenin labeled nptIIprobe at 47°C. The probe was labeled with digoxigeninusing the DIG High Prime DNA labeling and detection kit(Roche Diagnostics, USA). After a 16-h hybridizationperiod, the filter was washed at 65°C and the probedetected following the manufacturer's instructions. The linesshowing hybridization signal were designated as T1–T14

transgenic lines.Total RNA, isolated from transgenic and untransformed

shoots using the RNeasy Plant Mini Kit according to themanufacturer's instructions (Qiagen, Germany), was elec-trophoresed in 1.5% formaldehyde gel for checking thequality of RNA. It was, thereafter, subjected to RT-PCRanalysis using one-step RT-PCR kit (Qiagen, Germany) andprimers for LeST 1.1 gene. The RT-PCR was performed ina reaction mixture (50 μL) consisting of 1× OneStep RT-PCR buffer, 0.2 mM dNTPs, 20 pmol of each primer DNA,0.5 μg template RNA, and one unit of Omniscript® andSensiscript® reverse transcriptase (Qiagen, Germany). Thereaction mixture was first incubated at 50°C for 30 min inPCR for cDNA synthesis. After that, HotStarTaq DNAPolymerase is activated by heating the mixture at 95°C for15 min. This was followed by 42 cycles at 94°C for 1 minannealing at 57°C for 1 min and extension at 72°C for1 min. At the end of 42 cycles, an additional final extension

at 72°C for 5 min was carried out to extend any prematuresynthesis of DNA.

Plant culture

The transgenic and untransformed plants were analyzed forsulfur uptake efficiency, and S-assimilation potential. Four-week-old rooted green plants were carefully removed fromsolid MS medium and cultured on Hoagland's nutrientmedium (Hoagland and Arnon 1938) for 10 days in anautomated culture room at 25±2°C and a 16-h light period.After 10 days, plants were transferred for 30 days innutrient solution containing 3 mM KNO3, 2 mM Ca(NO3)2,1 mM NH4H3PO4, 50 μM KCl, 25 μM H3BO3,2 μM MnCl2, 2 μM ZnCl2, 0.5 μM CuCl2, 0.5 μM(NH4)6Mo7O24, and 20 μM NaFeEDTA. The pH of thesolution was adjusted to 5.5 with KOH. MgSO4 was addedas indicated in the experiments and Mg2+ concentrationswere maintained at 1 mM by the addition of MgCl2whenever needed. The nutrient solution was replacedweekly (Blake-Kalff et al. 1998).

Sulfur uptake experiment

Transgenic and untransformed plants were pre-cultured onthe medium without SO4

2− for 20 days. After this pre-culture, the plants were transferred to nutrient solutioncontaining 25, 50, and 1,000 μM SO4

−2 and maintained for7 days. These concentrations of sulfate were taken based onour earlier experimentations (Ahmad et al. 2005) and otherreports (Heiss et al. 1999; Dan et al. 2007). The sulfurconcentrations sulfur uptake was measured at the start andafter every 24-h interval during the entire period ofexperiments. After adjusting the nutrient solution to the

Fig. 1 The LeST 1.1 geneconstruct

Sulfur uptake and assimilation of HAST gene expression in Indian mustard

original volume, an aliquot was taken from the nutrientsolution and the sulfate contents were analyzed by anionexchange HPLC (Waters, Massachusetts). The uptake ofsulfate was calculated as the difference in ion amount(μmol) between samples taken at start and after 24 h,divided by the total plant fresh weight (g) after 24 h. It wasexpressed as micromoles per gram fresh weight (Westermanet al. 2000). The sulfate contents in the nutrient solutionswere determined according to the method of Maas et al.(1986). The anions were separated on a Spherisorb 10 μmSAX anion exchange column (4.6×250 mm; Waters) and50 mM potassium dihydrogen phosphate (pH 3.0) was usedas a mobile phase. The flow rate was 1 mlmin−1.

Analysis of growth and S-assimilation potential

After transfer to the hydroponic system, plants wereexposed to three different sulfate concentrations, viz., 25,50, and 1,000 μM for 30 days. Ten plants from eachtransgenic and untransformed plant were subjected to eachof the above treatments and a total of seven transgenic andone untransformed plants were studied using variousparameters, viz., biomass accumulation (dry weight), sulfurcontent, ATP-sulfurylase activity, soluble protein, andchlorophyll contents.

Measurement of biomass accumulation

Biomass accumulation of transgenic plants was recorded interms of dry weight. To record dry weight, the plants weredried in hot air oven at 65°C for 72 h. Thereafter, their dryweights were determined on digital balance by unitarymethod as grams dry weight per plant.

Estimation of contents of chlorophyll and soluble protein

Chlorophyll content was determined according to Hiscoxand Israelstam (1979), and the protein content wasmeasured according to the method of Bradford (1976) withBSA as the standard.

Estimation of sulfur content

The estimation of sulfur content in plants was carried outby direct determination using CHNOS analyzer (ModelVERIO EL-III, GMBH, Germany). The dry mater wasconverted into fine powder in a mortar pestle and tightlypacked in pre-weighed aluminum boats. These boats wereadded serially in the furnace chamber. Sulfanilic acid wasused as standard for control reaction. The tungsten oxidepowder was added with dry plant powder, which helps incomplete digestion of dry matter. The sulfur content wasexpressed in terms of milligrams per gram dw.

Determination of ATP sulfurylase activity

In vitro ATP sulfurylase activity in shoots of transgenic anduntransformed plants was determined by the method ofWilson and Bandurski (1958). With the help of mortar andpestle placed in ice, 0.5 g of fresh tissue was homogenized in5 ml of extraction buffer. The homogenate was centrifuged at5,000 rpm for 15 min at 4°C. A 0.1-ml aliquot was taken inthe test tube, to which 0.4 ml of reaction mixture was added.It was then incubated in water bath at 33°C for 30 min. Thereaction was terminated in hot water. Next, 1 ml ofammonium molybdate solution and 0.1 ml of reducing agentwere added. Volume was made to 10 ml with distilled water.After 20 min, absorbance was read at 660 nm (Techne,Specgene model FSPECGE, UK). Calibration curve wasprepared using different concentrations of KH2PO4 solution.The enzyme activity was expressed as micromoles Pi permilligram of protein per minute.

Statistical analysis

Statistical analysis was carried out by two-way classifica-tion of ANOVA (Cocharn and Cox 1957). The presentedmean values were separated using Duncan's multiple rangetest (DMRT) at p≤0.05.

Results

Transformation of B. juncea cv. Pusa Jai Kisan with LeST1.1 gene

Transgenic B. juncea cv. Pusa Jai Kisan was developed bytransferring the LeST 1.1 gene through Agrobacterium-mediated genetic transformation. Sequence comparison byperforming multiple alignment analysis using Clustal Wrevealed that Lycopersicon esculantum sulfate transportermRNA sequence (LeST 1.1, accession number AF347613.1)had 29% homology with B. juncea low affinity sulfatetransporter mRNA partial sequence (AJ223495.1). Co-cultivation of B. juncea cv. Pusa Jai Kisan hypocotylexplants with A. tumefaciens (LBA 4404) harboring LeST1.1 gene cassette was carried out in 20 independent assays.All together, 500 explants were co-cultivated with Agro-bacterium. A total of 14 putative transgenic shoots weresurvived on kanamycin-containing medium (transformationfrequency 2.8%). Ten transgenic shoots showed 2 kbamplification products when amplified with LeST1.1 gene-specific primers, while the untransformed shoots were notshowing any amplification (Fig. 2). In southern hybridiza-tion, DIG-labeled nptII probe was used to hybridize SalIdigested genomic DNA of putative transgenic and untrans-formed shoots of B. Juncea, and SalI digested DNA of pBin

M.Z. Abdin et al.

19 was taken as positive control. The DNA samples fromputative transgenic shoots and positive control showedhybridization signals, while no hybridization could be seenin untransformed shoots. These results confirmed thetransgenic nature of the selected shoots. The transgenicshoots showed up to three copies of transgene integrated inthe genome. The hybridization patterns were non-identical,indicating that regenerated shoots must have originated fromdifferent transformation events (Fig. 3).

Expression of LeST 1.1 gene at mRNA level wasconfirmed by RT-PCR analysis, which was done usingtotal RNA isolated from leaves of transgenic and untrans-formed shoots of B. juncea. The LeST 1.1 gene wasdetected in seven out of ten transgenic lines. No expressionwas detected in untransformed plants (Fig. 4).

Sulfate uptake

The sulfate uptake rates were measured in seven transgeniclines and untransformed plants of B. juncea at an interval of24 h up to 7 days after their exposure to different sulfursupplied conditions, i.e., 25, 50, and 1,000 μM. The resultsof uptake measurements indicated that all plants (transgeniclines and untransformed plants) showed similar trends insulfate uptake rate under different sulfur supplied conditions.

In all the transgenic lines, except T1, the sulfate uptake ratewas higher than untransformed plants under both S-sufficientand S-insufficient conditions. The sulfate uptake in theseplants increased and reached the peak at 48 h and thereafterdeclined. At 25- and 50-μM sulfate concentrations, thesulfate uptake rates were saturated in T10 transgenic linesafter the fifth day, while T2 and T14 transgenic lines showedsaturation after the sixth day. At 1,000 μM sulfate supply, theoverall sulfate uptake rates of both transgenic and untrans-formed plants were higher than those observed at 25 and50 μM. Further, T1 and T2 transgenic lines showedsaturation in uptake rate after the fifth day, while T10 andT14 showed saturation after the sixth day at this sulfateconcentration. It was further observed that T14 plants showedtwofold increase in sulfate uptake as compared to theuntransformed plants. This can be attributed to highexpression level of the LeST 1.1 gene (Fig. 5).

Biomass accumulation

The transgenic plants accumulated more biomass under bothS-insufficient and S-insufficient conditions as compared tountransformed plants, suggesting that they were able tomaintain good growth and development under these con-ditions. Though sufficient supply of sulfur enhanced the dry

Fig. 2 PCR analysis of B. jun-cea L. cv. Pusa Jai Kisan trans-genic lines. M 1 kb DNA ladder,1 plasmid as positive control, 2untransformed plant, T1 to T14kanamycin resistant shootsshowing amplification of LeST1.1 (2 kb) gene

Fig. 4 RT PCR analysis. T1–T14 Southern positive transgenic lines ofB. juncea L. cv. Pusa Jai Kisan

Fig. 3 Southern blot analysis of ten kanamycin resistant shoots of B.juncea with nptII probe. C1 SalI-restricted pBin19-LeST 1.1 DNA, C2

SalI-restricted genomic DNA of non transformed B. juncea plant, T1–T14SalI restricted genomic DNA of kanamycin resistant shoots of B.juncea, M DIG-labeled DNA molecular weight marker XVI (250 bpladder)

Sulfur uptake and assimilation of HAST gene expression in Indian mustard

matter production and growth in both transgenic anduntransformed B. juncea plants, the magnitude of enhance-ment was greater in the former than in the latter (Fig. 6).

Chlorophyll, soluble protein, total sulfur, and ATPsulfurylase activity

Untransformed B. juncea plants had shown severe visualsulfur deficiency symptoms after 20–30 days of growth under

S-insufficient condition (25 and 50μMSO4−2). The transgenic

plants, however, had not shown any visible deficiencysymptoms like chlorosis, except T1 plants on later stages ofgrowth. Growth stunting was also not severe in transgenicplants, as observed in untransformed plants. The chlorophyll,soluble protein, ATP sulfurylase activity, and sulfur contentswere higher in transgenic plants when compared withuntransformed plants under S-insufficient conditions(Figs. 7, 8, 9, and 10). The values of these parameters in

Fig. 6 Dry weights of transgenic and untransformed B. juncea L. cv.Pusa Jai Kisan plants grown under different concentration of sulfate.Values are means of three independent replicates (bar represents SE).Data represented by similar letters are not significantly different at p≤0.05 according to DMRT. T1, T2, T10, and T14 are LeST 1.1 transgeniclines (as mentioned in the “Materials and methods” section); Wuntransformed control

Fig. 5 Sulfate uptake rate of B.juncea L. cv. Pusa Jai Kisantransgenic lines with untrans-formed plants at every 24 h upto 1 week after their exposure to25, 50, and 1,000 μM sulfate.Total number of observations(n)=5. T1, T2, T10, and T14 aretransgenic lines with LeST 1.1gene, and W is untransformedcontrol. Bar represents SE. Datarepresented by similar letters arenot significantly different at p≤0.05 according to DMRT

Fig. 7 Chlorophyll contents in the shoots of transgenic anduntransformed B. juncea L. cv. Pusa Jai Kisan plants grown underdifferent concentration of sulfate. Values are means of threeindependent replicates (bar represents SE). Data represented bysimilar letters are not significantly different at p≤0.05 according toDMRT. T1, T2, T10, and T14 are LeST 1.1 transgenic lines (asmentioned in the “Materials and methods” section); W untransformedcontrol

M.Z. Abdin et al.

transgenic plants were also higher under S-sufficientconditions when compared with untransformed plants.

Discussion

Optimization of nutrient inputs for crop production andminimization of the associated adverse environmental impactis the main goal of crop nutritionists. Implicit in this is astrategy of sustainable use of precious resources. This requiresa proper understanding of processes that affect efficientnutrient acquisition and utilization by plants. Sulfur is one ofthe essential nutrients required for plant growth, functioning,and adaptation to changes in the environment, including stressresistance. It is considered as the fourth major importantnutrient after nitrogen, phosphorus, and potassium foragricultural crop production. In spite of its crucial role invarious metabolic processes, sulfur is a neglected nutrient forcrop plants. As a result, its deficiency is increasing inagricultural soils, resulting in decreased yield and inferiorquality produce. The problem of deficiency can be simplysolved by adding the sulfur fertilizers. However, continuoususe of sulfatic fertilizer will result in adverse effects on soilfertility. The ideal solution for the problem of S deficiencycould be the development of S-efficient crop plants that cangrow and yield well at low sulfur levels. Since the first step ofsulfur assimilation is the uptake of sulfate from the soil, wehave developed transgenic Indian mustard expressing thehigh-affinity sulfate transporter gene (LeST 1.1) of tomato.Sulfur uptake and assimilation potential of the both transgenic

and untransformed Indian mustard plants were assessed underboth S-insufficient and S-sufficient conditions.

Five hundred hypocotyl explants of B. juncea were co-cultivated with genetically engineered A. tumefaciens strain

Solu

ble

prot

ein

cont

ent

(mg

g-1d.

w.)

Fig. 10 Soluble protein contents from shoots of transgenic anduntransformed B. juncea L. cv. Pusa Jai Kisan plants grown underdifferent concentrations of sulfate. Values are means of threeindependent replicates (bars represents SE). Data represented bysimilar letters are not significantly different at p≤0.05 according toDMRT. T1, T2, T10, and T14 are LeST 1.1 transgenic lines (asmentioned in the “Materials and methods” section); W untransformedcontrol

AT

P s

ulph

uryl

ase

acti

vity

(µm

ol p

i mg-1

pro

tein

min

-1)

Fig. 9 ATP suphurylase activities from shoots of transgenic anduntransformed B. juncea L. cv. Pusa Jai Kisan grown under differentconcentrations of sulfate. Values are means of three independentreplicates (bar represents SE). Data represented by similar letters arenot significantly different at p≤0.05 according to DMRT. T1, T2, T10,and T14 are LeST 1.1 transgenic lines (as mentioned in the “Materialsand methods” section); W untransformed control

Fig. 8 Total sulfur contents in dry shoots of transgenic anduntransformed B. juncea L. cv. Pusa Jai Kisan grown under differentconcentration of sulfate. Values are means of three independentreplicates (bar represents SE). Data represented by similar letters arenot significantly different at p≤0.05 according to DMRT. T1, T2, T10,and T14 are LeST 1.1 transgenic lines (as mentioned in the “Materialsand methods” section); W untransformed control

Sulfur uptake and assimilation of HAST gene expression in Indian mustard

LBA4404 harboring LeST 1.1 gene. Out of these, only 14were able to regenerate into kanamycin-resistant shootsand, therefore, designated as putative transgenic clones(transformation frequency of 2.8%). Among these, only tenclones were tested PCR positive for the presence of LeST1.1 gene. This means that the other four PCR-negativeclones were escapes (Fig. 2). The untransformed shootswere also tested PCR negative. This could be due to the factthat the primers designed for LeST 1.1 gene were not ableto anneal with B. juncea sulfate transporter (low-affinitysulfur transporter) gene as the former has very lowhomology (29%) with the latter gene. The integration andcopy numbers of LeST 1.1 gene in plant genome wereassessed through Southern analysis of DNA samplesobtained from transgenic and untransformed B. junceaplants employing DIG-labeled nptII probe. Most of thetransgenic lines obtained in this study had single-copyinsertions (Fig. 3). Further, only seven out of ten transgeniclines were able to show expression at transcriptional level,and the levels of transgene LeST1.1 expression were alsodifferent in these transgenic lines as shown by the intensityof the amplified products in RT-PCR assay (Fig. 4).Interestingly, T14 transgenic line (having single copy) hadshown the highest level of RT-PCR product, indicatinghigher expression of the LeST 1.1 gene, which was alsoreflected in terms of sulfate uptake rate (Figs. 4 and 5).Though the value of transformation frequency obtained inour study was less than that reported by Barfield and Pua(1991), we reported single-copy insertion of transgene inmost of our transgenic lines. This could be due to thedifference in the Agrobacterium strain and the B. junceacultivar used by us. Further, the differential expressionobserved in our study may be due to the positional effectand random integration of the transgene at non-specificsites in the plant genome (Prols and Mayer 1992; Konez etal. 1989; Salinas et al. 1988).

Study of sulfate uptake rate of transgenic lines except T1

showed higher uptake of sulfate than untransformedcontrol. This could be due to the presence of functionalcopy of LeST 1.1 gene in transgenic lines. Among all thetransformed lines, T14 showed twofold increase in sulfateuptake as compared to the untransformed control (Fig. 5).These observations are in agreement with earlier studies,where the sulfate (5 μM) uptake in transgenic Arabidopsisthaliana plants was facilitated by the functional sulfatetransporters, 35S:SULTR1; 1myHis and 35S:SULTR 1;2mycHis (Muruyama-Nakashita et al. 2004; Yoshimoto et al.2007). The transgenic lines of B. juncea cv. Pusa Jai Kisanshowed enhancement in sulfur uptake under both S-insufficient (25 and 50 μM SO4

2−) and S-sufficientconditions when compared with untransformed plants.However, the magnitude of increase in these values washigher under S-insufficient conditions. This may be due to

the up-regulation of LeST 1.1 gene under S-insufficientconditions resulting in higher levels of its mRNA in thetransgenic plants. The uptake rate was gradually decreasedfrom first to seventh days in all sulfur-supplied conditions,which could be due to feed-back inhibition caused byaccumulation of end product or metabolites like cysteine andglutathione, as discussed in the earlier studies (Lappartient andTouraine 1996).

After being taken up from soil, sulfate is assimilated by aseries of enzymes. First enzyme of S-assimilation is ATPsulfurylase, which is considered as the rate limiting enzymeof sulfur assimilation (Ahmad et al. 1999b). In our study,the activity of ATP sulfurylase was higher in transgenicplants of B. juncea under both S-insufficient and S-sufficient conditions, compared to untransformed plants(Fig. 9). Increased activity of this enzyme in transgenicplants may be due to the availability of adequate amountsof sulfate, since the sulfate is the substrate for ATPsulfurylase. It has been reported earlier that improvedsulfate uptake had resulted in the accumulation of sufficientamounts of sulfate in the system and its transport, as well asdistribution into the aerial parts of the plant for assimilation(Takahashi et al. 2000; Shibagaki et al. 2002; Yoshimoto etal. 2002, 2007). This observation is further supported byhigher total sulfur contents in shoots of transgenic linesunder both S-insufficient and S-sufficient conditions,compared to untransformed plants (Fig. 8). Sulfate istransported to shoots for the assimilation because the leavesare regarded as the primary site of SO4

2− assimilation andthere is a shoot/root recycling of the sulfur (Anderson 1990;Bell et al. 1995).

Interestingly, the transgenic lines showed better growthand higher accumulation of biomass than the untransformedplants. It has been reported that sulfur deficiency limits thegrowth and yield of crop plants in the agricultural fieldmainly because of impairment in the nitrogen uptake andassimilation (Zhao et al. 1993; Sexton et al. 1998;Ingenbleek and Young 2004). The carbon assimilationpathway is closely linked to nitrate assimilation. Whilecarbon fixation forms carbon skeletons, nitrate assimilationprovides reduced nitrogen for use in the synthesis of aminoacids and proteins (Rubisco). Nitrogen assimilation islinked to S metabolism so that, as S metabolism slowsdown, N assimilation is also down regulated (Anderson1990). The work of Reuveny et al. (1980) in tobacco andAhmad et al. (1999b) in rapeseed-mustard showed thatsulfur availability has a role in regulating nitrate reductase,in addition to its role in regulating ATP sulfurylase.Similarly, nitrogen availability has a role in regulatingATP sulfurylase, as well as nitrate reductase. The synthesisof cysteine as a result of the incorporation of the sulfidemoiety into O-acetylserine appears to be the meeting pointbetween N- and S-metabolism. The increase in nitrogen and

M.Z. Abdin et al.

protein contents in the transgenic lines as obtained in ourstudy thus may be due to a metabolic coupling betweenS and N assimilation. A positive role of sulfate inregulating nitrate reductase, an enzyme that catalyzes therate-limiting step of nitrate assimilatory pathway, wasfound by several workers (Ahmad et al. 1999a; Beeversand Hageman 1969). Efficient sulfate uptake not onlyenhances the N uptake, but also improves nitrogenutilization efficiency of the transgenic plants by enhancingprotein synthesis, as S is the constituent of the initiationamino acid, methionine (Ahmad and Abdin 2000b). Theenhanced protein and chlorophyll accumulation in trans-genic lines hence could be the result of better S and Nmetabolism (Figs. 7 and 10). Both chlorophyll and theproteins are the constituents of PSI and PSII, and morethan 30–50% of soluble proteins constitute Rubisco(ribulose-1,5-bisphosphate carboxilase/oxygenase) en-zyme in chloroplast (Feller et al. 2008).

Conclusions

On the basis of the results obtained in our study, it could beconcluded that S uptake and assimilation potentials of B.juncea cv. Pusa Jai Kisan were enhanced by constitutiveover-expression of LeST 1.1 gene encoding high-affinitysulfur transporter. It was reflected in terms of increasedsulfate uptake rate; higher ATP-sulfurylase activity; chlo-rophyll, soluble protein, and total sulfur contents; and morebiomass accumulation under both S-insufficient and S-sufficient conditions. The same approach, therefore, can beused in other mustard varieties and several other crops toimprove their S-uptake and, consequently, S-assimilationpotentials leading to higher yields and better-qualityattributes of the produce. These crops with better S-uptakeand assimilation potentials can be profitably grown in soilwith low S-fertility levels.

Acknowledgements We thank Dr. M. J. Hawkesford (Crop Perfor-mance and Improvement Division, Rothamsted Research HarpendenHerts, UK, AL52JQ) for the gift of pBin 19-LeST 1.1cDNA construct.One of the authors (M. Akmal) is thankful to the Council of Scientificand Industrial Research for the award of research fellowship for hisDoctoral research. We are also thankful to Dr. M. A. A. Khan,NISCAIR, New Delhi, for editing the manuscript.

Conflict of interest The authors declare that they have no conflictsof interest.

References

Ahmad A, Abdin MZ (2000a) Effect of sulphur application on lipid,RNA and fatty acid content in developing seeds of rapeseed(Brassica campestris L.). Plant Sci 152:71–76

Ahmad A, Abdin MZ (2000b) Photosynthesis and its relatedphysiological variables in the leaves of Brassica genotype asinfluence by sulphur fertilization. Physiol Plant 110:144–149

Ahmad A, Abraham G, Abdin MZ (1999a) Physiological investiga-tion on the impact of nitrogen and sulphur application on seedand oil yield of rapseed (Brassica campestris L.) and mustard(Brassica juncea [L.] Czern. and Coss.) genotypes. J Agron CropSci 183:19–25

Ahmad A, Abrol YP, Abdin MZ (1999b) Effect of split application ofsulphur and nitrogen on growth and yield attributes of Brassicagenotypes differing in their time of flowering. Can J Plant Sci79:175–180

Ahmad A, Khan I, Nasar AA, Abrol YP, Iqbal M (2005) Role ofsulphur systems in sulphur efficiency of mustard genotypes.Plant Sci 169:842–846

Anderson JW (1990) Sulfur metabolism in plants. In: Miflin BJ, LeaPJ (eds) The biochemistry of plants, a comprehensive treatise,vol. 16. Academic, New York, pp 327–381

Aoun M, Charles G, Hourmant A (2008) Micropropagation of threegenotypes of Indian mustard [Brassica juncea (L.) Czern. Coss.]using seedlings derived transvers thin layer cells (tTCL) explants.Q Biol 1:1–8

Barfield DG, Pua EC (1991) Gene transfer in plants of Brassicajuncea using Agrobacterium tumefaciens-mediated transforma-tion. Plant Cell Rep 10:308–314

Beevers L, Hageman RH (1969) Nitrate reduction in higher plant.Annu Rev Plant Physiol 20:495–522

Bell CL, Clarkson DT, Cram WJ (1995) Sulphate supply and itsregulation of transport in roots of a tropical legume Macroptiliumatropurpurium cv. Siratro. J Exp Bot 46:65–71

Blake-Kalff MA, Harrison KR, Hawkesford MJ, Zhao FJ, McGrathSP (1998) Distribution of sulfur within oilseed rape leaves inresponse to sulfur deficiency during vegetative growth. PlantPhysiol 118:1337–1344

Bradford MM (1976) A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Ann Biochem 72:248–254

Buchner P, Elisabeth C, Stuiver E, Westerman S, Wirtz M, Hell R,Hawkesford MJ, De Kok LJ (2004) Regulation of sulphateuptake and expression of sulphate transporter gene in Brassicaoleracea as affected by atmospheric H2S and pedosphericsulphate nutrition. Plant Physiol 136:3396–3408

Burton WA, Pymer SJ, Salisbury PA, Kirk JTO, Oram RN (1999)Performance of Australian canola quality Indian mustard breed-ing lines. Proc. 10th Int. Rapeseed Congress, Canberra, Australia

Clemente R, Walker DJ, Bernal MP (2005) Uptake of heavy metalsand As by Brassica juncea grown in a contaminated soil inAznalcollar (Spain): the effect of soil amendments. EnvironPollut 138:46–58

Cocharn WG, Cox GM (1957) Experimental designs. Willey, NewYork

Dan H, Yang G, Zheng Z (2007) A negative regulatory role for auxinin sulphate deficiency response in Arabidopsis thalana. PlantMol Biol 63:221–235

Feller U, Anders I, Mae T (2008) Rubiscolytics: fate of Rubisco afterits enzymatic function in a cell is terminated. J Exp Bot 59:1615–1624

Hawkesford MJ (2000) Plant responses to sulphur deficiency and thegenetic manipulation of sulphate transporter to improve S-utilization efficiency. J Exp Bot 51:131–138

Hawkesford MJ (2003) Transporter gene families in plants: thesulphate transporter gene family-redundancy or specialization?Physiol Plant 117:155–163

Heiss S, Schäfer HJ, Haag-Kerwer A, Rausch T (1999) Cloning sulfurassimilation genes of Brassica juncea L.: cadmium differentiallyaffects the expression of a putative low-affinity sulphate

Sulfur uptake and assimilation of HAST gene expression in Indian mustard

transporter and isoforms of ATP sulfurylase and APS reductase.Plant Mol Biol 39:847–857

Hiscox JD, Israelstam GF (1979) A method for extraction ofchlorophyll from leaf tissue without maceration. Can J Bot59:463–469

Hitsuda K, Sfredo GJ, Klepker D (2004) Diagnosis of sulfurdeficiency in soybean using seeds. Soil Sci Soc Am J 68:1445–1451

Hoagland D, Arnon DI (1938) The water culture method for growingplant without soil. Bulletin of California Agriculture Station 346,State of California, Sacramento

Hofgen R, Willmitzer L (1988) Storage of competent cells Agro-bacterium tumefaciens. Nucleic Acids Res 16:9877

Howarth JR, Fourcroy P, Davidian J, Smith FW, Hawkesford MJ(2003) Cloning of two contrasting high-affinity sulfate trans-porters from tomato induced by low sulfate and infection by thevascular pathogen Verticillium dahlia. Planta 218:58–64

Imsande J, Schmidt JM (1998) Effect of N source during soybean podfilling on nitrogen and sulphur assimilation and remobilization.Plant Soil 202:41–47

Ingenbleek Y, Young VR (2004) The essentiality of sulfur is closelyrelated to nitrogen metabolism: a clue to hyper homocysteinae-mia. Nutr Res Rev 17:135–151

Konez C, Martini N, Mayerhofer R, Konez KZ, Korber H, Redei GP(1989) High frequency T-DNA mediated gene tagging in plant.Proc Natl Acad Sci USA 86:8467–8471

Lappartient AG, Touraine B (1996) Demand-driven control of rootATP sulphurylase activity and SO4

2− uptake in intact canola.Plant Physiol 111:147–157

Maas FM, Hoffmann I, Van Harmelen MJ, De Kok LJ (1986)Refractometeric determination of sulphate and other anions inplants separated by high performance liquid chromatography.Plant Soil 91:129–132

Murashige T, Skoog F (1962) A revised medium for rapid growth andbio assay with tobacco tissue cultures. Physiol Plant 15:473–497

Muruyama-Nakashita A, Nakamura Y, Watanabe-Takahashi A,Yamaya T, Takahashi H (2004) Induction of SULTR 1;1 sulfatetransporter in Arabidopsis roots involve protein phosphorylation/dephosphorylation circuit for transcriptional regulation. PlantPhysiol 132:597–605

Prols F, Mayer P (1992) The methylation patterns of chromosomalintegration regions influence gene activity of transferred DNA inPetunia hybrida. Plant J 2:465–475

Qadir S, Qureshi MI, Javed S, Abdin MZ (2004) Genotypic variationin phytoremediation potential of Brassica juncea cultivarsexposed to Cd stress. Plant Sci 167:1171–1181

Reuveny Z, Dougall DK, Trinity PM (1980) Regulatory coupling ofnitrate and sulphate assimilation pathways in cultured tobaccocells. Proc Natl Acad Sci USA 77:6670–6672

Salinas J, Matassi G, Montero LM, Bernadi G (1988) Compositionalcompartmentalization and compositional patterns in the nucleargenomes of plants. Nucleic Acids Res 17:5273–5290

Sexton PJ, Paek NC, Shibles RM (1998) Effects of nitrogen sourceand timing of sulfur deficiency on seed yield and expression of11S and 7S seed storage proteins of soybean. Field Crops Res5:1–8

Shibagaki N, Rose A, McDermott JP, Fujiwara T, Hayashi H,Yoneyama T, Davies JP (2002) Selenate-resistant mutants ofArabidopsis thaliana identify Sultr1.2, a sulphate transporterrequired for efficient transport of sulfate into roots. Plant J29:475–486

Smith FW, Ealing PM, Hawkesford MJ, Clarkson DT (1995) Plantmembers of a family of sulphate transporter reveals functionalsubtypes. Proc Natl Acad Sci USA 92:9373–9377

Smith FW, Hawkesford MJ, Ealing PM, Clarkson DT, Van den BergPJ, Belcher AR, Warrilow AGS (1997) Regulation of expressionof a cDNA from barley roots encoding a high affinity sulphatetransporter. Plant J 12:875–884

Spencer D, Rerie WG, Randall PJ, Higgins TJV (1990) The regulationof pea seed storage protein genes by sulphur stress. Aust J PlantPhysiol 17:355–363

Takahashi H, Yamazaki M, Sasakura N, Watanabe A, Leustek T, deAlmeida-Engler J, Engler G, Van Montagu M, Saito K (1997)Regulation of sulphate assimilation in higher plants: a sulphatetransporter induced in sulphate deprived roots play a central rolein Arabidopsis thaliana. Proc Natl Acad Sci USA 94:11102–11107

Takahashi H, Sasakura N, Kimura A, Watanabe T, Saito K (1999)Identification of two leaf-specific sulphate transporters inArabidopsis thaliana. Plant Physiol 121:686

Takahashi H, Watanabe-Takashahi A, Smith FW, Blake-Kalff M,Hawkesford MJ, Saito K (2000) The role of three functionalsulphate transporters involved in uptake and translocation ofsulphate in Arabidopsis thaliana. Plant J 23:171–182

Westerman S, De Kok LJ, Stuiver CEE, Stulen I (2000) Interactionbetween metabolism of atmospheric H2S in the shoot andsulphate uptake by the roots of curly kale (Brassica oleracea).Physiol Plant 109:443–449

Wilson CG, Bandurski RS (1958) Enzymatic reactions involving sulfate,sulfite, selenate and molybdate. J Biol Chem 233:975–981

Woods DL, Capcara JJ, Downey RK (1991) The potential of mustard(Brassica juncea [L.] Coss.) as an edible oil crop on theCanadian prairies. Can J Plant Sci 71:195–198

Yoshimoto N, Takahashi H, Smith FW, Yamaya T, Saito K (2002)Two distinct high-affinity sulfate transporter with differentinducibilities mediate uptake of sulphate in Arabidopsis roots.Plant J 29:465–473

Yoshimoto N, Inoue E, Watanabe-Takahashi A, Saito K, Takahashi H(2007) Post-transcriptional regulation of high-affinity sulfatetransporters in Arabidopsis by sulfur nutrition. Plant Physiol145:378–388

Zhao FJ, Evans EJ, Bilsborrow PE, Syers JK (1993) Influence ofsulphur and N on seed yield and quality of low glucosinolateoilseed rape (Brassica napus L.). J Sci Food Agric 63:29–37

M.Z. Abdin et al.