Comparison of molecular techniques for the typing of Mycoplasma hyopneumoniae isolates

www.elsevier.com/locate/jmicmeth

Journal of Microbiological Methods 6

Comparison of molecular techniques for the typing of

Mycoplasma hyopneumoniae isolates

Tim Stakenborg a,*, Jo Vicca b, Dominiek Maes b, Johan Peeters a,

Aart de Kruif b, Freddy Haesebrouck b, Patrick Butaye a

a Veterinary and Agrochemical Research Centre, Groeselenberg 99, 1180 Brussels, Belgiumb Faculty of Veterinary Medicine, Ghent University, Salisburylaan 133, 9820 Merelbeke, Belgium

Received 5 September 2005; received in revised form 6 December 2005; accepted 7 December 2005

Available online 3 February 2006

Abstract

In this study, we compared the potential of amplified fragment length polymorphism (AFLP), random amplified polymorphic

DNA (RAPD) analysis, restriction fragment length polymorphism (RFLP) of the gene encoding lipoprotein P146, and the variable

number of tandem repeats (VNTR) of the P97 encoding gene, as possible methods for typing an international collection of

Mycoplasma hyopneumoniae isolates. All techniques showed a typeability of 100% and high intraspecific diversity. However, the

discriminatory power of the different techniques varied considerably. AFLP (N0.99) and PCR-RFLP of the P146 encoding gene

(N0.98) were more discriminatory than RAPD (0.95) and estimation of the VNTR of P97 (b0.92). Other, preferentially well spread,

tandem repeat regions should be included in order for this latter technique to become valuable for typing purposes. RAPD was also

found to be a less interesting typing technique because of its low reproducibility between different runs. Nevertheless, all molecular

techniques showed overall more resemblance between strains isolated from different pigs from the same herd. On the other hand,

none of the techniques was able to show a clear relationship between the country of origin and the fingerprints obtained. We

conclude that AFLP and an earlier described PFGE technique are highly reliable and discriminatory typing techniques for outlining

the genomic diversity of M. hyopneumoniae isolates. Our data also show that RFLP of a highly variable gene encoding P146 may

be an equally useful alternative for demonstrating intraspecific variability, although the generation of sequence variability of the

gene remains unclear and must be further examined.

D 2005 Elsevier B.V. All rights reserved.

Keywords: Amplified fragment length polymorphism; Random amplified polymorphic DNA analysis; Restriction fragment length polymorphism;

Variable number of tandem repeats; Mycoplasma hyopneumoniae

1. Introduction

Mycoplasma hyopneumoniae is the primary cause of

enzootic pneumonia in pigs. Although vaccines have

been developed, infections are still hard to control

(Maes et al., 1999) and, even in countries aiming to

0167-7012/$ - see front matter D 2005 Elsevier B.V. All rights reserved.

doi:10.1016/j.mimet.2005.12.002

* Corresponding author. Tel.: +32 2 3790437; fax: +32 2 3790690.

E-mail address: [email protected] (T. Stakenborg).

eradicate enzootic pneumonia, reinfections occur fre-

quently (Hege et al., 2002). The disease is not associ-

ated with a high mortality rate, but the severity may

vary greatly between different herds (Vicca et al.,

2003). Farm management is considered essential

(Done, 1991), but also the intrinsic virulence of circu-

lating M. hyopneumoniae strains has been proven to be

an important cause for this variation (Vicca et al.,

2003). The underlying mechanism to explain these

6 (2006) 263–275

mailto:[email protected]

http://dx.doi.org/10.1016/j.mimet.2005.12.002

Table 1

Overview of the M. hyopneumoniae strains used in this study and the estimated number of reiterated repeats of P97

Farm Pig Strain Year of Place, country Number in Estimated number of reiterated repeats

number designation isolation of origina vitro passagesRR1 RR2

F1 12 A 2000 Nieuwekapelle, Belgium 9 2.0 3.0

F2 3 K 2000 Wuustwezel, Belgium 9 12.0 4.9

F3 1 M 2000 Namen, Belgium 10 20.9 2.9

F4 2 C 2001 Moorsele, Belgium 6 12.9 3.0

F5 6 A 2000 Loenhout, Belgium 19 16.4 3.9

F6 12 D 2000 Linter, Belgium 8 9.1 4.9

F7 2 C 2000 Landegem, Belgium 8 16.5 2.9

F8 3 C 2001 Diksmuide, Belgium 18 13.4 2.9

F8 5 L 2001 Diksmuide, Belgium 9 13.4 2.8

F9 8 K 2001 Diksmuide, Belgium 15 11.1 2.9

F10 7 E 2001 Beveren, Belgium 8 9.1 3.0

F11 1 A 2001 Veurne, Belgium 7 10.6 3.0

F11 8 A 2001 Veurne, Belgium 7 10.6 3.0

F12 6 A 2001 Linter, Belgium 6 10.7 3.0

F13 7 B 2001 Poperinge, Belgium 10 14.0 2.9

F13 10 A 2001 Poperinge, Belgium 10 14.1 2.9

F14 7 E 2001 Minderhout, Belgium 8 12.9 2.9

F14 9 A 2001 Minderhout, Belgium 8 12.9 2.9

F15 2 A 2001 Olen, Belgium 8 8.0 4.0

F15 3 L 2001 Olen, Belgium 15 8.0 3.9

F15 10 A 2001 Olen, Belgium 6 8.0 4.0

F16 2 X 2001 Olen, Belgium 8 8.1 2.9

F16 4 B 2001 Olen, Belgium 6 13.1 2.9

F17 1 J 2002 Sluizen, Belgium 16 13.0 2.9

F17 2 N 2002 Sluizen, Belgium 5 13.0 2.9

F18 2 A 2002 Slijpe, Belgium 6 12.3 3.9

F19 1 E 2002 Leffinge, Belgium 7 11.0 2.9

F19 4 A 2002 Leffinge, Belgium 21 11.1 2.9

F19 6 E 2002 Leffinge, Belgium 6 11.0 2.9

F21 9 C 2002 Bocholt, Belgium 13 10.3 3.9

F23 7 E 2002 Waasmunster, Belgium 9 10.1 3.9

– – J ~1965 NAb (ATCC 27715) NA 9.0 4.9

LH1 2 A 2003 Vilnius, Lithuania 6 14.1 2.9

LH1 3 B 2003 Vilnius, Lithuania 8 14.3 2.9



– – MP143 NA Denmark NA 11.1 2.9

– – SVS22 2000 Denmark NA 10.8 2.8

– – Mp18 1998 Denmark NA 11.0 2.9

– – 232 NA USAc 20 14.2 3.9

NL2 6 B NA The Netherlands NA 14.3 5.9

NL3 4 A NA The Netherlands NA 13.5 2.9

– – W79 ~1995 United Kingdom NA 12.4 1.9

– – W58 ~1995 United Kingdom NA 15.7 1.9

– – E62 ~1995 United Kingdom NA 11.5 3.9

a Strains originating from Denmark were kindly provided by Dr. F. Friis (Danish Veterinary Institute, Copenhagen, Denmark), from the USA by

Dr. E. Thacker (Iowa State University, USA), from The Netherlands by Dr. A. van Essen (Animal Sciences Group, Wageningen University and

Research Centre, The Netherlands), and from the UK by Dr. H. Windsor (Mycoplasma Experience, Surrey, UK). The Lithuania strains were isolated

from porcine lungs kindly provided by Dr. K. Garlaite (Lithuanian Veterinary Academy, Vilnius, Lithuania).b NA=not available.c Strain 232 was isolated originally from a pig infected with M. hyopneumoniae strain 11 (ATCC 27714) (Minion et al., 2004).

T. Stakenborg et al. / Journal of Microbiological Methods 66 (2006) 263–275264

results has remained elusive, though several techniques

have demonstrated M. hyopneumoniae to be a highly

heterogeneous species.

Analysis of the proteome showed different SDS-

PAGE profiles for different isolates (Chen et al.,

1992) that were at least partly the result of strain-

T. Stakenborg et al. / Journal of Microbiological Methods 66 (2006) 263–275 265

specific post-translational modifications (Djordjevic

et al., 2004). At the genomic level, an enormous hete-

rogeneity has been demonstrated by various typing

techniques such as random amplified polymorphic

DNA (RAPD) (Artiushin and Minion, 1996), amplified

fragment length polymorphism (AFLP) (Kokotovic

et al., 1999), and pulsed-field gel electrophoresis

(PFGE) (Stakenborg et al., 2005). Moreover, the num-

ber of a yet unassigned insertion-like sequence varied

between different strains (Harasawa et al., 1995) and

differences in the reiterated regions of a P97 adhesin

encoding gene have been reported for different iso-

lates (Hsu et al., 1997; Hsu and Minion, 1998b). All

these different techniques may prove useful in future

epidemiological studies to trace strains or to visualize

infection patterns. To perform such epidemiological

studies, the choice of the typing technique is essential.

However, in the case of M. hyopneumoniae, the value

of different typing techniques has never been assessed.

As long as whole genome sequencing is not easily

attainable, typing techniques, which ideally represent

the true phylogenetic relation between strains, are

bound to their own intrinsic limitations. In this study,

we compared the use of formerly described techniques

(RAPD and AFLP) and newly PCR-based techniques

(PCR-RFLP of the P146 gene and the VNTR of the

P97 gene) as possible methods for studying the diver-

sity of M. hyopneumoniae strains. For each typing

technique, the discriminatory power, reproducibility

and ease of performance were compared using an iden-

tical set of strains. The results obtained were discussed

in detail and compared with PFGE data on a similar set

of isolates described earlier by our group (Stakenborg

et al., 2005).

2. Materials and methods

2.1. Bacterial isolates, media, and DNA extraction

A total of 43 M. hyopneumoniae isolates were used,

together with reference strains J (ATCC 25934), USA

232 (Minion et al., 2004), and Mycoplasma flocculare

Ms42 (ATCC 27399). All Belgian and Lithuanian field

isolates were derived from lung samples of pigs at

slaughter. These isolates received a name of the format

dF1.2AT, where F1 represents the number of the herd,

2 indicates the number of the pig and A is an arbitrary

letter representing the isolate. Isolates from different

pigs from the same herd were obtained from lung

samples collected at the same moment. For strains

that were received from other laboratories, the genuine

strain designation was kept unchanged. For reasons of

clarity, the international code representing the country

of origin was always indicated between parentheses

after the isolate’s name. Further information about the

included strains is listed in as much detail as possible

in Table 1.

Friis’ broth was used to grow both the M. flocculare

and the M. hyopneumoniae strains (Friis, 1975).

Purified, genomic DNA was prepared using a phenol/

chloroform extraction method (Bashiruddin, 1998).

2.2. RAPD

For RAPD analyses, 45 cycles (1V94 8C; 1V36 8C;and 2V72 8C) were run on a GeneAmp 9600 Thermal

Cycler (Perkin Elmer, Ma, USA) using 20 pmol of

a primer OPA-3 (5V AGTCAGCCAC) described by

Artiushin and Minion (1996), and exactly 30 ng of

purified, genomic DNA as a template. To minimize

the variability between different runs, Ready-To-Go

RAPD Beads (Amersham Biosciences, Germany)

were used and all samples were run simultaneously

during one single PCR. After amplification, 10 Al ofthe PCR mixture were analyzed by electrophoresis

(120 V, 90V) on 1% agarose gel (Sigma, UK). The

DNA fragments were visualized using a GeneGenius

gel documentation system (Westburg, The Netherlands)

and exported to Bionumerics (V3.5, Applied-Maths,

Belgium) for further analysis. Bands annotated by the

software were visually controlled and fragments smaller

than 500 bp were omitted for further analysis. Calcu-

lation of similarity coefficients was performed using the

Dice algorithm. The unweighted pair group method

with arithmetic means (UPGMA) was used for cluster-

ing with a band position tolerance and optimization

setting of 1%.

2.3. AFLP

AFLP was performed in similarity to an earlier

report (Kokotovic et al., 1999). Briefly, 200 ng ge-

nomic DNA was diluted in 20 Al restriction buffer

(SuRE/Cut Buffer M, Roche, Switzerland) and restrict-

ed with 10 U BglII (Roche) and 10 U MfeI (Fermentas,

Lithuania) for 3 h at 37 8C. After incubation for 15Vat65 8C, a 20 Al ligation reaction was set up using 5 Al ofthe digested DNA, 2 pmol of the BGL adapter, 20 pmol

of the MFE adapter (Kokotovic et al., 1999), 1 U T4

ligase (Amersham), 2 Al restriction buffer (Amersham),

and 8 Al restriction buffer (Amersham). Ligation was

carried out overnight at 16 8C. The succeeding ampli-

fication reaction was performed as noted in Table 2

using 2 Al of the 10-fold diluted ligation product as

Table 2

Primers and cycle conditions used in this study

Target sequence Sequence (5VY3V) Number of cycles (cycle conditions)a

Primer

AFLP PCRb 30 (1V 94 8C; 1V 54 8C; and 90W 72 8C)BGL-2F* (D4*)GAGTACACTGTCGATCT

MFE-1 GAGAGCTCTTGGAATTG

P146 (pre-amplification) 30 (15W 94 8C; 30W 51 8C; and 1V72 8C)P146 cFOR CATTAGTAACAGCAACAGCCATTG

P146 cREV TACCTCGCCGCCTTAGCAG

P146 (amplification) 25 (15W 94 8C; 30W 52,5 8C; and 1V72 8C)P146 FOR TTAGTAACAGCAACAGCCATTG

P146 REV CCCTTAAGTGGACAATTTTAGC

P97 (repeat region 1) 30 (30W 94 8C; 30W 53,7 8C; and 1V72 8C)RR1 FOR GAAGCTATCAAAAAAGGGGAAACTA

RR1 REV GGTTTATTTGTAAGTGAAAAGCCAG

P97 (repeat region 2) 30 (1V94 8C; 1V50,3 8C; and 45W 72 8C)RR2 FOR AGCGAGTATGAAGAACAAGAA

RR2 REV TTTTTACCTAAGTCAGGAAGG

a All PCRs, unless stated otherwise (see footnote b of this table), were performed using 3U of recombinant Taq polymerase (Invitrogen), 5 Al ofPCR buffer (Invitrogen) including 2 mM MgCl2, 0.2 mM of each dNTP and 10 pmol of both forward and reverse primer.b The AFLP-PCR was performed using 2U of AmpliTaq polymerase (Amersham Biosciences), 5 Al of PCR buffer II (Amersham Biosciences)

supplemented with 2.5 mM MgCl2, 0.2 mM of each dNTP and 10 pmol of both forward and reverse primer.


template. One Al of the amplified PCR products was

diluted in 40 Al sample loading solution (Beckman,

UK) supplemented with CEQ Size-standard 600 (Beck-

man) and run on a CEQ8000 Genetic Analysis System

(Beckman) for separation and visualization. The raw

data obtained were subsequently exported to Bionu-

merics (Applied-Maths) and converted to gel images.

After normalization, fragments between 60 and 560 bp

were defined. Clustering analysis of the fingerprints

obtained was performed with UPGMA on the basis

of a similarity matrix with calculated Jaccard’s similar-

ity coefficients. For clustering, the tolerance and opti-

misation level was set to 0.7%.

To determine the reproducibility of the AFLP pro-

cedure, three independent DNA samples of 10 arbitrari-

ly chosen strains were analyzed on different days.

2.4. PCR-RFLP analysis of the P146 encoding gene

For the amplification of the P146 gene, a PCR was

performed using primers and reaction conditions noted

in Table 2. Some strains yielded a faint non-specific

PCR fragment of about 900 bp in size, and for these

strains the PCR was repeated in nested format using

a pre-amplification step as noted in Table 2. After

PCR, about 100 ng of the final PCR product was

digested for 3 h at 37 8C in restriction buffer (SuRE/

Cut Buffer A, Roche) containing 10 U of restriction

enzyme AluI (Roche). Restricted fragments were

separated for 2 h at 120 V on a 2% Nusieve agar

(Cambrex Bioscience). The 50 bp O’RangeRuler (Fer-

mentas) was used as size standard and was loaded at

least twice for every 10 samples. After electrophoresis,

DNA fragments were visualized using a GeneGenius

gel documentation system (Westburg). The digital

images were exported to Bionumerics (Applied-

Maths) for standardization and annotation of the

bands. Fragments smaller than 175 bp were omitted

from the analysis. Levels of similarity between finger-

prints were calculated employing the Dice algorithm. In

order to attain a complete match between strains ana-

lyzed in duplicate, the tolerance and optimization levels

were both set to 1%. Cluster analysis was performed

with UPGMA.

To verify the accuracy of the technique, the observed

in vitro restriction patterns of isolates F7.2C and USA

232 were compared with those calculated in silico

based on the P146 gene sequences (see further). To

check whether in vitro cultivation influenced the

results, the test was repeated on three strains after 5,

10, and 15 in vitro subcultivation steps.

2.5. VNTR present in the P97 encoding gene

Two different reiterated repeat regions (RR1 and

RR2) have been described for the P97 adhesin gene

of M. hyopneumoniae (Hsu et al., 1997). For each

strain, two PCRs were performed to selectively amplify

Table 3

The by PCR estimated number of RR repeats of the P97 gene of strain USA232 and 10 arbitrarily chosen isolates compared with the actual number

of RR repeats determined by sequence analysis

Strain RR1 RR2

Estimated

length

Actual

length

Estimated

RR1 repeatsaActual

RR1 repeats

Number

TN repeatsbEstimated

length

Actual

length

Estimated

RR2 repeatscActual

RR2 repeats

F1.12K 184 185 1.9 2 3 284 284 3.0 3

F5.6B 403 401 16.5 16 4 312 314 3.0 3

F6.12D 292 288 9.1 8 5 341 344 3.9 4

F7.2C 399 397 16.3 15 6 282 284 4.9 5

F9.8K 322 320 11.1 11 3 280 284 2.9 3

F12.6A 316 320 10.7 11 3 285 284 3.0 3

F13.7B 365 368 14.0 13 6 282 284 2.9 3

F15.2A 275 275 8.0 8 3 317 314 4.1 4

J 290 290 9.0 9 3 340 344 4.9 5

MP143 322 317 11.1 11 3 280 284 2.9 3

USA232 368 368 14.2 15 1 312 314 3.9 4

a The estimated number of RR1 repeats was calculated assuming 3 TN repeats (i.e., the estimated length of the PCR product minus 155 bp and

divided by the 15 bp of one repeat unit).b The RR1 repeat region is followed by a repeat region of format GCT(ACTAAT)nACT on sequence level (or A(TN)nT on amino acid level), in

which dnT represents a number between 1 and 6.c The estimated number of RR2 repeats is determined by subtracting 194 (i.e., the number of amplified base pairs not included in the repeat

region) from the estimated length of the amplified PCR product and dividing this result by 30 (i.e., the length of one reiterated repeat unit).


the RR regions using the primers and cycle conditions

stated in Table 2. Amplified fragments were separated

on a 2% Nusieve agar (Cambrex Bioscience) for 2 h at

120V and visualized using a GeneGenius gel documen-

tation system (Westburg). Based on a 50 bp O’Ran-

geRuler (Fermentas), which was loaded at least twice

for every 10 samples, the sizes of amplified fragments

were estimated using Kodak digital science 1D soft-

ware (V3.0, Kodak Company, NY, USA). The accuracy

of the technique for estimation of the number of repeats

was examined by sequence analysis of the repeat

regions for 10 arbitrarily chosen isolates (see further).

In addition, the standard deviation of the technique was

calculated by comparing the expected size of the am-

plified RR2 region (i.e., number of RR2 repeats times

30 bp plus 194 bp) with the size of the amplification

products observed on gel. To check whether the strains

could be safely grown in the laboratory, the number of

repeats was compared for three arbitrarily chosen

strains that were subcultivated 5, 10, and 15 times in

vitro.

2.6. Discriminatory power

The Simpson’s index of diversity was calculated for

each technique (Hunter and Gaston, 1988). Since the

dependency between isolates originating from a single

herd was unknown, two different discriminatory

indexes were calculated, one including all M. hyopneu-

moniae strains and one excluding all isolates that had

an identical fingerprint and originated from a single

herd. This implies that in the event some isolates of

the same herd represent an identical clone, the true

value of the Simpson’s index of diversity should fall

between these two estimates.

2.7. Sequence analysis

Sequencing of the gene encoding lipoprotein P146

of strain F7.2C and part of the genes encoding P97 of

10 arbitrarily chosen isolates (Table 3) was performed

on PCR products. The samples were purified with

QIAquick spin columns (Qiagen, Germany) and se-

quenced on a CEQ8000 Genetic Analysis System

(Beckman, UK) by using the Quickstart kit (Beckman)

according to the manufacturer’s instructions. The

sequences obtained were exported to VectorNTI (V9,

Informax, Invitrogen) for assemblage and further anal-

ysis. The sequence of the P146 gene of isolate F7.2C

was submitted to Genbank (accession nr. DQ088147).

3. Results

3.1. RAPD

Since the observed RAPD patterns were not repro-

ducible between different runs (data not shown), even

not with the use of an as much as possible standardised

method, the analysis of all samples was carried out

during one single run. A limited number of fragments

Fig. 1. RAPD patterns of theM. hyopneumoniae isolates and theM. flocculare strain Ms42. Cluster analysis was performed with UPGMA using the

Dice coefficient and a tolerance and optimization level of 1%. Bands below 500 bp were omitted for analysis.


Fig. 2. Dendrogram of the obtained AFLP fragments from 60 to 560 bp in size. Cluster analysis was performed with UPGMA using the Jaccard’s

coefficient and a tolerance and optimization level of 0.7%. The dashed line represents the cut-off value (92%) for similarity determined by analysis

of replicates. Patterns with a higher similarity value are considered indistinguishable. The M. flocculare strain Ms42 that is included served as

an outgroup.


Fig. 3. PCR-RFLP patterns of the P146 gene the M. hyopneumoniae isolates. Cluster analysis was performed with UPGMA using the Dice

coefficient and a tolerance and optimization level of 1%. Bands below 175 bp were omitted from the analysis.



(two to eight) were observed for each isolate. All iso-

lates showed a band of about 1300 bp in size and for

most M. hyopneumoniae isolates another band of about

550 bp was observed. For the M. flocculare Ms42

strain, an intense band of about 750 bp was observed,

but it could not be used for species differentiation as

fragments of a similar size were observed for some

Danish M. hyopneumoniae field isolates as well

(Fig. 1). The intensity of many bands between non-

identical patterns varied and complicated the analysis.

Isolates originating from the same herd had identical

RAPD patterns, with the exception of isolates from

herds F8 (BE), F16 (BE), F19 (BE) and LH3 (LT).

On the other hand, many strains originating from dif-

ferent herds also had identical profiles, resulting in

a discriminatory index of 0.95 (for both calculated

indexes).

3.2. AFLP

All M. hyopneumoniae isolates generated about 100

clearly separated fragments, with the exception of the

isolates of herd F19 (BE), F21 (BE) and F23 (BE),

which showed more bands, and of the isolate F2.3K

(BE), which showed considerably fewer bands. The M.

flocculare Ms42 strain showed a clearly different and

less complex pattern and formed the root of the den-

drogram. Reproducibility tests showed similar peak

profiles, though peak intensities often varied. After

normalization and band annotation, all replicates

showed similarity values of at least 92% (data not

shown). This value was used as a cut-off value to

differentiate between isolates. Despite this cut-off

value, only the multiple isolates originating from herd

F17 (BE), F19 (BE), and LH1 (LT) were indistinguish-

able. The AFLP patterns of F21.9C (BE) and F23.7E

(BE) were also considered identical. All other

isolates had similarity values below the cut-off value

(Fig. 2). This corresponded to a discriminatory index

that was calculated to be higher than 99% (both with

and without the inclusion of multiple isolates of the

same herd).

3.3. PCR-RFLP analysis of the P146 encoding gene

Restriction analysis with AluI showed an extensive

variation in the P146 gene of different isolates. This

variation was further illustrated by the high Simpson’s

index of diversity, which was calculated to be higher

than 0.98 without and higher than 0.97 with the inclu-

sion of isolates originating from the same farm. In

contrast to this enormous variation, isolates originating

from the same herd had identical profiles in 6 out of 10

cases (Fig. 3). The restriction profiles of three strains

that were subcultured up to 15 times in the laboratory

were also identical (data not shown).

Restriction patterns calculated in silico for the

determined sequence of the P146 encoding gene of

strain F7.2K (BE) and strain USA232 (Minion et al.,

2004) corresponded to those observed on gel. Upon

comparison of the two DNA sequences, several highly

variable repeat regions were observed, mainly in the

C-terminal part of the gene. These regions included

a poly-serine chain of variable length, a repeat region

rich in proline and glutamine residues of variable

length that could be represented by the following

format [Q]n[(P/S)Q]m, and a variable poly-alanine

chain situated directly before the stop codon of the

gene.

3.4. VNTR present in the P97 encoding gene

Both the RR1 (15 bp in length) and the RR2

repeat (30 bp in length) have been described in detail

before (Hsu et al., 1997; Wilton et al., 1998). As

shown in Table 1, the estimated number of RR1

repeats ranged for most strains from 8 to 16 copies.

However, two extremes were noted, isolate F1.12

(BE) with only 2 copies, and isolate F3.1M (BE)

with 21 copies of the RR1 repeat. The number of

RR2 repeats was less diverse and ranged from 2 to

6 copies, with most isolates having 3 copies. The

number of repeat regions of isolates originating from

the same herd was identical, except for the two

isolates of herd F16 (BE) where a difference between

the number of RR1 repeats was noted. This resulted

in a discriminatory power as low as 0.90 for RR1

and 0.59 for RR2 when excluding replicates, or 0.88

for RR1 and 0.53 for RR2 when including all isolates

of the same herd as well. When the two repeats were

combined, the discriminatory power rose to 0.91 with

and 0.94 without the inclusion of multiple isolates

per herd.

The calculated standard deviation of the estimated

size was 3.0 bp, while the maximum error observed

between the expected fragment size and the size de-

termined on gel was 7 bp. Therefore, the technique

can be used to exactly determine the number of RR2

repeats. In the event of RR1 repeats, and as verified

by sequence analyses, the copy number is merely an

estimate of the true value. Apparently, RR1 repeats are

followed by another repeat region of the format

GCT(ACTAAT)nACT, where n represents a number

from 1 to 6 (Table 3). Since the region consists of


repeated threonine and asparagine residues, the repeat

is further referred to as a TN repeat.

The number of repeats did not appear to change

easily over in vitro passages, since bands of identical

size were observed for three strains subcultivated 5, 10

and 15 times in vitro (data not shown).

4. Discussion

In this study, M. hyopneumoniae isolates were

differentiated by several typing techniques, including

some newly proposed techniques and some already

described by other authors (Artiushin and Minion,

1996; Kokotovic et al., 1999; Wilton et al., 1998).

Though multi-locus sequence typing (MLST) has been

proposed as a key technique for typing and character-

izing strains of many bacterial species (Urwin and

Maiden, 2003), it has not been worked out in detail

for M. hyopneumoniae. Moreover, MLST is still

rather expensive to be used routinely (Olive and

Bean, 1999) and other molecular typing techniques

may be favorable. However, until this study, these

different techniques had never been compared to each

other for the typing of M. hyopneumoniae. Based on

the results described here, we conclude that all the

different techniques typed all strains, but they

showed differing levels of discriminatory power and

reproducibility.

RAPD has been used as an easily performable and

highly discriminatory test to type strains of many

Mycoplasma species (Rawadi, 1998). In our study, as

well, the discriminatory power was satisfactory, despite

the relatively low number of fragments using the primer

described. On the other hand, RAPD lacked reproduc-

ibility, which made the comparison with new isolates

possible only by reanalyzing all isolates again in a

single experiment. Such a low reproducibility has

been described before (e.g., Penner et al., 1993; Van

Looveren et al., 1999) and even for a species like

Mycoplasma gallisepticum, where RAPD has often

been successfully used for epidemiological studies,

variation between gels and different runs has been

reported (Hong et al., 2005). Contrary to RAPD,

AFLP yielded more complex banding patterns and

was much more reproducible. Although AFLP was

reported fully reproducible for mycoplasmas (Kokoto-

vic et al., 1999), in our study the conversion of AFLP

patterns to gel images and subsequent analysis in Bio-

numerics (Applied-Maths) yielded similarity values of

92% or higher for replicates analyzed on different days.

Similar cut-off values have been reported for several

other bacterial species (e.g., Duim et al., 1999; van

Eldere et al., 1999). This did not influence the discrim-

inatory power of the technique (N99%).

As demonstrated earlier (Stakenborg et al., 2005),

PFGE also proved to be a reproducible and highly

discriminatory typing technique. The use of two differ-

ent restriction enzymes, SalI and ApaI, was evaluated

and yielded complementary results. The Simpson’s

index of diversity for this technique was calculated to

be at least as high as 0.98, which is comparable

to AFLP.

In this study, we additionally describe some molec-

ular techniques that have never been evaluated for the

typing M. hyopneumoniae. The VNTR of the P97

encoding gene were assessed. Compared to the other

methods, the estimation of the number of repeats in

the P97 encoding gene may be a fast and easily per-

formable technique. Since it is PCR based, theoretically

no culture steps are necessary and the technique may

give an initial indication about possible variation be-

tween two strains. However, a major drawback of

the technique is its low discriminatory power. Even

when including the combined data of the two repeats,

the discriminatory power merely rose above 0.91.

Moreover, the number of repeats can abruptly change

and more similar repeat units, preferably well-spread

over the genome, should be included before any pos-

tulations about the relation between strains can be

made. With the raising number of fully sequenced

genomes and revelation of new regions with tandem

repeats, VNTR typing has been evaluated for and ap-

plied to several bacterial species (e.g., Ramisse et al.,

2004; Scott et al., 2005; Yazdankhah et al., 2005). This

technique may be especially useful for mycoplasmas

in general, which are fastidious to cultivate and carry

many repeats (Rocha and Blanchard, 2002). However,

in the case of M. hyopneumoniae, the number of

genes containing tandem repeat regions appears to be

limited (Minion et al., 2004). Moreover, before setting

up a VNTR typing scheme, the stability must be firmly

validated since, in contrast to our results for P97, many

mycoplasma-specific proteins were reported to change

between different passages (Rosengarten and Yogev,

1996).

Despite the low discriminatory power, the use of P97

repeats in typing may be an indication of the colonizing

capacities of the isolates. A direct link between the

number of RR1 tandem repeats and adhesion has

been demonstrated and at least seven RR1 repeats

seem to be necessary to allow a strain to adhere to

sodium dodecyl sulfate-solubilized porcine tracheal

cells in vitro (Hsu and Minion, 1998a). Strain F1.2A

(BE) only contained two RR1 repeat regions. Still, the


isolate appears to be able to colonize the respiratory

tract, as it was isolated from a lung sample collected in

the slaughterhouse and it was able to cause lesions in an

experimental study (Vicca et al., 2003). This might

indicate that, besides P97 repeats, other colonization

factors may be present on M. hyopneumoniae strains.

The P146 lipoprotein of M. hyopneumoniae

shows a strong homology to the LppS lipoprotein of

Mycoplasma conjunctivae, which was shown to be

involved in in vitro adhesion (Belloy et al., 2003). In

addition, the N-terminus region of P146 also shows a

strong homology to the P97 adhesin (Minion et al.,

2004) and possesses a strong hydrophobic region

(amino acid 7-29), indicating a transmembrane region

and suggesting that the protein is expressed on the

surface of M. hyopneumoniae cells. The enormous

intraspecific diversity shown for the P146 encoding

gene was at least partly the result of differences be-

tween several repeat regions present in the gene, most

notably a polyserine chain of variable length and a

[Q]n[(P/S)Q]m repeat region. Polyserine chains often

function as a spacer region in proteins involved in

complex carbohydrate degradation (Howard et al.,

2004), while sequences rich in both proline and gluta-

mine are not uncommon and can form a conformation

known as a polyproline II helix (Kay et al., 2000;

Rucker and Creamer, 2002). Such proline rich

sequences are often involved in binding processes and

are highly immunogenic (Kay et al., 2000). Interesting-

ly, Bencina et al. (2001) hypothesized a correlation

between the length of a proline-rich region in the

pvpA gene of Mycoplasma synoviae and virulence.

Still, as long as the function of the P146 protein remains

unknown, correlations with virulence or adhesion are

speculative and need further investigation.

In this study, the presence of size-variable regions

increased the discriminatory power of the P146 PCR-

RFLP technique, which turned out to be very high

(N0.98). Moreover, the typing technique is reproducible

and easy to perform. Similar to estimation of the VNTR

of P97, the technique is PCR-based and thus in princi-

ple does not need pure cultures. The most important

drawback for epidemiological studies is the limited

genomic region under investigation. The molecular

clock of the gene (i.e., the rate at which mutations

are included) is unknown and does not appear to be

constant over the entire gene. The presence of the

highly variable regions seems in sharp contrast with

the observed stability of the gene after several in vitro

passages and with the fact that several isolates of

the same herd but of different pigs had identical restric-

tion patterns.

Apart from differences in reproducibility, complex-

ity and discriminatory power, the different techniques

yielded largely different clusters. Multiple isolates

of herds LH1 (LT), F15 (BE) and F17 (BE) were

indistinguishable with all described typing techniques,

including the above described PFGE analyses (Staken-

borg et al., 2005), and likely represent a single clone. In

addition, isolates F21.9C (BE) and F23.7E (BE) were

considered identical for all tests, although the farms are

from different geographical locations. Interestingly, the

different isolates of F16 were largely diverse for all

techniques applied in this study, while they appeared

almost identical on the basis of PFGE analysis (Staken-

borg et al., 2005).

Although most techniques clustered the other iso-

lates of the same farm in close proximity of each other,

not one technique uniquely clustered isolates according

to their geographical origin. Since an extensive vari-

ability was observed even for small geographical

regions, an association between country and isolate is

unlikely, even by including more international isolates.

This complicates the comparison of different methods,

since validation of typing data is most effective when it

is based on profound epidemiological knowledge and a

known phylogenetic relationship between isolates. In

the case of M. hyopneumoniae, such a relationship

between strains is hard to attain. Isolates are abundantly

present in nature and highly diverse, and they often

cause infections that remain subclinical. In order to

include at least some closely related strains in our

study, multiple isolates originating from the same

herd were used. Our data do indeed indicate that mainly

one clone is circulating at a specific point in time in a

single herd. It may be interesting to investigate the

variability of isolates of the same farm over a longer

period of time to better understand and to model the

transmission patterns of M. hyopneumoniae clones. As

demonstrated, various typing techniques with high dis-

criminatory power are available to perform such stud-

ies, although the use of more than one technique may

be essential to detect differences between closely

related strains.

In conclusion, the typing of M. hyopneumoniae can

easily be performed with high discriminatory power

and reproducibility by restriction analysis of the highly

variable gene encoding a P146 lipoprotein. However,

the limited region under investigation may be insuffi-

cient to visualize many genomic rearrangements.

Therefore, AFLP or PFGE, although much more labor

intensive, may be preferred. RAPD lacks reproducibil-

ity, while determination of the number of repeats in the

gene encoding P97 may only be used if other epidemi-


ological markers are included as well. The different

techniques described are useful for modeling the epi-

demiology of M. hyopneumoniae, which may be help-

ful for developing precautionary measures in order to

control enzootic pneumonia in the future. Finally, a

typing scheme containing P97 VNTR analysis and

P146 variability may be valuable for direct application

on clinical samples and might provide information on

the adherence capacities or virulence of the strains. This

should be further investigated, however.

Acknowledgements

This study was supported by a grant from the Fed-

eral Public Service Health, Food Chain Safety and

Environment (Grant number S-6136).

The authors are grateful to Dr. F. Friis, Dr. E.

Thacker, Dr. A. van Essen, Dr. H. Windsor and Dr. K.

Garlaite for providing us with international M. hyop-

neumoniae isolates or lung samples. The authors would

also like to thank Sara Tistaert for her skilful techni-

cal assistance.

References

Artiushin, S., Minion, F.C., 1996. Arbitrarily primed PCR analysis of

Mycoplasma hyopneumoniae field isolates demonstrates genetic

heterogeneity. Int. J. Syst. Bacteriol. 46, 324–328.

Bashiruddin, J.B., 1998. Extraction of DNA from mycoplasmas.

Methods Mol. Biol. 104, 141–144.

Belloy, L., Vilei, E.M., Giacometti, M., Frey, J., 2003. Characteriza-

tion of LppS, an adhesin of Mycoplasma conjunctivae. Microbi-

ology 149, 185–193.

Bencina, D., Drobnic-Valic, M., Horvat, S., Narat, M., Kleven, S.H.,

Dovc, P., 2001. Molecular basis of the length variation in the N-

terminal part of Mycoplasma synoviae hemagglutinin. FEMS

Microbiol. Lett. 203, 115–123.

Chen, J.W., Zhang, L., Song, J., Hwang, F., Dong, Q., Liui, J.,

Qian, Y., 1992. Comparative analysis of glycoprotein and gly-

colipid composition of virulent and avirulent strain membranes

of Mycoplasma hyopneumoniae. Curr. Microbiol. 24, 189–192.

Djordjevic, S.P., Cordwell, S.J., Djordjevic, M.A., Wilton, J., Minion,

F.C., 2004. Proteolytic processing of the Mycoplasma hyopneu-

moniae cilium adhesin. Infect. Immun. 72, 2791–2802.

Done, S.H., 1991. Environmental factors affecting the severity of

pneumonia in pigs. Vet. Rec. 128, 582–586.

Duim, B., Wassenaar, T.M., Rigter, A., Wagenaar, J., 1999. High-

resolution genotyping of Campylobacter strains isolated from

poultry and humans with amplified fragment length polymor-

phism fingerprinting. Appl. Environ. Microbiol. 65, 2369–2375.

Friis, N.F., 1975. Some recommendations concerning primary isola-

tion of Mycoplasma suipneumoniae and Mycoplasma flocculare a

survey. Nord. Vet. Med. 27, 337–339.

Harasawa, R., Asada, K., Kato, I., 1995. A novel repetitive

sequence from Mycoplasma hyopneumoniae. J. Vet. Med. Sci.

57, 557–558.

Hege, R., Zimmermann, W., Scheidegger, R., Stark, K.D., 2002.

Incidence of reinfections with Mycoplasma hyopneumoniae and

Actinobacillus pleuropneumoniae in pig farms located in respira-

tory-disease-free regions of Switzerland. Identification and quan-

tification of risk factors. Acta Vet. Scand. 43, 145–156.

Hong, Y., Garcia, M., Levisohn, S., Savelkoul, P., Leiting, V.,

Lysnyansky, I., Ley, D.H., Kleven, S.H., 2005. Differentiation

of Mycoplasma gallisepticum strains using amplified fragment

length polymorphism and other DNA-based typing methods.

Avian Dis. 49, 43–49.

Howard, M.B., Ekborg, N.A., Taylor, L.E., Hutcheson, S.W., Weiner,

R.M., 2004. Identification and analysis of polyserine linker

domains in prokaryotic proteins with emphasis on the

marine bacterium Microbulbifer degradans. Protein Sci. 13,

1422–1425.

Hsu, T., Minion, F.C., 1998a. Identification of the cilium binding

epitope of the Mycoplasma hyopneumoniae P97 adhesin. Infect.

Immun. 66, 4762–4766.

Hsu, T., Minion, F.C., 1998b. Molecular analysis of the P97

cilium adhesin operon of Mycoplasma hyopneumoniae. Gene

214, 13–23.

Hsu, T., Artiushin, S., Minion, F.C., 1997. Cloning and functional

analysis of the P97 swine cilium adhesin gene of Mycoplasma

hyopneumoniae. J. Bacteriol. 179, 1317–1323.

Hunter, P.R., Gaston, M.A., 1988. Numerical index of the discrimi-

natory ability of typing systems: an application of Simpson’s

index of diversity. J. Clin. Microbiol. 26, 2465–2466.

Kay, B.K., Williamson, M.P., Sudol, M., 2000. The importance of

being proline: the interaction of proline-rich motifs in signaling

proteins with their cognate domains. FASEB J. 14, 231–241.

Kokotovic, B., Friis, N.F., Jensen, J.S., Ahrens, P., 1999. Amplified-

fragment length polymorphism fingerprinting of Mycoplasma

species. J. Clin. Microbiol. 37, 3300–3307.

Maes, D., Deluyker, H., Verdonck, M., Castryck, F., Miry, C., Vrijens,

B., de Kruif, A., 1999. Risk indicators for the seroprevalence of

Mycoplasma hyopneumoniae, porcine influenza viruses and

Aujeszky’s disease virus in slaughter pigs from fattening pig

herds. Zentralbl. Veterinarmed. [B] 46, 341–352.

Minion, F.C., Lefkowitz, E.J., Madsen, M.L., Cleary, B.J., Swartzell,

S.M., Mahairas, G.G., 2004. The genome sequence of Mycoplas-

ma hyopneumoniae strain 232, the agent of swine mycoplasmosis.

J. Bacteriol. 186, 7123–7133.

Olive, D.M., Bean, P., 1999. Principles and applications of methods

for DNA-based typing of microbial organisms. J. Clin. Microbiol.

37, 1661–1669.

Penner, G.A., Bush, A., Wise, R., Kim, W., Domier, L., Kasha, K.,

Laroche, A., Scoles, G., Molnar, S.J., Fedak, G., 1993. Repro-

ducibility of random amplified polymorphic DNA (RAPD) anal-

ysis among laboratories. PCR Methods Appl. 2, 341–345.

Ramisse, V., Houssu, P., Hernandez, E., Denoeud, F., Hilaire, V.,

Lisanti, O., Ramisse, F., Cavallo, J.D., Vergnaud, G., 2004. Var-

iable number of tandem repeats in Salmonella enterica subsp.

enterica for typing purposes. J. Clin. Microbiol. 42, 5722–5730.

Rawadi, G.A., 1998. Characterization of Mycoplasmas by RAPD

fingerprinting. Methods Mol. Biol. 104, 179–187.

Rocha, E.P., Blanchard, A., 2002. Genomic repeats, genome plasticity

and the dynamics of Mycoplasma evolution. Nucleic. Acids Res.

30, 2031–2042.

Rosengarten, R., Yogev, D., 1996. Variant colony surface antigenic

phenotypes within Mycoplasma strain populations: implications

for species identification and strain standardization. J. Clin.

Microbiol. 34, 149–158.


Rucker, A.L., Creamer, T.P., 2002. Polyproline II helical structure in

protein unfolded states: lysine peptides revisited. Protein Sci. 11,

980–985.

Scott, A.N., Menzies, D., Tannenbaum, T.N., Thibert, L., Kozak, R.,

Joseph, L., Schwartzman, K., Behr, M.A., 2005. Sensitivities and

specificities of spoligotyping and mycobacterial interspersed re-

petitive unit-variable-number tandem repeat typing methods for

studying molecular epidemiology of tuberculosis. J. Clin. Micro-

biol. 43, 89–94.

Stakenborg, T., Vicca, J., Butaye, P., Maes, D., Peeters, J., de Kruif,

A., Haesebrouck, F., 2005. The diversity of Mycoplasma hyop-

neumoniae within and between herds using pulsed-field gel elec-

trophoresis. Vet. Microbiol. 109, 29–36.

Urwin, R., Maiden, M.C., 2003. Multi-locus sequence typing: a tool

for global epidemiology. Trends Microbiol. 11, 479–487.

van Eldere, J., Janssen, P., Hoefnagels-Schuermans, A., van Lierde,

S., Peetermans, W.E., 1999. Amplified-fragment length polymor-

phism analysis versus macro-restriction fragment analysis for

molecular typing of Streptococcus pneumoniae isolates. J. Clin.

Microbiol. 37, 2053–2057.

Van Looveren, M., Ison, C.A., Ieven, M., Vandamme, P., Martin, I.M.,

Vermeulen, K., Renton, A., Goossens, H., 1999. Evaluation of the

discriminatory power of typing methods for Neisseria gonor-

rhoeae. J. Clin. Microbiol. 37, 2183–2188.

Vicca, J., Stakenborg, T., Maes, D., Butaye, P., Peeters, J., de

Kruif, A., Haesebrouck, F., 2003. Evaluation of virulence of

Mycoplasma hyopneumoniae field isolates. Vet. Microbiol. 97,

177–190.

Wilton, J.L., Scarman, A.L., Walker, M.J., Djordjevic, S.P., 1998.

Reiterated repeat region variability in the ciliary adhesin gene of

Mycoplasma hyopneumoniae. Microbiology 144, 1931–1943.

Yazdankhah, S.P., Lindstedt, B.A., Caugant, D.A., 2005. Use of

variable-number tandem repeats to examine genetic diversity of

Neisseria meningitidis. J. Clin. Microbiol. 43, 1699–1705.

Comparison of molecular techniques for the typing of Mycoplasma hyopneumoniae isolates

Documents