Comparative Biochemistry and Physiology, Part Cuos-envitox.com.mocha3031.mochahost.com/wp-content/uploads/2… · riparius (Diptera, Chironomidae) larvae as a potential biomarker

Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part C

j ourna l homepage: www.e lsev ie r .com/ locate /cbpc

Characterization and expression of superoxide dismutase genes in Chironomusriparius (Diptera, Chironomidae) larvae as a potential biomarker of ecotoxicity

Sun-Young Park, Prakash M. Gopalakrishnan Nair, Jinhee Choi ⁎School of Environmental Engineering and Graduate School of Energy and Environmental System Engineering, University of Seoul, 90 Jeonnong-dong, Dongdaemun-gu, Seoul 130‐743,Republic of Korea

⁎ Corresponding author. Tel.: +82 2 2210 5622; fax:E-mail address: [email protected] (J. Choi).

1532-0456/$ – see front matter © 2012 Elsevier Inc. Alldoi:10.1016/j.cbpc.2012.06.003

a b s t r a c t

Article history:Received 28 March 2012Received in revised form 6 June 2012Accepted 7 June 2012Available online 15 June 2012

Keywords:Chironomus ripariusSuperoxide dismutase genesOxidative stressBiomarker

Superoxide dismutase (SOD, EC 1.15.1.1) is an enzyme involved in the scavenging of reactive oxygen species(ROS) into molecular oxygen and hydrogen peroxide. In this study, a copper–zinc superoxide dismutase (Cu–ZnSOD) gene and a manganese superoxide dismutase (MnSOD) gene in aquatic midge, Chironomus riparius(CrSODs) was identified using an Expressed Sequence Tag (EST) database generated by 454 pyrosequencing.A multiple sequence alignment of C. riparius sequences revealed high homology with other insect sequencesin terms of the amino acid level. Phylogenetic analysis of the CrSODs revealed that they were grouped withSODs of other organisms, such as Polypedilum vanderplanki, Drosophila melanogaster, Aedes aegypti, Anophelesgambiae, Culex quinquefasciatus and Bombyx mori. Expression of the corresponding CrSODs was analyzed dur-ing different developmental stages and following exposure to various environmental contaminants with dif-ferent mode of actions i.e., paraquat, cadmium, benzo[a]pyrene, and chloropyrifos. CrSOD gene expressionwas significantly up or down regulated in response to exposure to the chemicals tested. The overall resultssuggested that SOD gene expression provided a platform for the understanding of oxidative stress responsescaused by exposure to various environmental contaminants, and the SOD genes could be used as biomarkersfor environmental disturbances such as oxidative stress initiated by xenobiotics.

© 2012 Elsevier Inc. All rights reserved.

1. Introduction

Chironomids are widely distributed and the most abundant insectsfound in freshwater ecosystems. Their ecological diversity is corroboratedby their physiological ability to tolerate environmental stress such as sa-linity, temperature and reduced levels of dissolved oxygen (Armitage etal., 1995; Choi et al., 1999; Ha and Choi, 2008). The larvae of Chironomusriparius Mg. possess hemoglobins (Hb) with a high affinity for oxygen(Osmulski and Leyko, 1986; Choi andHa, 2009),which is believed to con-fer the ability of the larvae to be highly tolerant to various pollutants(Armitage et al., 1995; Choi et al., 1999; Al-Shami et al., 2010). The surviv-al of Chironomus in hypoxic or polluted habitats suggests that it possessesefficient biochemical equipment for defense against oxidative stress.C. riaprius is widely used as ecotoxicological test organism using organ-ism/population and biochemcical level biomarker (Ha and Choi, 2008;Choi and Ha, 2009; Lee and Choi, 2006, 2007). However, because of lim-ited genome information, studies on stress response genes as biomarkerwere relatively less than other species (Nair et al., 2011a).

The prime antioxidant enzymes, superoxide dismutases (SOD) aremetalloenzymes, which catalyze the dismutation of superoxide radicalsto hydrogen peroxide and oxygen. They are classically divided into two

+82 2 2244 2245.

rights reserved.

evolutionary classes copper/zinc and manganese, or iron containingdismutases, which are respectively referred to as CuZn-SOD, Mn-SODand Fe-SOD (Bannister et al., 1987). Eukaryotes possess two majorkinds of SOD, CuZn-SOD, which is presentmostly in the cytosol and nu-cleus, andMn-SODwhich is present inmitochondria (Kroll et al., 1995).

Molecular characterization of the SOD genes was well studied inmodel species such as Drosophila melanogaster, Caenorhabditis elegansand Danio rerio (Seto et al., 1989; Duttaroy et al., 1994; Giglio et al.,1994; Hunter et al., 1997; Ken et al., 1998; Lin et al., 2009). Though,SODhas been frequently used as an ecotoxicity biomarker inmany aquat-ic species using its enzyme activity (Singh et al., 2006; Arzate-Cárdenasand Martínez-Jerónimo, 2011; Li et al., 2011) including C. riparius (Choiet al., 1999, 2002), the SOD gene has been characterized by only a smallnumber of environmental species (Kim et al., 2011; Rajarapu et al.,2011; Rhee et al., 2011; Xiong et al., 2012). Recent increasing use ofNext Generation Sequencing (NGS) technology enables sequencing ofthe entire genome or transcriptomes on environmentally relevant organ-isms and our laboratory obtained the C. riparius transcriptome from 454pyrosequencing, which revealed several candidate genes of ecotoxico-logical interest, including SOD (Nair et al., 2011a). Characterization ofSOD genes in important ecotoxicity model species, such as C. riparius,will heighten the potential use of this species in sensitive ecotoxicitymonitoring.

In this study we characterized the C. riparius CuZn-SOD and Mn-SOD genes identified from the EST database generated using 454

http://dx.doi.org/10.1016/j.cbpc.2012.06.003mailto:[email protected]://dx.doi.org/10.1016/j.cbpc.2012.06.003http://www.sciencedirect.com/science/journal/15320456

Fig. 1. (1–1) Multiple sequence alignment of C. riparius Cu Zn SOD (Cr Cu–Zn SOD) with other species. Alignments were done using ClustalW (Thompson et al., 1994) with defaultparameters. Identical amino acids in all species are highlighted with same color. Dashes are used to denote gaps introduced for making maximum alignment. Putative amino acid forCu-binding (H69, H71, H86 and H134) and putative amino acid for Zn-binding (H86, H94, D105 and H134) are marked by “*”. The boxes are Cu–Zn SOD family signature sequences(GFHIHEKGDLS and GNAGGRVACGIV). PvCu–ZnSOD (Polypedilum vanderplanki Cu–ZnSOD, ADM26626.1), DmCu–ZnSOD (Drosophila melanogaster Cu–ZnSOD, NP_476735.1),AegCu–ZnSOD (Aedes aegypti Cu–ZnSOD, EAT48703.1), AngCu-ZnSOD (Anopheles gambiae Cu–ZnSOD, AAS17758.1), CqCu–ZnSOD (Culex quinquefasciatus Cu–ZnSOD,XP_001841816.1), BmCu–ZnSOD (Bombyx mori Cu–ZnSOD, NP_001037084.1), CeSOD1 (Caenorhabditis elegans SOD1, NP_001021956.1), CeSOD5 (Caenorhabditis elegans SOD5,NP_494779.1), CeSOD4 (Caenorhabditis elegans SOD4, NP_499091.1), HsCu–ZnSOD (Homo sapiens Cu–ZnSOD, NP_000445.1), HsCu–ZnSOD_extracellular (Homo sapiens extracellularCu–ZnSOD, NP_003093.2). (1–2) Multiple sequence alignment of C. ripariusMn SOD (Cr Mn SOD) with other species. Alignments were done using ClustalW (Thompson et al., 1994)with default parameters. Identical amino acids in all species are highlighted with same color. Dashes are used to denote gaps introduced for making maximum alignment. Putativeamino acid for Mn-binding (H48, H97, D181, H185) is marked by “*”. The box is Mn SOD family signature sequence (DVWEHAYY). DmMnSOD (Drosophila melanogaster MnSOD,NP_476925.1), AegMnSOD (Aedes aegypti MnSOD, EAT43773.1), AngMnSOD (Anopheles gambiae MnSOD, AAR90328.1), CqMnSOD (Culex quinquefasciatus MnSOD, EDS40380.1),BmMnSOD: (Bombyx mori NP_001037299.1), CeSOD2 (Caenorhabditis elegans SOD2, NP_492290.1), CeSOD3 (Caenorhabditis elegans SOD3, NP_510764.1), HsMnSOD (Homo sapiensMnSOD MnSOD AAH12423.1).

188 S-Y. Park et al. / Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

Fig. 1 (1–2) (continued).

189S-Y. Park et al. / Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

pyrosequencing. In order to test the applicability of these genes as bio-markers for oxidative stress to be used in ecotoxicity monitoring, theexpression changes of the CuZn- andMn-SOD genes by exposure to en-vironmental contaminants were investigated. Many environmentalcontaminants may induce oxidative stress either directly or indirectlyafter bioactivation (e.g. phase I reactions), or as a consequence of prima-ry toxicity. In this study, we tested three chemicals having differentmode of actions inducing oxidative stress, such as, cadmium (Cd),benzo[a]pyrene (BaP) and chloropyrifos (CP).

Cadmium(Cd), a highly persistent and toxicmetal pollutant has alsobeen reported to produce free radical resulting in oxidative deteriora-tion of lipids, proteins and DNA (Aswathi et al., 1996; Waisberg et al.,2003; Yalin et al., 2006; Liu et al., 2008). Benzo[a]pyrene (B[a]P), a ubiq-uitously distributed polycyclic aromatic hydrocarbons (PAH) (JuhaszandNaidu, 2000), and chloropyrifos (CP), an organophosphorous insec-ticide, are both activated after metabolic processing via cytochromeP450 (CYP450) (Safe, 1995; Extoxnet, 1996; Burczyniski and Penning,2000; Tang et al., 2001; Hassanain et al., 2007). Paraquat (PQ), an oxy-gen radical generating herbicide, is a well-known and widely used pos-itive control for oxidative stress studies (Suntres, 2002; Lushchak,2011). We also used PQ as positive control as it is also shown to induceoxidative stress in aquatic species such as, Channa punctata (Parvez andRaisuddin, 2006), zebrafish (Bretaud et al., 2004), and rainbow trout(Stephensen et al., 2002).

In this study, we characterized CuZn- and Mn-SOD in 4th instarlarvae of C. riparius and its potential as a biomarker of ecotoxicity

was then tested using the expression analysis under the treatmentof the three above-mentioned chemicals.

2. Materials and methods

2.1. Insects

C. ripariusMg. (Diptera, Chironomidae)were obtained from the Tox-icological ResearchCenter of the Korea Institute of Chemical Technology(Daejeon, Korea). The larvae were reared on an artificial diet of fishflake food (Tetramin, Tetrawerke, Melle, Germany) in glass chamberscontaining dechlorinated tap water and acid washed sand with aera-tion, and under a 16–8 h light–dark photoperiod and at 20±1 °C.

2.2. Chemical preparation and exposure

Groups of 10 fourth instar larvae were exposed to each chemical inseparate beakers of 100 mL of EPA water (APHA et al., 1992). Expo-sures to 50 mg/L of PQ (paraquat dichloride, Sigma Aldrich), 2, 10and 20 mg/L of Cd (cadmium chloride, Sigma Aldrich), 10, 100 and1000 μg/L of BaP (Sigma-Aldrich) and 0.2, 1 and 2 μg/L of CP (SigmaAldrich) were performed for 12 and 24 h.

Three independent sets of biological treatments were maintainedfor all exposure conditions including control larvae were maintainedwithout any exposure to chemicals for different duration of treatments.

CdCl2 (mg/L)

2 10 20

Rel

ativ

e ex

pres

sion

(C

ontr

ol=

1)

0.0

0.5

1.0

1.5

2.0

2.5

(A)

(B)

12h24h

aa

c

c c

b

2.5

CrCu-ZnSOD

PvCu-ZnSOD

AngSOD2

CqSOD2

DmCu-ZnSOD

BmCu-ZnSOD

HsCuZnSOD

CeSOD5

CeSOD1

CeSOD4

AegCu-ZnSOD

HsCuZnSOD(extracellular)

CrMnSOD

AegMnSOD

AngMnSOD

DmMnSOD

CqMnSOD

BmMnSOD

CeSOD2

CeSOD3

HsMnSOD

81

94

32

17

59

24

47

100

100

99

99

95

97

63

82

40

29

80

0.2

Fig. 2. Phylogenetic relationships of C. riparius SODs (CrSODs) with that of other spe-cies, SOD amino acid sequences were aligned using ClustalW and a distance neighbor-joining tree was generated using MEGA 4. The values shown at the nodes of the bra-nches are the confidence levels from 1000 replicate bootstrap samplings. The scalebar indicates the evolutionary distance between groups. PvCu–ZnSOD (ADM26626.1), DmCu–ZnSOD (NP_476735.1), AegCu–ZnSOD (EAT48703.1), AngCu–ZnSOD(AAS17758.1), CqCu–ZnSOD(XP_001841816.1), BmCu–ZnSOD (NP_001037084.1),CeSOD1 (NP_001021956.1), CeSOD5 (NP_494779.1), CeSOD4 (NP_499091.1), HsCu-ZnSOD: (NP_000445.1), HsCu-ZnSOD_extracellular NP_003093.2), DmMnSOD (NP_476925.1), AegMnSOD (EAT43773.1), AngMnSOD (AAR90328.1), CqMnSOD (EDS40380.1), BmMnSOD: (NP_001037299.1), CeSOD2 (NP_492290.1), CeSOD3 (NP_510764.1),HsMnSOD (AAH12423.1).

PQ 50 mg/L24h12h

Rel

ativ

e ex

pres

sion

(co

n=1)

0.0

0.5

1.0

1.5

2.0

2.5

3.0

MnSODCu-ZnSOD

a

a

a

a

Fig. 4. Real-time PCR of C. riparius SOD gene expression after treatment with PQ 50 mg/Lfor 12 h, 24 h. Expression profiles of mRNA of SODs. mRNA expression level values werecalculated relative to the Chironomus actin (GenBank Accession number: AB070370)expression and shown as mean±SE (n=3). Asterisks indicate significant difference((a) pb0.05, (b) pb0.01, (c) pb0.001) as compared to the control.

190 S-Y. Park et al. / Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

After exposure, the larvae were collected, immediately frozen in liquidnitrogen and stored at−80 °C.

2.3. Identification and phylogenetic analysis of the SOD genes

The SOD gene sequences were retrieved from the EST database andmanually annotated in order to predict their transcription initiation and

CdCl2(mg/L)2 10 20

Rea

ltive

exp

ress

ion

( C

ontr

ol=

1)

0.0

0.5

1.0

1.5

2.0

12h24h

aa

c

b

b

Fig. 5. Real-time PCR of C. riparius SOD gene expression after treatment with 2, 10,20 mg/L CdCl2. Expression profiles of mRNA of CrSODs. mRNA expression level valueswere calculated relative to the Chironomus actin (GenBank Accession number:AB070370) expression and shown as mean±SE (n=3). Alphabets indicate significantdifference ((a) pb0.05, (b) pb0.01, (c) pb0.001) as compared to the control. (A)MnSOD (B) Cu–Zn SOD.

Development stage

egg larva pupa male female

Rel

ativ

e ex

pres

sion

0

5

10

15

20

25

Mn SODCu-ZnSOD

Fig. 3. Real-time PCR analysis of Chironomus riparius SODs mRNA transcripts at differ-ent developmental stages. The mRNA expression of SOD genes was quantified usingreal time PCR and normalized using Chironomus actin gene. All values represent themean±SE (n=2).

**

BaP (µg/L)

10 100 1000

Rel

ativ

e ex

pres

sion

(C

ontr

ol=

1)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

12h24h

cc

c

BaP (µg/L)10 100 1000

Rel

ativ

e ex

pres

sion

(C

ontr

ol=

1)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.412h24h

a

a

c

c

cc

(A)

(B)

Fig. 6. Real-time PCR of C. riparius SOD gene expression after treatment with BaP10,100,100 μg/L for 12 h, 24 h. Expression profiles of mRNA of SODs. mRNA expressionlevel values were calculated relative to the Chironomus actin (GenBank Accessionnumber: AB070370) expression and shown as mean±SE (n=3). Alphabets indicatesignificant difference ((a) pb0.05, (b) pb0.01, (c) pb0.001) as compared to the control.(A) MnSOD (B) Cu–Zn SOD.

Rel

ativ

e ex

pres

sion

(C

ontr

ol=

1)

0.0

0.5

1.0

1.5

2.012h24h

a

cc

c

CP (µg/L)

CP (µg/L)

0.2 1 2

0.2 1 2

Rel

ativ

e ex

pres

sion

(C

ontr

ol=

1)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

12h24h

a

c

c

a c

(A)

(B)

Fig. 7. Real-time PCR of C. riparius SOD gene expression after treatment with CP 0.2, 1,2 μg/L for 12 h, 24 h. Expression profiles of mRNA of SODs. mRNA expression levelvalues were calculated relative to the Chironomus actin (GenBank Accession number:AB070370) expression and shown as mean±SE (n=3). Alphabets indicate significantdifference ((a) pb0.05, (b) pb0.01, (c) pb0.001) as compared to the control. (A)MnSOD (B) Cu–Zn SOD.

191S-Y. Park et al. / Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

termination sites using BlastX comparisons of putative amino acid trans-lations were deduced using an online translation tool (http://www.expasy.ch/tools/) aligned using ClustalW (Thompson et al., 1994). A phy-logenetic tree was constructed by the neighbor-joining method and thebootstrap values were calculated with 1000 replications using MEGA4.1(Tamura et al., 2007). The deduced amino acid sequence was analyzedusing the Expert Protein Analysis System and the predicted molecularweight was calculated using an online tool (http://expasy.org/).

2.4. Expression analysis of the SOD genes

Total RNAwas extracted from the samples using TrizolTM (Invitrogen,USA) following the manufacturer's instructions. The cDNA was synthe-sized by reverse transcribing 1 μg of total RNA using an iScript cDNA Syn-thesis kit (Bio-Rad, CA, USA). The primers were designed using Primer3(http://frodo.wi.mit.edu/primer3/) (Table 1). In order to study the SODgene expression of the larvae exposed to PQ, Cd, CP and BaP, quantitativereal time RT-PCR was performed using IQ SYBR Green Super Mix (Bio-Rad) in reaction conditions as follow: initial denaturing at 95 °C for7 min followed by 44 cycles of 95 °C for 15 s, 55 °C for 1 min and exten-sion of 72 °C for 15 s. Melting curve cycles were performed from 65 °Cto 95 °C with a 0.2 °C increase per cycle using a CFX96 TM real time PCRdetection system (Bio-Rad). The expression level of each SOD genes was

calculated after exposure to the different chemicals. The mRNA level ofeach gene was normalized to that of the C. riparius β-actin mRNA(GenBank Accession number: AB070370) which was used as a referencegene served to provide the relative expression level calculations. TheCycle threshold (Ct) values were converted to relative gene expressionlevel using the CT (2−ΔCt) method and analysis software provided withthe CFX-96 real time PCR machine (Bio-Rad).

2.5. Data analysis

Statistical differences between the control and treated sampleswere examined with one-way ANOVA test using SPSS 12.0KO (SPSSInc., Chicago, IL, USA). All data were provided as relative mRNA ex-pression reported as means±standard error of the mean (SEM).One-way analysis of variance was performed on all data and pb0.05was considered statistically significant.

3. Results and discussion

3.1. Identification of C. riparius SOD genes (CrSODs)

The antioxidant enzymes protect organisms from the toxic effects ofthe activated oxygen species and help to maintain cellular homeostasis

http://www.expasy.ch/tools/http://www.expasy.ch/tools/http://expasy.org/http://frodo.wi.mit.edu/primer3/

192 S-Y. Park et al. / Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

by removing ROS which constitutes antioxidant enzymes such assuperoxide dismutase (SOD), catalase (CAT), glutathione peroxi-dase (GPx) glutathione reductase (GR), glutathione S-transferase(GST), thioredoxinreductase (TrxR) and others (Mackay and Bewley,1989; Tavares-Sánchez et al, 2004). In our previous studies CAT, GSTs,TrxR-1 and PHGPx from C. riparius were characterized, and the mRNAexpression was determined after exposure to different environmentalcontaminants, and it was found that environmental contaminants in-duced these antioxidant enzyme genes in time and dose-dependentmanners, suggesting their potentials as biomarkers for ecotoxicitymon-itoring (Nair and Choi, 2011, 2012; Nair et al., 2011b, 2012).

Previously, a C. riparius transcriptome was obtained from 454pyrosequencing (Nair et al., 2011a). Following the assembly of the se-quences, the contigs and singletons from the C. riparius EST databasewere BlastX searched against the protein databases “nr” and “Uniprot”,from which the sequences encoding the putative C. riparius SOD genes(CrSODs) were identified (Fig. 1). The 1399 bp CrCu,Zn-SOD includedan open reading frame of 526 bp encoding a putative protein of 175amino acids. Therewas a 235 bp 5′ and a long 636 bp3′ untranslated re-gion (UTR) with a polyadenylation signal site (AATAAA). The predictedmolecular mass and theoretical pI of the CrCu–ZnSOD were 18.34 and6.42 kDa, respectively. The 873 bp CrMnSOD included an open readingframe of 657 bp encoding a putative protein of 218 amino acids. Therewas a 95 bp 5′ and a long 121 bp 3′ UTR with a polyadenylation signalsite (AATAAA). The putative protein encoded by the CrMn-SOD cDNAhad a molecular mass of 24.33 kDa and a theoretical pI of 8.48.

ClusterW analysis revealed that the deduced amino acid sequence,CrSODs, displayed higher identity with insect species than any other tax-onomy group species. The deduced amino acid sequence of the Cu–ZnSOD protein displays especially high similarity to the Cu–ZnSODsequences from Culex quinquefasciatus (60%) and from Polypedilumvanderplanki (82%). The deduced amino acid sequence of theMnSODpro-tein displays a high similarity to the MnSOD sequences from Drosophilamelanogaster (62%), Aedes aegypti (70%), Anopheles gambiae (63%) andBombyx mori (60%).

Multiple alignment of SODs revealed that several characteristic mo-tifs and signature sequences could be identified in CrSODs. H69, H71,H86 and H134 in the CrCu–Zn SOD were predicted to be critical for Cubinding, a finding which was highly consistent with the Cu–Zn SODfound in other species. Four conserved Zn binding sites, H86, H94,D105 and H134 were identified. Two Cu–Zn SOD family signature se-quences (GFHIHEKGDLS and GNAGGRVACGIV) were the highest con-served regions according to multiple alignments (Fig. 1(1-1), (1-2)).Four manganese binding sites (H48, H97, D181 and H185) were ob-served, and the Mn SOD family signature sequence (DVWEHAYY) wasthe highest conserved region according to multiple alignments. Thephylogenetic relationship of CrSODswas investigatedwith other speciesincluding insect species such as D. melanogaster, A. aegypti, A. gambiae,C. quinquefasciatus, B. mori and P. vanderplanki. The analysis revealedthat the CrSODs were grouped into two major clades Cu–Zn and MnSOD, and CrSODs were more closely related to the insect SODs thanother species such as human, C. elegans (Fig. 2). In order to determine

Table 1Primers used in real time PCR study.

Primer name Sequence of primer (5′ – 3′) Amplified product length (bp)

CrCu–ZnSOD-F GTCGTGCTGTTGTCGTTCAT 81CrCu–ZnSOD-R CAGCATTGCCAGTTTTGTGTCrMnSOD-F CTGATGCACTCCAAAAAGCA 86CrMnSOD-R AACTCCAACAGCAGCGACTTCrActin-F GATGAAGATCCTCACCGAACG 145CrActin-R TTCGAGTGAGGTTGATGCAG

the evolutionary relationships existing between the different Cu–Zn andMn SODs, the sequences isolated in this study, as well as those availablein the GenBank database, were used in a phylogenetic comparison. Thesequences of cDNA described in this study were deposited into GenBankwith the accession numbers JQ342169 (CrMnSOD) and JQ342170 (CrCu–ZnSOD).

3.2. CrSOD mRNA expression

Developmental stage-specific expression patterns of CrSODs wereobserved in eggs, larvae, pupae and adults (male and female) (Fig. 3).The CrSODs showed varying levels of mRNA expression in all stages,with most exhibiting higher expression levels in the eggs and maleand female adult stages. However, CrSOD expression levels were foundto be low in the larval stage. In C. riparius, oxidative stress is closely relat-ed to Hb as the autoxidation of Hb is an important source of superoxideradical (Choi et al., 1999). Thus, high SOD expression level at the stagesof low or absence of Hb and low expression level at the stage of high Hbcontents are difficult to explain. The fact that expression of the mito-chondrial SOD gene (i.e., MnSOD) increased more than that of theCuZn SOD gene in the egg stage may be related to intensive mitochon-drial activity due to high energy demand required during this develop-mental period.

To identify the potential of SOD genes as biomarkers for environ-mental contaminants, SOD gene expression was first assessed usingPQ as a positive control for oxidative stress, and subsequently, envi-ronmental chemicals, which are known direct oxidative stress induc-er (Cd) and indirect inducers (B[a]P, CP). The expression level of theCrSOD genes significantly increased compared to the correspondingcontrol treatments upon exposure to PQ 50 mg/L for 12 and 24 h(Fig. 4). The expression levels of both SOD genes were significantly upregulated upon exposure to Cd for 12 h (in about 1.5–2 fold comparedto control), but significantly down regulated after 24 h of exposure(more than 2 fold compared to control), (Fig. 5). The rapid increase ofboth CuZn- and Mn-SOD due to exposure by PQ and Cd may havebeen due to the direct ROS formation by these chemicals, as both arewell known ROS producers (Ali et al., 1996; Cuypers et al., 2010). Previ-ously, increased expression of SOD gene as a result of Cd exposure wasalso observed in aquatic species such as Oplegnathus fasciatus, Tigriopusjaponicas and Crassostrea gigas (Cho et al., 2006; Jo et al., 2008; Kim etal., 2010). However, decreased expression of SODgenes after 24 h of ex-posure to Cd may suggest the serious progression of Cd toxicity. In ourprevious study, decreases in total Hb content and expression of globinproteins were observed after exposure to Cd for 24 h, which occurredconcomitantly with deterioration in organism fitness such as growth,reproduction and development (Choi and Ha, 2009). We explainedthat phenomenon as that the alteration of globin protein expressionmay be a toxic response potentially leading to the physiological conse-quences. Thus, the early response of the SOD genes may be consideredas a maintaining homeostasis, whereas its response during a longer ex-posure period may probably reflect the adverse effects of Cd exposure.

In a 12 h BaP and CP exposure, decreased MnSOD expression wasobserved at all treatment concentrations (in about 0.25–0.7 fold com-pared to control), and increased Cu–ZnSOD expression was observedat a BaP exposure of 1000 μg/L (in about 1.2 fold compared to control).In a 24 h exposure, CuZnSOD expression was decreased by BaP (inabout 0.5 fold compared to control), and CP exposure of 1 and 2 μg/L(in about 0.7 fold compared to control), and 2 μg/L of CP exposure in-creased MnSOD (more than 1.5 fold compared to control) (Figs. 6 and7). The primary toxic mode of action of BaP is DNA adduct formation,while for CP it is inhibition of acetylcholinesterase, and they are bothmediated by reactivemetabolites formed via Cytochrome P450 systems(CYP450). Even though their primary toxicity produced by CYP450 isnot directly related to oxidative stress, changed expression of the SODgenes may reflect oxidative stress related toxicity, as it is well knownthat ROS tends to form during xenobiotic metabolism by CYP450. The

193S-Y. Park et al. / Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

involvement of oxidative stress in the manifestation of CP toxicity haspreviously been reported (Saulsbury et al., 2009), and increased DNAdamage and transcripts of CuZn- and MnSOD by BaP exposure werealso observed in the copepod Tigriopus japonicas (Kim et al., 2011).However, the direction of change is difficult to explain as an increasedROS level is expected due to higher CYP activity to metabolize CP andBaP.

In conclusion, CuZn- and Mn-SOD genes were characterized inC. riparius, and an expression analysis suggested that the CrSODgenes seem to react to both direct and indirect oxidative stress in-ducers, and thus has potential as biomarkers for environmental con-tamination, particularly for oxidative stress inducing xenobiotics.However, the measurement of SOD gene expression alone is ratherlimited to allow a full understanding of oxidative stress related toxic-ity. Thus, further studies on SOD enzyme activity and on other antiox-idant enzymes genes are warranted in order to develop CrSOD genesuseful in ecotoxicity monitoring.

Acknowledgments

Thisworkwas supported byMid-career Researcher Program throughNRF grant funded by the Korean MEST (no. 2011‐0027489).

References

Ali, S., Jain, S.K., Abdulla, M., Athar, M., 1996. Paraquat induced DNA damage by reactiveoxygen species. Biochem. Mol. Biol. Int. 39, 63–67.

Al-Shami, S.A., Rawi, C.S., HassanAhmad, A., Nor, S.A., 2010. Distribution of chironomidae(Insecta: Diptera) in polluted rivers of the Juru River Basin, Penang, Malaysia. J. Envi-ron. Sci. (China) 22 (11), 1718–1727.

APHA, WPCF, AWWA, 1992. Standard Methods for the Examination of Water andWaste Water. American Public Health Association, Washington, DC.

Armitage, P., Cranston, P.S., Pinder, L.C.V., 1995. The Chironomidae. The Biology andEcology of Non-biting Midges. Chapman and Hall, New York.

Arzate-Cárdenas, M.A., Martínez-Jerónimo, F., 2011. Age-altered susceptibility in hexa-valent chromium-exposed Daphnia schodleri (Anomopoda: Daphniidae): integrat-ed biomarker response implementation. Aquat. Toxicol. 105 (3–4), 528–534.

Aswathi, S., Bajpai, K.K., Singhal, S.S., Frenkel, E.P., Ansari, G.A.S., Aswati, Y.C., 1996. Theeffect of glutathione S-transferases on interactions of glutathione and melphalan.Drug Metab. Dispos. 24, 371–374.

Bannister, J.V., Bannister, W.H., Rotilio, G., 1987. Aspects of the structure, function, andapplications of superoxide dismutase. CRC Crit. Rev. Biochem. 22, 111–180.

Bretaud, S., Lee, S., Guo, S., 2004. Sensitivity of zebrafish to environmental toxins impli-cated in Parkinson's disease. Neurotoxicol. Teratol. 26, 857–864.

Burczyniski, M.E., Penning, T.M., 2000. Genotoxicity polycyclic aromatic ortho-quinonesgenerated by aldo-keto reductase induce CYP1A1 via nuclear translocation of thearyl hydrocarbon receptor. Cancer Res. 60, 908–915.

Cho, Y.S., Choi, B.N., Kim, K.H., Kim, S.K., Kim, D.S., Bang, I.C., Nam, Y.K., 2006. Differen-tial expression of Cu/Zn superoxide dismutase mRNA during exposures to heavymetals in rockbream (Oplegnathus fasciatus). Aquaculture 253, 667–679.

Choi, J., Ha, M.H., 2009. Effect of cadmium exposure on the globin protein expression in4th instar larvae of Chironomus riparius Mg. (Diptera: Chironomidae): anecotoxicoproteomics approach. Proteomics 9 (1), 31–39.

Choi, J., Roche, H., Caquet, T., 1999. Characterization of superoxide dismutase activity inChironomus riparius Mg. (Diptera, Chironomidae) larvae-a potential biomarker.Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 124 (1), 73–81.

Choi, J., Caquet, T., Roche, H., 2002. Multilevel effects of sublethal fenitrothion exposurein Chironomus ripariusMg. (Diptera, Chironomidae) larvae. Environ. Toxicol. Chem.21 (12), 2725–2730.

Cuypers, A., Plusquin, M., Remans, T., Jozefczak, M., Keunen, E., Gielen, H., Opdenakker,K., Nair, A.R., Munters, E., Artois, T.J., Nawrot, T., Vangronsveld, J., Smeets, K., 2010.Cadmium stress: an oxidative challenge. Biometals 23 (5), 927–940.

Duttaroy, A., Meidinger, R., Kirby, K., Carmichael, S., Hilliker, A., Phillips, J.A., 1994. Manga-nese superoxide dismutase-encoding cDNA from Drosophila melanogaster. Gene 143(2), 223–225.

Extoxnet, 1996. Pesticide information profiles: chlorpirifos, http://www.extoxnet.orst.edu/cgiwebglimpse/mfs/services/data/info/extoxnet?link=http://acS.

Giglio, A.M., Hunter, T., Bannister, J.V., Bannister, W.H., Hunter, G.J., 1994. The copper/zinc superoxide dismutase gene of Caenorhabditis elegans. Biochem. Mol. Biol. Int.33 (1), 41–44.

Ha, M.H., Choi, J., 2008. Effect of environmentalcontaminants on hemoglobin of larvaeof aquatic midge, Chironomus riparius (Diptera: Chironomidae); a potential bio-marker for ecotoxicity monitoring. Chemosphere 71, 1928–1936.

Hassanain, M.A., Abdel-Rahman, E.H., Abo-Hegab, S., Tawfik, M.A., Abbas, W.T., 2007.Induction of cytochrome P450 1A1 as a biomarker of benzo-a-pyrene pollution inEgyptian fresh water fish. Pak. J. Biol. Sci. 10, 1161–1169.

Hunter, T., Bannister, W.H., Hunter, G.J., 1997. Cloning, expression, and characterizationof two manganese superoxide dismutases from Caenorhabditis elegans. J. Biol.Chem. 272, 28652–28659.

Jo, P.G., Choi, Y.K., Choi, C.Y., 2008. Cloning and mRNA expression of antioxidant en-zymes in the Pacific oyster, Crassostrea gigas in response to cadmium exposure.Comp. Biochem. Physiol. C Toxicol. Pharmacol. 147 (4), 460–469.

Juhasz, A.L., Naidu, R., 2000. Enrichment and isolation of non-specific aromatic de-graders from unique uncontaminated (plant and faecal material) sources and con-taminated soils. J. Appl. Microbiol. 89 (4), 6642–6650.

Ken, C.R., Shaw, J.F., Wu, J.L., Lin, C.T., 1998. Molecular cloning of a cDNA coding for cop-per/zinc superoxide dismutase from zebrafish and its expression in Escherichia coli.J. Agric. Food Chem. 46, 2863–2867.

Kim, J.H., Rhee, J.S., Lee, J.S., Dahms, H.U., Lee, J., Han, K.N., Lee, J.S., 2010. Effect of cadmiumexposure on expression of antioxidant gene transcripts in the river pufferfish, Takifuguobscurus (Tetraodontiformes). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 152 (4),473–479.

Kim, B.M., Rhee, J.S., Park, G.S., Lee, J., Lee, Y.M., Lee, J.S., 2011. Cu/Zn- and Mn-superoxide dismutase (SOD) from the copepod Tigriopus japonicus: molecularcloning and expression in response to environmental pollutants. Chemosphere84 (10), 1467–1475.

Kroll, J.S., Langford, P.R., Wilks, K.E., Keil, A.D., 1995. Bacterial [Cu, Zn]-superoxide dis-mutase: phylogenetically distinct from the eukaryotic enzyme, and not so rareafter all! Microbiology 141 (Pt 9), 2271–2279.

Lee, S.B., Choi, J., 2006. Multiple level evaluation of nonylphenol toxicity in 4th instarlarvae of Chironomus riparius (Diptera, chironomidae). Environ. Toxicol. Chem.25, 3006–3014.

Lee, S.B., Choi, J., 2007. Effects of bisphenol A and ethynyl estradiol exposure on enzymeactivities, growth and development in the fourth instar larvae of Chironomusriparius (Diptera, Chironomidae). Ecotoxicol. Environ. Saf. 68, 84–90.

Li, Z.H., Zlabek, V., Velisek, J., Grabic, R., Machova, J., Kolarova, J., Li, P., Randak, T., 2011.Multiple biomarkers responses in juvenile rainbow trout, Oncorhynchus mykiss,after acute exposure to a fungicide propiconazole. Environ. Toxicol., http://dx.doi.org/10.1002/tox.20701.

Lin, C.T., Tseng, W.C., Hsiao, N.W., Chang, H.H., Ken, C.F., 2009. Characterization, molec-ular modelling and developmental expression of zebrafish manganese superoxidedismutase. Fish Shellfish Immunol. 27 (2), 318–324.

Liu, J., Qian, S.Y., Guo, Q., Jiang, J., Waalkes, M.P., Mason, R.P., Kadiiska, K.B., 2008. Cad-mium generates reactive oxygen- and carbon-centered radical species in rats: in-sights from in vivo spin-trapping studies. Free Radic. Biol. Med. 45, 475–481.

Lushchak, V.I., 2011. Environmentally induced oxidative stress in aquatic animals.Aquat. Toxicol. 101, 13–30.

Mackay, W.J., Bewley, G.C., 1989. The genetics of catalase in Drosophila melanogaster:isolation and characterization of acatalasemic mutants. Genetics 122 (3), 643–652.

Nair, P.M.G., Choi, J., 2011. Identification characterization and expression profiles ofChironomus riparius glutathione S-transferase (GST) genes in response to cadmiumand silver nanoparticles exposure. Aquat. Toxicol. 101, 550–560.

Nair, P.M.G., Choi, J., 2012. Characterization and transcriptional regulation ofthioredoxin reductase 1 on exposure to oxidative stress inducing environmentalpollutants in Chironomus riparius. Comp. Biochem. Physiol. B 161, 134–139.

Nair, P.M.G., Park, S.Y., Choi, J., 2011a. Analyses of expressed sequence tags fromChironomus riparius using pyrosequencing: molecular ecotoxicology perspective.Environ. Health Toxicol. 26, e2011010.

Nair, P.M.G., Park, S.Y., Choi, J., 2011b. Expression of catalase and glutathione S-transferase genes in Chironomus riparius on exposure to cadmium and nonylphenol.Comp. Biochem. Physiol. C 154, 399–408.

Nair, P.M.G., Park, S.Y., Choi, J., 2012. Characterization and expression analysis of phospholip-id hydroperoxide glutathione peroxidase cDNA from Chironomus riparius on exposureto cadmium. Comp. Biochem. Physiol. B, http://dx.doi.org/10.1016/j.cbpb.2012.04.004.

Osmulski, P.A., Leyko, W., 1986. Structure, function and physiological role ofChironomus haemoglobin. Comp. Biochem. Physiol. A 85, 701–722.

Parvez, S., Raisuddin, S., 2006. Effects of paraquat on the freshwater fish Channa punctata(Bloch): non-enzymatic antioxidants as biomarkers of exposure. Arch. Environ. Contam.Toxicol. 50, 392–397.

Rajarapu, S.P., Mamidala, P., Herms, D.A., Bonello, P., Mittapalli, O., 2011. Antioxidantgenes of the emerald ash borer (Agrilus planipennis): gene characterization and ex-pression profiles. J. Insect Physiol. 57 (6), 819–824.

Rhee, J.S., Won, E.J., Kim, R.O., Lee, J., Shin, K.H., Lee, J.S., 2011. Expression of superoxidedismutase (SOD) genes from the copper-exposed polychaete, Neanthes succinea.Mar. Pollut. Bull. 63 (5–12), 277–286.

Safe, S.H., 1995. Modulation of gene expression and endocrine response pathways by2,3,7,8-tetrachlorobenso-p-dioxin and related compounds. Pharmacol. Ther. 67,247–281.

Saulsbury, M.D., Heyliger, S.O., Wang, K., Johnson, D.J., 2009. Chlorpyrifos induces oxi-dative stress in oligodendrocyte progenitor cells. Toxicology 259 (1–2), 1–9.

Seto, N.O., Hayashi, S., Tener, G.M., 1989. Cloning, sequence analysis and chromosomallocalization of the Cu–Zn superoxide dismutase gene of Drosophila melanogaster.Gene 75 (1), 85–92.

Singh, S., Eapen, S., D'Souza, S.F., 2006. Cadmium accumulation and its influence onlipid peroxidation and antioxidative system in an aquatic plant, Bacopa monnieriL. Chemosphere 62 (2), 233–246.

Stephensen, E., Sturve, J., Förlin, L., 2002. Effects of redox cycling compounds on gluta-thione content and activity of glutathione-related enzymes in rainbow trout liver.Comp. Biochem. Physiol. C Toxicol. Pharmacol. 133 (3), 435–442.

Suntres, Z.E., 2002. Role of antioxidants in paraquat toxicity. Toxicology 180, 65–77.Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genet-

ics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.

http://www.extoxnet.orst.edu/cgiwebglimpse/mfs/services/data/info/extoxnet?link=http://acShttp://www.extoxnet.orst.edu/cgiwebglimpse/mfs/services/data/info/extoxnet?link=http://acShttp://dx.doi.org/10.1002/tox.20701http://dx.doi.org/10.1016/j.cbpb.2012.04.004

194 S-Y. Park et al. / Comparative Biochemistry and Physiology, Part C 156 (2012) 187–194

Tang, J., Cao, Y., Rose, R.L., Brimfield, A.A., Dai, D., Goldstein, J.A., Hodgson, E., 2001. Me-tabolism of chlorpyrifos by human cytochrome P450 isoforms and human, mouse,and rat liver microsomes. Drug Metab. Dispos. 29 (9), 1201–1204.

Tavares-Sánchez, O.L., Gómez-Anduro, G.A., Felipe-Ortega, X., Islas-Osuna, M.A., Sotelo-Mundo, R.R., Barillas-Mury, C., Yepiz-Plascencia, G., 2004. Comp. Biochem. Physiol.B Biochem. Mol. Biol. 138 (4), 331–337.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1994. TheCLUSTALX windows interface: flexible strategies for multiple sequence alignmentaided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Waisberg, M., Joseph, P., Hale, B., Beyersmann, D., 2003. Molecular and cellular mech-anisms of cadmium carcinogenesis: a review. Toxicology 192, 95–117.

Xiong, W., Bai, L., Muhammad, R.U., Zou, M., Sun, Y., 2012. Molecular cloning, charac-terization of copper/zinc superoxide dismutase and expression analysis of stress-responsive genes from Eisenia fetida against dietary zinc oxide. Comp. Biochem.Physiol. C Toxicol. Pharmacol. 155 (2), 416–422.

Yalin, S., Comelekoglu, U., Bagis, S., Sahin, N.O., Ogenler, O., Hatungil, R., 2006. Acute ef-fect of single-dose cadmium treatment on lipid peroxidation and antioxidant en-zymes in ovariectomized rats. Ecotoxicol. Environ. Saf. 65, 140–144.

Characterization and expression of superoxide dismutase genes in Chironomus riparius (Diptera, Chironomidae) larvae as a potential biomarker of ecotoxicity1. Introduction2. Materials and methods2.1. Insects2.2. Chemical preparation and exposure2.3. Identification and phylogenetic analysis of the SOD genes2.4. Expression analysis of the SOD genes2.5. Data analysis

3. Results and discussion3.1. Identification of C. riparius SOD genes (CrSODs)3.2. CrSOD mRNA expression

AcknowledgmentsReferences