Top Banner
Company LOGO Magnetic silica sph eres with large nan opores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials University of Queensland, Australia
23

Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

Dec 18, 2015

Download

Documents

Lionel Johnston
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

Company LOGO

Magnetic silica spheres with large nanopores for nucleic acid adsorptio

nand cellular uptake

Jian Liu, Bo Wang, Sandy Budi Hartono BiomaterialsUniversity of Queensland, Australia

Page 2: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

contents

Introduction Experimental Section Results and Discussion Conclusions

Page 3: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

IntroductionMesoporous materials Large specific surface area Large pore volume Uniform pore size distribution

Mesoporous silica nanoparticles (MSNs)

Biocompatibility Low toxicity

Catalysis

Imaging

Drug delivery

Biological application

Page 4: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Introduction

Other properties that MSNs required for biological application

Large pore sizes Appropriate magnetic properties Appropriate functional surface

Page 5: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Introduction1 、 Large pore size Large internal surface Large mesoporous volume

Cytochrom C 2.6×3.2×3.3 nm

a-L-arabinofuranosidase 3.9×9.7×14.4 nm

Suitable pore sizes for immobilisation of these proteins can vary from10 to 50 nm

Page 6: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Introduction

2 、 Magnetic properties Bioseparation Cell sorting Diagnostic analysis Simultaneous imaging and drug delivery

Page 7: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

IntroductionPreparation methods : Large pore size mesoporous materials Templates : Pluronic P123 Swelling agent : 1,3,5-trimethyl benzene (TMB) or alkanes Condition : Strong acidic Magnetic mesoporous materials Templates : Brij56 micelles Condition : Basic

Page 8: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Introduction3 、 Functional surface To delivery nucleic acids, the silica surface with posit

ive charge is needed to electrostatically bind DNA and RNA molecules

Methods : Functionalisation with amine-derivative group such as APTES Conjugations with cationic polymers such as PEI

Page 9: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Introduction

Develop synthesis methods to prepare MSNLP Establish a surface functionalisation method to enabl

e adsorption and delivery of nucleic acids

Page 10: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Experimental SectionSynthesis of monodisperse superparamagnetic Fe3O4 nanocrystals

Fe3+

1-octadecene

Iron stearic acid

1,2-hexadecanediol+

Static conditions at 250℃in a Teflon-lined autoclave for 6~12 h

The concentration of the magnetic nanocrystals is 10 or 30 mg/ mL and suspended in hexane

Page 11: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Experimental Section Synthesis of magnetic silica nanospheres with large nanopores

30-glycidox-ypropyltrimethoxysilane (GOPS)

PLL

Page 12: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Experimental Section

DNA adsorption CpG DNA 1826 (5‘ to 3‘, TCCATGACGTTCCTGACGTT ) Measuring A260 absorbance at 260 nm

Transfection of cells CyTM3-labeled miRNA Rat kidney epithelial cells (NRK-52E)

Page 13: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and DiscussionSynthesis of magnetic silica nanospheres with large nanopores

Page 14: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and Discussion

Fig. 1. SEM (a, c), TEM (b, d-f), and HRTEM (g, h) images of MSNLP synthesised with different amount of hexane: MSNLP-0-350 (a, b), MSNLP-10-350 (c, d), MSNLP-10-700 (e), MSNLP-10-1400 (f-h).

Page 15: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and Discussion

Page 16: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and Discussion

Brij56: polyoxyethylene 10 cetyl ether, C16H33EO10

N0I0 route

Page 17: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and DiscussionMagnetic properties of magnetic silica nanospheres with large nanopores

Page 18: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and Discussion

Fig. (A) Field-dependent magnetisation at 300 K of MSNLP with different amounts of magnetite: a) MSNLP-10-350, b) MSNLP-10-700, c) MSNLP-10-1400, and d) MSNLP-30-1400; and (B) the separation process of MSNLP-30-1400 nanospheres from solution by magnet (right picture) and their re-dispersion by as slight shake (left picture).

Page 19: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and DiscussionComposition of PLL functionalised MSNLP

Page 20: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and DiscussionAdsorption of DNA on PLL functionalisedmagnetic silica nanospheres with largenanopores

MSNLP-0-350-PLL qm=22.5μg/mg

MSNLP-10-350-PLL qm =15μg/mg

MSNLP-10-1400-PLL qm=10μg/mg

Page 21: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Results and Discussion

Fig. Left panel a-d, cells transfected with fluorescent oligonucleotide only; middle panel e-h, cells transfected with nanoparticles alone; andright panel i-l, cells transfected with nanoparticles loaded with fluorescent oligonucleotide. From top to bottom: cy5 channel - images of fluorescence of CyTM3 labeled miRNA (red),F-actin - images of F-actin stained by FITC-Phalloidin (green), DAPI - images of nuclei stained with DAPI (blue), and merge - the merged picture.

Page 22: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Conclusions

Magnetic silica nanospheres with large nanopores(13-20 nm) were synthesised for the first time

The saturation magnetisation values can be conveniently controlled by changing the amount of Fe3O4 magnetic nanocrystals encapsulated

After functionalisation with PLL, high adsorption capacity ranging from 10 to22.5 μg/mg for CpG DNA and efficient cellular delivery capability for miRNA were achieved

The materials synthesised in this study could find broad applications

Page 23: Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials.

www.themegallery.com,

Thank You