Co-delivery of cell-wall-forming enzymes in the same vesicle for ... · Supplementary Figure 3: Null mutants of mcs1 and chs6 exhibit different cell wall phenotypes a, Electron micrographs

Co-delivery of cell-wall-forming enzymes in thesame vesicle for coordinated fungal cell wall

formation

SUPPLEMENTARY INFORMATIONARTICLE NUMBER: 16149 | DOI: 10.1038/NMICROBIOL.2016.149

NATURE MICROBIOLOGY | www.nature.com/naturemicrobiology 1

Colour-adjusted main figures for readers with red-green colour

blindness (Supplementary Figure 1-6)

Supplementary Figure 1: Domain organisation of fungal class V and class VII

CHSs

a, Maximum likelihood tree and domain structure of class V and class VII CHSs from

ascomycete and basidiomycete fungi, as well as the ancient cryptomycete fungus R.

allomyces. Class V CHSs from asco- and basidomycetes carry an N-terminal motor

domain that shows high sequence conservation (indicated by high probability of

being identified as a myosin motor domain in PFAM) and the presence of an ATP-

binding P-loop1, a supporting A-loop2 and a residue implicated in actin-binding3. In

contrast, the myosin motor domain in class VII CHSs is absent or truncated and has

lost ATP-binding motifs (see also Supplementary Fig. 7). The tree is based on the

CHS domains and was calculated in MEGA5.2 (ref. 4). Bootstrap values from 1000

replications are given at nodes.

b, Domain structure of Mcs1, Chs6 and the fusion protein MMD-Chs6.

c, Localisation of GFP-Chs6 in the absence of endogenous Chs6 (∆chs6), Chs6 and

Mcs1 (∆chs6∆mcs1) and localisation of the chimaeric fusion protein GFP-MMD-Chs6

in the ∆chs6∆mcs1 double mutant. Bar: 2 µm.

d, Fluorescent Intensity profiles of GFP-Chs6 in ∆chs6 (red curve) and ∆chs6∆mcs1

mutants (yellow curve), and the chimaeric fusion protein GFP-MMD-Chs6 (blue

curve). A fusion protein of the Mcs1 MMD and Chs6 partially rescues the polar

localisation. Each data point given as mean ± standard error, n= 15 measurements.

e, Kymographs showing motility of GFP-Chs6 in a ∆chs6∆mcs1 double mutant. Bars:

2 s (vertical) and 2 µm (horizontal)

Supplementary Figure 2: Class V CHS and class VII CHS co-migrate and co-

secrete

a, Mcs1-GFP3 (left) and Chs6-GFP3 (right) localisation in plasma membrane

(mCherry-Sso1-labelled, magenta). Bar: 2 µm.

b, Mcs1-GFP3 and Chs6-GFP3 motility parameters. Velocity and pausing time shown

as Whiskers' plots, flux shown as mean± standard error; n= 3 experiments, each

data set >45 measurements; n.s. indicates non-significant difference at Pvelocity=

0.257, Ppausing= 0.435, PFlux= 0.169. See Supplementary Video 1, 2.

c, Co-motility kymographs of mCherry3-Mcs1 and Chs6-GFP3. Bars: 3 s (vertical), 2

µm (horizontal). See Supplementary Fig. 8b, 8c, Supplementary Video 3.

d, Degree of co-motility of Mcs1 and Chs6. n= 36 cells; ***= P<0.0001.

e, Co-localisation of mCherry3-Mcs1 (magenta) and Chs6-GFP3 (green) after

secretion at growth region (co-localisation in yellow). Images are deconvoluted,

brightness, contrast and gamma processed. Bar: 2 µm.

f, Intensity profiles of mCherry3-Mcs1 (magenta) and Chs6-GFP3 (blue) at growth

region, taken from Supplementary Fig. 9a. Co-localisation indicated by arrowheads.

g, Chs6-GFP3 secretion. Chs6 concentrates in apical plasma membrane (mCherry-

Sso1, magenta; Pre). After photo-bleaching (0 min; mCherry-Sso1 from Pre image),

newly-secreted signals reappear (5 min, arrowheads). Bar: 2 µm.

h, Mcs1-GFP3 and Chs6-GFP3 secretion rates at apical tip and in mother cell; n.s.

indicates non-significant difference at PTip= 0.204 and PMother= 0.645; n= 20 cells

(Mcs1) and 21 cells (Chs6 at tip, Mcs1 and Chs6 in mother).

i, Co-secretion of mCherry3-Mcs1 (magenta) and Chs6-GFP3 (green) at 5 min post-

bleaching. Dotted box in indicates bleached region, arrowhead secreted signals;

right panel provides larger magnification. Bar: 0.5 µm.

j, Chs6-GFP3 fluorescence at cell tip in conditional mcs1 mutants. In presence of

mcs1, Chs6-GFP3 locates at growth region (Mcs1↑), whereas fluorescence is

reduced when mcs1 is repressed (Mcs1↓); n= 3 experiments, 56 cells for Mcs1↑ and

79 cells for Mcs1↓; ***= P<0.0001.

k, Chs6-GFP3 secretion rate in conditional mcs1 mutants. Repression of mcs1

(Mcs1↓) reduces Chs6-GFP3 secretion. n=3 experiments, 32 cells for Mcs1↑ and 30

cells for Mcs1↓; ***= P<0.0001.

Non-normal distributed data sets were analysed using Mann-Whitney tests and are

shown as Whiskers' plots (2b, 2h, 2k), with 25/75 percentile indicated by blue and

median by red line; whisker ends represent minimum/maximum values. Gaussian-

distributed data sets (2b, 2d, 2j) were analysed by unpaired Student's t-test with

Welch's correction and are shown as bars of mean ± standard error.

Supplementary Figure 3: Null mutants of mcs1 and chs6 exhibit different cell wall

phenotypes

a, Electron micrographs of control and ∆chs6 cell walls (dotted red). Bar: 0.1µm.

b, Cell wall thickness, measured in electron micrographs. n= 53 cells, 2 experiments;

***=P <0.0001.

c, Protoplast formation in control and mutants at 10 minutes of exposure to cell wall-

degrading enzymes. Bar: 10 µm.

d, Protoplast formation in control and mutants at 10 minutes of exposure to cell wall-

degrading enzymes. ∆chs6 forms less protoplasts (P= 0.0179), while ∆chs6∆mcs1

forms more (P<0.0001) protoplasts than control; n= 5 experiments, 510-593 cells.

e, Chitin staining in control cells and ∆chs6. Insets show growth regions, arrowheads

indicate bud scars. Bar: 2 µm.

f, Chitin staining in control cells and ∆chs6. n= 90 (control) and 71 (∆chs6) cells, 2

experiments; ***= P<0.0001.

g, Domain organisation of U. maydis Gsc1 and S. cerevisiae Fks1p.

h, Co-localisation mCherry3-Mcs1 (magenta) and GFP3-Gsc1 (green) at growth

region (co-localisation in yellow). Bar: 2µm.

i, Intensity profile of mCherry3-Mcs1 (magenta) and GFP3-Gsc1 (blue) at growth

region. Filled arrowheads= co-localisation, open arrowheads Gsc1 alone. See also

see Supplementary Fig. 12.

j, Kymographs of mCherry3-Mcs1 and GFP3-Gsc1 co-motility. Bars: 2s (vertical) and

1µm (horizontal). See Supplementary Video 4.

k, Degree of co-motility of Mcs1 and Gsc1. n= 593 (control), 542 (∆chs6), 561

(∆chs6∆mcs1) from 5 experiments; ***= P<0.0001.

l, Secreted GFP3-Gsc1 at growth region in conditional ∆mcs1. n= 81 (Mcs1↑) and 90

(Mcs1↓) cells, 3 experiments; ***= P<0.0001.

m, GFP3-Gsc1 at growth region in conditional ∆mcs1. Repression of mcs1 results in

accumulation of internal signals (Mcs1↓, arrowheads). Bar: 2 µm.

n, GFP3-Gsc1 secretion rate in conditional mcs1 mutants. Repression of mcs1

(Mcs1↓) reduces GFP3-Gsc1 secretion. n=30 cells for Mcs1↑ and Mcs1↓, 3

experiments; **: P= 0.002.

Non-normal distributed data sets were analysed using Mann-Whitney tests and are

shown as Whiskers' plots (3b, 3f, 3l), with 25/75 percentile indicated by blue and

median by red line; whisker ends represent minimum/maximum values. Gaussian-

distributed data sets (3k, 3n) were analysed by unpaired Student's t-test with Welch's

correction and are shown as bars of mean ± standard error.

Supplementary Figure 4: Mcs1, Chs6 and Gsc1 locate in the same vesicle

a, Merged fluorescent images of secretory vesicle preparations, showing co-

localisation of mCherry3-Mcs1 (magenta) and Chs6-GFP3 (green, left panel), as well

as mCherry3-Mcs1 and GFP3 -Gsc1(right panel). Note that both channels were

shifted slightly to better visualise co-localisation. Bar: 2 µm.

b, Electron micrographs showing immuno-gold-based co-localisation of mCherry3-

Mcs1 and Chs6-GFP3 (upper row; Chs6-GFP3 indicated by large gold particles,

mCherry3-Mcs1 by smaller gold particles), as well as mCherry3-Mcs1 and GFP3 -

Gsc1 in vesicle preparation that were chemically fixed (lower row; GFP3 -Gsc1

indicated by large gold particles, mCherry3-Mcs1 by smaller gold particles). Bars: 50

nm.

c, Diameter of mCherry3-Mcs1 and Chs6-GFP3-, and mCherry3-Mcs1 and GFP3 -

Gsc1-carrying vesicles. Mean± standard error shown, n= 16 (Chs6+Mcs1) and 21

(Gsc1+Mcs1), 2 experiments; n.s. indicates non-significant difference at P= 0.057

from Student's t-test with Welch's correction.

d, False coloured image of the fluorescent nucleoporin GFP-Nup107. Individual

nuclear pores (arrowheads) contain a known number of GFP-Nup107 molecules and

their uniform fluorescent intensity was used as internal calibration standard to

determine the number of Mcs1-GFP3, Chs6-GFP3 and GFP3 -Gsc1 molecules per

moving vesicles (see Fig. 4e). Bar: 1 µm.

e, Estimated numbers of Mcs1-GFP3, Chs6-GFP3 and GFP3-Gsc1 molecules per

moving vesicle. Gsc1 is often present in numerous copies. Median indicated by red

dotted line; n= 100 signals (Mcs1, Chs6, Gsc1), 3 experiments.

Supplementary Figure 5: Mcs1, Chs6 and Gsc1 remain co-located in stationary

wall-forming foci

a, Kymographs of secreted mCherry3-Mcs1/Chs6-GFP3 and mCherry3-Mcs1/GFP3-

Gsc1 at photo-bleached growth regions. Bar: 2 µm.

b, Co-localisation of newly-secreted mCherry3-Mcs1 and Chs6-GFP3 (Mcs1+Chs6)

and mCherry3-Mcs1 and GFP3-Gsc1 (Mcs1+Gsc1) 5, 7 and 10 minutes after photo-

bleaching. n= 3 experiments, 56-58 cells.

c, Motility behaviour of secreted Mcs1-GFP3. Signals are stationary in control cells,

in cells expressing Mcs1∆MM, deleted in myosin motor domain of Mcs1 (∆MM; ref. 5),

and after disruption of the cytoskeketon (LatA+Ben). Diffusion increases when cell

wall is digested (No cell wall) or when enzyme activity was inhibited by CHS inhibitor

nikkomycin Z (NikkoZ) or β-GS inhibitor caspofungin (CSG). Simultaneous treatment

had a stronger effect, suggesting that enzymes are anchored by nascent

polysaccharides in plasma membrane. n= 664 (control), 277 (∆MM), 419

(LatA+Ben), 288 (No cell wall), 293 (NikkoZ+CSG), 372 (NikkoZ), 387 (CSG), 2

experiments; ***= P<0.0001, n.s. indicates non-significant differences (Control, ∆MM,

LatA+Ben: P= 0.422; No cell wall, NikkoZ+CSG: P= 0.646; NikkoZ, CSG: P=0.965).

See Supplementary Video 5.

d, Localisation of Mcs1-GFP3 in cell wall-less protoplasts. Bar: 2 µm.

e, Motility behaviour of secreted Mcs1-GFP3 in control cells and protoplasts (No cell

wall). Diffusion increases when the cell wall is removed. Bars: 5 s (vertical) and 1 µm

(horizontal).

f, Motility behaviour of secreted Mcs1-GFP3 when enzyme activity was inhibited by

simultaneous treatment with the CHS inhibitor nikkomycin Z (NikkoZ) and the β-GS

inhibitor caspofungin (CSG). Bars: 5 s (vertical) and 1 µm (horizontal).

g, Motility behaviour of secreted GFP3-Gsc1 in presence of the specific CHS inhibitor

nikkomycin Z (NikkoZ) or β-GS inhibitor caspofungin (CSG). Inhibiting enzyme

activity increases diffusive motility of GS in plasma membrane. n= 330 (control), 290

(NikkoZ+CSG), 342 (NikkoZ), 361 (CSG), 2 experiments; ***= P<0.0001, n.s.

indicates non-significant differences (NikkoZ+CSG and NikkoZ: P= 0.459;

NikkoZ+CSG, NikkoZ, CSG: P= 0.060).

Non-normal distributed data sets were analysed using Mann-Whitney tests (pairwise

comparison in 5c, 5f) and Kruskal-Wallis tests (multiple comparison in Fig. 5c, 5f),

and are shown as Whiskers' plots (5c, 5f), with 25/75 percentile indicated by blue

and median by red line; whisker ends represent minimum/maximum values.

Gaussian-distributed data sets (5b) are shown as bars of mean ± standard error.

Supplementary Figure 6: Cell wall synthases co-travel in the same vesicle in

hyphae

a, Localization of GFP3-Gsc1, Mcs1-GFP3 and Chs6-GFP3 in hyphal cells. Bar: 5

µm.

b, Kymographs showing anterograde co-motility of mCherry3-Mcs1 and GFP3-Gsc1.

Bars: 2 s (vertical) and 2 µm (horizontal).

c, Degree of co-motility of mCherry3-Mcs1/Chs6-GFP3 and mCherry3-Mcs1 and

GFP3-Gsc1. n=50 for each column, 2 experiments. Mean ± standard error is shown.

d, Electron micrographs showing immuno-gold-based co-localisation mCherry3-

Mcs1/Chs6-GFP3 and mCherry3-Mcs1/GFP3-Gsc1 using antibodies against mCherry

and GFP. Note that vesicles were not chemically fixed. Red arrowhead: double-

labelled vesicle; yellow arrowhead: only Chs6-GFP3; blue arrowhead: only mCherry-

Mcs1. Bars: 30 nm (left panel) and 100 nm (right panel).

e, Model of secretion of cell wall-forming enzymes. Kinesin-1 and myosin-5 deliver

Mcs1-containing vesicles to the growth region6. These carriers contain other cell

wall-forming enzymes, including Chs6 and Gsc1. Near the plasma membrane, Mcs1

tethers the vesicles, so increasing the likelihood of exocytosis. After insertion into the

plasma membrane, the enzymes begin cell wall synthesis. The nascent

polysaccharide anchors the enzymes at their location for several minutes. This

ensures coordinated formation of the complex fungal cell wall.

Supplementary data figures and legends

Supplementary Figure 7: Comparison of a region in the putative myosin motor

domain of class V and class VII CHSs from ascomycete and basidiomycete fungi.

Basidiomycete class V CHSs carry MMDs that exhibit ATP-binding motifs, including

a P- and an A-loop. The A-loop is lost in ascomycete class V CHSs. Class VII CHSs

show only remnant traces of a myosin motor domain.

Supplementary Figure 8: Motility of Mcs1 and Chs6 in yeast-like cells.

a, Contrast-inverted kymographs showing bi-directional motility of Mcs1-GFP3 and

Chs6-GFP3. Note that the majority of the delivered Mcs1-containing vesicles turn

around and only <10% of the arriving Mcs1 signals insert in the plasma membrane17.

Bars: 2 s (vertical) and 1 µm (horizontal).

b, Contrast-inverted kymographs showing co-motility mCherry3-Mcs1 and Chs6-

GFP3. Most signals co-migrate; a few signals were moving on their own (arrowhead).

Bars: 1 s (vertical) and 1 µm (horizontal).

c, Colour-adjusted version of panel b for red-green colour-blind readers.

Supplementary Figure 9: Co-localisation of mCherry3-Mcs1 and Chs6-GFP3 at

growing tips of yeast-like cells. Motility of Mcs1 and Chs6 in yeast-like cells.

a, mCherry3-Mcs1 (red) and Chs6-GFP3 (green) at the growth region of a yeast-like

cell. Note that this image corresponds to the intensity profile shown in Fig. 2f. Bar: 3

µm.

b, mCherry3-Mcs1 (red) and Chs6-GFP3 (green) at the growth region of a yeast-like

cell. Yellow arrowhead corresponds to arrowhead in panel c. Bar: 3 µm.

c, Intensity profiles of mCherry3-Mcs1 (red) and Chs6-GFP3 (blue) at growth region.

Graph corresponds to panel b.

d, Colour-adjusted version of panel a for red-green colour-blind readers.

e, Colour-adjusted version of panel b for red-green colour-blind readers.

Supplementary Figure 10: Intensity profile of Chs6-GFP3 (blue) and mCherry-Sso1

(red) at 5 min after photo-bleaching. The extracellular space (outside) and the

cytoplasm (inside) is indicated. The peaks of both intensity curves almost overlap

(dotted lines), consistent with the conclusion that Chs6-GFP3 signals are inserted

into the plasma membrane. Each data point represents the mean ± standard error of

14 measurements.

Supplementary Figure 11: Secretion of Chs6-GFP3 in conditional mcs1 mutants.

a, Chs6-GFP3 is expressed in conditional mutants, where mCherry3-Mcs1 is

expressed under the inducible/repressible crg-promoter. Under inducing conditions,

mCherry3-Mcs1 is produced and co-localises with Chs6-GFP3 at the growth region

(Mcs1↑; co-localisation results in yellow signal). Repression of mcs1 expression

depletes mCherry3-Mcs1 and inhibits secretion of Chs6-GFP3 into the peripheral

plasma membrane (Mcs1↓). Instead, cytoplasmic accumulations appear

(arrowheads). Bar: 2 µm.

b, Colour-adjusted version of panel a for red-green colour-blind readers.

Supplementary Figure 12: Intensity profiles of mCherry3-Mcs1 (red) and GFP3-

Gsc1 (blue) at the growth region in a yeast-like cell. Co-localising peaks are

indicated by filled arrowheads. Near the tip of the cell, Gsc1 shows regions where

Mcs1 is excluded (open arrowheads).

Supplementary Figure 13: Electron micrographs showing immuno-gold-based co-

localisation mCherry3-Mcs1 and Chs6-GFP3 using antibodies against mCherry and

GFP. Note that the antibodies label a subset of the membranes. Bar: 200 nm.

Supplementary Figure 14: Fluorescent recovery after photo-bleaching of GFP-

Sso1 in the plasma membrane at the growth region of yeast-like cells. The darkened

region closes within minutes, demonstrating that integral plasma membrane proteins

are diffusing at the cell tip. Bars: top panel 2 µm and bottom panel 1 µm.

Supplementary Figure 15: Motility of mCherry3-Mcs1 and GFP3-Gsc1 in hyphal

cells.

a, Kymographs showing anterograde co-motility of mCherry3-Mcs1 and GFP3-Gsc1.

Bars: 2 s (vertical) and 2 µm (horizontal). Most signals co-migrate.

b, Colour-adjusted version of panel b for red-green colour-blind readers.

Supplementary Figure 16: Comparison of the predicted amino acid sequence of

the truncated MMD in class VII CHSs from ascomycete fungi. 53% of the amino

acids are identical, suggesting that this domain has a conserved cellular role. The

alignment was done in ClustalOmega.

Supplementary Tables

Supplementary Table 1 Strains and plasmids used in this study

Strain name Genotype Reference

FB1∆Chs6GChs6 a1b1 ∆chs6::hygR / pnGChs6 This study

FB1∆Chs6∆Mcs1GChs6 a1b1 ∆chs6::hygR ∆mcs1::bleR / pnGChs6 This study

FB1∆Chs6∆Mcs1GChs6MMD a1b1 ∆chs6::hygR ∆mcs1::bleR / pnGM-Chs6 This study

AB33Mcs1G3_ChSso1 a2 PnarbW2 PnarbE1, bleR, Pmcs1-mcs1-3xegfp, hygR /pomChSso1

This study

AB33Chs6G3_ChSso1 a2 PnarbW2 PnarbE1, bleR, Pchs6-chs6-3xegfp, hygR /pomChSso1

This study

AB33Chs6G3 a2 PnarbW2 PnarbE1, bleR, Pchs6-chs6-3xegfp, hygR This study

AB33Mcs1G3 a2 PnarbW2 PnarbE1, bleR, Pmcs1-mcs1-3xegfp, hygR Ref. 6

AB33Ch3Mcs1_Chs6G3 a2 PnarbW2 PnarbE1, bleR, Pmcs1-3xmcherry-mcs1, natR, Pchs6-chs6-3xegfp, hygR

This study

FB1Chs6G3_rCh3Mcs1 a2 PnarbW2 PnarbE1, bleR, Pchs6-chs6-3xegfp, hygR, Pcrg-3xmcherry-mcs1, natR,

This study

SG200 a1 mfa2 bW2 bE, bleR Ref. 7

SG200∆Chs6 a1 mfa2 bW2 bE, bleR, ∆chs6::hygR Ref. 8

FB1∆Chs6∆Mcs1 a1 b1 ∆chs6::hygR, ∆mcs1::bleR Ref. 8

AB33Ch3Mcs1_G3Gsc1 a2 PnarbW2 PnarbE1, bleR, Pmcs1-3xmcherry-mcs1, natR,

Pgsc1-3xegfp-gsc1, hygR This study

FB2N107G a2b2 Pnup107-nup107-egfp, bleR Ref. 9

AB33G3Gsc1 a2 PnarbW2 PnarbE1, bleR, Pgsc1-3xegfp-gsc1, hygR, This study

AB33G3Gsc1_rCh3Mcs1 a2 PnarbW2 PnarbE1, bleR, Pgsc1-3xegfp-gsc1, hygR, Pcrg-

3xmcherry-mcs1, natR

This study

SG200∆Mcs1_G3Mcs1 a1 mfa2 bW2 bE, bleR, ∆mcs1::hygR /pnG3Mcs1 Ref. 5

SG200∆Mcs1_G3Mcs1∆MM a1 mfa2 bW2 bE, bleR, ∆mcs1::hygR /pnG3Mcs1∆MM Ref. 5

AB33GSso1 a2 PnarbW2 PnarbE1, bleR/poGSso1 Ref. 10

pnGChs6 Pchs6-egfp-chs6, cbx This study

pnGM-Chs6 Pchs6-egfp-mcs1 1-915-chs6 59-1180, cbxR This study

pomChSso1 Potef-mCh-sso1, natR Ref. 5

pnChs6G3 Pchs6-chs6-3xegfp, hygR This study

pnG3Gsc1 Pgsc1-3xegfp-gsc1, hygR This study

pPcmCh3Mcs1 Pcrg-3xmch-mcs1, natR This study

pnG3Mcs1 Pmcs1-3xegfp-mcs1, cbxR Ref. 5

poGSso1 Potef-egfp-sso1, cbxR Ref. 10

pnG3Mcs1∆MM Pmcs-3xegfp-mcs1 ∆57-753, cbxR Ref. 5

a, b, mating type loci; P, promoter; -, fusion; ::, replacement; ∆, deletion; hygR, hygromycin resistance; bleR, phleomycin

resistance; natR, nourseothricin resistance; cbxR, carboxin resistance; otef: constitutive promoter; crg, conditional promoter; /,

ectopically integrated; E1, W2, genes of the b mating-type locus; egfp, enhanced green fluorescent protein; mcherry, a monomeric

red fluorescent protein; sso1, a syntaxin-like plasma membrane protein; mcs1, myosin-chitin synthase 1; chs6, chitin synthase 6;

gsc1, catalytic subunit of 1,3-beta-glucan synthase; MMD or MM, Mcs1 myosin motor domain.

Supplementary Table 2. Experimental usage of U. maydis strains

Strain name Type of experiment Figure or Video

FB1∆Chs6GChs6 Localisation studies Fig. 1 c, d; Supp. Fig. 1 c, d

FB1∆Chs6∆Mcs1GChs6 Localisation studies Fig. 1 c, d, e; Supp. Fig. 1 c, d, e

FB1∆Chs6∆Mcs1GChs6MMD Localisation studies Fig. 1 c, d; Supp. Fig. 1 c, d

AB33Mcs1G3_ChSso1 Pictures for localization in the plasma

membrane and bud and mother secretion rates Fig. 2 a, h; Supp. Fig. 2 a, h

AB33Chs6G3_ChSso1 Pictures for localization in the plasma

membrane and bud and mother secretion rates

Fig. 2 a, g, h; Supp. Fig. 2 a, g, h;

Supp. Fig. 10

AB33Chs6G3 Motility measurements, number in vesicles,

localisation in hyphae

Fig. 2 b; Fig. 4 e; Fig. 6 a; Supp.

Fig. 2 b; Supp. Fig. 4 e; Supp. Fig. 6

a; Supp. Fig. 8 a; Supp. Video 1, 2

AB33Mcs1G3 Motility measurements, number in vesicles,

localisation in hyphae

Fig. 2 b; Fig. 4 e; Fig. 6 a; Supp.

Fig. 2 b; Supp. Fig. 4 e; Supp. Fig. 6

a; Supp. Fig. 8 a; Supp. Video 2

AB33Ch3Mcs1_Chs6G3 Co-localization of Mcs1 and Chs6 Fig. 2 c-f, i; Fig. 4 a-c; Fig. 5 a, b;

Fig. 6 c, d; Supp. Fig. 2 c-f, i; Supp.

Fig. 4 a-c; Supp. Fig. 5 a, b; Supp.

Fig. 6 c, d; Supp. Fig. 8 b, c; Supp.

Fig. 9; Supp. Fig. 13; Supp. Video 3

FB1Chs6G3_rCh3Mcs1 Secretion of Chs6 in the absence of Mcs1 Fig. 2 j, k; Supp. Fig. 2 j, k; Supp.

Fig. 11 a, b

SG200 Cell wall thickness measurements by TEM,

protoplast formation, wheat germ agglutinin

staining

Fig. 3 a-f; Supp. Fig. 3 a-f

SG200∆Chs6 Cell wall thickness measurements by TEM,

protoplast formation, wheat germ agglutinin

staining

Fig. 3 a-f; Supp. Fig. 3 a-f

FB1∆Chs6∆Mcs1 Protoplast formation Fig. 3 c, d; Supp. Fig. 3 c, d

AB33Ch3Mcs1_G3Gsc1 Co-localization of Mcs1 and Gsc1 Fig. 3 h-k; Fig. 4 a-c; Fig. 5 a, b;

Fig. 6 b-d,; Supp. Fig. 3 h-k; Supp.

Fig. 4 a-c; Supp. Fig. 5 a, b; Supp.

Fig. 6 b-d; Supp. Fig. 12, Supp. Fig.

15; Supp. Video 4, 6

FB2N107G Number in vesicles Fig. 4 d; Supp. Fig. 4 d

AB33G3Gsc1 Number in vesicles, localisation in hyphae Fig. 4 e; Fig. 5 f; Fig. 6 a; Supp. Fig.

4 e; Supp. Fig. 5 f; Supp. Fig. 6 a

AB33G3Gsc1_rCh3Mcs1 Secretion of Gsc1 in absence of Mcs1 Fig. 3 l-n; Supp. Fig. 3 l-n

SG200∆Mcs1G3Mcs1 Investigation of mechanism of

immobilisation at the plasma membrane

Fig 5 c-e, g; Supp. Fig. 5 c-e, g;

Supp. Video 5

SG200∆Mcs1G3Mcs1∆MM Investigation of mechanism of

immobilisation at the plasma membrane Fig. 5 c; Supp. Fig. 5 c

AB33GSso1 Diffusion of plasma membrane protein Sso1

at cell tip Supp. Fig. 14

Supplementary Table 3. Primers used in this study

Primer name Sequence (3’ to 5’)

YH166 ATGGTGAGCAAGGGCGAGGAG

YH269 GACGTTGTAAAACGACGGCCAG

YH270 GATTGACGGCTGAGTCGAAAGC

YH273 CTTGTACAGCTCGTCCATGCCG

YH421 AACTGTTGGGAAGGGCGATCGGTGCGGGCCTTCATGTGCTACGAGACACGG

YH422 GCTTGGCACTGGCCGTCGTTTTACAACGTCAAGCCAAGCATACGTGAGTCTG

YH423 ATACGAACGCTTTCGACTCAGCCGTCAATCTGTTTGGCTTTTGGCTTTCGCC

YH424 GGTGAACAGCTCCTCGCCCTTGCTCACCATCCCGTGCAAAGAGTTTGTGTG

YH425 ATCACTCTCGGCATGGACGAGCTGTACAAGATGTCGTCCCATCACGGCGC

YH426 ATGTTGTGTGGAATTGTGAGCGGATAACAAACGACCTCGAAGACCTGGTCG

YH461 GTTATGTTAGTATTAAGAACGTTATTTATAGGATCCCGCGATACGCACCTTG

YH462 TGGCCATGTTATCCTCCTCGCCCTTGCTCACCATGTGTCTACGTATTGTTGTATCTTTTTTGGCC

MU209 CGAGGTGGTGGGCACTTCTTCGACGGCGTCACCGAGTGGCTCTTCGGTG

MU210 GACGCCGTCGAAGAAGTGCC

MU211 CACACAGGAAACAGCTATGACCATGATTACCGCGCAGTGGTGAGTGGTTC

MU213 CCATCAACGTGCTCGATGCGGCCGCGGCGCACGGCGTCGATAAGGCGAAC

MU214 GGTGAACAGCTCCTCGCCCTTGCTCACCATTGTAGGAAAGAAGGAG

MU215 CTTGTACAGCTCGTCCATG

MU216 ATCACTCTCGGCATGGACGAGCTGTACAAGATGTCGACCAAAGACGCCC

MU217 GGCTTGTGCGCCACCGGACAG

MU218 GACGATACACTGTCCGGTGGCGCACAAGCCTGACGGAAAAGCTCTCTTTTG

SK50 GATCTGTGCAATTGCCTTACCAG

SK179 ATGGTGAGCAAGGGCGAGGA

SK434 GGTGAACAGCTCCTCGCCCTTGCTCACCATTGTAGGAAAGAAGGAGGGGAGAG

Supplementary Video Legends

Supplementary Video 1. Motility of Chs6-GFP3 in U. maydis. Video shows Chs6-

GFP3 motility in U. maydis cells. The growth region was photo-bleached (yellow box)

to reduce interference with vacuoles and stationary signals. Note that peripheral

signals in the mother cell are stationary. Time is given in seconds:milliseconds; scale

bar, 5 µm.

Supplementary Video 2. Motility of Mcs1-GFP3 and Chs6-GFP3 in a yeast-like

cell of U. maydis. Contrast-inverted video shows Mcs1-GFP3 and Chs6-GFP3

motility in photo-bleached buds of U. maydis cells. Note that most signals undergo

bi-directional motility, and only a small subset gets inserted into the plasma

membrane17. Time is given in seconds:milliseconds; scale bar, 2 µm.

Supplementary Video 3. Co-motility of mCherry3-Mcs1 and Chs6-GFP3 in a

yeast-like cell of U. maydis.

Co-moving signals in a photo-bleached bud of an U. maydis cell. Time is given in

seconds:milliseconds; scale bar, 2 µm.

Supplementary Video 4. Co-motility of mCherry3-Mcs1 and GFP3-Gsc1 in a

yeast-like cell of U. maydis.

Co-moving signals in a photo-bleached bud of an U. maydis cells. Time is given in

seconds:milliseconds; scale bar, 2 µm.

Supplementary Video 5. Diffusive motion of Mcs1-GFP3 in control cells, cell

wall-less protoplasts and in the presence of the CHS inhibitor nikkomycin Z

and the GS inhibitor caspofungin.

Newly-secreted signals remain stationary at the growth region (Control). When the

cell wall is digested by lytic enzymes, most Mcs1-GFP3 signals undergo diffusive

motion (No cell wall). Blocking the activity of cell wall forming enzymes results in a

similar phenotype (NikkoZ + CSG). This suggests secreted Mcs1 is anchored in the

plasma membrane via newly formed cell wall polymers. Note that the cytoskeleton

has no obvious role in anchoring cell wall-forming enzymes (see main text, Fig. 6d).

Time is given in seconds:milliseconds; scale bar, 2 µm.

Supplementary Video 6. Co-motility of mCherry3-Mcs1 and GFP3-Gsc1 in a

hyphal cell of U. maydis.

Co-moving signals in a photo-bleached region of an U. maydis hypha. Time is given

in seconds:milliseconds; scale bar, 1 µm.

Supplementary Information References

1 Walker, J. E., Saraste, M., Runswick, M. J. & Gay, N. J. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1, 945-951 (1982).

2 Ambudkar, S. V., Kim, I. W., Xia, D. & Sauna, Z. E. The A-loop, a novel conserved aromatic acid subdomain upstream of the Walker A motif in ABC transporters, is critical for ATP binding. FEBS Lett 580, 1049-1055 (2006).

3 Sasaki, N., Asukagawa, H., Yasuda, R., Hiratsuka, T. & Sutoh, K. Deletion of the myopathy loop of Dictyostelium myosin II and its impact on motor functions. J Biol Chem 274, 37840-37844 (1999).

4 Tamura, K. et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28, 2731-2739 (2011).

5 Treitschke, S., Doehlemann, G., Schuster, M. & Steinberg, G. The myosin motor domain of fungal chitin synthase V is dispensable for vesicle motility but required for virulence of the maize pathogen Ustilago maydis. Plant Cell 22, 2476-2494 (2010).

6 Schuster, M. et al. Myosin-5, kinesin-1 and myosin-17 cooperate in secretion of fungal chitin synthase. EMBO J 31, 214-227 (2012).

7 Bölker, M., Genin, S., Lehmler, C. & Kahmann, R. Genetic regulation of mating and dimorphism in Ustilago maydis. Can J Bot 73, 320-325 (1995).

8 Weber, I., Assmann, D., Thines, E. & Steinberg, G. Polar localizing class V myosin chitin synthases are essential during early plant infection in the plant pathogenic fungus Ustilago maydis. Plant Cell 18, 225-242 (2006).

9 Steinberg, G. et al. Motor-driven motility of fungal nuclear pores organizes chromosomes and fosters nucleocytoplasmic transport. J Cell Biol 198, 343-355 (2012).

10 Steinberg, G. & Schuster, M. The dynamic fungal cell. Fungal Biol Rev 25, 14-37 (2011).