Characterization of cancer stem-like cells in chordoma

J Neurosurg / January 27, 2012

DOI: 10.3171/2011.12.JNS11430

1

A chordomA was first described by Virchow in 1856 as a small tumor of the clivus. Microscopi-cally, these tumor cells were observed to contain

bubble-like vacuoles, called physaliphorous structures.18 Chordomas are rare primary tumors of the bone and orig-inate from the remnants of notochord after embryogen-esis.9 They are traditionally considered to be slow-grow-ing, locally invasive neoplasms with a low tendency to

metastasize and a high potential for recurrence.8,29,53 Cy-togenetic studies also indicate that abnormal karyotypes may play a role in the recurrence and poor survival rates.3 Chordomas occur in patients of any age but appear more often in those between 40 and 60 years old. In rare cases, they have appeared in patients younger than 20 years of age.34 In adults, 50% occur in the sacrococcygeal region, 15% in the vertebral column, and 35% in cranial regions.1 The incidence of chordoma ranges from 1% to 4% of all bone tumors, and 0.08 cases per 100,000 population are diagnosed annually, with a predominance in men (1.0) over women (0.6). Almefty and colleagues2 found that in a series of 67 patients treated between 1990 and 2006, 16% of chordomas occurred in those ranging in age from

Characterization of cancer stem-like cells in chordoma

Laboratory investigation*Esra aydEmir, m.sc.,1 OmEr Faruk Bayrak, Ph.d.,1,3 FikrEttin sahin, Ph.d.,1 Basar atalay, m.d.,2 GamzE tOrun kOsE, Ph.d.,1 mustaFa OzEn, m.d.,3,5 sErhat sEvli, m.sc.,3 altay Burak dalan, Ph.d.,4 mEhmEt Emir yalvac, Ph.d.,1 turGut dOGruluk, B.s.,5 and UğUr Türe, M.D.2

1Department of Genetics and Bioengineering, Faculty of Engineering and Architecture, Yeditepe University; Departments of 2Neurosurgery and 3Medical Genetics, Yeditepe University School of Medicine; 4Department of Molecular Medicine, The Institute of Experimental Medicine, Istanbul University, Capa, Istanbul, Turkey; and 5Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas

Object. Chordomas are locally aggressive bone tumors known to arise from the remnants of the notochord. Because chordomas are rare, molecular studies aimed at developing new therapies are scarce and new approaches are needed. Chordoma cells and cancer stem-like cells share similar characteristics, including self-renewal, differen-tiation, and resistance to chemotherapy. Therefore, it seems possible that chordomas might contain a subpopulation of cancer stem-like cells. The aim of this study is to determine whether cancer stem-like cells might be present in chordomas.

Methods. In this study, the authors used gene expression analysis for common cancer stem-like cellmarkers, including c-myc, SSEA-1, oct4, klf4, sox2, nanog, and brachyury, and compared chordoma cells and tissues with nucleus pulposus tissues (disc degenerated nontumorigenic tissues). Differentiation through agents such as all-trans retinoic acid and osteogenic differentiation medium was induced to the chordoma cells. Additionally, U-CH1 cells were sorted via magnetic cell sorting for stem cell markers CD133 and CD15. After separation, positive and negative cells for these markers were grown in a nonadherent environment, soft agar, to determine whether the presence of these cancer stem-like cells might be responsible for initiating chordoma. The results were compared with those of untreated cells in terms of migration, proliferation, and gene expression by using reverse transcriptase polymerase chain reaction.

Results. The results indicate that chordoma cells might be differentiating and committing into an osteogenic lineage when induced with the osteogenic differentiation agent. Chordoma cells that are induced with retinoic acid showed slower migration and proliferation rates when compared with the untreated cells. Chordoma cells that were found to be enriched by cancer stem-like cell markers, namely CD133 and CD15, were able to live in a nonadherent soft agar medium, demonstrating a self-renewal capability. To the authors’ knowledge, this is the first time that cancer stem-like cell markers were also found to be expressed in chordoma cells and tissues.

Conclusions. Cancer stem-like cell detection might be an important step in determining the recurrent and meta-static characteristics of chordoma. This finding may lead to the development of new approaches toward treatments of chordomas.(http://thejns.org/doi/abs/10.3171/2011.12.JNS11430)

kEy WOrds • chordoma • cancer stem-like cell • differentiation • retinoic acid • SSEA-1 • nucleus pulposus • oncology

1

Abbreviations used in this paper: ALP = alkaline phosphatase; ATRA = all-trans retinoic acid; FITC = fluorescein isothiocyanate; ODM = osteogenic differentiation medium; PBS = phosphate-buffered saline; PCR = polymerase chain reaction.

* Ms. Aydemir and Dr. Bayrak contributed equally to this work.

E. Aydemir et al.

2 J Neurosurg / January 27, 2012

0 to 17 years, 34% appeared in those ranging in age from 18 to 40 years, and 49% occurred in those older than 40 years. 6,23,43,49

Recent studies have indicated that tumors consist of different subsets of cells, and that a small proportion of cells, called cancer stem-like cells, are responsible for primary tumor growth, recurrence, and metastasis. These cancer stem-like cells are similar to normal tissue stem cells in that they have self-renewal capacity, can asym-metrically divide, and are capable of multilineage differ-entiation.28,30,42 Small numbers of cancer stem-like cells can give rise to new heterogeneous tumors when intro-duced in vivo.10 Cancer stem-like cells are also resistant to conventional therapies such as chemotherapy.19,45 Thus, understanding the molecular pathways that control the maintenance and differentiation ability of normal stem cells and cancer stem-like cells may contribute to new approaches to treat cancer. The mechanism that controls the formation of chordoma is not clearly understood, and this study examines the possibility that cancer stem-like cells may be present in chordoma, contributing to its ag-gressive nature.

Gross-total resection is the most effective method to treat chordomas.2 However, due to the high recurrence rate, new perspectives and novel treatment methods are needed. A promising treatment method for chordoma is to induce differentiation, which forces maturation of the cancer cells and causes an arrest in the G0 phase of the cell cycle.24,27 With the influence of the differentiation method, cancer stem-like cells are expected to complete their maturation, which would stop their proliferation. Furthermore, since they originate from stem cells, chor-domas may differentiate into other mesenchymal lineag-es upon induction with differentiation agents, including chondrogenic/osteogenic factors and ATRA. Therefore, the aim of the present study was to determine the pres-ence of cancer stem-like cells in chordomas by using gene expression profiling and differentiation with differentia-tion agents, as well as using additional techniques includ-ing the scratch assay, proliferation assay, cell sorting, soft agar, and flow cytometry assays to characterize chordo-mas and the presence of stem cell–like properties.

MethodsTissue Samples

All samples were obtained in accordance with ap-proved ethical standards of the responsible committee of Yeditepe University Hospital. Ten chordoma speci-mens were obtained from patients who underwent sur-gery between November 2006 and February 2009, and 10 samples of nucleus pulposus tissue were extracted from patients with degenerative disc disease at our institution and used as negative controls as in a previous study done by Gottschalk et al.20 The ages of patients with chordoma and degenerative disc disease varied from 8 to 68 years and from 26 to 59 years, respectively (Table 1).

Cell CultureA chordoma cell line, U-CH1 (Fig. 1), generated by

Silke Bruederlein at the University of Ulm, Germany, was kindly provided by the Chordoma Foundation (Durham, NC). For the cell culture, the protocol described previous-ly by Scheil and colleagues44 was followed. The U-CH1 cells with passage numbers 27–30 were used on gelati-nized tissue culture flasks and cultured with IMDM/RPMI (4:1) (GIBCO) containing 10% fetal bovine serum and 1% antibiotics (100 mg/ml streptomycin and 10,000 U/ml penicillin). Primary cell cultures were generated from nucleus pulposus specimens (Fig. 2) by incubat-ing the tissues with a collagenase type I, II, and IV mix overnight. They were then cultured in DMEM containing 10% fetal bovine serum and 1% antibiotics (100 mg/ml streptomycin and 10,000 U/ml penicillin). All cell cul-tures were grown at 37°C in 5% CO2. The medium for all cell cultures was changed twice per week until the conflu-ency reached 70%–80%.

Osteogenic Differentiation and ATRA InductionTo detect the differentiation potential of chordoma

cells (U-CH1), the Osteogenesis Differentiation Kit (GIB-CO) and ATRA (Sigma) were used. The U-CH1 cells were trypsinized with 0.5% trypsin-EDTA (GIBCO) and seeded into 2 sets of 2 gelatinized T-25 tissue flasks with a density of 6 × 105 cells. Differentiation medium was added to the cells 24 hours later. Cells in 1 set of flasks were collected for gene expression analysis on Days 7 and 14. Both media were refreshed once every 3 days for 3 weeks. Cells were harvested on Days 7 and 14 from the

TABLE 1: Clinical characteristics of patients with clivus chordoma and degenerative disc diseases*

Sample No. Age (yrs), Sex Origin

CH1 68, M clivus chordomaCH2 8, M clivus chordomaCH3 40, F clivus chordomaCH4 55, M clivus chordomaCH5 28, F clivus chordomaCH6 63, F clivus chordomaCH7 15, F clivus chordomaCH8 50, F clivus chordomaCH9 21, F clivus chordomaCH10 28, F clivus chordomaNP1 57, F nucleus pulposusNP2 48, F nucleus pulposusNP3 56, F nucleus pulposusNP4 46, M nucleus pulposusNP5 56, M nucleus pulposusNP6 30, M nucleus pulposusNP7 42, M nucleus pulposusNP8 43, F nucleus pulposusNP9 59, F nucleus pulposusNP10 26, F nucleus pulposus

* CH = clivus chordoma; NP = nucleus pulposus with degenerative diseases.


Cancer stem-like cells in chordoma

3

ODM induction, and the pellets were processed for the ALP activity analysis.

Alkaline Phosphatase ActivityTo detect osteogenic differentiation, the Alkaline

Phosphatase Detection Kit (Randox Laboratories, Ltd.) was used on the 7th and 14th days of induction accord-ing to the manufacturer’s protocol. In brief, for each time point, the medium was removed, and the cells were washed 3 times with PBS, trypsinized, and lysed in 500 ml lysis buffer containing 0.2% Triton X-100 (Sigma). Lysates were vortexed vigorously for up to 30 minutes. Protein lysates (25 ml per sample) were mixed with 75 ml ALP detection solution. For each cell with triplicate controls, absorbance was measured every 30 minutes for 2 hours at 405 nm using an ELx800 ELISA microplate reader (BioTek).

Scratch AssayTo observe the effect of differentiation on the mi-

gration ability, U-CH1 cells treated with ODM and 10 mM ATRA were seeded into three 35-mm petri dishes (25,000 per dish). Straight lines were scratched across the petri dishes using a pipette tip, as described in a previous study,31 and the cells were left to proliferate for 21 days. On each day, observations were made using an inverted microscope (Leica) and the images were saved.

Proliferation AssayThe proliferation assay was performed to evaluate

the effects of differentiating agents used in this study. The U-CH1 cells (at a density of 15 × 103) treated with ODM and 10 mM ATRA were placed in a 12-well plate. The proliferation rate was measured via MTS assay by us-ing One Solution Reagent (Promega) on the 7th and 14th days, according to the manufacturer’s protocol. In short, One Solution Reagent was added to each well and incu-bated at 37°C for 3 hours. Cell proliferation was assessed by measuring the absorbance at 490 nm with an ELx800 ELISA microplate reader (BioTek).

Identification of Stem Cell Surface Markers by Flow Cytometry

In this study, flow cytometry analysis was done to de-termine whether stem cell surface markers were present in U-CH1 cells. The U-CH1 cells were trypsinized and distributed (100,000 cells per tube) into 1.5-ml Eppen-dorf tubes (for 10 primary and secondary antibodies and a negative control). Cells were incubated with the FITC-labeled primary antibodies CD90, CD73, CD105, CD166, CD34, CD45, and CD133 (Santa Cruz Biotechnology, Inc.).15,35,40,50,56 Primary antibodies were added at a con-centration of 200 g/ml for 1 hour. Incubated cells were washed with PBS and stored in a mixture of PBS and 4% paraformaldehyde (Lachema) at 4°C. The cells treated with CD73 and CD133 antibodies were also washed and exposed to the secondary anti–mouse antibodies for an-other hour at 4°C. After the incubation time, all cells were transferred into the flow cytometry polypropylene tubes. Flow cytometry analysis was performed using a FACS-Calibur device (Becton, Dickinson, and Co.).

RNA Isolation and cDNA SynthesisFor gene expression analysis, total RNA was isolated

using Trizol reagent (GIBCO) on Day 14 of induction with ODM and ATRA. RNA was also isolated using Trizol reagent from primary nucleus pulposus cells at passage 0. Complementary DNAs for each cell were synthesized with the Anchored-oligo(dT) Primer (Transcriptor High Fidelity cDNA Synthesis Kit) method using 1 mg RNA.

Gene Expression Profiles for Cancer Stem-Like CellsFor the gene expression analysis of stem cells, sev-

eral templates were used: cDNAs synthesized from to-tal RNAs from 10 tumor tissues, primary cell cultures generated from nucleus pulposus tissues, and 3 cell lines of U-CH1 (1 each treated with ODM and 10 mM retinoic acid, and 1 untreated). They were exposed to conventional PCR by using appropriate stem cell mark-ers. The following custom-designed primers were used: brachyury F: 5ʹ TGAGACCCAGTTCATAGCGG 3 ,́ R: 5ʹ TGCTGGTTCCAGGAAGAAGC 3 ;́ c-myc F: 5ʹ CCT

Fig. 1. Inverted microscopy images of chordoma cell line U-CH1. Originalmagnification× 20.

Fig. 2. Primarynucleuspulposuscells.Originalmagnification× 20.

E. Aydemir et al.


TGCAGCTGCTTAGACGC 3 ,́ R: 5ʹ TCTGCTGCTGCT GCTGGTAG 3 ;́ nanog F: 5ʹ CCTCCAGCAGATGCA AGAAC 3 ,́ R: 5ʹ CCAGGTCTGAGTGTTCCAGG 3 ;́ smad2 F: 5ʹ CCCAGCAGGAATTGAGCCAC 3 ,́ R: 5ʹ GTGAGGGCTGTGATGCATGG 3 ;́ nestin F: 5ʹ CCT GGAGCAGGAGAAACAGG 3 ,́ R: 5ʹ GGAGCAAAG ATCCAAGACGC 3 ;́ SSEA-1 F: 5ʹ GGCCAGCTCACC TTGCCCTG 3 ,́ R: 5ʹ CGCTGGCCCGGGAATGGA AG 3 ;́ GAPDH F: 5ʹ CCATCTTCCAGGAGCGAG ATC 3 ,́ R: 5ʹ GGCATTGCTGATGATCTTGAGG 3 ;́ CD44 F: 5ʹ GCCTCCGTCCGAGAGATGCTG 3 ,́ R: 5ʹ GCAGCCAACTTCCGAGGCAG 3 ;́ CD90 F: 5ʹ TCA GGCTGAACTCGTGGA 3 ,́ R: 5ʹ CCAGATCCAGGA CTGAGATC 3 .́ The primers for klf4, oct3/4, sox2, and CD24 have been described previously.4,54,57 Touch-down amplification was done (5 minutes at 95°C followed by 34 touchdown cycles of 95°C/30 seconds, 60–52°C/30 sec-onds, 72°C/30 seconds, and 72°C/15 minutes), and bands were visualized and recorded as present or absent on a benchtop ultraviolet transilluminator (Avegene).

Stem Cell Separation by Magnetic Cell SortingChordoma cells were separated using the stem cell

marker CD133. Single cell suspensions were prepared at a concentration of 2 × 107 cells/ml in PBS medium con-taining 2% fetal bovine serum and 1 mM EDTA. Cells were first treated with a species-specific blocking anti-body, then with primary biotinylated CD133 antibody at a final concentration of 0.5 mg/ml, and incubated at room temperature for 15 minutes in polystyrene round-bottom tubes. A biotin selection cocktail was added at 100 ml/ml, and the specimens were incubated at room tempera-ture for 15 minutes. After this step, magnetic nanopar-ticles were added to the solution at 50 ml/ml. To obtain a uniformly distributed cell suspension, cells were pipetted several times. The cell suspension was brought to a to-tal volume of 5.0 ml by adding recommended medium and was incubated at room temperature for 10 minutes. The suspension containing cells was placed into a mag-net, where it rested for 5 minutes. The magnet was then picked up and inverted in one continuous motion and the supernatant, which was known to consist of CD133-nega-tive cells, was poured off into another flask for further ap-plications. The magnetically labeled CD133-positive cells remained inside the walls of the tube.

Soft Agar Assay for CD133-Negative and CD133-Positive Cells

To evaluate the colony-forming ability of chordoma cells, we performed soft agar assay by seeding 10,000 single CD133-positive and CD133-negative U-CH1 cells into 0.7% top agar in T25 tissue flasks prepared with a 1% agar base layer in 1× McCoy culture medium containing 10% FBS and incubated at 37°C for 21 days. Flasks were stained with 0.5 ml of 0.005% crystal violet for more than 1 hour, and colonies containing more than 20 cells were counted using a dissecting stereomicroscope.

ResultsStem Cell Origin of Chordoma Cells

To investigate whether chordomas contained cancer

stem-like cells, we used flow cytometry analysis to evalu-ate the expression of several stem cell markers that have been identified in other systems.15,35,40,50,56 To this end, chordoma cells were stained with FITC-labeled primary antibodies for appropriate stem cell surface markers in-cluding CD105, CD73, CD166, CD90, CD34, CD45, and CD133. After labeling with common stem cell surface markers, we identified subpopulations of U-CH1 cells that were positive for all cancer stem cell markers tested as follows: CD90 (11.82%), CD105 (5.66%), CD166 (4.76%), CD73 (0.46%), CD45 (8.2%), CD34 (2.66%), and CD133 (2.6%) (Fig. 3), suggesting that chordoma cells might have a cancer stem-like cell origin.

Proliferation of Chordoma Cells Induced With ATRATo evaluate the effect of differentiation on the pro-

liferation of chordoma cells, we treated chordoma cells with ATRA, which is a differentiating agent that stops ab-normal cell growth during cell cycle and lead cell arrest and maturation.33 We performed a proliferation assay and found that in the presence of ATRA, the number of cells was diminished between Days 4 and 14. However, the proliferation of cells treated with ODM was not affected. At the end of Day 4, the number of living cells treated with 10 mM ATRA had decreased by 65% of the total. Likewise, by the end of Day 14, surviving cells, which showed resistance to ATRA, were only 49% of the total. Overall, this showed that ATRA had an apoptotic effect on U-CH1 cells by forcing the cells to become terminally differentiated and sensitive to the treatment. Unlike the effect of treatment with ATRA, differentiation via ODM had almost no effect on proliferation and cells survived (> 90%) throughout the treatment (Fig. 4). Overall, we con-clude that chordoma cells may be induced to differentiate via ATRA.

Differentiation of Chordoma Cells Into Osteogenic Lineages

The ability of U-CH1 cells to differentiate into osteo-genic lineages when induced with ODM was investigated using the ALP assay. To this end, we treated U-CH1 cells with ODM for 14 days and observed that the ratio of dif-ferentiation was higher than that of the untreated control on both Days 7 and 14. Interestingly, we also observed that the cell morphology of treated cells was consistent with the quantification of differentiation results, since treated cells had a morphology consistent with cells of the osteogenic lineage, including features such as ex-panded cytoplasm (Fig. 5). Throughout the 14 days, the ratio of differentiation of U-CH1 cells treated with ODM increased 2-fold compared with the differentiation at the end of Day 7 (Fig. 6).

The Effect of Differentiation on the Migration of Chordoma Cells

Malignant tumor cells share many of the same char-acteristics as stem cells, such as self-renewal, extensive proliferation, and the ability to differentiate.42 In addi-tion, it has been hypothesized that migratory metastatic cells might have a stem cell origin.5 Therefore, we wanted to investigate the migration capacity of chordoma cells



5

in the absence and presence of differentiating agents to determine whether treatment with such agents would affect migration. The migration rate of chordoma cells treated with both ATRA and ODM was investigated us-ing the scratch assay. Later, most cells treated with 10 mM ATRA had died by the end of the 3rd week, while the cells treated with osteogenic medium continued to grow and covered the scratched path at a much slower migra-tion rate than those cells that were untreated. This finding suggests that osteogenic differentiation might reduce the aggressive nature of chordoma cells by inhibiting their migration (Fig. 7).

Expression of Cancer Stem-Like Cell Markers in Chordoma Cells

Next, we wished to investigate whether chordomas expressed markers of cancer stem-like cells using gene

expression analysis. To this end, we compiled a list of cancer stem-like cell markers that have been used in other systems, including smad2, oct4, sox2, nanog, c-myc, klf4, CD44, CD24, CD90, and SSEA-1. At the same time, we also wished to evaluate whether treatment with differen-tiating agents would alter the expression levels of the can-cer stem-like cell markers. To evaluate this hypothesis, we treated 2 flasks with each differentiating agent, ATRA and ODM. On Day 7, the cells exposed to ATRA and ODM were collected and RNAs were extracted. The oth-er 2 flasks, which were also exposed to both treatments, were collected at the end of the 3rd week of the treatment with ATRA and ODM. The majority of the cells treated with ATRA were found to be dead; however, a subgroup of resistant cells was observed, collected, and subcultured for further gene expression analysis to determine if there was any difference between the cells induced with ATRA

Fig. 3. Flow cytometry results of U-CH1 cells stained with FITC-labeled antibodies.

E. Aydemir et al.


and ODM for 7 days and those that were resistant and subcultured. According to the expression profiles, cells treated with ATRA for 7 days did not show any expres-sion of the stem cell markers, including oct4, klf4, c-myc, smad2, sox-2, and brachyury, while untreated U-CH1 cells showed positive expression of these genes (Fig. 8). Interestingly, the subgroup of resistant cells that survived after 14 days of treatment reexpressed these markers. The data suggest that the primary exposure of ATRA may cause a subgroup of cells in chordoma to differentiate and that, prior to differentiation, these cells might pos-sess cancer stem-like features since the cells expressed high levels of cancer stem-like cell markers.

Expression of the Cancer Stem-Like Cell Markers in Chordoma Tissues

To confirm the expression data generated from chor-doma cells, we obtained tissue samples of primary chor-domas from the Department of Neurosurgery at Yedite-pe University Hospital and performed gene expression analysis for the panel of stem cell markers listed above. We found that the gene expression of these markers in primary chordoma tissues was also consistent with the

gene expression profile observed in untreated U-CH1 cells, which express all the cancer stem-like cell markers (Table 2), including chordoma markers such as EMA and cytokeratin 19 (data not shown).

We also compared the gene expression of the can-cer stem-like cell markers in chordoma tissues with healthy nucleus pulposus tissues, by preparing primary cell cultures from nucleus pulposus tissues. According to the gene expression profile, only a few nucleus pulposus cells expressed some of the cancer stem-like cell mark-ers (Table 3) compared with the chordoma tissues, which expressed most of the stem-like cell markers. These data suggest that chordomas upregulate cancer stem-like cell markers that are not normally expressed in untrans-formed cells, perhaps contributing to cancer progression and recurrence.

Colony-Forming Ability of Chordoma Cells That Exhibit Stem Cell Characteristics

Previously, colony formation in soft agar has been used as a method to evaluate stem-like properties.7 To evaluate the colony-forming ability of chordoma cells, we seeded U-CH1 cells that were sorted using CD133 and CD15 and compared soft agar formation of CD133-positive and CD15-positive cells to their CD133-negative and CD15-negative counterparts, respectively. Using a dissecting stereomicroscope, colonies were counted after 14 days of growth in soft agar. Plating efficiency was the number of colonies per 20 cells plated.11,41,48 According to the results, CD133-enriched cells were found to be 10-fold higher than the CD133-depleted cells in soft agar col-ony formation (Fig. 9), while CD15-enriched cells were more than 1-fold when compared with the CD15-depleted cells (Fig. 10). These results suggest that chordoma cells that are CD133 positive might be responsible for initiat-ing chordoma, given that they have a greater capacity for anchorage-independent growth than the CD133-negative counterparts. Further studies in vivo will reveal whether CD133-positive cells are also capable of initiating tumor growth.

DiscussionChordomas are believed to arise from the remnants

Fig. 4. Effect of differentiation on the proliferation of U-CH1 cells treated with retinoic acid (RA) and osteogenic (Osteo) differentiation medium on Days 4 and 14.

Fig. 5. U-CH1cellstreatedwithODM.Originalmagnification× 20.

Fig. 6. Alkaline phosphatase activity of U-CH1 cells treated with ODM versus untreated cells on Days 7 and 14. The amount of ALP activity increases while the rate of proliferation of U-CH1 cells untreated with ODM remains unchanged.



7

of the embryonic notochord. Due to their local metasta-sis to nearby tissues and resistance to chemotherapy/ra-diotherapy, conventional therapy methods are not useful for treating chordomas. Therefore, novel perspectives are needed to fight against this tumor. To our knowledge, this study is the first to show the effects of differentiation by ATRA and osteogenic factors on chordoma cells. It is also the first time that chordoma cells have been shown to ex-press defined cancer stem-like cell markers through flow cytometry, a robust method that has been used previously to characterize the stem cells in bulk tumors of several malignancies.26,46 Our flow cytometry data show that all the stem cell markers of interest were present in different percentages. Among these, CD90 and CD105 were found to be quite high, as shown in previous studies.21,32 These authors showed that CD90 and CD105 are mesenchymal stem cell markers that regulate breast cancer stem cells through a cytokine network. CD166 is also another im-portant marker that is expressed in several malignancies including colorectal cancer.14 Based on these findings, we conclude that chordomas might contain a subpopulation of cancer stem-like cells. This study also shows for the first time that according to the gene expression analysis, chordoma cells (U-CH1 cells) and tissues express all the common stem cell markers, including oct4, klf4, c-myc, and sox2, and embryonic stem cell markers SSEA-1 and nanog. The expression of these genes together with our differentiation data indicates that chordomas might con-tain cells with the capacity to differentiate, recalling a crucial hallmark of stem cells.

Stem cells are able to differentiate into other lineages

during development.42 Based on this, to our knowledge, for the first time, we proposed that the presence of pos-sible cancer stem-like cells in chordomas may be detected when appropriate differentiating agents are introduced. Chordoma cells could be differentiated into another mes-enchymal lineage when treated with an osteogenic dif-ferentiation agent. Distinct alteration in the morphology of chordoma cells was observed when these cells were induced with osteogenic medium. To confirm this, we performed alkaline phosphatase activity assay and dem-onstrated that there is an increase in the calcification of chordoma cells after induction, as was shown previously in the investigations of Dudley et al.17 The effect of dif-ferentiation on the migration capacity of chordoma cells was examined via the scratch assay, and we found that chordoma cells treated with osteogenic factors decreased their migration when compared with untreated cells, a phenomenon seen in a similar study by Gruber and as-sociates.22 The differentiation into an osteogenic lineage indicated that a subpopulation of chordoma cells may possess stem-like cell characteristics.

We also aimed to show whether there was a change in the rate of migration of chordoma cells after the in-duction with ATRA. The results indicated that chordoma cells treated with ATRA migrated at a much slower rate than untreated cells. A similar event was reported in a previous study, which showed that ATRA exerted an apoptotic effect on oral squamous cell carcinoma cells consistent with, as in our case, a drastic decrease in the proliferation rate of chordoma cells.55

According to the gene expression profile, the expres-

Fig. 7. Scratch assay results for untreated U-CH1 cells (A), those treated with osteogenic medium (B), and those treated with retinoic (C) on Days 1, 7, and 13. Original magnification × 10.

E. Aydemir et al.


sion of stem cell markers, including c-myc, klf, and oct4, whose expression is known to play crucial roles in dif-ferentiation, were not detected in U-CH1 cells treated with ATRA, suggesting that differentiation with ATRA promotes differentiation of stem-like cells that previously expressed stem cell markers. On the other hand, cells treated with ODM continued to express these markers, suggesting that ODM is not capable of inducing complete differentiation of cancer stem-like cells in chordomas.

We have for the first time detected the presence of enriched cancer stem-like cell markers in chordoma by using a molecular approach including magnetic cell sep-aration followed by soft agar analysis. The capacity for anchorage-independent growth both in soft agar and in nonadherent 2D cell culture has been shown previously to be attributed to cancer stem-like cells.12,13,36,38 Our results showed that chordoma cells separated by a neural stem cell marker, CD133, and an adhesion molecule, SSEA-1 (also known as CD15, which is responsible for migration of the cells in the early embryo), showed an enhanced an-chorage independence that might lead to the initiation of chordomas, when compared with cells that were CD133 and CD15 negative. CD133 is a neural stem cell marker discovered and defined in glioblastoma25 and has been shown in many subsequent studies to be a stem cell mark-er.37,52 It has also been shown to play a role in initiation of several tumors including brain, colon, and melanoma.51 Therefore, the presence of CD133-positive, anchorage-independent cells in U-CH1 cells suggests that chordoma cells might have cancer stem-like characteristics.

SSEA-1 is an important embryonic stem cell mark-er and has been shown to be expressed in various stem cell studies.39 SSEA-1 is being used as a marker to detect embryonic stem cells.16 Studies performed on this par-ticular gene are very sensitive and important, and one is especially important because it demonstrates that SSEA-1 may be an enrichment marker for tumor-initiating cells for most glioblastomas.47

We showed for the first time that some of the chor-doma tissues express the SSEA-1 gene, whereas nucleus pulposus cells do not express SSEA-1, confirming that the presence of this particular marker distinguishes between

TABLE 2: Gene expression profile for chordoma tissue samples (CH1–10) and U-CH1 cells*

Markers CH1 CH2 CH3 CH4 CH5 CH6 CH7 CH8 CH9 CH10 U-CH1 Positive/Total

smad2 + + + + + + − + − + − 8/11oct4 + + + + + + + − − + + 9/11sox2 + + + + + + + + + + + 11/11nanog + + + + + + − + + + + 10/11c-myc + + + + + + + − + + + 10/11klf4 + + + + + + − + + + + 10/11CD44 + + + + + + + + − − + 9/11CD24 + + + + + + + + + + + 11/11CD90 + − − + + + − − + + + 7/11SSEA-1 + + + + + − − − − − + 6/11GAPDH + + + + + + + + + + + 11/11

* CH1–10 = chordoma tissue samples 1–10; + = positive expression; − = no expression.

Fig. 8. Gene expression analysis of U-CH1 cells treated with differ-ent differentiating agents for the stem cell markers. U-CH1 with 10 mM retinoic acid (subculture: groups of cells that survived and proliferated when they were treated with 10 mM retinoic acid for 3 weeks; A), U-CH1 with osteogenic medium (B), U-CH1 with 10 mM retinoic acid (primary culture; C), and U-CH1 (negative control; D).



9

malignant chordoma cells/tissues and normal nucleus pulposus cells. Unlike other cancer stem-like cell mark-ers, SSEA-1 has been found to be expressed in half of the chordoma tissues and also was positive in U-CH1 cells, which may suggest that, since U-CH1 cells were gener-ated from a case of recurrent chordoma, SSEA-1 may be an early recurrence marker. Therefore, for future studies, this gene may be used as an early detection marker in recurrent chordoma cases upon the completion of patient follow-up visits. To confirm these results, further func-tional studies are needed.

ConclusionsTo our knowledge, this is the first study demonstrating

the existence of possible cancer stem-like cells in chor-domas. By using various assays including gene expres-sion analysis, flow cytometry, and anchorage-independent growth in soft agar assay, we found that chordomas ex-press stem cell markers and are capable of differentia-tion, which support the idea that chordomas may contain a subpopulation of stem-like cells. Based on our findings we conclude that chordomas may contain cancer stem-

like cells, which have a role in resistance to conventional therapies, recurrence, and metastasis. The existence of these cancer stem-like cells should be confirmed in the future with functional in vivo studies.

Disclosure

This study was supported by Yeditepe University Research Funding.

Author contributions to the study and manuscript preparation include the following. Conception and design: Aydemir, Bayrak, Sahin. Acquisition of data: Aydemir, Bayrak. Analysis and interpre-tation of data: Aydemir, Bayrak, Kose, Selvi. Drafting the article:

TABLE 3: Gene expression profile for nucleus pulposus cells

Markers NP1 NP2 NP3 NP4 NP5 NP6 NP7 NP8 NP9 NP10 Positive/Total

brachyury − + − − + + + − + − 6/10smad2 + + − + + − + + + + 8/10oct4 + − − − + − − − + + 4/10sox2 − + − + + + − − − − 4/10nanog + + − + − − − − + + 5/10c-myc + − + + + + − + + + 8/10klf4 + + + + + + + + + + 10/10CD44 + − + − + − − + + + 6/10CD24 + + + + − + + + + + 9/10CD90 + + − + + + − + − + 7/10SSEA-1 − − − − − − − − − − 0/10GAPDH + + + + + + + + + + 10/10

Fig. 9. A soft agar culture for CD133-positive cells.

Fig. 10. U-CH1 cell immunostained with CD15 antibody. The image wasobtainedundera fluorescentmicroscope.Originalmagnification× 40.

E. Aydemir et al.


Ture, Aydemir, Bayrak, Kose, Yalvac. Critically revising the article: all authors. Reviewed submitted version of manuscript: all authors. Approved the final version of the manuscript on behalf of all authors: Ture. Administrative/technical/material support: Dogruluk. Study supervision: Ture, Atalay.

References

1. al-Mefty O, Borba LA: Skull base chordomas: a management challenge. J Neurosurg 86:182–189, 1997

2. Almefty K, Pravdenkova S, Colli BO, Al-Mefty O, Gokden M: Chordoma and chondrosarcoma: similar, but quite differ-ent, skull base tumors. Cancer 110:2457–2467, 2007

3. Almefty KK, Pravdenkova S, Sawyer J, Al-Mefty O: Impact of cytogenetic abnormalities on the management of skull base chordomas. Clinical article. J Neurosurg 110:715–724, 2009

4. Bauwens CL, Peerani R, Niebruegge S, Woodhouse KA, Ku-macheva E, Husain M, et al: Control of human embryonic stem cell colony and aggregate size heterogeneity influences dif ferentiation trajectories. Stem Cells 26:2300–2310, 2008

5. Brabletz T, Jung A, Spaderna S, Hlubek F, Kirchner T: Opin-ion: migrating cancer stem cells - an integrated concept of malignant tumour progression. Nat Rev Cancer 5:744–749, 2005

6. Catton C, O’Sullivan B, Bell R, Laperriere N, Cummings B, Fornasier V, et al: Chordoma: long-term follow-up after radi-cal photon irradiation. Radiother Oncol 41:67–72, 1996

7. Chen YC, Chen YW, Hsu HS, Tseng LM, Huang PI, Lu KH, et al: Aldehyde dehydrogenase 1 is a putative marker for cancer stem cells in head and neck squamous cancer. Biochem Bio-phys Res Commun 385:307–313, 2009

8. Choi D, Melcher R, Harms J, Crockard A: Outcome of 132 op-erations in 97 patients with chordomas of the craniocervical junction and upper cervical spine. Neurosurgery 66:59–65, 2010

9. Chugh R, Tawbi H, Lucas DR, Biermann JS, Schuetze SM, Baker LH: Chordoma: the nonsarcoma primary bone tumor. Oncologist 12:1344–1350, 2007

10. Clarke M, Al-Hajj M, Wicha M, Nunez G, Morrison S: Pro-spective identification and isolation of breast cancer tumor initiating cells. Eur J Cancer 38:S104, 2002 (Abstract)

11. Clarke MF, Dick JE, Dirks PB, Eaves CJ, Jamieson CH, Jones DL, et al: Cancer stem cells—perspectives on current status and future directions: AACR Workshop on cancer stem cells. Cancer Res 66:9339–9344, 2006

12. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ: Pro-spective identification of tumorigenic prostate cancer stem cells. Cancer Res 65:10946–10951, 2005

13. Curley MD, Therrien VA, Cummings CL, Sergent PA, Kou-louris CR, Friel AM, et al: CD133 expression defines a tumor initiating cell population in primary human ovarian cancer. Stem Cells 27:2875–2883, 2009

14. Dalerba P, Dylla SJ, Park IK, Liu R, Wang X, Cho RW, et al: Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci U S A 104:10158–10163, 2007

15. Deans RJ, Moseley AB: Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 28:875–884, 2000

16. Dong WZ, Shen WZ, Hua JL, Dou ZY: [Study on pluripotency and cultivation of ES-like cells derived from male germ stem cells of bovine fetuses.] Sheng Wu Gong Cheng Xue Bao 23: 751–755, 2007 (Chinese)

17. Dudley AC, Khan ZA, Shih SC, Kang SY, Zwaans BM, Bischoff J, et al: Calcification of multipotent prostate tumor endothelium. Cancer Cell 14:201–211, 2008

18. Erlandson RA, Tandler B, Lieberman PH, Higinbotham NL: Ultrastructure of human chordoma. Cancer Res 28:2115–2125, 1968

19. Gilbert CA, Ross AH: Cancer stem cells: cell culture, markers, and targets for new therapies. J Cell Biochem 108:1031–1038, 2009

20. Gottschalk D, Fehn M, Patt S, Saeger W, Kirchner T, Aigner T: Matrix gene expression analysis and cellular phenotyping in chordoma reveals focal differentiation pattern of neoplastic cells mimicking nucleus pulposus development. Am J Pathol 158:1571–1578, 2001

21. Grange C, Tapparo M, Collino F, Vitillo L, Damasco C, Deregibus MC, et al: Microvesicles released from human re-nal cancer stem cells stimulate angiogenesis and formation of lung premetastatic niche. Cancer Res 71:5346–5356, 2011

22. Gruber R, Karreth F, Kandler B, Fuerst G, Rot A, Fischer MB, et al: Platelet-released supernatants increase migration and proliferation, and decrease osteogenic differentiation of bone marrow-derived mesenchymal progenitor cells under in vitro conditions. Platelets 15:29–35, 2004

23. Higinbotham NL, Phillips RF, Farr HW, Hustu HO: Chordo-ma. Thirty-five-year study at Memorial Hospital. Cancer 20: 1841–1850, 1967

24. Huang Y, Fernandez SV, Goodwin S, Russo PA, Russo IH, Sutter TR, et al: Epithelial to mesenchymal transition in hu-man breast epithelial cells transformed by 17beta-estradiol. Can cer Res 67:11147–11157, 2007

25. Ignatova TN, Kukekov VG, Laywell ED, Suslov ON, Vrionis FD, Steindler DA: Human cortical glial tumors contain neural stem-like cells expressing astroglial and neuronal markers in vitro. Glia 39:193–206, 2002

26. Jinushi M, Chiba S, Yoshiyama H, Masutomi K, Kinoshita I, Dosaka-Akita H, et al: Tumor-associated macrophages regu-late tumorigenicity and anticancer drug responses of cancer stem/initiating cells. Proc Natl Acad Sci U S A 108:12425–12430, 2011

27. Jones-Villeneuve EM, Rudnicki MA, Harris JF, McBurney MW: Retinoic acid-induced neural differentiation of embryo-nal carcinoma cells. Mol Cell Biol 3:2271–2279, 1983

28. Kristeva MA: Stem cells in light of a new concept for cell dif-ferentiation. Stem Cells Dev 17:849–852, 2008

29. Lanzino G, Dumont AS, Lopes MB, Laws ER Jr: Skull base chordomas: overview of disease, management options, and out come. Neurosurg Focus 10(3):E12, 2001

30. Li N, Yang R, Zhang W, Dorfman H, Rao P, Gorlick R: Ge-netically transforming human mesenchymal stem cells to sar-comas: changes in cellular phenotype and multilineage differ-entiation potential. Cancer 115:4795–4806, 2009

31. Liang CC, Park AY, Guan JL: In vitro scratch assay: a conve-nient and inexpensive method for analysis of cell migration in vitro. Nat Protoc 2:329–333, 2007

32. Liu S, Ginestier C, Ou SJ, Clouthier SG, Patel SH, Monville F, et al: Breast cancer stem cells are regulated by mesenchymal stem cells through cytokine networks. Cancer Res 71:614–624, 2011 (Erratum in Cancer Res 71:2407, 2911)

33. Martin SJ, Green DR: Apoptosis and cancer: the failure of controls on cell death and cell survival. Crit Rev Oncol He-matol 18:137–153, 1995

34. McMaster ML, Goldstein AM, Bromley CM, Ishibe N, Parry DM: Chordoma: incidence and survival patterns in the United States, 1973-1995. Cancer Causes Control 12:1–11, 2001

35. Moore MA: Putting the neo into neoangiogenesis. J Clin In-vest 109:313–315, 2002

36. Morel AP, Lièvre M, Thomas C, Hinkal G, Ansieau S, Pui-sieux A: Generation of breast cancer stem cells through ep-ithelial-mesenchymal transition. PLoS ONE 3:e2888, 2008

37. O’Brien CA, Pollett A, Gallinger S, Dick JE: A human colon cancer cell capable of initiating tumour growth in immunode-ficient mice. Nature 445:106–110, 2007

38. Peñuelas S, Anido J, Prieto-Sánchez RM, Folch G, Barba I, Cuartas I, et al: TGF-beta increases glioma-initiating cell self-renewal through the induction of LIF in human glioblastoma. Cancer Cell 15:315–327, 2009

39. Pera MF, Reubinoff B, Trounson A: Human embryonic stem cells. J Cell Sci 113 (Pt 1):5–10, 2000



11

40. Pittenger MF, Mosca JD, McIntosh KR: Human mesenchymal stem cells: progenitor cells for cartilage, bone, fat and stroma. Curr Top Microbiol Immunol 251:3–11, 2000

41. Read TA, Fogarty MP, Markant SL, McLendon RE, Wei Z, Ellison DW, et al: Identification of CD15 as a marker for tu-mor-propagating cells in a mouse model of medulloblastoma. Cancer Cell 15:135–147, 2009

42. Reya T, Morrison SJ, Clarke MF, Weissman IL: Stem cells, cancer, and cancer stem cells. Nature 414:105–111, 2001

43. Samii A, Gerganov VM, Herold C, Hayashi N, Naka T, Mirza-yan MJ, et al: Chordomas of the skull base: surgical manage-ment and outcome. J Neurosurg 107:319–324, 2007

44. Scheil S, Brüderlein S, Liehr T, Starke H, Herms J, Schulte M, et al: Genome-wide analysis of sixteen chordomas by com-parative genomic hybridization and cytogenetics of the first hu man chordoma cell line, U-CH1. Genes Chromosomes Can cer 32:203–211, 2001

45. Sciubba DM, Chi JH, Rhines LD, Gokaslan ZL: Chordoma of the spinal column. Neurosurg Clin N Am 19:5–15, 2008

46. Shats I, Gatza ML, Chang JT, Mori S, Wang J, Rich J, et al: Using a stem cell-based signature to guide therapeutic selec-tion in cancer. Cancer Res 71:1772–1780, 2011

47. Son MJ, Woolard K, Nam DH, Lee J, Fine HA: SSEA-1 is an enrichment marker for tumor-initiating cells in human glio-blastoma. Cell Stem Cell 4:440–452, 2009

48. Sun Y, Kong W, Falk A, Hu J, Zhou L, Pollard S, et al: CD133 (Prominin) negative human neural stem cells are clonogenic and tripotent. PLoS ONE 4:e5498, 2009

49. Sundaresan N: Chordomas. Clin Orthop Relat Res 204:135–142, 1986

50. Tapp H, Deepe R, Ingram JA, Kuremsky M, Hanley EN Jr, Gruber HE: Adipose-derived mesenchymal stem cells from the sand rat: transforming growth factor beta and 3D co-cul-ture with human disc cells stimulate proteoglycan and col-lagen type I rich extracellular matrix. Arthritis Res Ther 10: R89, 2008

51. Tirino V, Desiderio V, d’Aquino R, De Francesco F, Piroz-zi G, Graziano A, et al: Detection and characterization of CD133+ cancer stem cells in human solid tumours. PLoS

ONE 3:e3469, 2008 (Erattum in PLoS One 3 [epub ahead of print], 2008)

52. Todaro M, Alea MP, Di Stefano AB, Cammareri P, Vermeu-len L, Iovino F, et al: Colon cancer stem cells dictate tumor growth and resist cell death by production of interleukin-4. Cell Stem Cell 1:389–402, 2007

53. Tzortzidis F, Elahi F, Wright D, Natarajan SK, Sekhar LN: Pa-tient outcome at long-term follow-up after aggressive micro-surgical resection of cranial base chordomas. Neurosurgery 59:230–237, 2006

54. Xiao J, Nan Z, Motooka Y, Low WC: Transplantation of a novel cell line population of umbilical cord blood stem cells ameliorates neurological deficits associated with ischemic brain injury. Stem Cells Dev 14:722–733, 2005

55. Xu Q, Zhang Z, Zhang P, Chen W: Antisense oligonucleotides and all-trans retinoic acid have a synergistic anti-tumor effect on oral squamous cell carcinoma. BMC Cancer 8:159, 2008

56. Yalvac ME, Ramazanoglu M, Rizvanov AA, Sahin F, Bayrak OF, Salli U, et al: Isolation and characterization of stem cells derived from human third molar tooth germs of young adults: implications in neo-vascularization, osteo-, adipo- and neuro-genesis. Pharmacogenomics J 10:105–113, 2010

57. Zheng B, Han M, Bernier M, Zhang XH, Meng F, Miao SB, et al: Krüppel-like factor 4 inhibits proliferation by platelet-derived growth factor receptor beta-mediated, not by retinoic acid receptor alpha-mediated, phosphatidylinositol 3-kinase and ERK signaling in vascular smooth muscle cells. J Biol Chem 284:22773–22785, 2009

Manuscript submitted March 15, 2011.Accepted December 6, 2011.Please include this information when citing this paper: pub-

lished online January 27, 2012; DOI: 10.3171/2011.12.JNS11430.Address correspondence to: Uğur Türe, M.D., Department of

Neurosurgery, Yeditepe University School of Medicine Devlet Yolu Ankara Cad. No: 102-104, Kozyatagi, 34752 Istanbul, Turkey. email: [email protected].

Characterization of cancer stem-like cells in chordoma

Documents