Characterisation of the Shigella flexneri O Antigen Polymerase Wzy Pratiti Nath M.Sc, B.Sc (Honours) Submitted for the degree of Doctor of Philosophy Department of Molecular and Cellular Biology School of Biological Sciences The University of Adelaide Adelaide, South Australia, Australia May, 2015
273
Embed
Characterisation of the Shigella flexneri · Abstract iii Abstract Shigella flexneri is the major causative agent of shigellosis that account for ~14000 deaths annually in Asia. The
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
!!!!!!
Characterisation of the Shigella flexneri
O Antigen Polymerase Wzy
Pratiti Nath M.Sc, B.Sc (Honours)
Submitted for the degree of Doctor of Philosophy
Department of Molecular and Cellular Biology
School of Biological Sciences
The University of Adelaide
Adelaide, South Australia, Australia
May, 2015
!!!!!!
!!!!!!
This thesis is dedicated to my parents Mr Pradip Kumar Nath and Ms Sumita Nath, my
husband Dr Arindam Dey, and my brother Prabreesh for their love, support, and
encouragement
!!!!!!
Declaration
i
Declaration
I certify that this work contains no material which has been accepted for the award of any
other degree or diploma in my name, in any university or other tertiary institution and, to the
best of my knowledge and belief, contains no material previously published or written by
another person, except where due reference has been made in the text. In addition, I certify
that no part of this work will, in the future, be used in a submission in my name, for any other
degree or diploma in any university or other tertiary institution without the prior approval of
the University of Adelaide and where applicable, any partner institution responsible for the
joint-award of this degree.
I give consent to this copy of my thesis when deposited in the University Library,
being made available for loan and photocopying, subject to the provisions of the Copyright
Act 1968.
The author acknowledges that copyright of published works contained within this
thesis resides with the copyright holder(s) of those works.
I also give permission for the digital version of my thesis to be made available on the
web, via the University’s digital research repository, the Library Search and also through web
search engines, unless permission has been granted by the University to restrict access for a
period of time.
_________________________
Pratiti Nath
May, 2015
ii
Abstract
iii
Abstract
Shigella flexneri is the major causative agent of shigellosis that account for ~14000 deaths
annually in Asia. The O antigen (Oag) component of S. flexneri lipopolysaccharide (LPS) is
important for virulence and a protective antigen. It is synthesised by a Wzy-dependent
mechanism. S. flexneri Wzy (WzySf) has 12 transmembrane (TM) segments and two large
periplasmic loops (PL). The modal chain length of the Oag is determined by chromosomally
encoded WzzSf and pHS-2 plasmid encoded WzzpHS2. Although WzySf was identified 20 years
ago, there is a lack of knowledge about its functional amino acid residues as WzySf has low
expression and poor detection. WzySf is thought to interact with WzzSf however, there is no
direct evidence on how these two proteins are associated.
A wzySf-gfp expression construct (pWaldo-wzySf-TEV-GFP or pRMPN1) was made; it
successfully expressed WzySf-GFP and complemented a wzySf mutant (!wzy). To identify
functionally important amino acid residues in WzySf, random mutagenesis was performed on
the wzySf in pRMPN1, followed by screening with colicin E2. Analysis of the LPS conferred
by mutated WzySf proteins in the !wzy strain identified 4 different mutant classes, with
mutations found in PL1, 2, 3, and 6; TM2, 4, 5, 7, 8, and 9, and cytoplasmic loop (CL) 1 and
CL5. The association of WzySf and WzzSf was investigated by transforming these mutated
wzySf plasmids into a wzySf and wzzSf deficient (!wzy !wzz) strain. Comparison of the LPS
profiles in the !wzy and !wzy !wzz backgrounds identified WzySf mutants whose
polymerisation activities were WzzSf dependent. Colicin E2 and bacteriophage Sf6c
sensitivities were consistent with the LPS profiles. Analysis of the expression levels of the
WzySf-GFP mutants in the !wzy and !wzy !wzz backgrounds identified a role for WzzSf in
WzySf stability. Hence, in addition to its role in regulating Oag modal chain length, WzzSf also
affects WzySf activity and stability.
Site-directed mutagenesis was performed on wzySf in pRMPN1 to alter Arg residues in
WzySf’s two large PLs (3 and 5) to Ala. Analysis of the LPS profiles conferred by mutated
WzySf proteins in the !wzy strain identified residues that affect WzySf activity. The importance
of the guanidium group of the Arg residues was investigated by altering the Arg residues to
Abstract
iv
Lys and Glu, which generated WzySf mutants conferring altered LPS Oag modal chain
lengths. The dependence of these WzySf mutants on WzzSf was investigated by expressing
them in the !wzy !wzz strain. Comparison of the LPS profiles identified a role for the Arg
residues in the association of WzySf and WzzSf. Comparison of the expression levels of
different mutant WzySf-GFPs with the wild-type WzySf-GFP showed that certain Arg residues
affected production levels of WzySf in a WzzSf-dependent manner.
WzySf-GFP-His8 was purified by affinity chromatography and I propose that WzySf
may form dimers. The negative dominance study suggested that the dimer formation may be
not essential for functioning of WzySf. In vivo crosslinking was performed in a !wzy strain
carrying plasmids encoding His-tagged WzySf and untagged WzzSf. In vivo crosslinking was
followed by affinity purification of WzySf, and Western immunoblotting with WzzSf antibody
detected the co-purification of WzzSf. This was also supported by mass spectrometry analysis
and provided the first report of complex formation between WzySf and WzzSf. The WzySf
mutants (WzySfR164A, WzySfV92M, WzySfY137H, and WzySfR250K) having Wzz-
dependent activity were still able to form complexes with WzzSf which suggested that
although their activity is Wzz-dependent, the mutational alterations do not affect the
interaction of WzySf with WzzSf. Thus the interaction may involve many regions of WzySf.
This thesis identified and characterised functionally important amino acid residues of
WzySf, identified several novel LPS phenotypes conferred by the WzySf mutants, and found
that WzzSf affects the functioning and stability of WzySf, both positively and negatively. The
work also first time identified direct physical interaction of WzzSf and WzySf, and developed a
purification method for WzySf. Finally, I proposed a model of Wzy-dependent Oag
polymerisation through the interaction of Wzy with Wzz.
Acknowledgements
v
Acknowledgements
First and foremost, I would like to thank my supervisor Associate Professor Renato Morona. I
was fortunate to have him as my mentor. I would like to appreciate him for giving me such a
wonderful project, and I really enjoyed all the challenges and opportunities came on my way.
He not only helped me to understand the research field, but also supported me throughout the
candidature. He has been a great source of inspiration. I have learned a lot from you Renato
and thank you for everything.
I would like to thank the University of Adelaide and School of Biological Sciences for
hosting me and supporting me with the scholarships and other facilities, which helped me to
conduct my research.
Throughout my doctoral study I have been fortunate to work with a number of talented
colleagues in Morona Laboratory. I would like to thank Dr Elizabeth Tran for answering
many questions, for sharing your knowledge on Shigella, and expertise on laboratory
techniques. I am thankful to Dr Stephen Attridge, Dr Alistair Standish, Matthew Doyle,
Jonathan Whittall, and Brad Qin for their help in numerous ways during my doctoral study. I
would also like to thank past and present members of Paton, Mcdevitt, and Kidd laboratories
for their support and making it such a great place to work.
I would like to take the opportunity to express my gratitude to all the teachers who
guided me from my primary school to the Masters degree and prepared me for this doctoral
study, especially Ms Mukti Basu, Mr. Rajen Mandal, Mr Amit Kumar Ghosh, Mr. Satipoti
Moitra, Dr Sharmila Chakraborty, Dr Saroj Kanti Das, and Dr Prajna Mandal. Their guidance,
care, and enthusiastic discussion helped me to pursue a research career.
I am grateful to all my friends from my childhood to now for their love, support, and
6.2 Residues important for polymerisation function of WzySf ........................................... 187
6.3 Purification of WzySf ..................................................................................................... 188
6.4 Understanding the association of the Oag biosynthesis proteins .................................. 190
Contents
!
xv
6.5 Mechanism of the association of Wzz and Wzy during the O antigen polymerisation in
S. flexneri ............................................................................................................................ 192
6.6 Conclusion and future work .......................................................................................... 195
Bibliography…………………………………………………………………... 197
Contents
!
xvi
List of Figures
Figure 1.1 S. flexneri pathogenesis ............................................................................................. 5!Figure 1.2 LPS structural types ................................................................................................ 11!Figure 1.3 S. flexneri Lipid A structure .................................................................................... 12!Figure 1.4 S. flexneri 2a core .................................................................................................... 14!Figure 1.5 Chemical composition of the Oag of different S. flexneri serotypes ...................... 16!Figure 1.6 Synthesis of R3 type LPS core sugar ...................................................................... 25!Figure 1.7 Organisation of S. flexneri Oag biosynthesis genes ................................................ 27!Figure 1.8 S. flexneri Y serotype Oag biosynthesis .................................................................. 28!Figure 1.9 S. flexneri Wzy (WzySf) .......................................................................................... 31!Figure 1.10 S. flexneri modal chain length ............................................................................... 35!Figure 3.1 Complementation of wzySf deficiency by WzySf-GFP ............................................. 88!Figure 3.2 Locations of mutations on the topology map of WzySf ........................................... 90!Figure 3.3 LPS phenotypes conferred by different WzySf mutants expressed in PNRM6
[!wzySf (pAC/pBADT7-1)] ....................................................................................................... 94!Figure 3.4 Comparison of the LPS phenotypes conferred by the WzySf mutants expressed in
the !wzy and !wzy !wzz backgrounds ..................................................................................... 95!Figure 3.5 Protein expression levels of the mutated WzySf-GFP compared to the positive
control ....................................................................................................................................... 99
Figure 4.2 Comparison of the LPS phenotype conferred by the WzySf mutants expressed in the
"wzy and "wzy "wzz backgrounds ......................................................................................... 132!Figure 4.3 Protein expression level of the WzySf-GFP mutants ............................................. 141!Figure 5.1 Purification of Wzy-GFP-His8 .............................................................................. 165!Figure 5.2 In vivo cross-linking with DSP .............................................................................. 167!Figure 5.3 Analysis of protein bands by MS .......................................................................... 170!Figure 5.4 Chemical cross-linking of WzySf mutants ............................................................. 174!Figure 5.S1 Topology map of WzySf ...................................................................................... 178
Figure 5.S2 Optimisation of the whole membrane solubilisation………………………….. 180
Figure 6.1 “Activation and inactivation” mechanism ............................................................. 194!
Contents
!
xviii
List of Tables
Table 1.1 Antigenic determinants of various S. flexneri serotypes .......................................... 18!Table 1.2 Overview of the chapters in this PhD thesis ............................................................. 41!Table. 2.1 Bacterial strains used in this study ........................................................................ 45!Table 2.2 Plasmids used in this study ...................................................................................... 50!Table 2.3 Differenet primers made in this study ...................................................................... 56!Table 3.1 Bacterial strains and plasmids used in this study ..................................................... 78!Table 3.2 ColE2 and bacteriophage Sf6c sensitivities and WzySf-GFP expression of controls
and different classes of mutants ................................................................................................ 91
Table 3.S1 Different primers made in this study…………………………………………....106
Table 3.S2 Colicin E2 (ColE2) sensitivity (performed by swab assay) of different WzySf
mutants during screening……………………………………………………………………107
Table 3.S3 Nucleotide base change in the WzySf mutants………………………………….108
Table 3.S4 Verifications of WzySf topological model using topological prediction
programs…………………………………………………………………………………….109
Table 4.1 Bacterial strains and plasmids used in this study ................................................... 126!Table 4.2 LPS profiles of different WzySf mutant phenotypic classes ................................... 134!Table 4.3 ColE2 and bacteriophage Sf6c sensitivities, and WzySf-GFP expression levels .... 137
Table 4.S1 Primers used in this study……………………………………………………….149
Table 4.S2 Periplasmic loop (PL)3 and PL5 of WzySf……………………………………...151
Table 5.1 Bacterial strains and plasmids used in this study ................................................... 160!Table 5.2 Detected peptides by MS analysis .......................................................................... 172!Table 6.1 Comparison of WzySf and WzyPa ............................................................................ 189!Table 6.2 LPS profiles of the Wzz-dependent WzySf mutants in the presence and absence of
has the R3 type of LPS core (Kubler-Kielb et al., 2010) (Fig. 1.4).
1.6.1.3 O antigen (Oag)
Oag is the most variable domain of the Gram-negative bacterial LPS (Yethon & Whitfield,
2001). The presence of Oag S-LPS restricts the accessibility of colicins to their OM receptors
(van der Ley et al., 1986). Oag also acts as the attachment site of the bacteriophages. Other
than the serotype conversion, bacteriophages use Oag as a receptor for adsorption and
infection of the host bacterium (Lindberg et al., 1978). Oag consists of oligosaccharide RUs.
Differences in the sugar contents, linkage between sugar units, and number of sugar units
make this domain highly variable (Liu et al., 2008; Wang et al., 2010a). The Gram-negative
bacterial species are subdivided into various serotypes depending on the differences in the
composition of LPS-Oag (Wang et al., 2010a). So far, there are 19 known serotypes [1a, 1b,
1c (or 7a), 1d, 2a, 2b, 3a, 3b, 4a, 4av, 4b, 5a, 5b, 6, 7b, X, Xv, Y, and Yv] of S. flexneri
Introduction
14
Figure 1.4 S. flexneri 2a core The core region is composed of Kdo, Hep, Glc, Gal, and GlcNAc. The inner core is composed
of Kdo + 3Hep and the outer core is composed of Glc, Gal, and GlcNAc. Outer core is
attached to the Oag RU. Oag chain is attached to the O-4 of Glc. n = number of Oag RU.
Figure adapted from Kondakova et al. (2010).
Introduction
15
(Jakhetia et al., 2014; Sun et al., 2013a; Sun et al., 2014). Except the S. flexneri serotype 6,
the Oag of all other serotypes has the same polysaccharide backbone containing three L-
rhamnoses (Rha), and one GlcNAc (Fig. 1.5). This basic Oag structure is known as serotype
Y. In serotype Y, the Rha residues are linked by # linkage, and Rha and GlcNAc residues are
linked by " linkage [!2)-#-L-RhaIII-(1!2)-#-L-RhaII-(1!3)-#-L-RhaI-(1!3)-"-D-
GlcNAc(1!]. Addition of either glucosyl, O-acetyl, or phosphoethanolamine (PEtN) groups
by various linkages to the sugars within the tetrasaccharide repeats of serotype Y creates
different serotypes of S. flexneri (Adams et al., 2001; Allison & Verma, 2000; Jakhetia et al.,
2014; Sun et al., 2013b) (Fig. 1.5).
The genes responsible for the Oag glucosylation [gtrA, gtrB, and gtr (type)] are
arranged in a single operon (gtr cluster). Among them gtrA and gtrB are conserved, however,
gtr (type) is unique and the encoded glucosyltransferase attaches the glucosyl group to the
specific sugar in the tetrasaccharide RU (Adams et al., 2001; Adhikari et al., 1999; Allison &
Verma, 2000; Allison et al., 2002; Guan et al., 1999; Mavris et al., 1997; Stagg et al., 2009).
Presence of the oac gene for O-acetyl transferase resulted in the O-acetylation of Oag (Clark
et al., 1991; Verma et al., 1991). There is an association between bacteriophages and serotype
conversion in S. flexneri. Seven bacteriophages or prophages encode the genes known so far
for Oag modifications, among them six (SfI, SfIC, SfII, SfIV, SfV, and SfX) encode gtr gene
cluster and one (Sf6) encodes oac gene. These genes are integrated into the conserved sites of
the S. flexneri genome (Adams et al., 2001; Adhikari et al., 1999; Allison et al., 2002;
Casjens et al., 2004; Clark et al., 1991; Guan et al., 1999; Mavris et al., 1997; Stagg et al.,
2009). Glucosylation can occur on any of the residues of the basic tetrasaccharide RU but oac
mediated O-acetylation occurs at position 2 of Rha I (Jakhetia et al., 2014). Although the
glucosylation and O-acetylation are phage encoded, the PEtN modification at position 3 of
Rha II and/or Rha III is encoded by the plasmid borne opt gene (Jakhetia et al., 2014).
For S. flexneri serotypes 1b, 3a, 3b, 3c, 4b, and 7b the O-acetylation site is position 2
of Rha I (Perepelov et al., 2012). However, a new O-acetylation site have been reported:
position 3 (major) and 4 (minor) of Rha III (3/4-O-acetylation) in serotypes 1a, 1b, 2a, 5a, Y,
6 and 6a, and at position 6 of GlcNAc in serotypes 2a, 3a, and Y. The degree of 3/4-O-
Introduction
16
Figure 1.5 Chemical composition of the Oag of different S. flexneri serotypes Serotype Y has the basic Oag, consisting of repeated tetrasaccharide units of !2)-#-L-RhaIII-
(1!2)-#-L-RhaII-(1!3)-#-L-RhaI-(1!3)-"-D-GlcNAc(1!. Addition of either glucosyl, O-
acetyl, or phosphoethanolamine groups to the sugar residues within the tetrasaccharide RU via
the indicated linkages generate different serotypes. Figure adapted from (Allison & Verma,
2000; Sun et al., 2012; Sun et al., 2014).
Introduction
17
acetylation varies between the ranges 30-70% at position 3 and 15-30% at position 4 within
the strains of one serotype (Jakhetia et al., 2014; Perepelov et al., 2012). According to recent
study S. flexneri 3/4-O-acetylation is mediated by the oacB gene carried by a transposon-like
structure located upstream of the adrA gene on the chromosome (Wang et al., 2014). The
temperate bacteriophages SfII, Sf6, SfV, and SfX convert the basic serotype Y to serotypes
2a, 3b, 5a, and X, respectively (Allison & Verma, 2000). Lysogenic bacteriophage SfII adds a
glucose residue to the Rha III residue of the tetrasaccharide RU of S. flexneri Oag and confers
serotype II Oag modification (Mavris et al., 1997). Recently, a new bacteriophage Sf101 was
isolated from serotype 7a. It contains the oac gene and responsible for the O-acetyl
modification in serotype 7a (Jakhetia et al., 2014). Serotype converting temparate
bacteriophage SfV adds a glucosyl group to Rha II of the tetrasaccharide RU by an # 1,3
linkage (Allison et al., 2002). A newly emerged and most prevalent serotype in China is
serotype Xv. For serotype Xv the Oag modification occurs by the addition of PEtN group at
position 3 of one of the Rha residues (Sun et al., 2012) (Fig. 1.5). PEtN modification is also
present in 4av, a serotype 4a variant; and Yv, a serotype Y variant. In these serotypes a PEtN
residue is added mainly to Rha III and Rha II, respectively (Sun et al., 2013a).
The antigenic structure of S. flexneri is simple. S. flexneri possesses somatic Oags and
certain varieties possess K antigen. Determination of S. flexneri group is done by
agglutination with polyvalent serum and the type diagnosis is performed by a monospecific
serum obtained after absorption of the group agglutinins. Certain varieties of S. flexneri
serotype 6 are O-inagglutinable as they have K antigen (Bergey & Breed, 1957). The basic
Oag structure serotype Y is characterised by a single group 3,4 antigenic determinant. Oag
glucosylation and/or O-acetylation result in different type [I, II, III, IV, V, IC (or VIII)] and
group (3,4; 6; 7,8) antigenic determinants (Sun et al., 2012; Sun et al., 2013a) (Table 1.1).
Group 6 antigenic determinant is present in serotypes 3a, 3b, 1b, 4b, and 7b and they are
characterised by the presence of O-acetylation on Rha I. Type I, IC (or VII), II, IV, V; and
group 7,8 determinants are associated with Oag glucosylation (Sun et al., 2012; Sun et al.,
2013a). Serotypes X and Y lack type antigens but group antigens are 7,8; and 3,4;
respectively (Simmons & Romanowska, 1987). Serotype Xv can agglutinate with both MASF
IV-I and 7,8 monoclonal antibodies (Sun et al., 2012).
Introduction
18
Table 1.1 Antigenic determinants of various S. flexneri serotypes
Serotypes Type antigen Group antigen
1a I 4
1b I 6 1c (7a) - MASF 1c
1d I 7,8 2a II 3,4
2b II 7,8 3a III 6,7,8
3b III 6,3,4 4a IV 3,4
4av IV 3,4 4b IV 6
5a V 3,4 5b V 7,8
6 VI 2,4 7b - 6
X - 7,8 Xv IV 7,8
Y - 3,4 Yv IV 3,4
Introduction
19
1.6.2 LPS as a virulence factor
LPS is the immunodominant surface antigen of S. flexneri. As a surface structure it interacts
with the host and the host defense systems recognise bacteria by the elicited immune
responses to their LPS. However, inside the host LPS causes a variety of non-specific
pathological reactions, known as endotoxic reactions (Lindberg et al., 1991). The LPS
morphology of S. flexneri has a critical role in the virulence property of the bacteria (Hong &
Payne, 1997; Van den Bosch et al., 1997). An assay to measure the ability of Shigella to
invade epithelial cells, spread intercellularly, and evoke inflammatory responses is known as
the Serény test (Sereny, 1957) and previous studies showed that S. flexneri with R-LPS were
avirulent in Serény test. Strains with R-LPS could invade the tissue-culture cells but were
unable to spread intercellularly (Okamura & Nakaya, 1977; Okamura et al., 1983). S. flexenri
strains with R-LPS were also deficient in plaque formation in tissue culture monolayer, with
very small or no plaques being observed (Hong & Payne, 1997; Sandlin et al., 1995; Van den
Bosch et al., 1997; Van den Bosch & Morona, 2003).
S-LPS with very long Oag chains gives S. flexneri protection against serum killing
(Hong & Payne, 1997). LPS also plays a role in the physiological relationship between host
and the bacteria. B cells differentiate, proliferate, and secrete immunoglobulins due to the
polyclonal activation by LPS. LPS activates macrophages which enhances cytotoxicity and
phagocytosis (Lindberg et al., 1991).
A number of genes involved in the synthesis of LPS were found important for the
virulence property of Shigella spp. (Okada et al., 1991a; Okada et al., 1991b). Several studies
through mutagenesis of genes involved in the LPS biosynthesis (galU, rfe, rfb, rmlD, wecA,
wzy, and wzz) showed that the S-LPS is essential for IcsA dependent ABM and cell-to-cell
spreading (Hong & Payne, 1997; Rajakumar et al., 1994; Sandlin et al., 1995; Van den Bosch
et al., 1997; Van den Bosch & Morona, 2003). In Shigella S-LPS strains, IcsA is unipolar
however, in R-LPS strains the unipolarity is lost and IcsA can be detected over the entire
bacterial surface (Robbins et al., 2001; Van den Bosch et al., 1997). There are two proposed
hypotheses for this loss of polarity in R-LPS strains. Robbins et al. (2001) proposed that the
biophysical properties of the OM can be altered due to the mutation in the LPS biosynthesis
genes of R-LPS strains, resulting in the increased migration of IcsA from pole to the non-
Introduction
20
polar sites (Robbins et al., 2001). However, according to the other hypothesis, presence of
LPS Oags masks IcsA expression in the non-polar regions and mutants lacking Oag alter
detection of IcsA at non-polar regions in addition to the pole (Morona & Van Den Bosch,
2003a; Morona & Van Den Bosch, 2003b). Although the loss of unipolarity of IcsA is
considered the cause behind the impaired ABM but the overexpression of IcsA in the S-LPS
strains resulted in circumferential localisation of IcsA similar to the R-LPS strains and ABM
was undisturbed (Van den Bosch & Morona, 2003). Hence, LPS Oag may have other critical
roles in S. flexneri cell to cell spreading.
Lipid A is the bioactive component of LPS and the activator of the innate immune
response in host. Several previous studies suggested that the changes in lipid A acylation
effect the virulence property of the bacteria by influencing protein secretion of TTSS, cell
division, and OM function (Clements et al., 2007; Murray et al., 2001; Post et al., 2003;
Ranallo et al., 2010; Somerville et al., 1999; Watson et al., 2000). D’Hauteville et al. (2002)
investigated the effect of genetic detoxification of lipid A on the S. flexneri pathogenicity. S.
flexneri has two types of msbB genes: one chromosomal (msbB1) and another on the VP
(msbB2); both encode myristoyl transferase. They showed that in S. flexneri, lacking both the
msbB genes had reduced lipid A acylation degree, and caused reduced TNF# production and
epithelial lining inflammatory destruction of a rabbit model (D'Hauteville et al., 2002).
Ranallo et al. (2010) performed an extensive study to analyse the virulence property and
inflammatory potential of the S. flexneri 2a lacking both msbB genes and producing
underacylated lipid A. Attenuation of msbB mutants in an acute mouse pulmonary challenge
model correlated with decreases in proinflammatory cytokine production and in chemokine
release without noticeable changes in lung histopathology. After infection of mouse
macrophages with either single or double msbB mutants, production levels of IL-1", MIP-1#,
and TNF-# were also significantly reduced. The msbB double mutant showed defects in the
invasion and replication ability, and spreading within the epithelial cells. They also performed
a vaccination-challenge study in a mouse lung model and found that in msbB-immunised mice
both humoral and cellular responses were significantly strong (Ranallo et al., 2010). Paciello
et al. (2013) reported that Shigella has the ability to modify the composition of the lipid A and
core sugar domains, during proliferation within epithelial cells. They showed that the lipid A
Introduction
21
of the LPS of intracellular bacteria is hypoacylated compared to the LPS of the bacteria grown
in laboratory medium and the immunopotential of intracellular bacterial LPS is dramatically
lower than that of the LPS of the bacteria grown in laboratory medium (Paciello et al., 2013).
Rossi et al. (2014) produced generalised modules for membrane antigens (GMMA) from
Shigella. GMMA is produced from the OM and mainly contains LPS. To reduce the
reactogenicity of GMMA they modified the Lipid A by deleting the msbB genes. GMMA
with penta-acylated Lipid A from the msbB mutant strains had 600 fold reduced activity
however, GMMA with hexa-acylated Lipid A resulted by lipid A palmitoleoylation had ~10
fold higher activity to stimulate peripheral blood mononuclear cells (Rossi et al., 2014).
S. flexneri waaJ, waaD, and waaL mutant strains are unable to synthesise inner core or
are deficient in ligating Oag to the outer core, were attenuated and failed to resist killing by
antimicrobial peptides expressed in the GI tract (Cunliffe & Mahida, 2004; West et al., 2005).
The rfbA mutant deficient in converting glucose-1-phosphate to deoxythymidine diphosphate
rhamnose (dTDP-Rha) a required step for Oag biosynthesis and the cld mutant having
truncated Oag were also attenuated (West et al., 2005). gtrV gene encodes glucosyltransferase
which adds glucose to the Oag (Guan et al., 1999). West et al. (2005) reported that Shigella
strains with gtrV deletion mutation were unable to survive in the GI tract. Their work also
suggested that LPS glucosylation allows the bacteria to survive in vivo. The gtr mutants were
unable to avoid innate immune killing but the non-invasive S. flexneri with gtr mutation,
which lacks TTSS, did not show any survival disadvantage. Hence, the effect of gtr deletion
only results after invasion into the mucosa (West et al., 2005). Shigella strains with increased
Oag glucosylation has increased ability to invade epithelial cells however, the gtr mutant
strains has decreased ability of epithelial invasion compared to the WT. LPS glucosylation
affects the TTSS function which determines cell invasion (West et al., 2005).
Following Shigella WT infection and experimental challenge strong mucosal secretory
IgA anti-Oag antibody responses are observed (Levine et al., 2007). The Oag of the LPS is
the protective antigen. After S. flexneri infection the host immune response is directed against
the Oag and the immune response is serotype specific correlated with the stimulation of local
humoral and intestinal immunity against somatic antigens. The serotype specific infection
provides protection against further infection with the same serotype (Allison & Verma, 2000;
Introduction
22
Brahmbhatt et al., 1992; Formal et al., 1991; Guan & Verma, 1998; Hale & Keren, 1992;
Lindberg & Pal, 1993). In an animal experiment conducted by Formal et al. (1991), virulent S.
flexneri 2a strain was used to infect Rhesus monkeys and later the infected monkeys were
rechallenged with either S. sonnei or S. flexneri 2a strains. Monkeys rechallenged with S.
sonnei suffered disease similar to the controls, however, monkeys rechallenged with
homologous S. flexneri 2a got full protection (Formal et al., 1991). In humans, it was also
found that pre-existing serotype-specific serum antibodies against the Shigella Oag is
correlated with the resistance to homologous shigellosis (Cohen et al., 1988).
1.7 LPS biosynthesis and export
In E. coli, Shigella, and Salmonella LPS biosynthesis and export are dependent on the
products of approximately 50 genes (Schnaitman & Klena, 1993). LPS biosynthesis occurs
mainly by two separate pathways: lipid A plus core biosynthesis and Oag biosynthesis. Other
than the membrane bound enzymes for glycerophospholipids synthesis, the enzymes required
for the early stage of lipid A biosynthesis are cytoplasmic or present in the cytoplasmic
membrane (Anderson et al., 1993). In the cytoplasm after synthesis of the lipid A, the core
oligosaccharides are assembled on the lipid A. At the cytoplasmic face of the IM the Oag RUs
are assembled on Und-PP (Marino et al., 1991; Mulford & Osborn, 1983). The lipd A-core
and Oag RUs are then transported from the cytoplasmic side to the periplasmic side. The
Und-PP linked Oag RUs are polymerised into Oag chains on the periplasmic face of the
cytoplasmic membrane. The Und-P is recycled. The lipid A-core and Oag chains are ligated
Stevenson et al., 1994; Wyckoff et al., 1998). The following steps of Lipid A biosynthesis are
mediated by the enzymes LpxC and LpxD. LpxC deacetylates the O-acetylated UDP-GlcNAc
and LpxD performs the second deacetylation. LpxD transfers a second acyl group from R-3-
hydroxymyristoyl-ACP to O-acetylated UDP-GlcNAc and forms UDP-2,3-diacylglucosamine
(Crowell et al., 1987; Raetz et al., 2007). UDP-2,3-diacylglucosamine is the immediate
precursor of non-reducing sugar of Lipid A. Some of the UDP-2,3-diacylglucosamine is
cleaved at the phosphate bond by LpxH to generate diacylglucosamine-1-phosphate or Lipid
X (Anderson et al., 1985; Raetz et al., 2007). It is the direct precursor of the reducing sugar of
Lipid A. LpxB mediates the condensation of another molecule of UDP-2,3-diacylglucosamine
with Lipid X to form the disaccharide and releases UDP. Phosphorylation of the disaccharide
formed by LpxB generates Lipid IVA (Raetz & Whitfield, 2002). In S. flexneri two Kdo
residues are then transferred by a bifunctional transferase to form keto-doxy-octonate 2 lipid
A (D'Hauteville et al., 2002). At the final steps of S. flexneri Lipid A synthesis 12-carbon
fatty acid laurate and the 14-carbon fatty acid myristate are acyl-oxyacyl-linked to two of the
four 3-OH-myristic acids available on keto-doxy-octonate 2 lipid A. htrB encodes the
transferase (LpxL or HtrB) that catalyses the acyl-oxyacyl linkage of laurate to the 3’
hydroxymyristate that is itself linked to the 2’ position of the glucosamine and msbB encodes
the transferase MsbB (LpxM) that catalyses the acyl-oxyacyl linkage of myristate on the
hydroxy-myristate that is itself linked to the 3’ position of the glucosamine disaccharide
(D'Hauteville et al., 2002; Goldman et al., 2008).
Introduction
24
Genes of the chromosomal waa locus including waaF, waaC, waaL, waaD, waaJ,
waaY, waaI, waaP, waaG, waaQ, and waaA encodes the proteins for E. coli R3 type core
sugar synthesis (Kaniuk et al., 2004) (Fig. 1.6). The product of the waaA, WaaA catalyses the
synthesis of inner core. It transfers the first two Kdo residues of the core. (Kaniuk et al., 2004;
Sirisena et al., 1994; Vimont et al., 1997). WaaC and WaaF are the first and second
heptosyltransferases. Inner core assembly phosphate transferases are WaaP and WaaY. WaaP
trasfers phosphate to heptose I and WaaY to heptose II. WaaQ transfers heptose III to heptose
II (Kaniuk et al., 2004; Muhlradt, 1969; Sirisena et al., 1992; Yethon et al., 1998). Initially
WaaG, an UDP-glucosyl transferase, attaches the first Glc to heptose II, WaaI attaches a Gal
unit to the first Glc, and then WaaJ adds a second Glc to the Gal (Heinrichs et al., 1998;
Kaniuk et al., 2004). WaaD an #-1,2-glucosyltransferase responsible for addition of the
terminal glucose side branch (Kaniuk et al., 2004).
1.7.2 O antigen biosynthesis
The Oag synthesis genes are generally found in a single cluster, named Oag gene cluster.
Three main types of genes are found in this Oag gene cluster: nucleotide sugar synthesis,
sugar transferase, and O unit processing genes. The location of these genes within a species is
conserved (Wang et al., 2010a). Oag assembly and processing are performed by three
different pathways: Wzx/Wzy, ABC transporter, and Synthetase pathway. Among these three
pathways, the Wzx/Wzy pathway synthesises most Oags (Liu et al., 1996; Raetz & Whitfield,
2002; Wang et al., 2010a).
For all the three pathways, initially a sugar phosphate is transferred from an NDP-
sugar to Und-P at the cytoplasmic side of the IM. In the Wzx/Wzy pathway,
glycosyltransferases sequentially add sugar residues to the first sugar at the cytoplasmic side
of the IM to form the O unit. The flippase protein Wzx translocates this O unit to the
periplasmic side. At the periplasmic side the O units are polymerised at the non-reducing end
by Wzy via a block transfer mechanism to form the polymer. The chain length of the final
Oag is regulated by the protein Wzz (Wang et al., 2010a; Whitfield, 2006; Woodward et al.,
2010).
Introduction
25
Figure 1.6 Synthesis of R3 type LPS core sugar S. flexneri has R3 type LPS core sugar. The known enzymes responsible for the synthesis of
R3 core sugar are shown. Enzymes WaaA, WaaC, WaaF, WaaY, WaaQ, WaaP, and WabB
synthesise inner core region; and WaaG, WaaI, WaaJ, and WaaD are responsible for the
synthesis of outer core region (Kaniuk et al., 2004).
Introduction
26
S. flexneri follows the Wzy-dependent pathway for Oag biosynthesis. In S. flexneri
most of the Oag biosynthesis genes (except wecA) are located in the Oag biosynthesis locus
between galF and his (previously known as rfb locus) (Allison & Verma, 2000; Morona et al.,
1995) (Fig. 1.7) and the coding region for Oag biosynthesis genes is ~11 kb (Macpherson et
al., 1991). Initially, GlcNAc-phosphate (GlcNAc-1-P) is transferred from an UDP-GlcNAc to
undecaprenol phosphate (Und-P) at the cytoplasmic side of the IM by WecA. Then the
rhamnosyl transferases RfbG and RfbF add Rha residues from dTDP-Rha to the GlcNAc
(Macpherson et al., 1994; Morona et al., 1994) to form the O unit. Then rest of the proteins of
the Wzx/Wzy pathway (Wzx, Wzy, Wzz, and WaaL) complete the Oag biosynthesis (Fig.
1.8).
In the ABC transporter pathway the complete Oag chain is synthesised on the
cytoplasmic side of the IM, and the ABC transporter proteins Wzm and Wzt translocate the
Oag chain. This pathway has been described for the Oags of Klebsiella pneumoniae, Vibrio
cholerae, Yersinia enterocolitica, A-band Oag of Pseudomonas. aeruginosa, and also for the
Oags of E. coli O8, O9, O9a, O52, and O99 (Wang et al., 2010a). The Synthetase pathway is
very rare with S. enterica O54 the only known case for Oag synthesis by Synthetase pathway.
A single integral protein performs the whole Oag synthesis process and the Oag chain is
homopolymers or having two sugars (Raetz & Whitfield, 2002; Wang et al., 2010a). For all of
the three pathways, Oag ligase WaaL then ligates the Oag chains to the core-lipid A. The
complete LPS is then translocated to the OM of the bacterial cell (Whitfield & Trent, 2014).
1.7.3 LPS export
The first step of LPS export is the flipping of the LPS across the IM. The ABC transporter IM
protein MsbA translocates the R-LPS (lipid A-core) across the IM. In Oag producing strains,
the Oag is then ligated to the lipid A-core by WaaL ligase. The Lpt (LPS transport) proteins
(LptA-G) transport the LPS from the IM to the cell surface (Chng et al., 2010; Ruiz et al.,
2009; Sperandeo et al., 2009).
Introduction
27
Figure 1.7 Organisation of S. flexneri Oag biosynthesis genes S. flexneri Oag biosynthesis genes (except wecA) are located in the Oag biosynthesis locus
between galF and his. The direction of transcription is indicated by horizontal red arrows.
Figure adapted from Morona et al. (1995).
Introduction
28
Figure 1.8 S. flexneri Y serotype Oag biosynthesis S. flexneri Oag biosynthesis occurs on either side of the IM. Initially, GlcNAc-1-P is
transferred from an UDP-GlcNAc to Und-P at the cytoplasmic side of the IM by WecA. Then
the rhamnosyl transferases add Rha residues to the GlcNAc to form the O unit. Wzx
translocates this O unit to the periplasmic side. At the periplasmic side the O units are
polymerised by Wzy and the chain length of the final Oag is regulated by the protein Wzz.
WaaL then ligates the Oag chains to the core-lipid A.
Introduction
29
Recent structural studies have disclosed the molecular mechanism of LPS transport of
the Gram-negative bacteria (Bishop, 2014; Dong et al., 2014; Qiao et al., 2014). ABC
transporter complex made of LptF, LptG, and LptB separates the LPS from the external
leaflet of the IM and takes the LPS through a filament (made of LptA and LptC) which
connects IM and OM. Then the LPS is delivered to a complex made of LptD and LptE in the
OM and this complex inserts the LPS into the outer leaflet of the OM. The X-ray crystal
structure of the LptD and LPtE complex from S. flexneri and Salmonella typhimurium showed
that LptD is made of "-strands that fold into two domains: a "-jellyroll and a "-barrel. The "-
jellyroll is away from the OM and contains a greasy groove that is able to bind Lipid A
leaving the core and Oag chain exposed. A similar "-jellyroll fold was found for LptA and
LptC. These proteins interconnect and combine the greasy "-jellyroll fold to make a passage
through the space between IM and OM. LptD forms a 26 stranded "-barrel in which the LptE
forms a roll-like structure. The hydrophilic sugar chains (core and Oag) pass through the
barrel and the Lipid A inserts into the external leaflet of the OM through a lateral opening of
the LptD between "1 and "26 (Bishop, 2014; Dong et al., 2014; Qiao et al., 2014; Whitfield
& Trent, 2014).
1.8 Oag polymerisation protein Wzy
The evidence of Oag polymerisation occurring in the periplasm was detected by McGrath and
Osborn (1991) by pulse-chase experiments using doubly conditional mutants. The Wzy-
dependent pathway is one of the most widely distributed polysaccharide biosynthesis pathway
in the nature. In Wzy homologues, there are 4-5 periplasmic loops (PLs), the larger PLs are on
the periplasmic side, and the number of transmembrane segments (TMs) vary from 10-14
(Daniels et al., 1998; Islam et al., 2010; Kim et al., 2010; Marczak et al., 2013; Mazur et al.,
2003; Zhao et al., 2014). So far there is no known X-ray crystal structure for Wzy
homologues and topology models only exist for Wzy proteins of S. flexneri (Daniels et al.,
1998), Pseudomonas aeruginosa PAO1 (Islam et al., 2010); and PssT (Wzy homologue) of
Rhizobium leguminosarum bv. trifolii strain TA1 (Mazur et al., 2003).
Introduction
30
1.8.1 S. flexneri Wzy (WzySf)
The Oag polymerisation protein Wzy is encoded by the rfc/wzy gene (Macpherson et al.,
1991) (Fig. 1.7); and Morona et al. (1994) for the first time characterised S. flexneri wzy gene
(wzySf) which spans a ~2 kb region. The wzy open reading frame is located downstream of
Oag gene cluster. WT wzySf lacks detectable ribosome binding site and has four rare codons
(at positions 4, 9, 22, and 23) in the translation initiation site. The wzySf coding region has a
low G+C % and has high percentage of minor codons in the first 25 amino acids. S. flexneri
Wzy protein (WzySf) is a 43.7 kDa hydrophobic integral membrane protein (Daniels et al.,
1998; Morona et al., 1994). Daniels et al. (1998) for the first time was able to express and
visualise WzySf, and they showed by western immunoblotting using anti::PhoA serum that
WzySf::PhoA fusion protein was able to form a dimer. Based on the topological model
proposed by Daniels et al. (1998), WzySf has 12 TMs, two large PLs - PL3 and PL5; and the
amino and carboxy terminal ends are located on the cytoplasmic side of the IM (Fig. 1.9).
wzySf mutants produce SR-LPS (Morona et al., 1994). They are avirulent in Serény test and
unable to produce plaque on tissue culture cells, and have IcsA distributed over the entire cell
surface (Sandlin et al., 1996).
1.8.2 Wzy proteins of different bacterial species
Wzy proteins have extremely low detectability in cells (Abeyrathne & Lam, 2007; Collins &
Hackett, 1991). Optimising conditions for overexpression and purification of Wzy is a
laborious and time-consuming process due to the hydrophobic and transmembrane nature of
the protein, presence of rare codons in the 5’ regions, and weak ribosomal binding site (Kim
et al., 2010; Wong et al., 1999). So far, limited work has been conducted on biochemical and
functional characterisation of Wzy proteins of different bacterial species. Kim et al. (2010)
performed site-directed mutagenesis on the Francisella tularensis LVS wzy (wzyFt) and found
that modifications of the residues G176, D177, G323, and Y324 resulted in loss of Oag
Introduction
31
Figure 1.9 S. flexneri Wzy (WzySf)
WzySf is an integral membrane protein. It has 12 TMs and two large PLs (PL3 and PL5). The
positions of the PLs (PL1-6) and TMs (TM1-12), and cytoplasmic loops (CL) (CL1-5) are
indicated. WzySf topology map is adapted from Daniels et al. (1998).
Introduction
32
polymerisation by F. tularensis Wzy (WzyFt). Comparing amino acid sequences and predicted
theoretical topology models by TMHMM server of the Oag polymerase of different bacterial
species, and the previously determined Shigella flexneri topology model by Daniels et al.
(1998), they found that these amino acids are in close proximity on the bacterial surface (Kim
et al., 2010). Woodward et al. (2010) for the first time were able to purify a Wzy protein,
from E. coli O86 (WzyEc), and suggested that WzyEc may form dimers. They also established
an in vitro Oag polymerisation system using the purified WzyEc (Woodward et al., 2010).
Extensive work on Pseudomonas aeruginosa PAO1 Wzy (WzyPa) was performed by
Islam et al. (Islam et al., 2010; Islam et al., 2011; Islam et al., 2013). They found that PL3
and PL5 of WzyPa contain RX10G motifs and also identified sequence conservation between
PL3 and PL5 of WzyPa. Site-directed mutagenesis on the Arg residues within these two
RX10G motifs showed that these Arg residues are important for WzyPa function. They found
that at physiological pH PL3 possesses a net positive charge (pI 8.59) and PL5 possesses a net
negative charge (pI 5.49). From these findings they proposed a “catch-and-release”
mechanism of Oag polymerisation by Wzy. According to this model PL3 acts as a “capture
arm” and catches incoming negatively charged Oag subunit for subsequent transfer to PL5,
which acts as a “retention arm” and involves relatively transient interaction with the Oag. PL5
is associated with constant binding and release of the growing Oag (Islam et al., 2011). They
claimed a widespread presence of the “catch-and-release” mechanism by finding homologues
Wzy proteins to WzyPa in other bacteria using a “jackhammer” search. Interestingly, their
search was unable to find any Wzy homologues to WzyPa in Enterobacteriaceae (Islam et al.,
2013).
Zhao et al. (2014) showed that WzyEc works in a distributive manner where the
polymerisation product leaves the active site of WzyEc after each round of reaction. They
found that at physiological pH the major PLs (PL3 and PL4) of WzyEc are positively and
negatively charged (pI values 9.08 and 4.29, respectively). Hence, they proposed that WzyEc
also follows the catch-and-release mechanism. However, the number of TMs and amino acid
sequence of WzyEc are different from WzyPa (Zhao et al., 2014).
PssT protein in R. leguminosarum is the counterpart of the Gram-negative bacterial
Wzy. Mazur et al. (2003) predicted the topology model of PssT having 12 TM and a large PL
Introduction
33
between TM9 and 10. Initially, a RX10G motif was found in PssT between amino acids 350-
361 and then bioinformatics analysis identified two new RX10G motifs between amino acids
159-170 and 229-240. According to the previously predicted topology model these new
RX10G motifs are present in cytoplasmic loops (CL) 2 and 3 but studies of PssT-PhoA fusion
protein Ala-158 suggested translocation of these segment to the periplasm (Marczak et al.,
2013). Hence, Marczak et al. (2013) proposed that these motifs may have important role in
PssT polymerisation activity similar to WzyPa.
There is little knowledge about the substrate specificity and cross complementation of
different Wzy proteins. Studies showed that in Salmonella enterica A, B1, and D1 Wzy
proteins from different serogroups cross-complemented and produced relevant Oags (Makela,
1965; Nurminen et al., 1971; Valtonen et al., 1975) but were unable to produce Oag of
serogroup C2 (Naide et al., 1965). WzySf was also unable to replace WzyFt and synthesise
relevant Oag (Kim et al., 2012).
1.8.3 Comparison of WzySf with other Wzy proteins
There is very little sequence identity between wzy gene and Wzy proteins of different
bacterial species (Kim et al., 2010). The number of TMs in different Wzy proteins also varies:
WzyFt has 11 TMs (WzyFt topology model generated using TMHMM-2.0 and S. flexneri
topology model), WzyPa has 14 TMs, WzyEc has 10 TMs; however, WzySf and PssT have 12
TMs (Daniels et al., 1998; Islam et al., 2011; Kim et al., 2010; Mazur et al., 2003; Zhao et
al., 2014). WzyPa, WzyFt, and WzySf have two major PLs - PL3 and PL5 (Daniels et al., 1998;
Islam et al., 2011; Kim et al., 2010), WzyEc has two major PLs - PL3 and PL4 (Zhao et al.,
2014); however PssT has only one major PL between TM9 and TM10 (Mazur et al., 2003).
There is also a difference in the charged property of substrate of different Wzy proteins such
as, the Oag of P. aeruginosa is negatively charged (Knirel et al., 2006) but the Oag of WzySf
is neutral. WzySf is also very flexible about its substrate recruitment compared to other Wzy
proteins as polymerisation of Oags of all the serotypes of S. flexneri are performed by a single
type of WzySf.
Introduction
34
1.9 Oag chain length regulator Wzz
Bacterial cell surface polysaccharides are regulated by the members of a large family of
proteins known as polysaccharide co-polymerase (PCP) family, anchored in the IM. PCPs are
subdivided into three classes (PCP1, PCP2, and PCP3) based on different characteristics such
as their association with a Wzy-dependent or ATP-binding cassette (ABC) transporter-
dependent pathway, and by the presence or absence of an additional cytoplasmic domain
(Morona et al., 2000b; Morona et al., 2009; Purins et al., 2008; Tocilj et al., 2008). All the
PCPs share some common structural features: N-terminal and C-terminal transmembrane
helices (transmembrane helices 1 and 2) separated by a polypeptide segment (~130 to 400
amino acid residues) with a coiled-coil region located externally or in the periplasm, and a
proline or glycine rich motif adjacent to the C-terminal transmembrane helix (Tocilj et al.,
2008). PCP1 and PCP2 proteins are involved in the Wzy-dependent pathway; and PCP3
proteins are involved in ABC dependent capsular polysaccharide synthesis (Morona et al.,
2009).
1.9.1 S. flexneri Wzz
The modal length of the Oag chain is regulated by Wzz proteins, members of the PCP1 family
(Morona et al., 2000a). Initially, wzz was named as regulator of O-chain length (rol) or chain
length determinant (cld) (Bastin et al., 1993; Batchelor et al., 1991). S. flexneri 2a has S-LPS
with two types of modal chain length (Fig. 1.10), short (S) type (11-17 Oag RUs) and very
long (VL) type (>90 Oag RUs), and the S-type and VL-type Oag chain lengths are determined
by WzzSf and WzzpHS2, respectively (Morona et al., 2003; Van den Bosch & Morona, 2003).
Both WzzSf and WzzpHS2 are members of the PCP1 subclass (Morona et al., 2009). Wzz is
characterised by two transmembrane helices and a large PL that comprises more than 85% of
the protein. Special feature of the PL of Wzz is the coiled coil formed by three regions
Introduction
35
Figure 1.10 S. flexneri modal chain length LPS from 108 bacteria of S. flexneri 2a strain 2457T was electrophoresed on a 15% (w/v)
polyacrylamide gel and silver stained. The VL-type LPS and the S-type LPS are shown.
Figure adapted from May (2007).
Introduction
36
(Marolda et al., 2008; Morona et al., 2000b). The coiled coil feature is a bundle of #-helices
that wind to form a superhelix (Lupas, 1996; Marolda et al., 2008).
Daniels and Morona (1999) performed site-directed mutagenesis to understand the
functional importance of the conserved residues in the carboxy and amino terminal ends of
WzzSf and found that not only the carboxy and amino terminal ends, but the amino acid
residues of the entire length of WzzSf are important for the Oag modal chain length control by
WzzSf. They also showed that WzzSf forms a dimer in vivo and may oligomerise up to a
hexamer (Daniels & Morona, 1999). Marolda et al. (2008) performed mutagenesis in the
coiled coil region of WzzSf and found that mutagenesis in region I (amino acid 108-130)
resulted in partial defects on the Oag modal chain length, region II (amino acids 153-173)
resulted in elimination of WzzSf function, and region III (amino acids 209-233) had no effect
on the LPS Oag modal chain length. Mutations in the coiled coil region of WzzpHS2 also
resulted in loss of Oag modal chain length control (Purins et al., 2008). Papadopoulas and
Morona (2010) performed random in-frame linker mutagenesis on wzzSf and created five
different classes (I-V) of mutants with varied Oag modal chain length [inactive (I), shorter (II
and III), nearly wild type (IV), and increased (V)]. In vivo chemical cross-linking showed
that class V mutants formed high-molecular weight oligomers but classes II and III were
unable to cross-link. Mapping of the class V mutations on the three dimensional structures
located the mutations within the inner cavity of PCP oligomer. Hence, they concluded that
stable dimer formation may be important for Oag modal chain length control by WzzSf
(Papadopoulos & Morona, 2010). Tran and Morona (2013) performed single amino acid
substitution on E. coli FepE which is a PCP1a protein and confers very long Oag modal chain
length (>80 Oag RUs). Analysis of the LPS profiles conferred by FepE mutants and chemical
cross-linking properties of the mutant FepE oligomer suggested that FepE residues located
within the internal cavity of the FepE oligomer contribute to Oag modal chain length but not
the oligomeric state of the protein (Tran & Morona, 2013). However, study of chimeric
molecules by Kalynych et al. (2012b) suggested that differences in the modal chain length
depends on the surface exposed amino acid residues in specific regions of WzzSf rather than
the oligomeric state. Cross complementation and chimeric studies using wzz from
phylogenetically similar species: E. coli, Salmonella enterica, and S. flexneri showed that
inherent variability of different Wzz lies in the PLs (Daniels & Morona, 1999; Kalynych et
Introduction
37
al., 2011; Klee et al., 1997). Hence, the difference in chain length regulation by Wzz proteins
is dependent on the PLs. However, as mentioned before Daniels and Morona (1999) showed
that the entire WzzSf protein has role in Oag modal chain length regulation and recent studies
also showed that the TMs of Wzz are also important for modal chain length regulation (Islam
et al., 2013; Taylor et al., 2013).
Tran et al. (2014) analysed the colicin E2 (ColE2) sensitivity of all the classes of
WzzSf mutants generated by Papadopoulos and Morona (2010) and found that mutants with S-
type or long type (16-28 Oag RUs) modal chain lengths were more resistant to ColE2
compared to the mutants with intermediate S-type (8-14 Oag RUs), very S-type (2-8 Oag
RUs), and VL-type (>80 Oag RUs) Oag modal chain lengths. From this data they concluded
that the LPS Oag modal chain length control by WzzSf may be evolved due to selection
pressure from colicin in the environment (Tran et al., 2014).
1.9.2 Chain length and virulence
Oag is one of the virulence determinants of S. flexneri, however presence of Oag is not the
sole determinant of LPS for providing virulence but its modal chain length also plays a
critical role in the pathogenesis of the bacteria. S. flexneri wzz mutants are unable to either
form plaques on HeLa cell monolayer or form F-actin comet tails. Hence, WT Oag modality
is important for cell-to-cell spreading of S. flexneri (Morona et al., 2003). Studies showed that
S-type Oag modal chain is essential for the unipolar localisation of IcsA and efficient ABM
(Morona & Van Den Bosch, 2003a; Robbins et al., 2001; Sandlin et al., 1995). S. flexneri
strains with WzzpHS2 as the sole determinant of the Oag modal chain length and hence
producing VL-type Oag chain, are unable to form plaques on HeLa cell monolayer, having
reduced level of IcsA on cell surface, reduced virulence in Serény test, and reduced ability to
form F-actin comet tails (Van den Bosch et al., 1997). WzzSf and WzzpHS2 compete for the
available WzySf (Carter et al., 2009). Hong and Payne (1997) showed that WzzpHS2 is required
for resistance to serum killing however, WzzSf is required for invasion and intercellular spread
(Hong & Payne, 1997). Both WzzSf and WzzpHS2 are required for the optimal virulence
property of the bacteria.
Introduction
38
1.10 Association of the proteins of the Oag biosynthesis pathway
Understanding the association of the participant proteins of the Wzy-dependent Oag
biosynthesis pathway is important to understand the actual mechanism behind this
biosynthesis. For a long time several research group suggested the multi-protein complex
formation in the Wzy-dependent pathway (Marolda et al., 2006; Whitfield, 2006; Whitfield,
2010). There are several proposed mechanisms about these associations such as molecular-
clock model (Bastin et al., 1993) and molecular chaperone model (Morona et al., 1995).
According to the proposed molecular-clock model, Wzz acts as a molecular clock and
regulates Wzy activity between two states: the E, or extension, state favours polymerisation,
and the T, or transfer, state favours the ligation reaction (Bastin et al., 1993). The molecular-
chaperone model describes Wzz as a typical molecular chaperone that regulates the overall
ratio of Wzy and WaaL in a complex and controls the enzyme kinetics of the ligation reaction
to define the modality (Morona et al., 1995). Tocilj et al. (2008) suggested that Wzz may
form a scaffold that recruits Wzy.
Kintz and Goldberg (2011) proposed a ruler model, which suggested that Wzz periplasmic
barrel, acts as a ruler and the Oag chain length is determined by the direct physical interaction
of the Oag polymer with the barrel of the Wzz oligomer. A more compact barrel generates
shorter Oag chain length as the area of interaction between Wzz and Oag polymer is reduced.
According to them the amount of Wzy has no correlation with the chain length of Oag (Kintz
& Goldberg, 2011). According to the model of Kalynych et al. (2012a) the growing Oag chain
adopt a higher order structure and may interfere with the proper positioning within the Wzy-
binding site. Wzz binds with the growing Oag and allows further polymerisation. After
achieving certain length the Oag can no longer be bound with the Wzz and dissociates
(Kalynych et al., 2012a). However, both of these models suggested the direct interaction of
the Oag polymer with Wzz or Wzz and Wzy but did not suggest any interaction between Wzz
and Wzy.
Islam and Lam (2014) proposed a hybrid model based on the Kintz and Goldberg (2011)
and Kalynych et al. (2012a) models. According to the hybrid model the Wzy dimer binds
with the TMs of the Wzz protomer within the PCP conserved bell-shaped quaternary
structure. The Oag chain is elongated due to the polymerisation by Wzy and the higher order
Introduction
39
Oag structure destabilises the interaction of the polymer with Wzz. As the tip of the growing
Oag chain reaches the apex of the Wzz bell, the mechanical feedback of the interaction of Oag
polymer and Wzz transmits through the Oag chain to the basal Oag RU in the Wzy active site
and the Oag chain dissociates from Wzy (Islam & Lam, 2014). However, there is no direct
evidence to date on how these proteins are associated except the study of Marolda et al.
(2006) that provided the genetic data about the interaction of Wzx, Wzz, and Wzy. The work
of Carter et al. (2009) contradicts their data and suggested that may be there is no direct
physical interaction between WzzSf and WzySf.
Woodward et al. (2010) provided evidence supporting the association of Wzz and Wzy
through their in vitro polymerisation assay and suggested that Wzz and Wzy are enough to
shape the Oag chain. Islam et al. (2013) suggested that the chain length of the Oag is
determined by the interaction of Wzz and Wzy. Taylor et al. (2013) showed that the inhibitor
of # polymerase (Iap) peptide inhibits Wzy# (Oag polymerase of P. aeruginosa PAO1
serotype O5) by mimicking the Wzz TM segment and provided the evidence of direct
interaction between Wzz and Wzy. Bacterial two-hybrid system analysis in R. leguminosarum
showed that PssP protein, which is a PCP, interacts with PssL and PssT, which are Wzx and
Wzy, respectively (Marczak et al., 2013; Marczak et al., 2014). However, to date there is a
lack of evidence on the interaction of Wzy with the other proteins of the Wzy-dependent Oag
biosynthesis pathway using more direct approaches. Several studies pointed towards the
complex formation of the IM proteins during the Wzy-dependent pathway. Hence a direct
evidence of the complex formation is required to confirm these models and to know the actual
mechanism behind this pathway.
1.11 Aims and hypotheses
WzySf is an important protein in synthesising Oag, the key virulence determinant of S.
flexneri. WzySf was identified more than 20 years ago (Morona et al., 1994) but there is lack
of knowledge about its functional amino acid residues and its association with the other
proteins of the Oag biosynthesis pathway. In this thesis, I have investigated the biochemical
Introduction
40
and functional characteristics of WzySf. Based on the earlier studies following hypotheses
were generated:
1. WzySf has variety of regions that are important for Oag polymerisation and chain
length control.
2. WzySf contains Arg residues in PL3 and PL5 which are essential for Oag
polymerisation.
3. WzySf interacts with WzzSf .
4. WzySf interacts physically with the other proteins of the Wzy-dependent pathway.
The following aims investigated the hypotheses:
1. To construct a suitable wzySf expression system for performing experiments to
understand the biochemical and functional characteristcs of WzySf.
2. To perform random mutagenesis on wzySf to identify the amino acid residues important
for WzySf polymerisation function.
3. To perform site-directed mutagenesis on the Arg residues on PL3 and PL5 of WzySf
and characterising the mutants based on their polymerisation activity and association
with WzzSf.
4. To optimise a purification method of S. flexneri WzySf.
5. To perform in vivo cross-linking followed by purification of WzySf to monitor the
direct physical association of the proteins of the Wzy-dependent pathway.
1.12 Thesis Organisation
The dissertation is organised as follow (Table 1.2).
Introduction
41
Table 1.2 Overview of the chapters in this PhD thesis
Chapter Purpose and investigated research aims
Chapter 1 (Introduction) Introduces the research domain and provides context of the research
Chapter 2 (Materials and Methods)
Describes the experimental methods and the materials used to perform the studies
Chapter 3 Construction of a wzySf expression system, identifying functional amino acid residues of WzySf, understanding the role of WzzSf in the Oag polymerisation (Aims 1 and 2)
Chapter 4 Identifying the importance of the Arg residues in PL3 and PL5 of WzySf and characterising the WzySf mutants based on their polymerisation function and association with WzzSf (Aim 3)
Chapter 5 Purifying WzySf, investigating dimer formation of WzySf and relation of the dimer formation with the functioning of the protein, monitoring the direct physical interaction of the proteins of the Wzy-dependent pathway (Aims 4 and 5)
Chapter 6 (Conclusions) Concludes the thesis by discussing key contributions and direction for future research
42
43
Chapter 2
Materials and Methods
Materials and Methods
44
Chapter 2: Materials and Methods
2.1 Bacterial strains and plasmids
A listing of Shigella flexneri and Escherichia coli host strains used in this work and a
complete list of strains constructed during this work is summarised in Table 2.1. Cloning
vectors and plasmids used in these studies are listed in Table 2.2.
2.2 Bacterial growth media and growth condition
2.2.1 Liquid growth media
All E.coli and S. flexneri strains were grown at 37°C in lysogeny broth (LB) (10 g/litre
tryptone, 5 g/litre yeast extract, 5 g/litre NaCl) and LB agar (LB broth, 15 g/litre Bacto agar).
Under induction conditions, 0.4 mM isopropyl-"-D-thiogalactopyranoside (IPTG) or 0.2%
(w/v) L-arabinose was added to the cultures, and they were grown for 20 h at 20°C.
Antibiotics were added as required to the media at the following final concentrations:
fhuA2 (lon) ompT gal ($ DE3) (dcm) "hsdS/ pLemo(Cmr)
New England Biolabs
PNRM1 DH5# (pGEMT-Easy-wzySf) This study PNRM3 DH5# (pWaldo-TEV-GFP) This study PNRM4 DH5# (pRMPN1) This study PNRM15 Lemo21(DE3) (pRMPN1) This study PNRM22 XL10-Gold (pRMPN2) This study PNRM24 XL10-Gold (pRMPN3) This study PNRM26 XL10-Gold (pRMPN4) This study PNRM27 XL10-Gold (pRMPN5) This study PNRM 30 XL10-Gold (pRMPN6) This study PNRM53 XL10-Gold (pRMPN7) This study PNRM56 XL10-Gold (pRMPN8) This study PNRM57 XL10-Gold (pRMPN9) This study PNRM59 XL10-Gold (pRMPN10) This study PNRM61 XL10-Gold (pRMPN11) This study PNRM64 XL10-Gold (pRMPN12) This study PNRM66 XL10-Gold (pRMPN13) This study PNRM67 XL10-Gold (pRMPN14) This study PNRM69 XL10-Gold (pRMPN15) This study PNRM71 XL10-Gold (pRMPN16) This study PNRM73 XL10-Gold (pRMPN17) This study PNRM95 XL10-Gold (pRMPN19) This study PNRM98 XL10-Gold (pRMPN21) This study PNRM100 XL10-Gold (pRMPN22) This study PNRM103 XL10-Gold (pRMPN23) This study PNRM114 XL10-Gold (pRMPN24) This study
Materials and Methods
46
Table 2.1 continued Strain Relevant characteristics # Source PNRM116 XL10-Gold (pRMPN25) This study PNRM179 XL10-Gold (pRMPN27) This study PNRM182 XL10-Gold (pRMPN28) This study PNRM184 XL10-Gold (pRMPN29) This study PNRM185 XL10-Gold (pRMPN30) This study PNRM187 XL10-Gold (pRMPN31) This study PNRM209 XL10-Gold (pRMPN32) This study PNRM210 XL10-Gold (pRMPN33) This study PNRM211 XL10-Gold (pRMPN34) This study PNRM212 XL10-Gold (pRMPN36) This study PNRM230 XL10-Gold (pRMPN35) This study S. flexneri PE638 S. flexneri Y rpoB (Rifr) (Morona et al., 1995) RMM109 PE638 !wzy (Rifr) (Morona et al., 1994) RMA4337 RMM109 !wzz (Rifr Tetr) This study PNRM5 RMM109 (pWaldo-TEV-GFP) This study PNRM6 RMM109 (pAC/pBADT7-1) This study PNRM7 PE638 (pWaldo-TEV-GFP) This study PNRM8 PE638 (pAC/pBADT7-1) This study PNRM9 RMM109 (pRMPN1) This study PNRM10 PE638 (pRMPN1) This study PNRM11 PNRM6 (pWaldo-TEV-GFP) This study PNRM12 PNRM8 (pAC/pBADT7-1) This study PNRM13 PNRM6 (pRMPN1) This study PNRM14 PNRM10 (pAC/pBADT7-1) This study PNRM16 PNRM6 (pRMPN2) This study PNRM17 PNRM6 (pRMPN3) This study PNRM18 PNRM6 (pRMPN4) This study PNRM19 PNRM6 (pRMPN5) This study PNRM20 PNRM6 (pRMPN6) This study PNRM75 PNRM6 (pRMPN7) This study PMRM76 PNRM6 (pRMPN8) This study PNRM77 PNRM6 (pRMPN9) This study PMRM78 PNRM6 (pRMPN10) This study
Materials and Methods
47
Table 2.1 continued Strain Relevant characteristics # Source PMRM79 PNRM6 (pRMPN11) This study PMRM80 PNRM6 (pRMPN12) This study PMRM81 PNRM6 (pRMPN13) This study PMRM82 PNRM6 (pRMPN14) This study PMRM83 PNRM6 (pRMPN15) This study PMRM84 PNRM6 (pRMPN16) This study PMRM85
PNRM6 (pRMPN17) This study PMRM87 PNRM7 (pRMPN2) This study PMRM88 PNRM7 (pRMPN3) This study PMRM89 PNRM7 (pRMPN5) This study PMRM90 PNRM7 (pRMPN6) This study PMRM91 PNRM7 (pRMPN7) This study PMRM92 PNRM7 (pRMPN8) This study PMRM93 PNRM7 (pRMPN15) This study PMRM94 PNRM7 (pRMPN16) This study PMRM119 PNRM6 (pRMPN19) This study PMRM120 PNRM6 (pRMPN20) This study PMRM121 PNRM6 (pRMPN22) This study PMRM122 PNRM6 (pRMPN23) This study PMRM123 PNRM6 (pRMPN24) This study PMRM124 PNRM6 (pRMPN25) This study PNRM126 RMA4337 (pAC/pBADT7-1) This study PMRM127 PNRM126 (pRMPN2) This study PMRM128 PNRM126 (pRMPN3) This study PMRM129 PNRM126 (pRMPN5) This study PMRM130 PNRM126 (pRMPN6) This study PMRM131 PNRM126 (pRMPN7) This study PMRM132 PNRM126 (pRMPN15) This study PMRM133 PNRM126 (pRMPN16) This study PMRM134 PNRM126 (pRMPN1) This study PMRM135 PNRM126 (pWaldo-TEV-GFP) This study PMRM136 PNRM126 (pRMPN8) This study PMRM137 PNRM126 (pRMPN10) This study
Materials and Methods
48
Table 2.1 continued Strain Relevant characteristics # Source PNRM140 PNRM126 (pRMPN13) This study PNRM141 PNRM126 (pRMPN14) This study PMRM142 PNRM126 (pRMPN9) This study PMRM143 PNRM126 (pRMPN11) This study PMRM144 PNRM126 (pRMPN19) This study PMRM145 PNRM126 (pRMPN24) This study PMRM146 PNRM126 (pRMPN25) This study PMRM147 PNRM126 (pRMPN23) This study PMRM148 PNRM126 (pRMPN21) This study PMRM149 PNRM126 (pRMPN22) This study PMRM150 PNRM126 (pRMPN12) This study PMRM151 PNRM126 (pRMPN17) This study PNRM153 PNRM126 (pRMPN4) This study PNRM159 PNRM13 (pWSK29-wzzSf) This study PNRM161 PNRM13 (pWSK29) This study PNRM190 PNRM6 (pRMPN27) This study PNRM192 PNRM6 (pRMPN28) This study PNRM194 PNRM6 (pRMPN29) This study PNRM196 PNRM6 (pRMPN30) This study PNRM198 PNRM6 (pRMPN31) This study PNRM216 PNRM6 (pRMPN32) This study PNRM218 PNRM6 (pRMPN33) This study PNRM220 PNRM6 (pRMPN34) This study PNRM222 PNRM6 (pRMPN36) This study PNRM232 PNRM6 (pRMPN35) This study PNRM246 PNRM126 (pRMPN27) This study PNRM248 PNRM126 (pRMPN28) This study PNRM250 PNRM126 (pRMPN29) This study PNRM252 PNRM126 (pRMPN30) This study PNRM252 PNRM126 (pRMPN30) This study PNRM254 PNRM126 (pRMPN31) This study PNRM256 PNRM126 (pRMPN32) This study PNRM258 PNRM126 (pRMPN33) This study
Materials and Methods
49
Table 2.1 continued Strain Relevant characteristics # Source PNRM260 PNRM126 (pRMPN34) This study PNRM262 PNRM126 (pRMPN35) This study PNRM264 PNRM126 (pRMPN36) This study PNRM271 RMM109 (pWSK29-wzzSf) This study PNRM289 PNRM16 (pWSK29-wzzSf) This study PNRM293 PNRM122 (pWSK29-wzzSf) This study PNRM299 PNRM85 (pWSK29-wzzSf) This study PNRM301 PNRM192 (pWSK29-wzzSf) This study
tetracycline resistant. $DE3 is $ sBamHIo !EcoRI-B int::(lacI::PlacUV5::T7 gene1)i21
!nin5. pLemo is pACYC184-PrhaBAD-lysY.
Materials and Methods
50
Table 2.2 Plasmids used in this study
Plasmid Description # Source pGEMT-Easy Cloning vector Promega pRMCD6 Source of wzySf (modified codons at
positions 4, 9, and 23) (Daniels et al., 1998)
pAC/pBADT7-1 Source of T7 RNA polymerase; Cmr (McKinney et al., 2002) pWaldo-TEV-GFP Cloning vector with GFP tag; Kmr (Waldo et al., 1999) pGEMT-Easy-wzySf wzySf with BamHI and KpnI sites This Study pRMPN1 pWaldo-wzySf-TEV-GFP This Study pCACTUS Suicide vector containing sacB, Cmr,
and orits (Morona et al., 1995)
pRMA577 Suicide vector contatining SphI-SphI fragment with the rol gene
(Morona et al., 1995)
pCACTUS-wzzSf::Tcr Suicide mutagenesis construct to construct the strain RMA4337
This Study
pWSK29 Cloning vector; Ampr (Wang & Kushner, 1991) pWSK29-wzzSf pWSK29 with S. flexneri 2a wzzSf (Murray et al., 2006)
pRMPN2 pRMPN1 with R164A point mutation in the wzySf
This Study
pRMPN3 pRMPN1 with R250A point mutation in the wzySf
This Study
pRMPN4 pRMPN1 with R258A point mutation in the wzySf
This Study
pRMPN5 pRMPN1 with R278A point mutation in the wzySf
This Study
pRMPN6 pRMPN1 with R289A point mutation in the wzySf
This Study
pRMPN7 pRMPN1 with G130V point mutation in the wzySf
This Study
pRMPN8 pRMPN1 with L11I point mutation in the wzySf
This Study
pRMPN9 pRMPN1 with N86K point mutation in the wzySf
This Study
pRMPN10 pRMPN1 with L28V point mutation in the wzySf
This Study
pRMPN11 pRMPN1 with P165S point mutation in the wzySf
This Study
Materials and Methods
51
Table 2.2 continued Plasmid Description # Source
pRMPN12 pRMPN1 with G82C point mutation in the wzySf
This Study
pRMPN13 pRMPN1 with N147K point mutation in the wzySf
This Study
pRMPN14 pRMPN1 with L191F point mutation in the wzySf
This Study
pRMPN15 pRMPN1 with L214I point mutation in the wzySf
This Study
pRMPN16 pRMPN1 with P352H point mutation in the wzySf
This Study
pRMPN17 pRMPN1 with V92M point mutation in the wzySf
This Study
pRMPN19 pRMPN1 with F52Y point mutation in the wzySf
This Study
pRMPN21 pRMPN1 with F52C/I242T point mutation in the wzySf
This Study
pRMPN22 pRMPN1 with C60F point mutation in the wzySf
This Study
pRMPN23 pRMPN1 with Y137H point mutation in the wzySf
This Study
pRMPN24 pRMPN1 with L49F/T328A point mutation in the wzySf
This Study
pRMPN25 pRMPN1 with F54C point mutation in the wzySf
This Study
pRMPN27 pRMPN1 with R164K point mutation in the wzySf
This Study
pRMPN28 pRMPN1 with R250K point mutation in the wzySf
This Study
pRMPN29 pRMPN1 with R258K point mutation in the wzySf
This Study
pRMPN30 pRMPN1 with R278K point mutation in the wzySf
This Study
pRMPN31 pRMPN1 with R289K point mutation in the wzySf
This Study
pRMPN32 pRMPN1 with R164E point mutation in the wzySf
This Study
pRMPN33 pRMPN1 with R250E point mutation in the wzySf
This Study
pRMPN34 pRMPN1 with R258E point mutation in the wzySf
This Study
Materials and Methods
52
Table 2.2 continued Plasmid Description # Source
pRMPN35 pRMPN1 with R278E point mutation in the wzySf
This Study
pRMPN36 pRMPN1 with R289E point mutation in the wzySf
pH 7.6]. Samples were heated for 5-10 min at 100ºC, then 10 µl of 2.5 mg/ml proteinase K
(Invitrogen) was added followed by incubation at 56ºC for ~16 h. LPS samples were stored at
-20ºC or used immediately.
2.13.2 Analysis of LPS by silver-stained SDS-PAGE
Silver-staining was performed as described previously (Tsai & Frasch, 1982) with minor
changes. LPS samples (Section 2.13.1) were heated at 100ºC for 5-10 min. Then 5-10 µl of
the heated samples were loaded on an SDS 15% (w/v) polyacrylamide gel and eletrophoresed
using the Sigma vertical gel electrophoresis unit (gel dimension: 16.5 cm x 22 cm) at 12 mA
for 16-18 h. The gel was fixed for 2 h in fixing solution [40% (v/v) ethanol, 5% (v/v) glacial
acetic acid in Milli Q water] with gentle agitation and then oxidised in oxidising solution
[40% (v/v) ethanol, 5% (v/v) glacial acetic acid, 0.7% periodic acid in Milli Q water] for 5
min. After 1.5-2 h washing in Milli Q water (changed water at 15 min intervals), the gel was
stained for 10 min in staining solution [2 ml NH4OH, 0.12 g NaOH, 1 g solid silver nitrate in
150 ml Milli Q water]. The gel was washed again in Milli Q water for 1 h (changed water at
10 min intervals) and developed with pre-warmed (42ºC) developing solution [50 mg/ml
citric acid in 1 litre Milli Q water (warmed to 42ºC) with 500 µl 37% (v/v) formaldehyde
Materials and Methods
69
solution (added just prior to developing)] and stopped by addition of the stopping solution
[4% (v/v) glacial acetic acid in Milli Q water].
!
70
!
71
Chapter 3
Mutational analysis of the Shigella flexneri O antigen
polymerase Wzy; identification of Wzz-dependent Wzy mutants
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
72
Mutational analysis of the Shigella flexneri O antigen
polymerase Wzy; identification of Wzz-dependent Wzy
mutants
Pratiti Nath, Elizabeth Ngoc Hoa Tran, and Renato Morona
Discipline of Microbiology and Immunology, School of Molecular and
Biomedical Science, University of Adelaide, Adelaide 5005, Australia
J Bacteriol. 2015 Jan 1;197(1):108-19. doi: 10.1128/JB.01885-14. Epub 2014 Oct 13.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
73
Statement of Authorship
Title of Paper Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-dependent Wzy mutants
Publication Status Published Publication Details J Bacteriol. 2015 Jan 1;197(1):108-19. doi: 10.1128/JB.01885-14. Epub 2014 Oct
13.
Author Contributions By signing the Statement of Authorship, each author certifies that their stated contribution to the publication is accurate and that permission is granted for the publication to be included in the candidate’s thesis. Name of Principal Author (Candidate)
Pratiti Nath
Contribution to the Paper Performed all experiments, performed analysis on all samples, interpreted data, and wrote manuscript.
Signature
Date 20.5.15
Name of Co-Author Elizabeth Ngoc Hoa Tran Contribution to the Paper Purified His6-ColE2 and constructed the strain RMA4337.
Signature
Date
Name of Co-Author Renato Morona Contribution to the Paper Supervised development of work, helped in data
interpretation, manuscript evaluation, and editing.
Signature
Date
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
74
Chapter 3: Third paper
3.1 Abstract
The O antigen (Oag) component of lipopolysaccharide (LPS) is a major virulence determinant
of Shigella flexneri and is synthesied by the Oag polymerase, WzySf. Oag chain length is
regulated by chromosomally encoded WzzSf and pHS-2 plasmid encoded WzzpHS2. To
identify functionally important amino acid residues in WzySf, random mutagenesis was
performed on the wzySf in a pWaldo-TEV-GFP plasmid, followed by screening with colicin
E2. Analysis of the LPS conferred by mutated WzySf proteins in the wzySf deficient ("wzy)
strain identified 4 different mutant classes, with mutations found in the Periplasmic Loops
(PL) - 1, 2, 3, and 6; Trans-membrane (TM) regions - 2, 4, 5, 7, 8, and 9; and Cytoplasmic
Loops (CL) - 1 and 5. The association of WzySf and WzzSf was investigated by transforming
these mutated wzySf plasmids into a wzySf and wzzSf deficient ("wzy "wzz) strain. Comparison
of the LPS profiles in the "wzy and "wzy "wzz backgrounds identified WzySf mutants whose
polymerisation activity was WzzSf-dependent. Colicin E2 and bacteriophage Sf6c sensitivities
were consistent with the LPS profiles. Analysis of the expression levels of the WzySf-GFP
mutants in the "wzy and "wzy "wzz backgrounds identified a role for WzzSf in WzySf
stability. Hence, in addition to its role in regulating Oag modal chain length, WzzSf also
affects WzySf activity and stability.
3.2 Introduction
Shigella flexneri lipopolysaccharide (LPS) is crucial for pathogenesis (Sperandeo et al.,
2009). LPS is exclusively located in the outer leaflet of the outer membrane (OM) and has
three domains: 1) Lipid A - a hydrophobic domain which anchors LPS to the OM, 2) the core
oligosaccharides - a non-repeating oligosaccharide domain, and 3) the O-antigen (Oag)
polysaccharide - an oligosaccharide repeat domain (Sperandeo et al., 2009) (Raetz &
Whitfield, 2002). The complete LPS structure with Oag chains is termed smooth LPS (S-
LPS). However, the LPS structure lacking the Oag is termed rough LPS (R-LPS), and LPS
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
75
with a single Oag tetrasaccharide repeat unit (RU) attached to the Lipid A and core sugar is
termed semi-rough LPS (SR-LPS) (Morona et al., 1994). S. flexneri is subdivided into various
serotypes depending on the differences in the composition of LPS Oag. So far there are 17
known serotypes of S. flexneri (Sun et al., 2013b). Except for S. flexneri serotype 6, the Oag
of all other serotypes has the same polysaccharide backbone containing three L-rhamnose
residues (Rha), and one N-acetylglucosamine (GlcNAc). This basic Oag structure is known as
serotype Y. Addition of either glucosyl, O-acetyl, or phosphoethanolamine (PEtN) groups by
various linkages to the sugars of the Y serotype tetrasaccharide repeat creates different S.
flexneri serotypes (Allison & Verma, 2000; Sun et al., 2012; Wang et al., 2010b). Oag is the
protective antigen as immunity against the S. flexneri infection is serotype specific (Jennison
& Verma, 2004; Stagg et al., 2009). S-LPS confers resistance to complement (Hong & Payne,
1997) and colicins (Tran et al., 2014; van der Ley et al., 1986), and Y serotype Oag acts as a
receptor to bacteriophage Sf6 (Lindberg et al., 1978).
S. flexneri Oag biosynthesis occurs by the Wzy-dependent pathway. Most of the Oag
biosynthesis genes (except wecA) of S. flexneri are located in the Oag biosynthesis locus
between galF and his (Allison & Verma, 2000; Morona et al., 1995). S. flexneri Oag
biosynthesis occurs on either side of the inner membrane (IM). Initially N-acetylglucosamine
phosphate (GlcNAc-1-P) is transferred from uridine diphosphate-GlcNAc (UDP-GlcNAc) by
WecA to undecaprenol phosphate (Und-P) at the cytoplasmic side of the IM (Guo et al.,
2008; Liu et al., 1996; Wang et al., 2010b). RfbG and RfbF then add Rhamnose (Rha)
residues from thymidine diphospho-rhamnose (dTDP-Rha) to the GlcNAc (Macpherson et al.,
1995; Morona et al., 1994) to form the O unit. In the Wzy-dependent model of LPS assembly,
the flippase protein Wzx translocates this O unit to the periplasmic side. At the periplasmic
side, the O units are polymerised at the non-reducing end by the Oag polymerisation protein
Wzy via a block transfer mechanism to form the polymer. The chain length of the final Oag is
regulated by the protein Wzz (Daniels et al., 1998; Morona et al., 1994). Finally, the Oag
ligase WaaL ligates the Oag chains to the previously synthesied core-lipid A. The Lpt
proteins (Lpt A-G) then transport the LPS from the IM to the OM (Ruiz et al., 2008;
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
76
Sperandeo et al., 2009).
The Oag polymerisation protein WzySf is encoded by the rfc/wzy gene. WzySf is a 43.7
kDa hydrophobic integral membrane protein. It has 12 transmembrane (TM) segments and
two large periplasmic (PL) domains (Daniels et al., 1998; Morona et al., 1994). Based on a
topology model proposed by our group, the amino and carboxy terminal ends are located on
the cytoplasmic side of the IM. The wild type (WT) wzySf gene lacks a detectable ribosome
binding site, and has a low G+C %, and a high percentage of minor codons in the first 25
amino acids, contributing to low expression and poor detection of the protein (Daniels et al.,
1998; Morona et al., 1994).
Islam et al. (2011) performed extensive work on Pseudomonas aeruginosa Wzy
(WzyPa) and showed that both PL3 and PL5 of WzyPa contain RX10G motifs, which are
important for the functioning of WzyPa. They also found several Arg residues within these
two motifs are also important for WzyPa function (Islam et al., 2011). However there is little
sequence identity between WzyPa and WzySf. So, it is not possible to predict the functional
amino acid residues of WzySf from another model.
Wzz is a member of the polysaccharide co-polymerase (PCP) family. S. flexneri has two
types of Wzz - chromosomally encoded WzzSf and pHS-2 plasmid encoded WzzpHS2. S.
flexneri 2a has S-LPS with two types of modal chain length: short (S) type (11-17 Oag RUs)
and very long (VL) type (>90 Oag RUs), and the S-type and VL-type Oag chain lengths are
determined by WzzSf and WzzpHS2, respectively. Controlling Oag chain length is crucial for
bacterial virulence, and loss of WzzSf mediated Oag modal chain length regulation affects
virulence due to masking of the OM protein IcsA (Morona et al., 2003; Morona & Van Den
Bosch, 2003b). Daniels and Morona (1999) showed that WzzSf forms a dimer in vivo and may
oligomerise up to a hexamer. Formation of these large complexes is consistent with the
hypothetical complex formation between Wzz and other enzymes of the Oag biosynthesis
pathway, including Wzy (Bastin et al., 1993; Morona et al., 1995). WzzSf and WzzpHS2
compete for the available WzySf (Carter et al., 2009).
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
77
Woodward et al. (2010) showed that Wzz and Wzy are sufficient to determine the Oag
modal chain length. There are several proposed mechanisms for modal length control by Wzz
and its association with Wzy: a molecular clock model was proposed by Bastin et al. (1993)
and a molecular chaperone model was proposed by Morona et al. (1995). Tocilj et al. (2008)
suggested that Wzz may form a scaffold and recruits Wzy. However, there is no direct
evidence to date on how these proteins are associated with each other in Oag polymerisation
and chain length control.
In this study we were able to overexpress and detect WzySf-GFP expression in S.
flexneri. We performed random mutagenesis on wzySf, and following screening with colicin
E2, for the first time identified amino acid residues important for WzySf function. We
classified the wzySf mutants based on their LPS profiles. We were able to determine mutant
protein expression levels, and also characterised the mutants depending on the phage and
colicin sensitivities they conferred. These findings provided insight to Wzy structure and
function. We further identified WzzSf-dependent WzySf mutants, and identified a novel role
for WzzSf in WzySf Oag polymerisation activity and stability, in addition to its role in
regulating Oag modal chain length.
3.3 Materials and Methods
3.3.1 Bacterial strains and plasmids
The strains and plasmids used in this study are shown in Table 3.1.
3.3.2 Growth media and growth conditions
The growth media used were Lysogeny broth (LB) (10 g/liter tryptone, 5 g/liter yeast extract,
5 g/liter NaCl) and LB agar (LB broth, 15 g/liter bacto agar).
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
78
Table 3.1 Bacterial strains and plasmids used in this study
Strains or Plasmids Characteristics* Reference Strains S. flexneri PE638 S. flexneri Y rpoB (Rifr) (Morona et al., 1995)
recruiWzy RMM109 PE638!wzy, Rifr (Morona et al., 1994) RMA4337 RMM109 !wzz (Rifr, Tetr) This study PNRM6 RMM109 (pAC/pBADT7-1) This study PNRM11 PNRM6 (pWaldo-TEV-GFP) This study PNRM13 PNRM6 (pRMPN1) This study PNRM75 PNRM6 (pRMPN7) This study PNRM76 PNRM6 (pRMPN8) This study PNRM77 PNRM6 (pRMPN9) This study PNRM78 PNRM6 (pRMPN10) This study PNRM79 PNRM6 (pRMPN11) This study PNRM80 PNRM6 (pRMPN12) This study PNRM81 PNRM6 (pRMPN13) This study PNRM82 PNRM6 (pRMPN14) This study PNRM83 PNRM6 (pRMPN15) This study PNRM84 PNRM6 (pRMPN16) This study PNRM85 PNRM6 (pRMPN17) This study PNRM119 PNRM6 (pRMPN19) This study PNRM120 PNRM6 (pRMPN21) This study PNRM121 PNRM6 (pRMPN22) This study PNRM122 PNRM6 (pRMPN23) This study PNRM123 PNRM6 (pRMPN24) This study PNRM124 PNRM6 (pRMPN25) This study PNRM126 RMA4337 (pAC/pBADT7-1) This study PNRM134 PNRM126 (pRMPN1) This study PNRM131 PNRM126 (pRMPN7) This study PNRM132 PNRM126 (pRMPN15) This study PNRM133 PNRM126 (pRMPN16) This study
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
79
Table 3.1 continued Strains or Plasmids Characteristics* Reference S. flexneri PNRM136 PNRM126 (pRMPN8) This study PNRM137 PNRM126 (pRMPN10) This study PNRM140 PNRM126 (pRMPN13) This study PNRM141 PNRM126 (pRMPN14) This study PNRM142 PNRM126 (pRMPN9) This study PNRM143 PNRM126 (pRMPN11) This study PNRM144 PNRM126 (pRMPN19) This study PNRM145 PNRM126 (pRMPN24) This study PNRM146 PNRM126 (pRMPN25) This study PNRM147 PNRM126 (pRMPN23) This study PNRM148 PNRM126 (pRMPN21) This study PNRM149 PNRM126 (pRMPN22) This study PNRM150 PNRM126 (pRMPN12) This study PNRM151 PNRM126 (pRMPN17) This study E.coli XL10-Gold
Tetr !(mcrA)183 !(mcrCB-hsdSMR-mrr)173
endA1 supE44 thi-1 recA1 gyrA96 relA1 lac
(F´ proAB lacIqZDM15 Tn10Tetr Cmr)
Stratagene
Lemo21(DE3)
fhuA2 (lon) ompT gal ($ DE3) (dcm) "hsdS/
pLemo(Cmr)
New England Biolabs
PNRM15 Lemo21(DE3) (pRMPN1) This study Plasmids pRMCD6 Source of wzySf (Daniels et al., 1998) pAC/pBADT7-1 Source of T7 RNA polymerase; Cmr (McKinney et al.,
2002) pWaldo-TEV-GFP Cloning vector with GFP tag; Kmr (Waldo et al., 1999) pRMPN1 pWaldo-wzySf-GFP; Kmr This study pRMPN7 pRMPN1 with G130V point mutation in the
wzySf gene
This study
pRMPN8 pRMPN1 with L111I point mutation in the
wzySf gene
This study
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
80
Table 3.1 continued Strains or Plasmids Characteristics* Reference Plasmids pRMPN9 pRMPN1 with N86K point mutation in the
wzySf gene
This study
pRMPN10 pRMPN1 with L28V point mutation in the
wzySf gene
This study
pRMPN11 pRMPN1 with P165S point mutation in the
wzySf gene
This study
pRMPN12 pRMPN1 with G82C point mutation in the
wzySf gene
This study
pRMPN13 pRMPN1 with N147K point mutation in the
wzySf gene
This study
pRMPN14 pRMPN1 with L191F point mutation in the
wzySf gene
This study
pRMPN15 pRMPN1 with L214I point mutation in the
wzySf gene
This study
pRMPN16 pRMPN1 with P352H point mutation in the
wzySf gene
This study
pRMPN17 pRMPN1 with V92M point mutation in the
wzySf gene
This study
pRMPN19 pRMPN1 with F52Y point mutation in the
wzySf gene
This study
pRMPN21 pRMPN1 with F52C/I242T point mutations in
the wzySf gene
This study
pRMPN22
pRMPN1 with C60F point mutation in the
wzySf gene
This study
pRMPN23 pRMPN1 with Y137H point mutation in the
wzySf gene
This study
pRMPN24 pRMPN1 with L49F/T328A point mutation in
the wzySf gene
This study
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
81
Table 3.1 continued Strains or Plasmids Strains or Plasmids Strains or Plasmids Plasmids Plasmids Plasmids pRMPN25 pRMPN1 with F54C point mutation in the
blue, 1 M Tris-HCl, pH 7.6] and incubated with 2 µg/ml of proteinase K for approximately 16
h. The LPS samples were then electrophoresed on an SDS-15% PAGE for 16 to 18 h at 12
mA. The gel was stained with silver nitrate and developed with formaldehyde (Murray et al.,
2003).
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
84
3.3.6 Random mutagenesis
Random mutagenesis of wzySf was undertaken to obtain a wide range of wzySf mutations in a
non-selected manner. For PCR random mutagenesis the wzySf coding region in plasmid
pRMPN1 was mutagenised by an error prone DNA polymerase using the GeneMorp II EZ-
Clone Domain Mutagenesis Kit (Catalogue number 200552, Stratagene) according to the
manufacturer’s instructions with the primers PN1_wzySfKpnF and PN2_wzySfBamHR
(Supplementary Table 3.S1). The mutagenised plasmids were transformed into competent
Escherichia coli cells, XL10-Gold (Agilent Technologies). Plasmid DNA was then isolated
from randomly chosen transformed mutated colonies and transformed into strain PNRM6
(Table 3.1). Colicin swab assays were performed to screen the mutants (See below). Plasmid
DNA was isolated from putative mutants, transformed into XL10-Gold cells, and subjected to
DNA sequencing (AGRF, Adelaide, Australia).
3.3.7 Construction of the strain RMA4437 (!wzy !wzz)
The S. flexneri Y PE638 "wzy "wzz mutant strain was constructed using allelic exchange
mutagenesis (Morona et al., 1995) to inactivate the wzzSf gene in RMM109 (Morona et al.,
1994). Initially, a tetracycline resistance (tetr) cartridge was inserted into the BglII site of
pRMA577 (Morona et al., 1995) to inactivate wzzSf, and the resulting pCACTUS-wzzSf::tet
(Table 3.1) plasmid was transformed into RMM109 via electroporation (Purins et al., 2008).
Allelic exchange mutagenesis was performed as previously described (Morona et al., 1995).
The wzzSf::tetr mutation in the chromosome was confirmed by PCR with primers ET35 and
ET36 (Supplementary Table 3.S1) to give the PE638 "wzy "wzz mutant RMA4337.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
85
3.3.8 Detection of WzySf expression in S. flexneri
For the detection of WzySf expression in S. flexneri, cells were harvested from the 50 ml 0.2%
(w/v) L-arabinose induced culture by centrifugation (9800 x g, Beckman J2-21M Induction
Drive Centrifuge, 10 min, 4 °C) and the cell pellet was resuspended in 4 ml sonication buffer
(Buffer C, 20 mM Tris-HCl, 150 mM NaCl, pH 7.5). The mixture was then lysed by
sonication, followed by centrifugation (2200 x g, SIGMA 3K15 table top centrifuge, 10 min,
4 °C) to remove debris. Ultracentrifugation was performed in a Beckman Coulter Optima
MAX-XP bench top ultracentrifuge (126000 x g for 1 h at 4 °C) to isolate the whole
membrane (WM) fraction. The WM fraction was resuspended in PBS and then solubilised in
Buffer A. Solubilised WM fraction from 3 X 108 cells was electrophoresed on an SDS-15%
PAGE. The gel was rinsed with distilled water and In-gel imaging was performed as
described above. Loading was checked by staining the gel with Coomassie Blue R-250. The
intensity of WzySf-GFP expression for mutant and control strains was measured by Fiji image
processing package (http://fiji.sc/Fiji) and the percent relative WzySf-GFP intensity for each
mutant strain was measured by comparing the WzySf-GFP intensity of each mutant strain with
WzySf-GFP intensity in the control strain PNRM13.
3.3.9 Colicin sensitivity assay
For the colicin sensitivity assay a solution of purified His6-ColE2 (ColE2) with an initial
concentration of 1 mg/ml was used (Tran et al., 2014).
3.3.9.1 ColE2 swab assay
A two fold serial dilution of 1 µg/ml ColE2 was swabbed onto antibiotic selective LB agar
plates containing 0.2% (w/v) L-arabinose with a cotton swab. Plates were left to dry for 1 h at
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
86
room temperature (RT). Individual 0.2% (w/v) L-arabinose induced mutant and control LB
cultures were then swabbed perpendicular to the ColE2 streak and plates were left to dry for
another 1 h at RT. Plates were then incubated for 16 h at 37°C. The susceptibility of the
mutant strains compared to the control strain was recorded and the image was taken using a
Canon scanner (CanoScan 9000F) against a dark background.
3.3.9.2 ColE2 spot assay
The spot assay was performed using the serial dilutions of ColE2. 100 µl of the individual L-
arabinose induced mutant and control strain cultures were spread onto LB agar plates with
appropriate antibiotics and 0.2% (w/v) L-arabinose. The plates were left to dry for 2 h at RT.
A 2-fold serial dilution of 1 µg/ml of ColE2 [denoted as Neat or (N)] was spotted on the dried
plates, and plates were left to dry for another 3 h at RT. The plates were then incubated for 18
h at 37°C. The end point of the killing zones of mutant strains was compared with the
controls. Images were recorded as above.
3.3.10 Bacteriophage sensitivity assay
Procedures of phage propagation and phage stock preparation have been described previously
(Mavris et al., 1997; Morona et al., 1994). The concentration of the bacteriophage Sf6c stock
used was 8.6 x 107 p.f.u./ml. Mutant and control strains were grown and induced with 0.2%
(w/v) L-arabinose. 100 µl of the individual mutant and control LB cultures were spread onto
LB agar plates with appropriate antibiotics and 0.2% (w/v) L-arabinose. The plates were left
to dry for 2 h at RT. Serial dilutions of the bacteriophage Sf6c stock (undiluted bacteriophage
Sf6c stock was denoted as N) were spotted on the dried plates and the plates were dried for a
further 3 h at RT. The plates were incubated for 18 h at 37°C. Phage sensitivity of the test
strains were compared with the controls. Images were recorded as above.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
87
3.4 Results
3.4.1 Construction of a WzySf-GFP expression plasmid
A suitable expression system was constructed to express wzySf and to detect WzySf by fusion
to GFP (Drew et al., 2006). S. flexneri 2457T 2a wzySf with three modified codons at postions
4, 9, 23 in pRMCD6 plasmid (Daniels et al., 1998) was PCR amplified and ligated into
pWaldo-TEV-GFP (Table 3.1) (See Materials and Methods). To confirm the construct was
able to express WzySf-GFP-His8 protein, pWaldo-wzySf-TEV-GFP-His8 (denoted as pRMPN1)
was transformed into Lemo21(DE3) cells. Whole cell In-gel fluorescence samples were then
prepared from PNRM15 [Lemo21(DE3), (pRMPN1)] and fluorescent imaging of the gel
detected a fluorescent band at approximately 64 kDa, which corresponded to the predicted
size of the WzySf-GFP protein (Supplementary Fig. 3.S1, lane 1), indicating that the construct
was able to express WzySf-GFP.
3.4.2 Complementation of wzySf deficiency
A complementation assay was performed to confirm the functionality of WzySf-GFP. For this
assay pRMPN1 was co-transformed along with pAC/pBADT7-1 (McKinney et al., 2002) into
a wzySf deficient strain RMM109 (Morona et al., 1994). RMM109 has a frameshift mutation
at position 9214 in the wzySf gene that results in premature termination of WzySf synthesis
(Morona et al., 1994). pAC/pBADT7-1 encodes T7 RNA polymerase, which drives the
expression of wzySf-GFP in pRMPN1. LPS samples were prepared from these control strains.
The silver-stained gel showed that PNRM6 [RMM109 (pAC/pBADT7-1)] had an SR-LPS
profile (Fig. 3.1, lane 3). But the PNRM13 [PNRM6 (pRMPN1)] had an S-LPS profile (Fig.
3.1, lane 5). Hence, pRMPN1 was able to complement the wzySf mutation in RMM109, and
the LPS profile resembled that of the WT strain PE638 (Fig. 3.1, lane 2).
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
88
Figure 3.1 Complementation of wzySf deficiency by WzySf-GFP LPS samples (equivalent to 1X109 bacterial cells) were prepared from the indicated strains by
proteinase K treatment, electrophoresed on an SDS-15% (w/v) PAGE gel, and silver stained
(see Materials and Methods). The positions of S-LPS, SR-LPS, and R-LPS are indicated. The
numbers on the right indicate the Oag RUs.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
89
3.4.3 Random mutagenesis of wzySf
Nothing is known about the residues important for WzySf function, and there is little sequence
identity between Wzy proteins of different bacterial species. Hence, it is difficult to predict
the functional amino acid residues of the S. flexneri WzySf. To obtain insight into the WzySf
residues needed for function, wzySf coding region in plasmid pRMPN1 was subjected to
random mutagenesis using an error-prone DNA polymerase (See Materials and Methods).
The resulting mutagenised plasmid library was transformed into PNRM6. We screened the
transformants to find mutants using ColE2. The basis for this is that the R-LPS strains are
more susceptible to the killing by colicins than the S-LPS strains (van der Ley et al., 1986),
and we recently found that there is a strong correlation between LPS Oag modal chain length
and susceptibility to ColE2 (Tran et al., 2014). A ColE2 swab assay (See Materials and
Methods) was used to screen and detect mutants that had a different sensitivity to ColE2
compared to the positive control strain PNRM13 (Supplementary Table 3.S2). Interestingly,
the WT strain PE638 was slightly more resistant to ColE2 compared to the complemented
positive control strain PNRM13 (Supplementary Table 3.S2) (Table 3.2). The wzySf mutant
RMM109 (SR-LPS) was highly sensitive to ColE2 (Supplementary Table 3.S2) (Table 3.2).
Transformants that were either more resistant or more sensitive to ColE2 than PNRM13 were
selected (Supplementary Table 3.S2), and the plasmids isolated and transformed into the
XL10-Gold strain. Plasmid DNA from these isolates was subjected to DNA sequencing to
identify mutational alterations in wzySf. The wzySf mutants had the following substitutions:
N86K, F54C, F52Y, L111I, G82C, and F52C/I242T (Supplementary Table 3.S3). The
mutations were present in PL1, 2, 3, and 6; TM 2, 4, 5, 7, 8, and 9; and Cytoplasmic Loops
(CL) 1 and 5 of the WzySf topology map (summarised in Fig. 3.2 and Table 3.2). After
sequence confirmation, the mutated plasmids were transformed into PNRM6 (Table 3.1) for
detailed characterisation.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
90
Figure 3.2 Locations of mutations on the topology map of WzySf Mutational alterations are indicated by arrows on the WzySf topology map [adapted from
Daniels et al. (1998)]. The positions of the periplasmic loops (PL 1-5), transmembrane
regions (TM 1-12), and cytoplasmic loops (CL 1-5) are indicated. Mutations (shaded circles)
are located in PL 1, 2, 3, and 6; TM 2, 4, 5, 7, 8, and 9; and CL 1 and 5.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-dependent Wzy mutants
91
Table 3.2 ColE2 and bacteriophage Sf6c sensitivities and WzySf-GFP expression of controls and different classes of mutants Mutant class Sensitivity*
Strain Relevant details
!wzy
background
!wzy/!wzz
background
ColE2 Sf6c Relative WzySf-GFP (%) Topology map
location#
!wzy
background
!wzy/!wzz
background
!wzy
background
!wzy/!wzz
background
!wzy
background
!wzy/!wzz
background
RMM109 wzySf mutants 1/256 - R - - - PE638 WT R - 10-6 - - - PNRM13 Positive control 1/2 - 10-5 - 100 - PNRM6 Negative control 1/256 - R - - - PNRM11 Negative control 1/256 - R - - - RMA4337 wzySf and wzzSf mutant - 1/256 - R - - PNRM126 Negative control - 1/256 - R - - PNRM134 Positive control - R - 10-6 - 17 P352H A B PL6 1/64 1/128 R R 36 38 V92M A E PL2 1/32 1/64 R R 84 76 Y137H A E TM5 1/32 1/64 R R 87 97 L214I B C TM8 1/128 1/128 R R 1.4 0.03 G130V C F TM5 1/512 1/128 R R 1.60 28.50 N147K D E PL3 R 1/16 10-6 R 21 52 P165S D E PL3 1/4 1/64 10-5 N 7 125 L191F D E TM7 R 1/16 10-6 N 162 64 C60F D E TM1 R 1/64 10-6 N 30 66 L49F/T328
A
D E TM2/CL5 R 1/64 10-6 R 65 68 L28V D E PL1 R 1/8 10-6 N 55 80 N86K D E PL2 R 1/64 10-6 R 84 82 F54C D E CL1 R 1/64 10-6 R 42 71 F52Y D E TM2 R 1/64 10-6 R 47 63 L111I D E TM4 R 1/8 10-6 N 41 51 G82C D E PL2 R 1/64 10-6 R 40 47 F52C/I242T D E TM2/TM9 R 1/64 10-6 N 82 81
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
107
Table 3.S2 Colicin E2 (ColE2) sensitivity (performed by swab assay) of different WzySf mutants during screening
Strain Relevant details ColE2 sensitivity*^ RMM109 Mutant wzySf ++++ PE638 WT R PNRM13 Positive control + PNRM6 Negative control ++++ PNRM11 Negative control ++++ Mutant # Mutant class
ColE2 sensitivity*^ P352H class A ++
V92M class A ++ Y137H class A ++ L214I class B +++ G130V class C ++++ N147K class D R P165S class D R L191F class D R C60F class D R L49F/T328A class D R L28V class D R N86K class D R F54C class D R F52Y class D R L111I class D R G82C class D R F52C/I242T class D R
*R, Resistant; ^Relative sensitivity to ColE2: ++++ > +++ > ++ > +; # Mutants are in
PNRM6.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
108
Table 3.S3 Nucleotide base change in the WzySf mutants
Mutations Site of point mutation in the WzySf sequence (5’-3’)
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
114
3.7.1 Construction of pWaldo-wzySf-GFP-His81
Primers PN1_wzySfKpnF and PN2_wzySfBamHR (Table 3.S1) which incorporated the KpnI
and BamHI restriction sites, respectively, were used to amplify the previously mutated S.
flexneri 2457T 2a wzySf coding region in pRMCD6 plasmid (Table 2.2) (Daniels & Morona,
1999). Codons 4, 9, and 23 are rare codons present in the translation initiation regions of WT
WzySf and cause lower expression of WT WzySf (Daniels et al., 1998). Hence, the codons
ATA, ATA, and AGA at 4, 9, and 23 were altered to ATT, ATT, and CGT, respectively, and
result in the increased expression of WzySf (Daniels et al., 1998). The amplified wzySf was
cloned into pGEM-T-Easy vector and generated the plasmid p-GEM-T-Easy-wzySf. Following
digestion of the p-GEM-T-Easy-wzySf with BamHI and KpnI, the generated fragment
containing wzySf was ligated into similarly digested pWaldo-TEV-GFP (Waldo et al., 1999).
pWaldo-TEV-GFP contains T7 promoter, ribosomal binding site, and T7 terminator for the
regulation of gene expression, Km selection marker, GFP moiety for detection of the protein,
C-terminal His8 tag for protein purification, and tobacco etch virus (TEV) protease
recognition site for removal of the GFP-His8 moiety (Drew et al., 2006; Waldo et al., 1999).
The insertion of wzySf in the resulting plasmid pWaldo-wzySf-GFP-His8, (Fig. 3.S4) also
denoted as pRMPN1 (Table 2.2), was confirmed by DNA sequencing. The sequence of the
insert in pWaldo-wzySf-GFP-His8 is shown in Fig. 3.S5.
1 Sections 3.7.1 onwards were not part of the original manuscript and were included as additional information for
the thesis chapter.
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
115
Figure 3.S4 Construction of pWaldo-wzySf-GFP-His8 (pRMPN1) plasmid The plasmid pWaldo-wzySf-GFP-His8 was constructed as described in section 6.2. Briefly,
forward and reverse primers incorporating KpnI and BamHI restriction sites, respectively,
were used to amplify wzySf (Genbank accession number X71970.1) from plasmid pRMCD6
(Daniels & Morona, 1999) (A). The amplified fragment was then ligated into pGEM-T-Easy
(B), excised from the plasmid with KpnI/BamHI double digest (C), and ligated into the
similarly digested vector pWaldo-TEV-GFP (Waldo et al., 1999) (D).
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
116
1 atgaataatattaataaaatttttattacatttttatgtattgaactgattattggtggt 1 M N N I N K I F I T F L C I E L I I G G 61 ggtggacgtttactggagccattgggaatattccctttgcgatatttattatttgtattt 21 G G R L L E P L G I F P L R Y L L F V F 121 agttttatacttttaatttttaatttagttacattcaatttttcaatcacccaaaaatgt 41 S F I L L I F N L V T F N F S I T Q K C
181 gtcagtctttttatatggttgcttttatttcctttttatggcttctttgtcggcttatta 61 V S L F I W L L L F P F Y G F F V G L L
241 gctggtaataaaataaatgatatactgtttgatgtgcaaccatacctttttatgctgtca 81 A G N K I N D I L F D V Q P Y L F M L S
301 cttatatatctatttacactaagatatactttaaaagtattttcatgtgagatttttatt 101 L I Y L F T L R Y T L K V F S C E I F I
361 aaaatagttaatgcatttgcattatatggatcactgttatatatttcatacataattttg 121 K I V N A F A L Y G S L L Y I S Y I I L
421 ttgaatttcggtttgttaaattttaatttaatttatgaacacttatcattgactagcgag 141 L N F G L L N F N L I Y E H L S L T S E
481 ttcttttttcgtcccgatggggcttttttttccaaatccttctacttttttggtgtcggt 161 F F F R P D G A F F S K S F Y F F G V G
541 gcgattatcagttttgtcgacaaaaaatatttaaaatgtctcataatagtgcttgcgata 181 A I I S F V D K K Y L K C L I I V L A I
601 ttattgacagaatcaagaggtgtattactttttacaacattatcactgttattagccagt 201 L L T E S R G V L L F T T L S L L L A S
661 tttaaattacataagctatatttaaatactattataataatattgggcagcgttctattt 221 F K L H K L Y L N T I I I I L G S V L F
721 ataattatgctttacatggtcggatcacgcagtgaagattctgactctgttagatttaat 241 I I M L Y M V G S R S E D S D S V R F N
Mutational analysis of the Shigella flexneri O antigen polymerase Wzy; identification of Wzz-
dependent Wzy mutants
117
781 gatttatatttttattataaaaatgttgatttagcgacgttcttgtttggaagaggattt 261 D L Y F Y Y K N V D L A T F L F G R G F
841 ggttcatttatattagatcgattaaggattgaaatagtacctcttgagatacttcagaaa 281 G S F I L D R L R I E I V P L E I L Q K
901 acaggcgttattggtgtatttatatcattagttcctatgttgcttatctttttgaaaggc 301 T G V I G V F I S L V P M L L I F L K G
961 tattttttaaatagtacaaaaacatcattaatgatgtcgttaatactttttttcagtatt 321 Y F L N S T K T S L M M S L I L F F S I
1021 accgtttctataactaatccatttctttttacacccatgggaatttttattataggcgtt 341 T V S I T N P F L F T P M G I F I I G V
1081 gtagttttatgggtattttctatagaaaatatccaaattagtaataacctcacttctgga 361 V V L W V F S I E N I Q I S N N L T S G
1141 gcaaaataaGGATCC 381 A K - BamHI
Figure 3.S5 DNA and predicted amino acid sequence of the inserted WzySf sequence in pWaldo-TEV-GFP plasmid The DNA sequence and the amino acid sequence of the wzySf fragment inserted in pWaldo-
TEV-GFP plasmid are shown. The wzySf (GenBank accession number X71970.1) sequence is
highlighted in yellow, the sart codon is highlighted in green, and the stop codon is highlighted
in pink. The BamHI sequence is shown in grey. The alterations in codons 4, 9 and 23 of wzySf
are indicated in red text.
118
119
Chapter 4
Mutational analysis of the major periplasmic loops of Shigella
flexneri Wzy: identification of the residues affecting O antigen
modal chain length control, and Wzz-dependent polymerisation
activity
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
120
Mutational analysis of the major periplasmic loops of
Shigella flexneri Wzy: identification of the residues
affecting O antigen modal chain length control, and Wzz-
dependent polymerisation activity
Pratiti Nath and Renato Morona
Discipline of Microbiology and Immunology, School of Molecular and
Biomedical Science, University of Adelaide, Adelaide 5005, Australia
Microbiology. 2015 Apr;161(Pt 4):774-85. doi: 10.1099/mic.0.000042. Epub 2015 Jan 27.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
121
Statement of Authorship
Title of Paper Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz dependent polymerisation activity.
Author Contributions By signing the Statement of Authorship, each author certifies that their stated contribution to the publication is accurate and that permission is granted for the publication to be included in the candidate’s thesis. Name of Principal Author (Candidate)
Pratiti Nath
Contribution to the Paper Performed all experiments, performed analysis on all
samples, interpreted data, and wrote manuscript.
Signature
Date 20.5.15
Name of Co-Author Renato Morona
Contribution to the Paper Supervised development of work, helped in data
interpretation, manuscript evaluation and editing.
Signature
Date
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
122
Chapter 4: Second paper
4.1 Abstract
The O antigen (Oag) component of LPS is a major Shigella flexneri virulence determinant.
Oag is polymerised by WzySf, and its modal chain length is determined by WzzSf and
WzzpHS2. Site-directed mutagenesis was performed on wzySf in pWaldo-wzySf-TEV-GFP to
alter Arg residues in WzySf’s two large periplasmic loops (PLs) (PL3 and PL5). Analysis of
the LPS profiles conferred by mutated WzySf proteins in the wzySf deficient ("wzy) strain
identified residues that affect WzySf activity. The importance of the guanidium group of the
Arg residues was investigated by altering the Arg residues to Lys and Glu, which generated
WzySf mutants conferring altered LPS Oag modal chain lengths. The dependence of these
WzySf mutants on WzzSf was investigated by expressing them in a wzySf and wzzSf deficient
("wzy "wzz) strain. Comparison of the LPS profiles identified a role for the Arg residues in
the association of WzySf and WzzSf during Oag polymerisation. Colicin E2 and bacteriophage
Sf6c susceptibility supported this conclusion. Comparison of the expression levels of different
mutant WzySf -GFPs with the wild-type WzySf-GFP showed that certain Arg residues affected
production levels of WzySf in a WzzSf -dependent manner. To our knowledge, this is the first
report of S. flexneri WzySf mutants having an effect on LPS Oag modal chain length, and
identified functionally significant Arg residues in WzySf.
4.2 Introduction
Shigella flexneri is the main causative agent for the disease shigellosis or bacterial dysentery.
Approximately, 125 million shigellosis cases occur annually in Asia, with nearly 14000
fatalities (Bardhan et al., 2010). The O antigen (Oag) component of the lipopolysaccharide
(LPS) of Shigella flexneri plays an important role in the pathogenesis of the bacteria. Oag is
composed of oligosaccharide repeat units (RUs) or O units. Oag is linked to the hydrophobic
anchor of the LPS (Lipid A) by the non-repeating oligosaccharide domain known as the core
sugar region (Raetz & Whitfield, 2002; Sperandeo et al., 2009). The complete LPS structure
with Oag chains is termed smooth LPS (S-LPS). However, the LPS structure devoid of Oag is
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
123
termed rough LPS (R-LPS), and LPS with only one O unit is termed semi-rough LPS (SR-
LPS) (Morona et al., 1994).
Oag is the serotype determinant and also the protective antigen of the bacteria (Jennison
& Verma, 2004; Stagg et al., 2009; Sun et al., 2013b). On the basis of the composition of
Oag, S. flexneri is divided into 17 serotypes (Sun et al., 2013b). Except serotype 6, all the
serotypes share a basic polysaccharide backbone containing three L-rhamnoses (Rha), and
one N-acetylglucosamine (GlcNAc). This basic Oag structure is known as serotype Y. The
differences between the serotypes are conferred by addition of glucosyl, O-acetyl, or
phosphoethanolamine (PEtN) functional groups by various linkages to the sugars of the basic
tetrasaccharide RU (Allison & Verma, 2000; Sun et al., 2012; Wang et al., 2010b). Oag
restricts the accessibility of the colicin to their outer membrane (OM) receptor protein (Tran
et al., 2014; van der Ley et al., 1986). In addition, the bacteriophage Sf6 uses Oag as a
receptor and forms plaques on serotype Y and X strains (Lindberg et al., 1978).
S. flexneri LPS biosynthesis occurs mainly by two separate pathways: 1) lipid A and
core biosynthesis and 2) Oag biosynthesis. Oag biosynthesis occurs on either side of the inner
membrane (IM) and it is mediated by the Wzy-dependent pathway (Allison & Verma, 2000;
Morona et al., 1995). S. flexneri Oag biosynthesis starts by the transfer of GlcNAc phosphate
from an uridine diphosphate-GlcNAc (UDP-GlcNAc) to undecaprenol phosphate (Und-P) at
the cytoplasmic side of the IM by WecA (Guo et al., 2008; Liu et al., 1996; Wang et al.,
2010b). The rhamnosyl transferases (RfbG and RfbF) then add sequential Rha residues to the
GlcNAc to form the O unit (Morona et al., 1994). Translocation of the O unit to the
periplasmic side is mediated by the protein Wzx. At the periplasmic side O units are
polymerised by Wzy to form the Oag. The chain length of the Oag is regulated by Wzz
(Daniels et al., 1998; Morona et al., 1994). Finally, the Oag chains are transferred to the core-
lipid A by the ligase WaaL. The Lpt proteins (Lpt A-G) facilitate the transport of the LPS
from the IM to the OM (Ruiz et al., 2008; Sperandeo et al., 2009).
S. flexneri Wzy (WzySf) is a 43.7 kDa hydrophobic integral membrane protein. It has 12
transmembrane (TM) segments and two large periplasmic (PL) domains (PL3 and PL5)
(Daniels et al., 1998; Morona et al., 1994). Previously we were able to identify some of the
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
124
key functional amino acid residues of WzySf, providing insight into WzySf structure and
function (Nath et al., 2015). WzySf has an RX15G motif in both of the PL3 and PL5 starting
from R164 in PL3 and from R289 in PL5. There are several Arg residues between these two
motifs. In the Pseudomonas aeruginosa Wzy (WzyPa), it was found that the PL3 and PL5
have RX10G motifs, which are important for Oag polymerisation activity. There are several
Arg residues within these two motifs, which play an important role in the Oag polymerisation
(Islam et al., 2011). However, there is little sequence identity between WzySf and WzyPa.
(Islam et al., 2013) performed extensive work on WzyPa and conducted a “jackhammer”
search to find the homologues of WzyPa. However, their results showed that WzyPa is not
related to Wzy from Enterobacteriaceae.
The modal length of the Oag chain is regulated by Wzz proteins, members of the
polysaccharide co-polymerase (PCP) family (Morona et al., 2000b). S. flexneri 2a has S-LPS
with two types of modal chain length: short (S) type (11-17 Oag RUs) and very long (VL)
type (>90 Oag RUs), and the S-type and VL-type Oag chain lengths are determined by WzzSf
and WzzpHS2, respectively (Morona et al., 2003; Morona & Van Den Bosch, 2003b).
(Woodward et al., 2010) proposed that Wzy and Wzz have an interaction during Oag
biosynthesis and that these two proteins are enough to shape the Oag modal chain length.
Several other research groups have also suggested that Wzz and Wzy interact during Oag
biosynthesis (Islam et al., 2013; Marolda et al., 2006; Taylor et al., 2013; Tocilj et al., 2008).
However, there is a lack of direct evidence on the association of Wzz and Wzy in Oag
polymerisation and chain length control. Recently, we identified the WzzSf dependent WzySf
mutants, and showed that WzzSf has a novel role in the stability of WzySf and also in the Oag
polymerisation activity of WzySf (Nath et al., 2015).
In this study we performed site-directed mutagenesis on Arg residues in the PL3 and
PL5 of WzySf and identified key Arg residues (R164, R250, R258, and R289) important for
WzySf polymerisation activity and Oag modal chain length control. Several Arg residues have
a role in the association of WzzSf and WzySf during Oag biosynthesis and the WzzSf dependent
stability of WzySf.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
125
4.3 Materials and Methods
4.3.1 Bacterial strains and plasmids
The strains and plasmids used in this study are detailed in Table 4.1.
4.3.2 Growth media and growth conditions
The growth media used were lysogeny broth (LB) broth (10 g/liter tryptone, 5 g/liter yeast
extract, 5 g/liter NaCl) and LB agar (LB broth, 15 g/liter bacto agar).
Strains were grown in LB broth with aeration for 18 h at 37°C. 18 h cultures were
diluted 1/20 into fresh LB broth and grown to mid-exponential phase (OD600 of 0.4-0.6). To
suppress protein expression, growth medium was supplemented with 0.2% (w/v) glucose
where required. Cells were centrifuged (2200 x g, SIGMA 3K15 table top centrifuge, 10 min,
4°C) and washed twice with LB broth to remove glucose. To induce protein expression, 0.2%
(w/v) L-Arabinose was added to cultures and grown for 20 h at 20°C. Antibiotics were added
as required to the media at the following final concentrations: 50 µg/ml kanamycin (Km) and
25 µg/ml chloramphenicol (Cm).
4.3.3 LPS method
LPS was prepared as described previously (Nath et al., 2015). Cells (1X109) were harvested
and resuspended in lysing buffer and incubated with proteinase K for approximately 16 h. The
LPS samples were then separated by SDS-PAGE on 15% (w/v) gels for 16.5 h at 12 mA.
Silver nitrate was used to stain the gels and finally the gels were developed with
formaldehyde (Murray et al., 2003).
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
126
Table 4.1 Bacterial strains and plasmids used in this study
Strains or Plasmids Characteristics* Reference Strains S. flexneri PE638 S. flexneri Y rpoB (Rifr) (Morona et al., 1994) RMM109 PE638"wzy, Rifr (Morona et al., 1994) RMA4337 RMM109 "wzz (Rifr, Tetr) (Nath et al., 2015) PNRM6 RMM109 (pAC/pBADT7-1) (Nath et al., 2015) PNRM13 PNRM6 (pRMPN1) (Nath et al., 2015) PNRM16 PNRM6 (pRMPN2) This study PNRM17 PNRM6 (pRMPN3) This study PNRM18 PNRM6 (pRMPN4) This study PNRM19 PNRM6 (pRMPN5) This study PNRM20 PNRM6 (pRMPN6) This study PNRM126 RMA4337 (pAC/pBADT7-1) (Nath et al., 2015) PNRM134 PNRM126 (pRMPN1) (Nath et al., 2015) PMRM127 PNRM126 (pRMPN2) This study PMRM128 PNRM126 (pRMPN3) This study PMRM129 PNRM126 (pRMPN5) This study PMRM130 PNRM126 (pRMPN6) This study PMRM153 PNRM126 (pRMPN4) This study PNRM190 PNRM6 (pRMPN27) This study PNRM192 PNRM6 (pRMPN28) This study PNRM194 PNRM6 (pRMPN29) This study PNRM196 PNRM6 (pRMPN30) This study PNRM198 PNRM6 (pRMPN31) This study PNRM216 PNRM6 (pRMPN32) This study PNRM218 PNRM6 (pRMPN33) This study PNRM220 PNRM6 (pRMPN34) This study PNRM222 PNRM6 (pRMPN36) This study PNRM232 PNRM6 (pRMPN35) This study
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
127
Table 4.1 continued Strains or Plasmids Characteristics* Reference E. coli XL10-G Tet r"(mcrA)183 "(mcrCB-hsdSMR-
Plasmids pAC/pBADT7-1 Source of T7 RNA polymerase; Cmr (McKinney et al., 2002)
pWaldo-TEV-GFP Cloning vector with GFP tag; Kmr (Waldo et al., 1999) pRMPN1 pWaldo-wzySF-GFP; Kmr (Nath et al., 2015) pRMPN2 pRMPN1 with WzyR164A This study pRMPN3 pRMPN1 with WzyR250A This study pRMPN4 pRMPN1 with WzyR258A This study pRMPN5 pRMPN1 with WzyR278A This study pRMPN6 pRMPN1 with WzyR289A This study pRMPN27 pRMPN1 with WzyR164K This study pRMPN28 pRMPN1 with WzyR250K This study pRMPN29 pRMPN1 with WzyR258K This study pRMPN30 pRMPN1 with WzyR278K This study pRMPN31 pRMPN1 with WzyR289K This study pRMPN32 pRMPN1 with WzyR164E This study pRMPN33 pRMPN1 with WzyR250E This study pRMPN34 pRMPN1 with WzyR258E This study pRMPN35 pRMPN1 with WzyR278E This study pRMPN36 pRMPN1 with WzyR289E This study
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
128
4.3.4 Site-directed mutagenesis
Site-directed mutagenesis on wzySf in plasmid pRMPN1 (Nath et al., 2015; Waldo et al.,
1999) was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit
(Catalogue number 210518, Stratagene) following the manufacturer’s instructions.
Mutagenised plasmids were transformed into XL10-Gold. Plasmids were isolated and the
mutations within the coding region were identified by DNA sequencing (AGRF, Adelaide,
Australia). The oligonucleotide primers used for site-directed mutagenesis are listed in
Supplementary Table 4.S1.
4.3.5 Detection of WzySf expression in S. flexneri
Procedure of WzySf-GFP expression in S. flexneri has been described previously (Nath et al.,
2015). Cells were harvested from the 50 ml L-arabinose induced culture. Then the cell pellet
was resuspended in 4 ml sonication buffer (20 mM Tris-HCl, 150 mM NaCl, pH 7.5) and
lysed by sonication. Cell debris was removed by centrifugation (2200 x g, SIGMA 3K15 table
top centrifuge, 10 min, 4 °C). The whole membrane (WM) fraction was isolated by
ultracentrifugation (Beckman Coulter Optima L-100 XP bench top ultracentrifuge, 126 000 X
g, 1 h, 4 °C). The WM fraction was resuspended in PBS and then solubilised in Buffer A [200
mM Tris-HCl (pH 8.8), 20% (v/v) glycerol, 5 mM EDTA (pH 8.0), 0.02% (w/v)
bromophenol blue, 4% (w/v) SDS, and 0.05 M DTT]. Solubilised WM fractions (from 3 X
108 cells) were electrophoresed on SDS-15% (w/v) PAGE gels. Gels were rinsed with
distilled water, and fluorescent imaging of the gels was performed to detect wild type (WT)
and mutant WzySf-GFP protein expression with a Bio-Rad Gel Doc XR + System using Image
Lab software (excitation at 485 nm and emission at 512 nm). Loading was checked by
staining the gels with Coomassie Blue R-250. The intensity of WT and mutant WzySf-GFP
expression in control and mutant strains was measured by Fiji image processing package
(http://fiji.sc/Fiji) and the percent relative WzySf-GFP intensity for each mutant was measured
by comparing with WT WzySf-GFP intensity in the control strain PNRM13.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
129
4.3.6 Colicin sensitivity assay
For the colicin sensitivity assay, His6-colicin E2 (ColE2) with an initial concentration of 1
mg/ml was used (Tran et al., 2014). The procedure of ColE2 spot assay has been described
previously (Nath et al., 2015). The ColE2 spot assay was performed for all strains expressing
WT and mutant WzySf-GFP and the other control strains. The end point of the killing zones of
mutant strains was compared with the controls.
4.3.7 Bacteriophage sensitivity assay
The procedures used for phage propagation and phage stock preparation have been described
previously (Mavris et al., 1997; Morona et al., 1994), and the bacteriophage Sf6c sensitivity
assay was as described previously (Nath et al., 2015). Phage sensitivity of all strains
expressing mutant WzySf-GFP was compared with the strains expressing WT WzySf-GFP and
the other controls.
4.4 Results
4.4.1 Site-directed mutagenesis of Arg residues in PL3 and PL5 of WzySf
In a previous study on WzySf, random mutagenesis failed to detect any functional residue in
PL5 (Nath et al., 2015). However, Islam et al. (2011) found that the Arg residues in the two
principal PLs (PL3 and PL5) of WzyPa are important for Oag polymerisation activity. The
RX10G motifs of the PL3 and PL5 of WzyPa (Islam et al., 2011) are absent in WzySf.
However, both PL3 and PL5 of WzySf contained RX15G motifs (starting from R164 in PL3
and R289 in PL5) (Fig. 4.1) (Table 4.S2), and there are also several Arg residues between
these two motifs. So, site-directed mutagenesis on wzySf in the pRMPN1 was performed to
change the basic polar and positively charged Arg residues (R164, R250, R258, R278, and
R289) to Ala (no-npolar and neutral substitution), Lys (basic polar and positively charged
substitution), and Glu (acidic polar and negatively charged substitution) (Fig. 4.1) (See
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
130
Figure 4.1 Location of the mutations constructed in this study on the topology map of WzySf Mutational alterations were indicated by arrows on the WzySf topology map [adapted from
Daniels et al. (1998)]. The positions of PL1-5, TM1-12, and cytoplasmic loops (CL) 1-5 are
indicated. The residues mutated in this study (dark grey circles) are located in PL3 and 5. The
position of RX15G motifs (light grey circles) in PL3 and PL5 of WzySf, starting from R164 and
R289 respectively, are indicated.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
131
Materials and Methods). Mutated plasmids were transformed into PNRM6 [RMM109
(pAC/pBADT7-1)] (!wzy) (Table 4.1) for phenotypic analysis (Nath et al., 2015).
4.4.2 LPS phenotype conferred by the WzySf mutants
LPS profiling by SDS-PAGE and silver staining were used to detect the effect of the WzySf
mutations on the LPS Oag polymerisation. Mutants were initially grouped into five different
phenotypic classes (A, B, C, D, and F) (Fig. 4.2 and Table 4.2) by comparing the LPS profiles
of the mutant strains with the WT positive control PNRM13. Based on the number of Oag
RUs in the Oag modal chain length (WzzSf regulated S-type) the class A mutants were further
subdivided into subclasses A1, A2, and A3 (Table 4.2). The mutational alteration R164A
resulted in complete loss of Oag polymerisation activity (SR-LPS or class C) (Fig. 4.2, lane
3), R164K resulted in an S-LPS with reduced Oag polymerisation (<30 Oag RUs) and lacking
modal chain length control (class F LPS) (Fig. 4.2, lane 5; and Table 4.2), and R164E resulted
in complete loss of polymerisation activity (SR-LPS or class C) (Fig. 4.2, lane 7), similar to
R164A. Mutational alterations R250A and R250E resulted in decreased Oag polymerisation
activity (LPS with <11 Oag RUs or class B) (Fig. 4.2, lanes 9 and 13). However, the
mutational alteration R250K resulted in an S-LPS with reduced Oag polymerisation, and the
modal chain length was reduced to 8-11 RUs (subclass A1) (Fig. 4.2, lane 11; and Table 4.2)
and was just detectable compared to the positive control (PNRM13). Similar to mutational
alterations of R164, both R258A and R258E resulted in an SR-LPS (class C) (Fig. 4.2, lanes
15 and 19). The mutational alteration R258K resulted in an S-LPS with reduced
polymerisation and the modal chain length was reduced to 9-14 RUs (subclass A2) (Fig. 4.2,
lane 17; and Table 4.2). For residue R278, the mutational alterations investigated had no
detectable effect on the LPS profiles, and all strains had LPS profiles (class D) similar to the
relevant WT control (PNRM13) (Fig. 4.2, lanes 21, 23, and 25). For residue R289, mutational
alteration R289A resulted in a class A LPS profile and the LPS Oag modal chain length of
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
132
Figure 4.2 Comparison of the LPS phenotype conferred by the WzySf mutants expressed in the "wzy and "wzy "wzz backgrounds The plasmids encoded mutant and WT WzySf proteins were expressed in PNRM6 [RMM109
(pAC/pBADT7-1)] and PNRM126 [RMA4337 (pAC/pBADT7-1)]. Strains were grown and
induced as described in the Materials and Methods. LPS samples were electrophoresed on a
SDS-15% (w/v) PAGE gel and silver stained (See Materials and Methods). Strains were
grouped into various mutant classes (A-F) and subclasses (A1-3) based on their LPS profiles
as described in the text (Table 4.2). Lanes 1-2 are: 1. PNRM13 [PNRM6 (pRMPN1)]; 2.
PNRM134 [PNRM126 (pRMPN1)]. Lanes 3-32 are the "wzy or "wzy "wzz strains with
plasmids encoding mutated WzySf proteins. The WzySf mutants in each lane are as follows: 3.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
("wzy), 32. R289E ("wzy "wzz). The position of R-LPS is indicated. The numbers on the left
and right indicate the Oag RUs. Letters (A1-3, B-F) at the bottom indicate the mutant class
(Table 4.2).
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
134
Table 4.2 LPS profiles of different WzySf mutant phenotypic classes
WzySf mutant Class LPS profile A1 S-LPS with reduced Oag polymerisation, and the modal
chain length was reduced to 8-11 RUs A2 S-LPS with reduced polymerisation and the modal chain
length was reduced to 9-14 or 8-14 Oag RUs A3 S-LPS with reduced polymerisation (<22 Oag RUs) and
the modal chain length was similar to the WT control (PNRM13)
B LPS with few Oag RUs (<11 Oag RUs) C SR-LPS D LPS profile similar to the WT control PNRM13 E S-LPS lacking Oag modal chain length control F S-LPS with reduced Oag polymerisation and lacking Oag
modal chain length control (<30 Oag RUs)
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
135
this strain was similar to PNRM13 (Fig. 4.2, lane 27; and Table 4.2) but lacked S-LPS with
Oag >22 RUs; the LPS profile of this strain was further classified as subclass A3. The
mutational alteration R289E resulted in a class A LPS profile with an Oag modal length of 8-
14 RUs (Subclass A2) (Fig. 4.2, lane 31; and Table 4.2) that was shorter than that seen in the
positive control (PNRM13). The mutational alteration R289K resulted in a class D LPS
profile (Fig. 4.2, lane 29). So, except R278 the other Arg residues (R164, R250, R258, and
R289) were found to be important for WzySf Oag polymerisation activity. For the positions
R164, R1250, and R258 the guanidium functional group of Arg is important as Lys
substitution resulted in partial WzySf activity. In particular, certain substitutions [R164K (no
4.2) resulted in an S-LPS with a decreased Oag modal chain length.
4.4.3 WzzSf dependence and polymerisation activity
Previously we found an effect of WzzSf on WzySf Oag polymerisation activity (Nath et al.,
2015). We investigated the dependence of the mutant WzySf proteins generated above on
WzzSf for their Oag polymerisation activity. All the plasmids encoding the mutated WzySf
proteins were transformed into the strain PNRNM126 [RMA4337 (pAC/pBADT7)], which
has both wzySf and wzzSf genes inactivated. LPS profiles conferred in the PNRM126
background (!wzy !wzz) were directly compared with the LPS profiles conferred in the
PNRM6 background (!wzy). The positive control strain in the !wzy !wzz background,
PNRM134 [PNRM126 (pRMPN1)] (Table 4.1) had a class E LPS profile (S-LPS without
Oag modal length control) (Fig. 4.2, lane 2; and Table 4.2). WzySf with Ala, Lys, and Glu
substitutions of R164 resulted in similar LPS profiles both in the !wzy and !wzy !wzz
backgrounds (Fig. 4.2, lanes 3-4, 5-6, and 7-8). The WzySf mutations R250A, R250E, and
R258A resulted in similar LPS profiles both in the !wzy and !wzy !wzz backgrounds (Fig.
4.2, lanes 9-10, 13-14, and 15-16). Interestingly, WzyR250K resulted in LPS with greatly
reduced Oag polymerisation (class B) in the !wzy !wzz background (Fig. 4.2, lane 12)
compared to the !wzy background (class A1) (Fig. 4.2, lane 11). In contrast, WzyR258E
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of the residues affecting O antigen modal chain length control, and Wzz-dependent polymerisation activity
136
resulted in dramatic increase in Oag polymerisation in the !wzy !wzz background (class E)
compared to the !wzy background (Class C) (Fig. 4.2, lanes 19-20). However, WzyR258K
resulted in a class F LPS profile (Fig. 4.2, lane 18) in the !wzy !wzz background. For residue
R278, all changes resulted in class E LPS profiles (Fig. 4.2, lanes 22, 24, and 26) in the !wzy
!wzz backgrounds, as expected. WzyR289A and WzyR289E resulted in class F LPS profiles
(Fig. 4.2, lanes 28 and 32) in the !wzy !wzz background. In contrast, the !wzy !wzz strain
with WzyR289K resulted in an S-LPS lacking Oag modal chain length control (class E LPS
profile) (Fig. 4.2, lane 30) and was similar to the control PNRM134 (Fig. 4.2, lane 2). Hence,
some of the WzySf mutants showed remarkably different LPS profiles in the absence of
WzzSf, indicating WzzSf dependence of their Oag polymerisation activity as previously
reported for other WzySf mutants (Nath et al., 2015).
4.4.4 ColE2 sensitivity of strains with WzySf mutants
The ColE2 sensitivity of the strains expressing WzySf mutants was investigated to verify the
LPS profiles determined by SDS-PAGE and silver staining. The ColE2 sensitivity
(summarised in Table 4.3) was determined by spot testing as described in the Materials and
Methods.
As expected, the negative control strains RMM109, PNRM6, PNRM11, RMA4337,
and PNRM126 had the highest sensitivity to ColE2 (killing zone at a dilution of 1/256) (Table
4.3). The WT strain PE638 and the positive control with WzySf-GFP in the !wzy !wzz
background (PNRM134) were resistant to the highest concentration of ColE2 used. However,
the positive control with WzySf-GFP in the !wzy background (PNRM13) showed a killing
zone at a dilution of 1/2 (Table 4.3), as previously reported (Nath et al., 2015). Strains with a
class A LPS profile in the !wzy background was sensitive to ColE2. Among them, strains
with decreased Oag modal chain length (subclass A1) were relatively more sensitive to ColE2
(killing zone at 1/64). However, the strains with more Oag (subclass A2 and A3) showed a
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation
137
Table 4.3 ColE2 and bacteriophage Sf6c sensitivities, and WzySf-GFP expression levels Sensitivity* Mutant class ColE2
Sf6c Relative WzySf-GFP (%)
Strain or mutants
Relevant details !wzy background
!wzy !wzz background
Topology map location#
!wzy background
!wzy !wzz background
!wzy background
!wzy !wzz background
!wzy background
!wzy !wzz background
Strains RMM109 wzySf mutant 1/256 - R - - - PE638 Wild type R - 10-6 - - - PNRM13 Positive control 1/2 - 10-5 - 100 - PNRM6 Negative control 1/256 - R - - - PNRM11 Negative control 1/256 - R - - - RMA4337 wzySf and wzzSf
mutant - 1/256 - R - -
PNRM126 Negative control - 1/256 - R - - PNRM134 Positive control - R - 10-6 - 17 Mutants R164A C C PL3 1/256 1/256 R R 132 87 R250A B B PL5 1/128 1/128 R R 81 55 R258A C C PL5 1/256 1/256 R R 62 200 R278A D E PL5 R 1/16 10-6 N 18 14 R289A A3 F PL5 1/32 1/128 R R 14 82 R164K F F PL3 1/64 1/128 R R 120 125 R250K A1 B PL5 1/64 1/128 R R 142 11 R258K A2 F PL5 1/32 1/64 N R 104 0.02 R278K D E PL5 1/2 1/16 10-5 10-1 46 36 R289K D E PL5 1/4 1/64 10-5 N 60 38 R164E C C PL3 1/256 1/256 R R 80 99 R250E B B PL5 1/128 1/128 R R 133 143 R258E C E PL5 1/256 1/64 R R 16 38 R278E D E PL5 R 1/64 10-6 R 135 28 R289E A2 F PL5 1/32 1/64 N R 21 140
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
138
# PL - Periplasmic loop (See Fig. 4.1).
* R, Resistant; N, plaques detected with undiluted Sf6c stock; the numbers represent the highest
dilution showing the zone of inhibition or plaques formation.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
139
killing zone at 1/32. Strains with a class B LPS profiles (both !wzy and !wzy !wzz backgrounds)
showed a killing zone at 1/128. As expected, the strains with class C LPS profiles (SR-LPS) (both
!wzy and !wzy !wzz backgrounds) showed the highest sensitivity to ColE2 (killing zone at 1/256),
and their sensitivity to ColE2 was similar to the negative control strains. Strains with WT like class
D LPS profiles (!wzy background) were more resistant to ColE2 (killing zone R-1/4). Among them
the !wzy strains with WzyR278A and WzyR289E showed ColE2 sensitivity similar to the WT strain
PE638, greater than the relevant positive control PNRM13. Strains with a class E LPS profile (!wzy
!wzz background) showed greater sensitivity to ColE2 (killing zone 1/16-1/64) compared to the
relevant positive control PNRM134, suggesting that they had a decreased level of Oag
polymerisation. Strains with a class F LPS profile in the !wzy and !wzy !wzz backgrounds were also
very sensitive to ColE2, and showed a killing zone at 1/64 or 1/128. Hence, as reported previously
(Nath et al., 2015), the ColE2 assay detects subtle differences in LPS Oag chain length and density,
which are consequences of difference in Oag polymerisation.
4.4.5 Bacteriophage Sf6c sensitivity of strains with WzySf mutants
The bacteriophage Sf6c sensitivity of the strains expressing WzySf mutants was investigated to
further verify the LPS profiles determined by SDS-PAGE and silver staining. The bacteriophage
Sf6c sensitivity of the strains (summarised in Table 4.3), carrying mutated wzySf plasmids were
determined by spot testing (see Materials and Methods).
The negative control strains (with an SR-LPS profile) RMM109, PNRM6, PNRM11,
RMA4337, and PNRM126 were all resistant to the highest concentration of bacteriophage Sf6c
tested, as expected. The WT strain PE638 and the positive control with WzySf-GFP in the !wzy !wzz
background (PNRM134) showed the highest sensitivity to bacteriophage Sf6c and showed plaques at
10-6 dilution. However, for the positive control with WzySf-GFP in the !wzy background (PNRM13)
the phage showed plaques at 10-5 (Table 4.3) (Nath et al., 2015). Strains with class A, B, C, and F
LPS profiles in the !wzy and !wzy !wzz backgrounds were resistant to the highest concentration of
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
140
bacteriophage Sf6c tested, similar to the negative control strains, except !wzy strain with
WzyR258K and WzyR289E showed plaques for undiluted Sf6c stock. However, the strains with
class D LPS profiles were very sensitive to bacteriophage Sf6c (plaques at 10-5 or 10-6). Among them
the !wzy !wzz strain with WzyR278A and WzyR278E showed the highest sensitivity to Sf6c and
their sensitivity to bacteriophage Sf6c was greater than the relevant positive control PNRM13, and
similar to the positive control with WzySf-GFP in the !wzy !wzz background (PNRM134). The
strains with class E LPS profile were relatively more resistant to bacteriophage Sf6c (resistant or
plaques at 10-1 or N) compared to the relevant positive control PNRM134, indicating a difference in
Oag density. Similar to our previous data (Nath et al., 2015), the bacteriophage Sf6c assays above
indicated that the degree of Oag polymerisation and density is correlated with bacteriophage Sf6c
sensitivity.
4.4.6 Protein expression levels of the WzySf mutants
We measured parental and mutant WzySf-GFP expression in the !wzy and !wzy !wzz backgrounds
by in-gel fluorescence and then calculated the % relative WzySf-GFP expression of all the mutant
strains by comparing expression levels of different WzySf-GFP mutants with the WzySf-GFP in
PNRM13 (100%) (See Materials and Methods). The positive control in the !wzy !wzz background
(PNRM134) had WzySf-GFP expression level (relative WzySf-GFP level 17%) less than the positive
control in the !wzy background (PNRM13) (Fig. 4.3A, B, and C, lanes 1 and 2, Table 4.3).
In both the !wzy and !wzy !wzz backgrounds, with some exceptions, most of the WzySf
mutants were expressed at a level less than 100%. The !wzy strain with WzyR164A had expression
of 132% (Fig. 4.3A, lane 3; and Table 4.3) but the !wzy !wzz strain with WzyR164A had a relative
WzySf-GFP level of 87% (Fig. 4.3A, lane 4; and Table 4.3). Both of these strains had an SR-LPS
profile. The !wzy !wzz strain with WzyR258A had an SR-LPS but the relative WzySf-GFP level was
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
141
Figure 4.3 Protein expression level of the WzySf-GFP mutants The strains were grown in LB and induced as described in the Materials and Methods. In-gel
fluorescence samples were prepared from the mutants in the "wzy and "wzy "wzz backgrounds,
and electrophoresed on SDS 15% (w/v) PAGE gels (See Materials and Methods). (A) Strains in
lane 1 and 2 are as follows: 1. PNRM13 [PNRM6 (pRMPN1)]; 2. PNRM134 [PNRM126
(pRMPN1)]. Lanes 3-12 are the "wzy or "wzy "wzz strains expressing mutated WzySf-GFP
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
142
proteins. The WzySf mutants in each lane are as follows: 3. R164A ("wzy), 4. R164A ("wzy
12. R289K ("wzy "wzz), 13. R298E ("wzy), 14. R289E ("wzy "wzz). In each panel, the relative
WzySf-GFP level of all the mutants were measured by considering the WzySf-GFP in PNRM13 in
lane 1 as 100%. Letters (A1-3, B-F) at the bottom indicate the mutant class (Table 4.2).
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
143
200% (Fig. 4.3A, lane 8; and Table 4.3), which is double than the WzySf-GFP level in PNRM13.
The !wzy strain with WzyR258A had a relative WzySf-GFP level of 62% (Fig. 4.3A, lane 7; and
Table 4.3). Both the !wzy and !wzy !wzz strains with WzyR164K expressed at a level more than
100% (120% and 125%, respectively) (Fig. 4.3B, lanes 3 and 4; and Table 4.3). In the !wzy !wzz
background both WzyR250K and WzyR258K were expressed at a very low level (11% and
0.02%, respectively) (Fig. 4.3B, lane 8; Fig. 4.3C lane 4; and Table 4.3). However, in the !wzy
strain, WzyR250K and WzyR258K were expressed at high levels (142% and 104%, respectively)
(Fig. 4.3B, lane 7; Fig. 4.3C, lane 3; and Table 4.3). Interestingly, the !wzy and !wzy !wzz
strains with WzyR250E had class B LPS profile but their relative WzySf-GFP levels were 133%
and 143%, respectively (Fig. 4.3B, lanes 9 and 10; and Table 4.3). The !wzy strain with
WzyR278E and the !wzy !wzz strain with WzyR289E had very high relative WzySf-GFP levels
(135% and 140%, respectively) (Fig. 4.3C, lanes 9 and 14; and Table 4.3). However, the !wzy
!wzz strain with WzyR278E and the !wzy strain with WzyR289E had low relative WzySf-GFP
levels (28% and 21% respectively) (Fig. 4.3C, lanes 10 and 13; and Table 4.3). Comparison of %
WzySf-GFP expression levels of different mutants in the !wzy and !wzy !wzz backgrounds
indicates that the expression of certain WzySf mutant proteins was affected by WzzSf.
4.5 Discussion
Wzy proteins are essential for the synthesis of many Oags that are virulence determinants of the
Gram-negative bacteria. WzySf has two large PLs (PL3 and PL5) (Daniels et al., 1998). During
mutational characterisation of WzySf we found that the amino acid P165 in PL3 is important for
the stabilisation of WzySf through interaction with WzzSf (Nath et al., 2015). However, through
random mutagenesis we were unable to identify any other amino acid residues in PL3 and PL5
important for the Oag polymerisation activity and association with WzzSf. In this study site-
directed mutagenesis of these two loops generated mutants that were then characterised based on
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
144
their LPS profiles, ColE2 and bacteriophage Sf6c sensitivities, and WzySf-GFP expression to
reveal novel mutant phenotypes.
Islam et al. (2011) showed that the mutational alteration of Arg to Ala in the WzyPa PL3
and PL5 within the two RX10G motifs resulted in either complete or partial loss of Oag
polymerisation activity and alterations of some of the Arg residues to Lys resulted in LPS
profiles similar to their Ala substitution. In S. flexneri, site-directed mutation of R164, R250,
R258, and R289 to Ala also resulted in the complete or partial loss of Oag polymerisation activity
in the "wzy background. The Arg residues in PL3 and PL5 were changed to Ala, Lys, and Glu to
determine the importance of the guanidium functional group of Arg at these positions. In the
!wzy background, Ala, Lys, and Glu substitutions of R164, R250, and R258 resulted in complete
or partial loss of polymerisation (Fig. 4.2). Lys substitutions at these three positions resulted in S-
LPS with reduced degree of Oag polymerisation (class F or class A) but with different Oag modal
chain lengths [Class F (without modal chain), class A1 (8-11 RUs), class A2 (9-14 RUs)] (Fig.
4.2) compared to the relevant positive control PNRM13. These WzySf mutants (WzyR164K,
WzyR250K, and WzyR258K) resulted in LPS with different Oag modal chain lengths. So,
guanidium functional group of Arg residues at these positions had a position-specific effect on
Oag polymerisation and modal chain length control. This effect has not been reported previously
for S. flexneri wzySf mutations.
Previously, we found Wzz-dependent WzySf mutants (Nath et al., 2015). In this study, we
found several new examples of WzzSf-dependent WzySf mutants. The !wzy !wzz strain with
WzyR250K had decreased Oag polymerisation in the absence of WzzSf and the !wzy !wzz strain
with WzyR258E had increased Oag polymerisation in the absence of WzzSf, even though
WzyR258E was inactive in the !wzy background (Fig. 4.2). Hence, residues R250 and R258
have roles in the association of WzySf and WzzSf during the WzySf mediated Oag polymerisation.
These and our previous results (Nath et al., 2015) suggest that the interactions between WzySf
and WzzSf are complex.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
145
The ColE2 and bacteriophage Sf6c sensitivity assays supported the LPS profiles of the
WzySf mutants. We found that the WzySf mutants with shorter Oag chains in the LPS were more
sensitive to ColE2 (Table 4.3), consistent with our previous results (Nath et al., 2015). Here we
found that in the !wzy background the strains with different Oag modal chain lengths showed
different sensitivities to ColE2, with an increase in resistance correlated with an increase in Oag
RUs in the LPS Oag modal chain. Strains with class A-C LPS profiles in the !wzy background
were resistant to bacteriophage Sf6c (Table 4.3). This result was consistent with our previous
findings (Nath et al., 2015) that bacteriophage Sf6c only infects if the S-LPS has WT or nearly
WT level of Oag polymerisation. In our previous study we found that while the strains with class
D LPS had S-LPS profiles very similar to the relevant positive control strain (PNRM13), they
were more resistant to ColE2 and more sensitive to bacteriophage Sf6c compared to PNRM13
(Nath et al., 2015). Here the !wzy strain with WzyR278A and WzyR278E showed a similar
phenotype (Fig. 4.3, and Table 4.3).
Previously, we found that WzzSf is not only associated with Oag modal chain length
control but also affects the level of WzySf (Nath et al., 2015). In the !wzy and !wzy !wzz
backgrounds most of the mutant WzySf-GFP proteins had expression levels less than the WzySf-
GFP in PNRM13 (Table 4.3). However, in the !wzy background the expression level of
WzyR164A and in the !wzy !wzz background the expression level of WzyR258A were greater
than the WzySf-GFP in PNRM13 (Table 4.3). We speculate that residues R164 and R258 are
important for the stabilisation of WzySf through a potential interaction with WzzSf. The !wzy
strain with WzyR164A and the !wzy !wzz strain with WzyR258A had SR-LPS profiles (Fig.
4.2). So, the absence of Oag polymerisation activity is not due to a lack of protein expression.
The !wzy and !wzy !wzz strains with WzyR164K and WzyR250E had a higher level of
expression compared to WzySf-GFP in PNRM13 but the LPS profiles of these strains indicated
that the mutant proteins had decreased Oag polymerisation activity compared to the relevant
positive controls (Table 4.3 and Fig. 4.3). So, these mutations in some way stabilised the protein,
both in the presence and absence of WzzSf.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
146
The !wzy strain with WzyR250K and WzyR258K had high levels of expression but !wzy
!wzz strain with WzyR250K and WzyR258K had very low levels of expression (Fig. 4.3 and
Table 4.3), suggesting that the presence of WzzSf stabilises these WzySf mutants. The !wzy strain
with WzyR250K had LPS with an increased degree of Oag polymerisation compared to !wzy
!wzz strain with WzyR250K, and the !wzy and the !wzy !wzz strains with WzyR258K had
nearly similar LPS profiles (class A2 and class F), but the !wzy strain with WzyR258K had LPS
with an Oag modal chain length of 9-14 RUs (Fig. 4.2). However, all these strains had LPS with
a decreased level of Oag polymerisation compared to the relevant positive controls. These results
again suggest that Oag polymerisation activity of WzySf is not correlated with the expression
level of the protein. The !wzy strain with WzyR278E and the !wzy !wzz strain with WzyR289E
(Fig. 4.3 and Table 4.3) had higher levels of expression compared to the WzySf-GFP in PNRM13.
Hence, residues R278 and R289 are also important for the stabilisation of WzySf through a
potential interaction with WzzSf.
According to the model proposed by Islam et al. (2011), at physiological pH, WzyPa PL3
and PL5 possess a net positive charge and a net negative charge, respectively. PL3, the “capture
arm”, catches incoming negatively charged Oag subunit for subsequent transfer to PL5, which
acts as a “retention arm”. It involves a relatively transient interaction with the Oag and is
responsible for the constant binding and release of growing Oag chain. They proposed that these
characteristics of PLs support their roles in the “catch- and-release” mechanism during Oag
polymerisation by Wzy (Islam et al., 2011). Zhao et al. (2014) found that Escherichia coli O86
Wzy (WzyEc) has a different number of TM and different amino acid sequence compared to
WzyPa but the pI values of PL3 and PL4 (the two largest PLs) of WzyEc are equivalent to PL3 and
PL5 of WzyPa. At physiological pH, PL3 and PL4 of WzyEc possess a net positive charge and a
net negative charge, respectively, which led them to conclude that WzyEc follows a similar
catalytic mechanism to WzyPa (Zhao et al., 2014). For WzySf, we found that the pI values of PL3
and Pl5 were 4.65 and 5.09, respectively, using the ExPASy pI calculator
(http://web.expasy.org/compute_pi/). Hence, at physiological pH both the PL3 and PL5 of WzySf
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
147
possess net negative charge. While the P. aeruginosa PAO1 Oag contains negatively charged
uronic acid (Knirel et al., 2006), S. flexneri Oag is neutral. So, the charge property of the substrate
for WzySf is different from the WzyPa. Polymerisation of the Oag of all the serotypes of S. flexneri
is conducted by a single type of WzySf, which defines the flexibility of substrate recruitment of
WzySf. The RX10G motifs of WzyPa contain several other Arg residues within the motifs (R176,
R180 in PL3 and R291 in PL5) (Islam et al., 2011; Islam et al., 2013) but the WzySf had no Arg
residues within the RX15G motifs of PL3 and PL5 (Fig. 4.1). The RX10G motifs of WzyPa starts in
the PL and ends in the PL (Islam et al., 2011; Islam et al., 2013) but the RX15G motifs of WzySf
start in the PL and end in the TM (Fig. 4.1). Nevertheless, we found that the Arg residues in the
PL3 and PL5 have roles in Oag polymerisation, association with WzzSf, and WzySf expression
level. Hence, a modified version of “catch-and-release” mechanism (Islam et al., 2011) may
exist for S. flexneri Oag synthesis.
In conclusion, we identified key Arg residues in PL3 and PL5 of WzySf that are important
for the polymerisation activity, association with WzzSf during polymerisation, and WzzSf
dependent stabilisation of the protein. The WzySf mutants that confer altered Oag modal chain
length suggest that WzzSf functions to alter the activity of WzySf and this is mimicked by certain
mutational alterations, leading to change in the Oag modal chain length. The current findings
extended the previous finding (Nath et al., 2015), and we conclude that a wider region (PL 2, 3,
5, 6 and TM 5, 8) is involved in the Oag polymerisation activity and potential interaction with
WzzSf. We hypothesize that these regions may contribute to the catalytic site of WzySf.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
148
4.6 Acknowledgements
Funding for this work is provided by a Program Grant to R.M. from the National Health and
Medical Research Council (NHMRC) (Grant number: 565526) of Australia. P.N. is the recipient
of an international postgraduate research scholarship (Adelaide Scholarship International) from
the University of Adelaide.
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
150
Table 4.S1 continued Primer *
Sequence (5’-3’) # Mutation Arg to Lys mutation PN34_R278K_R CTAATATAAATGAACCAAATCCTTTTCCAAACA
Mutational analysis of the major periplasmic loops of Shigella flexneri Wzy: identification of residues affecting O antigen modal chain length control and Wzz-dependent polymerisation activity
151
Table 4.S2 Periplasmic loop (PL)3 and PL5 of WzySf
PL Sequence of the PL (5’-3’) pI of the PL Sequence of the RX15G motif (5’-3’)
Detection of Wzy/Wzz interaction in Shigella flexneri
Detection of Wzy/Wzz interaction in Shigella flexneri
154
Detection of Wzy/Wzz interaction in Shigella flexneri
Pratiti Nath and Renato Morona
Department of Molecular and Cellular Biology, School of Biological
Sciences, University of Adelaide, Adelaide 5005, Australia
Microbiology (In Press) Published online 09 July, 2015, doi:10.1099/mic.0.000132
Detection of Wzy/Wzz interaction in Shigella flexneri
155
Statement of Authorship
Title of Paper Detection of Wzy/Wzz interaction in Shigella flexneri
Publication Status Submitted for publication
Publication Details Microbiology (In Press) Published online 09 July, 2015,
doi:10.1099/mic.0.000132
Author Contributions By signing the Statement of Authorship, each author certifies that their stated contribution to the publication is accurate and that permission is granted for the publication to be included in the candidate’s thesis. Name of Principal Author (Candidate)
Pratiti Nath
Contribution to the Paper Performed all experiments, performed analysis on all
samples, interpreted data, and wrote manuscript.
Signature
Date 20.5.15
Name of Co-Author Renato Morona
Contribution to the Paper Supervised development of work, helped in data
interpretation, manuscript evaluation and editing.
Signature
Date
Detection of Wzy/Wzz interaction in Shigella flexneri
156
Chapter 5: Third paper
5.1 Abstract
The O antigen (Oag) component of Shigella flexneri lipopolysaccharide (LPS) is important for
virulence and a protective antigen. It is synthesised by the Wzy-dependent mechanism. S. flexneri
Wzy has 12 transmembrane (TM) segments and two large periplasmic loops (PL). The modal
chain length of the Oag is determined by Wzz. Experimental evidence supports multi-protein
interactions in the Wzy-dependent pathway. However, evidence for direct interaction of Wzy
with the other proteins of the Wzy-dependent pathway is limited. Initially, we purified Wzy-
GFP-His8 and detected the presence of a dimeric form. Then in vivo crosslinking was performed
in a S. flexneri wzy mutant strain carrying plasmids encoding Wzy-GFP-His8 and untagged Wzz.
Following solubilisation with n-dodecyl-"-D-maltopyranoside (DDM) and affinity purification of
Wzy-GFP-His8, immunoblotting with Wzz antibody detected co-purification of Wzz; this was
supported by mass spectrometry (MS) analysis. This is the first reported isolation of a complex
between Wzy and Wzz. Wzy mutants (WzyR164A, WzyV92M, WzyY137H, and WzyR250K)
whose properties are affected by Wzz were able to form complexes with Wzz. Their mutational
alterations do not affect the interaction of Wzy with Wzz. Thus the interaction may involve many
regions of Wzy.
5.2 Introduction
The lipopolysaccharide (LPS) of S. flexneri plays an important role in the pathogenesis of the
bacteria (Jennison & Verma, 2004). LPS is composed of three domains - 1) Lipid A - the
hydrophobic anchor of the LPS, 2) Core oligosaccharides - a non-repeating oligosaccharide
domain, and 3) O antigen (Oag) chains - an oligosaccharide repeat domain. Oag tetrasaccharide
repeat units (RUs) are linked to the Lipid A via the Core (Raetz & Whitfield, 2002).
Oag is the most variable domain, serotype determinant, and also the protective antigen of
the bacteria (Jennison & Verma, 2004; Stagg et al., 2009; Sun et al., 2013b). S. flexneri Oag is
synthesised by the Wzy-dependent pathway (Allison & Verma, 2000; Morona et al., 1995). Oag
Detection of Wzy/Wzz interaction in Shigella flexneri
157
biosynthesis starts by the transfer of N-acetylglucosamine phosphate (GlcNAc-1-P) from an
UDP-GlcNAc to undecaprenol phosphate at the cytoplasmic side of the inner membrane (IM) by
WecA (Guo et al., 2008; Liu et al., 1996; Wang et al., 2010b). Then the rhamnosyl transferases
RfbG and RfbF add sequential rhamnose residues to the GlcNAc to form the RU (Morona et al.,
1994). The flippase protein Wzx translocates the RU to the periplasmic side where the RUs are
polymerised by Wzy to form the Oag. The Oag chain length is determined by Wzz, a
polysaccharide co-polymerase (PCP) type1 protein (Daniels & Morona, 1999; Morona et al.,
1995; Morona et al., 2009). Finally, the ligase WaaL ligates Oag chains to the core-lipid A to
form LPS. The Lpt proteins (Lpt A-G) transport LPS from the IM to the outer membrane (Ruiz et
al., 2008; Sperandeo et al., 2009).
The S. flexneri Oag polymerase protein Wzy (WzySf)2 is a 43.7 kDa hydrophobic integral
membrane protein. It has 12 transmembrane (TM) segments and two large periplasmic (PL)
domains (Daniels et al., 1998; Morona et al., 1994). In S. flexneri 2a Wzy activity is affected by
two types of Wzz - chromosomally encoded WzzSf 3
and pHS-2 plasmid encoded WzzpHS2
(Papadopoulos & Morona, 2010; Purins et al., 2008). This results in LPS with two types of Oag
modal chain lengths: the predominant short (S) type (11 - 17 Oag RUs) determined by Wzz, and
the minor very long (VL) type (>90 Oag RUs) determined by WzzpHS2 (Morona et al., 2003;
Morona & Van Den Bosch, 2003b). The S-type Oag chains are responsible for IcsA mediated
actin-based motility (Van den Bosch & Morona, 2003) and affects virulence (Van den Bosch et
al., 1997), and the VL-type Oag chains are responsible for resistance to complement (Hong &
Payne, 1997). Wzz and WzzpHS2 compete for the available Wzy (Carter et al., 2009).
Recent research supports the presence of multi-protein interactions in the Wzy-dependent
pathway (Marczak et al., 2013; Marczak et al., 2014; Marolda et al., 2006). Woodward et al.
purified Escherichia coli O86 Wzy (WzyEc) and showed using an in vitro assay that Wzz and
Wzy are sufficient to determine the Oag modal chain length (Woodward et al., 2010). Daniels
and Morona (1999) showed that Wzz forms a dimer in vivo and may oligomerise up to a
2 In rest of the paper we refer to WzySf as Wzy. 3 In rest of the paper we refer to WzzSf as Wzz.
Detection of Wzy/Wzz interaction in Shigella flexneri
158
hexamer. Tocilj et al. (2008) found PCP oligomers in the crystal structures, and suggested that
Wzz may form a scaffold and recruit Wzy. Marolda et al. (2006) provided genetic data
supporting the interaction of Wzx, Wzz, and Wzy in the Oag biosynthesis pathway but Carter et
al. (2009) failed to detect a physical interaction between Wzy and Wzz. Marczak et al. (2013)
showed by using a bacterial two-hybrid system that the Rhizobium leguminosarum PssP, which is
a PCP, interacts with PssL and PssT, which are Wzx and Wzy proteins, respectively. Recently,
they again showed that the PssP2 protein, which is also a PCP, interacts with PssT using a
bacterial two-hybrid system (Marczak et al., 2014). However, to date there is a lack of evidence
on the interaction of Wzy with other proteins of the Wzy-dependent Oag biosynthesis pathway
using more direct approaches.
In this study our aim was to detect the interaction of Wzy and Wzz by use of chemical
cross-linking of intact cells, and purification of tagged Wzy. Our western immunoblotting and
MS data support the first isolation of a Wzy and Wzz complex. Hetero-oligomeric complex
formation between Wzy mutants whose properties are Wzz-dependent and Wzz were then
investigated by cross-linking. The data indicated that these Wzy mutants could be cross-linked to
Wzz, however, there was no consistent correlation with an effect on Wzy mutant properties.
5.3 Materials and Methods
5.3.1 Ethics Statement
The Wzz antibody was produced under the National Health and Medical Research Council
(NHMRC) Australian Code of Practice for the Care and Use of Animals for Scientific Purposes
and was approved by the University of Adelaide Animal Ethics Committee.
5.3.2 Bacterial strains, growth media and growth conditions
The strains used in this study are shown in Table 5.1.
Detection of Wzy/Wzz interaction in Shigella flexneri
159
The growth media used were LB broth (10 g/liter tryptone, 5 g/liter yeast extract, 5 g/liter
NaCl) and LB agar (LB broth, 15 g/liter bacto agar).
Strains to be induced were initially grown in LB broth with aeration for 18 h at 37°C.
Cultures were then diluted 1/20 into fresh LB broth and grown to mid-exponential phase (OD600
of 0.4 - 0.6). To suppress Wzy-GFP-His8 expression, growth medium was supplemented with
0.2% (w/v) glucose where required. Cells were collected by centrifuged (9600 x g, Beckman
Coulter Avanti J-26XP centrifuge, 8 min, 4°C) and washed twice with LB broth to remove
glucose. To induce protein expression either 0.4 mM IPTG or 0.2% (w/v) L-Arabinose was
added and cultures grown for 20 h at 20°C. Strain PNRM271 did not require induction and was
grown in LB broth with aeration for 18 h at 37°C. Antibiotics were added as required to the
media at the following final concentrations: kanamycin (Km), 50 µg/ml; chloramphenicol (Cm)
25 µg/ml; and ampicillin (Amp), 100 µg/ml.
5.3.3 Plasmids and DNA methods
The plasmids used in this study are shown in Table 5.1. Plasmid constructs were prepared from
E. coli DH5# strains using the QIAprep Spin Miniprep kit (QIAGEN). Preparation of
electrocompetent cells and the electroporation method was described previously (Morona et al.,
2003).
Detection of Wzy/Wzz interaction in Shigella flexneri
160
Table 5.1 Bacterial strains and plasmids used in this study
Strains or Plasmids Characteristics* Reference Strains S. flexneri RMM109 PE638"wzy, Rifr (Morona et al., 1994) RMA4337 RMM109 "wzz (Rifr, Tetr) (Nath et al., 2015) PNRM6 RMM109 (pAC/pBADT7-1) (Nath et al., 2015) PNRM13 PNRM6 (pRMPN1) (Nath et al., 2015) PNRM16 PNRM6 (pRMPN2) (Nath & Morona, 2015) PNRM85 PNRM6 (pRMPN17) (Nath et al., 2015) PNRM122 PNRM6 (pRMPN23) (Nath et al., 2015) PNRM126 RMA4337 (pAC/pBADT7-1) (Nath et al., 2015) PNRM134 PNRM126 (pRMPN1) (Nath et al., 2015) PNRM159 PNRM13 (pWSK29-wzz) This study PNRM192 PNRM6 (pRMPN28) (Nath & Morona, 2015) PNRM271 RMM109 (pWSK29-wzz) This study PNRM289 PNRM16 (pWSK29-wzz) This study PNRM293 PNRM122 (pWSK29-wzz) This study PNRM299 PNRM85 (pWSK29-wzz) This study PNRM301 PNRM192 (pWSK29-wzz) This study E. coli Lemo21(DE3) fhuA2 (lon) ompT gal ($ DE3)
(dcm) !hsdS/ pLemo (Cmr) New England Biolabs
PNRM15 Lemo21 (DE3) (pRMPN1) This study Plasmids pAC/pBADT7-1 Source of T7 RNA polymerase; Cmr (McKinney et al., 2002) pRMPN1 pWaldo-wzy-GFPe; Kmr (Nath et al., 2015) pWSK29-wzz pWSK29 with S. flexneri 2a wzz (Murray et al., 2006) pRMPN2 pRMPN1 with WzyR164A (Nath & Morona, 2015) pRMPN17 pRMPN1 with WzyV92M (Nath et al., 2015) pRMPN23 pRMPN1 with WzyY137H (Nath et al., 2015) pRMPN28 pRMPN1 with WzyR250K (Nath & Morona, 2015)
(Sarkosyl), and 10% (w/v) SDDS] at different temperatures (RT or 4°C). Unsolubilised material
was separated by ultra centrifugation (Beckman Coulter Optima Max-XP tabletop ultracentrifuge,
4 Section 5.7.1 onwards were not part of the original manuscript and were added as additional information for the
thesis chapter.
Detection of Wzy/Wzz interaction in Shigella flexneri
180
Figure 5.S2 Optimisation of the whole membrane solubilisation Whole membrane fractions of PNRM15 were solubilised in 2x solubilisation buffer containing
for 1h at room temperature (RT); and 10% (w/v) SDDS for overnight at 4°C as described in
section 5.7.1.2. Unsolubilised material was separated by ultra centrifugation. Supernatants and
unsolubilised pellets were collected. In-gel fluorescence was performed to assess the amount of
WzySf-GFP-His8 in the supernatants (A) and pellets (B).
Detection of Wzy/Wzz interaction in Shigella flexneri
181
160,000 X g, 1 h, 4°C). Supernatants and unsolubilised pellets were collected. In-gel fluorescence
was performed to check the amount of WzySf-GFP- His8 in the supernatants and pellets (Fig.
5.S2). In the in-gel fluorescence image the WM solubilised with SDDS showed the highest
WzySf-GFP-His8 expression for the supernatant (Fig. 5.S2A, lane 6) and the lowest WzySf-GFP-
His8 expression for the unsolubilised pellet (Fig. 5.S2B, lane 6). Hence, the detergent SDDS was
selected for WM solubilisation and the WM was resuspended in 500 µl of Mili Q water followed
by solubilisation with 500 µl of 2X solubilisation buffer [40 mM Tris-HCl, 300 mM NaCl, 10%
(w/v) SDDS, pH 7.5] at 4°C for overnight. The solubilised supernatant was used for eltuion of
WzySf-GFP-His8.
5.7.1.3 Metal affinity purification of WzySf-GFP-His8
100 µl IMAC Ni-Charged Resin (Bio-Rad) was equilibrated with equilibration buffer [20 mM
Tris-HCl, 150 mM NaCl, 5 mM imidazole, 0.1% (w/v) DDM, 10% (v/v) glycerol, pH 7.5] and
incubated with solubilised supernatant in a 10 ml Falcon tube for 1 h at RT with gentle shaking.
The mixture was centrifuged (Labofuge 400R Heraeus Instrument, 3000 rpm, 10 min), the
supernatant was discarded, and the Ni-NTA beads were washed with 5 ml wash buffer [20 mM
Tris-HCl, 150 mM NaCl, 0.1% (w/v) DDM, 10% (v/v) glycerol, pH 7.5] with different imidazole
concentrations (10 mM, 20 mM, and 50 mM). The beads were incubated at RT for 5 min with
gentle rotation for each wash. Finally, the His8 tagged WzySf-GFP protein was eluted in 200 µl
elution buffer [20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, 0.1% (w/v) DDM, 10%
(v/v) glycerol, pH 7.5] at RT for 1 h with gentle rotation.
5.7.2 Negative dominance
To check the importance of the dimerisation for the functioning of WzySf the negative dominance
study was performed. For this study the WzySf mutants (WzyR164A, WzyR250A, WzyR278A, WzyR289A, WzyG130V, WzyL11I, WzyL214I, WzyP352H) (See Chapter 3 and 4) were co-
Detection of Wzy/Wzz interaction in Shigella flexneri
182
Detection of Wzy/Wzz interaction in Shigella flexneri
183
Figure 5.S3 Negative dominance Plasmids pRMPN1 with mutations in the wzySf gene were transformed into WT S. flexneri strain
PE638 as described in section 1.7.2. Strains were grown and LPS samples were prepared
followed by electrophoresis on an SDS-15% PAGE gel. The gel was stained with silver nitrate
and developed with formaldehyde. Lane 1, PE638; Lane 2, Strain PNRM12 [PE638 (pWaldo-
TEV-GFP) (pAC/pBADT7-1)]; Lane 3, Strain PNRM14 [PE638 (pRMPN1) (pAC/pBADT7-1)];
Lanes 4 to 11, PE638 strain with pAC/pBADT7-1 and plasmids encoding mutated WzySf
proteins, as indicated.
Detection of Wzy/Wzz interaction in Shigella flexneri
184
-expressed with WT WzySf. If the dimerisation is important for functioning then the formation of
mixed oligomer of the mutant WzySf and WT WzySf might cause the inactivation of WT WzySf
protein due to the presence of compromised WzySf protein in the oligomer.
Plasmid pRMPN1 having mutations in the wzySf gene expressing mutated WzySf proteins
(WzyR164A, WzyR250A, WzyR278A, WzyR289A, WzyP352H, WzyL214I, WzyL111I, and
WzyG130V) (Table 2.2) was co-transformed with pAC/pBADT7-1 into the WT S. flexneri strain
PE638 (Table 2.1). pAC/pBADT7-1 encodes T7 RNA polymerase, which drives the expression
of wzySf-gfp in pRMPN1. Strains were grown in LB broth with aeration for 18 h at 37°C and
diluted 1/20 into fresh LB broth and grown to mid-exponential phase (OD600, 0.4 to 0.6). To
suppress protein expression growth medium was supplemented with 0.2% (w/v) glucose. Cells
were centrifuged (2,200 X g; Sigma 3K15 tabletop centrifuge; 10 min; 4°C) and washed twice
with LB broth to remove glucose. To induce protein expression 0.2% (w/v) L-Arabinose was
added to the cultures and grown for 20 h at 20°C. Antibiotics Km (50 µg/ml) and Cm (25 µg /ml)
was added to the medium. LPS samples were prepared as described previously (Chapter 2). The
LPS samples were then electrophoresed on an SDS-15% PAGE gel for 16 to 18 h at 12 mA. The
gel was stained with silver nitrate and developed with formaldehyde.
Strain PE638 had S-LPS profile. After transformation of the plasmids expressing mutated
WzySf proteins into PE638, the generated strains also had S-LPS profiles similar to the WT
PE638 (Fig. 5.S3). Interestingly, some of theses mutated WzySf proteins had partial (WzyR289A,
WzyP352H, and WzyL214I) and some had null (WzyR164A, WzyR250A, and WzyG130V)
activity. Hence, the dimer formation of WzySf may be not essential for the functioning of WzySf.
185
Chapter 6
Conclusion
Conclusion
186
Chapter 6: onclusion
6.1 Introduction
According to a review of literature from 1966-1997, annually ~164.7 million shigellosis cases
occurred worldwide, of which 163.2 million cases were in developing countries with 1.1 million
deaths (Kotloff et al., 1999). However, a current review of literature from 1990-2009 suggested
that ~125 million shigellosis cases occur annually in Asia with 14,000 fatalities (Bardhan et al.,
2010). The later author suggested that the number of deaths by shigellosis was reduced by 98%
possibly due to improved nutrition, vitamin A supplementation, less virulent strains, and
availability of antimicrobial drugs (Bardhan et al., 2010; Kotloff et al., 1999). Due to
antimicrobial resistance, load of disease, and clinical severity, Shigella is a significant target of
vaccine development (Livio et al., 2014), however there is no available vaccine for shigellosis
(Stagg et al., 2009).
The immunity against S. flexneri is serotype specific and different serotypes of S. flexneri are
generated due to different chemical structure of the LPS Oag RUs (Jennison & Verma, 2004;
Stagg et al., 2009) (detailed in Chapter 1). However, the Oags of all the S. flexneri serotypes are
polymerised by a single type of Oag polymerase WzySf (Daniels et al., 1998; Morona et al.,
1994). Hence, the characterisation and purification of WzySf is potentially useful for in vitro
synthesise of Oag, which will be a great resource for S. flexneri vaccine development in future.
Several proteins are involved in the Wzy-dependent Oag biosynthesis pathway. For a long
time, researchers speculated that these Oag biosynthesis proteins are associated with each other
and may form a multi-protein complex (Marolda et al., 2006; Whitfield, 2006; Whitfield, 2010;
Woodward et al., 2010) (detailed in Chapter 1 and 5). Hence, identification of these associations
will help to understand the Wzy-dependent Oag biosynthesis pathway.
Below is an overview of the outcomes of this thesis. The results characterised WzySf,
identified the association of WzySf and WzzSf during Oag biosynthesis pathway; and established a
foundation to understand the Wzy-dependent Oag biosynthesis pathway.
Conclusion
187
6.2 Residues important for polymerisation function of WzySf
Only a few studies have been conducted to characterise the Wzy proteins of different bacterial
species. Kim et al. (2010) characterised WzyFt and predicted it has 11 TM segments. Islam et al.
(2010) created a topology map of WzyPa, which had 14 TM segments. Previous experimental data
on WzySf topological mapping identified 12 TM segments (Daniels et al., 1998) which is
different to that found in WzyFt and WzyPa. There is also little sequence identity between wzy
genes and Wzy proteins of different bacterial species (Morona et al., 1994). Hence, random
mutagenesis (Chapter 3) was performed on the wzySf and identified a number of residues (V92,
G130, L214, and P352) important for the polymerisation function of WzySf. These residues are
present in the PL2, TM5, TM8, and PL6. Previous characterisation of the Wzy from the other
bacteria identified important functional residues only in the PLs (Islam et al., 2013; Kim et al.,
2010). However, this study for the first time was able to identify functional residues in the TMs
of WzySf. In Chapter 3, the ColE2 sensitivity assay was used for screening of mutants, and also to
verify the LPS profiles of the mutant strains. This method was found to be an effective method to
identify subtle differences in the LPS profiles of the mutant strains. The bacteriophage Sf6c
sensitivity assay was also used for the first time as an effective method to characterise the WzySf
mutants based on their LPS profiles. Significantly, this approach found mutations in WzySf that
resulted in different LPS phenotypes (SR LPS, LPS with few Oag RUs, and reduced
polymerisation) and also generated strains (Class D) which had LPS profiles nearly similar to the
positive control strain but their Oag density was more than that of the positive control strain.
Other than this study on WzySf, the most characterised Wzy is WzyPa. In WzyPa the Arg
residues (R175, R176, R180, R290, and R291) in the PL3 and PL5 are important for the function
(Islam et al., 2011). Site-directed mutagenesis of the Arg residues in the PL3 and PL5 of WzySf
also identified several functionally important Arg residues (R164, R250, R258, and R289). The
PL3 and PL5 of WzyPa has RX10G motifs which are important for the “catch-and-release”
mechanism (Islam et al., 2011). Zhao et al. (2014) found that WzyEc has a different number of
TM and different amino acid sequence compared to WzyPa but the pI values of PL3 and PL4 (the
two largest PLs) of WzyEc are equivalent to PL3 and PL5 of WzyPa, which led them to conclude
Conclusion
188
that WzyEc follows a similar catalytic mechanism to WzyPa. Marczak et al. (2013) found that
PssT has RX10G motifs in the two PLs similar to WzyPa. They proposed that these RX10G motifs
might be associated with the polymerisation activity (Marczak et al., 2013).
Comparison of WzySf with WzyPa shows a number of striking differences: comparatively
different pI values for PL3, different number of TMs, and absence of RX10G motifs and instead
the presence of RX15G motifs in the PL3 and PL5; different arrangement of the Arg residues in
the motifs; and different substrate specificity of WzySf compared to WzyPa (Table 6.1). The
unique characteristics of WzySf also suggest that it follows a different or a modified mechanism
for its polymerisation function compared to WzyPa and other Wzy proteins (including WzyEc and
PssT).
6.3 Purification of WzySf
Due to the transmembrane nature, the purification of Wzy was always challenging (Woodward et
al., 2010). WzySf is a hydrophobic protein with a low percentage of G + C content in the coding
region (Daniels et al., 1998; Morona et al., 1994). The first evidence of the purification of Wzy
protein was the work of Woodward et al. (2010) (detailed in Chapter 1 and 5). WzySf was
purified using the Woodward et al. protocol with some modifications (Chapter 5), that include
using a different cloning vector, overexpression system [Lemo21(DE3)], Ni-beads, centrifugation
speed, and avoiding the concentration and desalting steps, FPLC, and gradient elution. The
method purified 1 mg/ml of ~90% pure monomeric WzySf (Fig. 5.1). This is the first evidence of
purification of S. flexneri WzySf. Woodward et al. (2010) used further purification steps and
concentrated their purified protein but the yield of WzyEc was almost undetectable in a
Coomassie Blue stained gel [see Supplementary Fig. 2.b of Woodward et al. (2010)]. Without
Conclusion
189
Table 6.1 Comparison of WzySf and WzyPa
Characteristics WzySf WzyPa
Number of TM 12 14 pI value of PL3 4.65 8.59
Charge property of PL3 at pH 7.4 Negatively charged Positively charged Motifs in PL3 and PL5 RX15G RX10G
Arrangement of the Arg residues in the motifs
No Arg residue within the RX15G motif
Arg residue within the RX10G motif
Charge property of substrate Neutral Negative
Conclusion
190
further purification [see Supplementary Fig. 2.a of Woodward et al. (2010)] their purified protein
was highly contaminated and the yield was also less compared to purified WzySf although
minimum steps were used during WzySf purification. Woodward et al. (2010) suggested that
WzyEc is able to form a dimer; and previously Daniels et al. (1998) showed by Western
immunoblotting using anti-PhoA serum that Wzy::PhoA fusion protein was able to form a dimer.
The data in Chapter 5 shows that WzySf is able to form a dimer, which also supported by
proteomics analysis. However, the experiments to determine negative dominance (Chapter 5)
suggest that the dimer formation has no correlation with the functioning of the protein. Further
investigation is needed to identify the connection of dimer formation with the functioning of
WzySf.
6.4 Understanding the association of the Oag biosynthesis proteins
The data in Chapters 3 and 4 for the first time provide the insight into the association of WzzSf
and WzySf in the Oag biosynthesis pathway. Seven WzySf amino acid residues (V92, Y137,
G130, L214, R250, R258, and P352) were identified that are important for the polymerisation
function of WzySf through the interaction with WzzSf (Table 6.2). For four of the WzySf mutants
(WzyV92M, WzyG130V, WzyY137H, and WzyR258E) the presence of WzzSf repressed WzySf
polymerisation activity and for three of the WzySf mutants (WzyL214I, WzyR250K, and
WzyP352H) the presence of WzzSf increased WzySf polymerisation activity. WzzSf also has role
in the stability of the WzySf protein. Eight amino acid residues (G130, R164, P165, L191, R250,
R258, R278, and R289) were identified which are important for the WzzSf dependent stabilisation
of WzySf (Table 6.2). For five WzySf mutants (WzyR164A, WzyL191F, WzyR250K,
WzyR258K, and WzyR278E) the presence of WzzSf stabilises WzySf but for four WzySf mutants
(WzyG130V, WzyP165S, WzyR258A, and WzyR289E) the absence of WzzSf stabilises the
protein. Residue R258 is important for stabilisation of WzySf but exhibited opposite effects
depending on the nature of the amino acid substitutions. The amino acid residues important for
Conclusion
191
Table 6.2 LPS profiles of the Wzz-dependent WzySf mutants in the presence and absence of
WzzSf
Mutation LPS profile WzzSf present WzzSf absent
R164A C (SR-LPS) C R164K F [S-LPS with reduced Oag polymerisation
and lacking Oag modal chain length control (<30 Oag RUs)]
F
R164E C C R250A B [LPS with few Oag RUs (<11)] B R250K A1 [S-LPS with reduced Oag polymerisation,
and modal chain length reduced to 8-11 RUs] B
R250E B B R258A C C R258K A2 [S-LPS with reduced polymerisation and
modal chain length reduced to 9-14 or 8-14 Oag RUs]
F
R258E C E [S-LPS lacking Oag modal chain length control] R278A D [LPS profile similar to the WT control
PNRM13] E
R278K D E R278E D E R289A A3 [S-LPS with reduced polymerisation (<22
Oag RUs) and modal chain length similar to the WT control (PNRM13)]
F
R289K D E R289E A2 F P352H A [S-LPS with reduced polymerisation (<20
Oag RUs)] B
V92M A E Y137H A E L214I B C G130V C F N147K D E P165S D E L191F D E
Conclusion
192
the association with WzzSf are not only present in the PL (PL2, 3, 5, and 6) but also present in the
TM (TM 5, 7, and 8). Noticeably, the amino acid G130 present in the TM5 has roles both in the
polymerisation activity of WzySf and association with WzzSf. WzzSf has both negative and
positive effects on the polymerisation ability and stability of WzySf.
Although several authors had suggested the complex formation by the proteins of the
Wzy-dependent Oag biosynthesis pathway, only Marolda et al. (2006) provided genetic evidence
about the association of Wzx, Wzy, and Wzz; and Marczak et al. showed by using a bacterial
two-hybrid system, that the R. leguminosarum PssP interacts with PssL and PssT (Marczak et al.,
2013; Marczak et al., 2014). However, there is no evidence about the direct physical interactions
of these proteins. In vivo chemical cross-linking followed by purification of WzySf identified
WzySf and WzzSf complex formation. Proteomics analysis also supported this data (Chapter 5).
The detected WzySf and WzzSf complex formation provides the first evidence of a close physical
interaction of the proteins of the Wzy-dependent Oag biosynthesis pathway. Although the
mutational data indicate that PL2, 3, 5, 6, and TM 5, 7, and 8 are involved in the association of
WzySf and WzzSf, the complex formation ability of the Wzz-dependent WzySf mutants with WzzSf
suggests that more extensive interactions between WzySf and WzzSf also occur.
6.5 Mechanism of the association of Wzz and Wzy during the O antigen
polymerisation in S. flexneri
There are several proposed models on the interaction of Wzy and Wzz, and on the Wzy-
dependent Oag polymerisation (described in Chapter 1). Some of them considered the direct
interaction of Wzz and Wzy. However, some models described the association of these proteins
through the interaction with the Oag polymer. Considering the merits and limitations of all the
proposed models and the result of this thesis I propose an “activation and inactivation”
mechanism (Fig. 6.1) to explain the polymerisation of Oag by WzySf and the association of WzzSf
and WzySf during the Oag biosynthesis process.
Conclusion
193
It is known that certain Wzy proteins such as Yersinia pseudotuberculosis (WzyYp), have
an absolute requirement for Wzz for polymerisation activity (Kenyon & Reeves, 2013). However,
WzySf has activity without WzzSf but the Oag lacks modal chain length control. In this model,
WzySf has two forms: activated (or stabilised) and inactivated (or destabilised). These two forms
switch spontaneously. WzzSf acts as a molecular chaperone protein and promotes a certain
frequency of switching likely controlling the polymerisation activity of WzySf and the modal
chain length of the growing Oag chain. For WzyYp and the other Wzy proteins that need Wzz
strictly for polymerisation activity, there is no spontaneous switching and Wzz is essential to
control the switching between the activated and inactivated forms of Wzy. Previously, Morona et
al. (1995) also proposed that Wzz acts as a molecular chaperone to facilitate the interaction of
WaaL, Wzy, and lipid-linked Oag chain (Morona et al., 1995).
Data generated from the mutational study suggests that in S. flexneri WzzSf binds at
different regions of WzySf during the Oag polymerisation process. Some of the regions can be
speculated through this mutational study but a number of other regions may be involved. The
presence of WzzSf stabilises WzyR164A, WzyL191F, WzyR250K, WzyR258, and WzyR278E;
and increased polymerisation activity of WzyL214I, WzyR250K, and WzyP352H. However,
presence of WzzSf destabilises WzyG130V, WzyP165S, WzyR258A, and WzyR289E and
repressed polymerisation activity of WzyV92M, WzyG130V, WzyY137H, and WzyR258E.
Hence, initially, WzzSf binds at a region (including R164, L191, R250, R258, and R278) of WzySf
which facilitates the switching towards the “activated” (or stabilised) form of WzySf, and the
activation of WzySf turns on the rapid polymerisation and WzySf starts to synthesise the nascent
Oag chain (the spontaneous polymerisation of WzySf is a slow process). Then WzzSf binds to
other regions (including L214 and P352) of WzySf as well. Mechanical feedback of this binding
facilitates the Oag synthesis and WzzSf controls the Oag modal chain length by interacting with
it. The WzzSf binding regions (denoted as “activation region”) that have roles in activating WzySf
and polymerisation are present in close proximity within the WzySf quaternary structure.
Conclusion
194
Figure 6.1 “Activation and inactivation” mechanism The activated or stabilised, and inactivated or destabilised forms of WzySf interconvert/switch
spontaneously. However, WzzSf acts as a molecular chaperone protein and promotes a certain
frequency of switching which controls the polymerisation activity of WzySf at certain level and
also determines the modal chain length of the growing Oag. Activated WzySf synthesises Oag,
and finally binding of WzzSf at certain regions of WzySf generates mechanical feedback which
releases the synthesised Oag from the substrate binding site of WzySf. Residues in PL2, 3, 5, 6
and TM5, 7, 8 of WzySf are involved in the switching between the two forms by possible
interactions with WzzSf.
Conclusion
195
Next, WzzSf moves to bind to the other regions (including G130, P165, and R289) of WzySf
which facilitates the switching towards the “inactivated” (or destabilised) form of WzySf, and the
inactivated WzySf turns off polymerisation. Then WzzSf binds to the other regions of WzySf
(including V92 and Y137) as well. Mechanical feedback of this binding releases the Oag chain
from the substrate binding domain of WzySf. WzzSf binding regions (denoted as “inactivation
region”) that have roles in inactivating WzySf and releasing the growing Oag chain may be
present in close proximity within the WzySf quaternary structure.
The mutational study showed that amino acid R258 of WzySf has a role in the WzzSf-
dependent stabilisation and destabilisation of WzySf, and R258 also has role in the WzzSf
dependent repression of polymerisation activity of WzySf depending on the mutational
substitutions (R258A, R258K, and R258E). Residue R258 is critical for interaction with WzzSf
and exhibits allele specific effects on Wzz-dependence, polymerisation activity, and protein
stability. The activation and inactivation regions are present on the PL2, 3, 5, 6, and TM5, 7, and
8. The residue R258 may be present in the middle of the activation and inactivation regions
within the WzySf quaternary structure.
6.6 Conclusion and future work
Collectively, this thesis identified and characterised functionally important amino acid
residues of WzySf, identified several novel LPS phenotypes conferred by the WzySf mutants, and
found that WzzSf affects the functioning and stability of WzySf, both positively and negatively.
The work also first time identified direct physical interaction of WzzSf and WzySf, and developed
a purification method for WzySf. We speculate that the PL2, 3, 5, 6 and TM5, 7, 8 may form the
catalytic site of the protein. However, the interaction of WzzSf and WzySf may be conducted on a
wider region of WzySf.
WzySf mutants were generated by mutagenesis on wzySf in pRMPN1. Hence, the effect of
mutations was measured for the overexpressed protein. Repetition of the mutagenesis on
Conclusion
196
chromosomal wzySf can be performed to understand if there is any effect of the overexpression on
the functioning of WzySf mutants.
During characterisation of WzySf and identification of the association of WzzSf and WzySf
(Chapter 3 and 4) all the mutational studies were conducted in S. flexneri Y serotype. However,
for all the S. flexneri serotypes the Oag polymerisation is conducted by a single type of WzySf.
Although the WT WzySf protein is identical in all serotypes, it will be meaningful to investigate
the effect of the mutation on WzySf functioning and association with WzzSf in different serotypes
to know if these mutations have any serotype specific effects.
Woodward et al. (2010) performed the first in vitro polymerisation assay and showed that
WzySf and WzzSf are sufficient to shape Oag. The purified WT WzySf protein can be used in an in
vitro polymerisation assay. Purified WzzSf can also be added to the in vitro system to control the
chain length. After optimisation of the protocol, different purified mutated WzySf proteins can be
used instead of the WT protein to understand the actual mechanism of Oag polymerisation and
association with WzzSf.
Preparing a safe and efficient vaccine against S. flexneri infection is the only way to control
the disease. As the S. flexneri infection is serotype specific, the conjugated vaccines using
detoxified LPS can be used as a vaccine. However, the conjugated vaccines have deficiencies
including accurate control of the detoxification step (Phalipon et al., 2006). Hence, purified
WzySf and WzzSf may be useful to produce Oag in vitro for vaccine development against S.
flexneri infection.
WzzSf determines the S-type (11-17 Oag RUs) Oag and previous study indicated that S-type
Oag is required for maintaining the polar localisation of IcsA for efficient actin-based motility
and cell-to-cell spreading (Morona & Van Den Bosch, 2003b; Van den Bosch & Morona, 2003).
Control over the functioning of WzySf and WzzSf can stop the infection caused by S. flexneri and
these two proteins are potential targets for anti-infection drug development.
197
Bibliography
Bibliography
198
Bibliography
Abeyrathne, P. D. & Lam, J. S. (2007). Conditions that allow for effective transfer of
membrane proteins onto nitrocellulose membrane in Western blots. Can J Microbiol 53, 526-532.
Adams, M. M., Allison, G. E. & Verma, N. K. (2001). Type IV O antigen modification genes
in the genome of Shigella flexneri NCTC 8296. Microbiology 147, 851-860.
Adhikari, P., Allison, G., Whittle, B. & Verma, N. K. (1999). Serotype 1a O-antigen
modification: molecular characterization of the genes involved and their novel organization in the