Cédric Notredame (20/09/2015) Finding What you Need in Biological Databases Cédric Notredame.

Cédric Notredame (19/04/23)

Finding What you Need in Biological

Databases

Cédric Notredame


Where is my Needle ?

Databases:



Our Scope

Give you means to answer simple questions

Databases are UNFRIENDLY INFORMATION DESKS

Give you an idea of what is possible

WHAT can you ask ?

HOW can you ask it ?


Outline

- An Overall view

- Asking a biological question to a database

- Turning a question into a query

- Bibliographic Databases: Medline, OMIM

- Gene Databases: GenBank, LocusLink, ENSEMBL

- Protein Databases: SwissProt, InterPro, Prodom

- SRS


Database:

What is a Database ?


DataBase Entries

1 entry = 1 SequenceAGCTGTCGAGGGATAGGACATATACATAAATTAATATAAT

1 entry = 1 File = Sequence +DocSEQ

DOC

= Flat File

Database = Collection of Flat FilesSEQ

DOCSEQ

DOCSEQ

DOCSEQ

DOCSEQ

DOCSEQ

DOCSEQ

DOC


DataBase Entries: Flat Files

Accession number: 1

First Name: Amos

Last Name: Bairoch

Course: DEA=oct-nov-dec 2002

http://www.expasy.org/people/amos.html

//

Accession number: 2

First Name: Laurent

Last name: Falquet

Course: EMBnet=sept 2000, sept 2001;DEA=oct-nov-dec 2000;

//

Accession number 3:

First Name: Marie-Claude

Last name: Blatter Garin

Course: EMBnet=sept 2000; sept 2001; DEA=oct-nov-dec 2000;

http://www.expasy.org/people/Marie-Claude.Blatter-Garin.html

//


DataBase: Relational Databases

TeacherAccession number

Education

Amos 1 Biochemistry

Laurent 2 Biochemistry

M-Claude 3 Biochemistry

CourseDate Involved

teachers

DEA Oct-nov-dec 2000 1,3

EMBnet Sept 2000, Sept 2001 2,3

Relational database (« table file »):


To Summarize: What’s a database ?

Collection of Data that is:•Structured Data •Searchable (index) -> table of contents

•Updated periodically (release) -> new edition

•Cross-referenced (hyperlinks) -> links with other db

Collection of tools (software) necessary for:

Searching –Updating -Releasing

Data storage managment: flat files, relational databases…


Database:

What’s on the Menu?


A large amount of information

More than 1000 different databases

Generally accessible through the webEBI: http://www.ebi.ac.uk/

NCBI: http://www.ncbi.nlm.nih.org

Google: http://www.google.com

Variable size: <100Kb to >10GbDNA: > 10 Gb

Protein: 1 Gb

3D structure: 5 Gb

Other: smaller

Update frequency: daily to annually


A Non Exhaustive List

AATDB, AceDb, ACUTS, ADB, AFDB, AGIS, AMSdb, ARR, AsDb, BBDB, BCGD, Beanref, Biolmage,BioMagResBank, BIOMDB, BLOCKS, BovGBASE,

BOVMAP, BSORF, BTKbase, CANSITE, CarbBank, CARBHYD, CATH, CAZY, CCDC, CD4OLbase, CGAP, ChickGBASE, Colibri, COPE, CottonDB, CSNDB, CUTG, CyanoBase, dbCFC, dbEST, dbSTS, DDBJ, DGP, DictyDb, Picty_cDB, DIP, DOGS, DOMO, DPD, DPlnteract, ECDC, ECGC, EC02DBASE, EcoCyc, EcoGene, EMBL, EMD db, ENZYME, EPD, EpoDB, ESTHER, FlyBase, FlyView, GCRDB, GDB, GENATLAS, Genbank, GeneCards, Genline, GenLink, GENOTK, GenProtEC, GIFTS, GPCRDB, GRAP, GRBase, gRNAsdb, GRR, GSDB, HAEMB, HAMSTERS, HEART-2DPAGE, HEXAdb, HGMD, HIDB, HIDC, HlVdb, HotMolecBase, HOVERGEN, HPDB, HSC-2DPAGE, ICN, ICTVDB, IL2RGbase, IMGT, Kabat, KDNA, KEGG, Klotho, LGIC, MAD, MaizeDb, MDB, Medline, Mendel, MEROPS, MGDB, MGI, MHCPEP5 Micado, MitoDat, MITOMAP, MJDB, MmtDB, Mol-R-Us, MPDB, MRR, MutBase, MycDB, NDB, NRSub, 0-lycBase, OMIA, OMIM, OPD, ORDB, OWL, PAHdb, PatBase, PDB, PDD, Pfam, PhosphoBase, PigBASE, PIR, PKR, PMD, PPDB, PRESAGE, PRINTS, ProDom, Prolysis, PROSITE, PROTOMAP, RatMAP, RDP, REBASE, RGP, SBASE, SCOP, SeqAnaiRef, SGD, SGP, SheepMap, Soybase, SPAD, SRNA db, SRPDB, STACK, StyGene,Sub2D,SubtiList, SWISS-2DPAGE, SWISS-3DIMAGE, SWISS-MODEL Repository, SWISS-PROT, TelDB, TGN, tmRDB, TOPS, TRANSFAC, TRR, UniGene, URNADB, V BASE, VDRR, VectorDB, WDCM, WIT, WormPep, YEPD, YPD, YPM, etc .................. !!!!

There Exists A Specialized Database on Almost anything you can think of


A database of databases


What’s on the Menu:The Art of Eating Well

Always Use Fresh Data: The Latest Update of your DataBase

Make Sure The DataBase is Maintained: Many Databases are poorly maintained

Treat DataBases like Publications: Some Journals are Better than Others


Bio-Google:

How Can I Search a Database ?


Searching Databases

There are 2 ways to search databases

Text based queries: Medline, EntrezSEQ

DOCSearch For « Smith AND dUTPase>

Similarity Searches: BLASTAGCTGTCGAGGGATAGGACATATACATAAATTAATATAAT


Searching Databases

Each database is a little kingdom…

Has its own query system

Has its own information structure

The main databases are well documentedand this documentation is available online

Most databases can be searched using SRSor Entrez


Databases: Asking the right Question

Databases ARE NOT meant for browsing

When you search a Database you must have an idea of what your Needle-in-a-hay-stack looks like



Browsing a database is like Using your

phone book in place of a dating agency…



Finding Data: Database Search

Finding Questions: Data Mining


The Kind Of Questions We Can Ask:

SEQUENCE Based

InterPro Any Known Domain in my Protein ???

SwissProt Any Protein like mine ???

These ARE Predictions


The Kind Of Questions We Can Ask:

TEXT Based

Medline Who Worked on my Protein ???

SwissProt Function of My Protein ???

PDB Structure of My Protein ???

These are NOT Predictions


Just like When You Google up

Specific Queries give Precise Answers


Medline:

Who worked on my Protein ?


Medline (PubMed)


What is in Medline ?

MEDLINE covers the fields of medicine, nursing, dentistry, veterinary medicine, the health care system, and the preclinical sciences

more than 4,000 biomedical journals and More than 10 million citations since 1966 until now

Contains links to biological db and to some journals

nMany papers not dealing with human are not in Medline

nBefore 1970, keeps only the first 10 authors !


Using Medline: Asking a question

During the last Lab Meeting, I heard the word dUTPase.

What can it be ? What has been published on this ?









By Default, Medline Assumes you mean:

Abergel AND dUTPase



I have found the reference I wanted.

Now I want to save it so that I can use it later, For instance to Import it in ENDnote my Reference Manager

Save Your Data in the Proper DataBase format


Using Medline: Storing your results




Retrieving EXACTLY the Information that you need

[AB] [AD]

Restricted fields



AB

AD


Using Medline: Looking for a Review

I Want to Find the LATEST REVIEW on the dUTPase.

Use The Limit Option of Medline


Using Medline: Looking For a Review

LanguageTitle OR Abstract

Article type

1-Limits


Using Medline: A Few Tips

•Quoted queries (e.g. «down syndrome» ) behave as a single word, and are great to improve the relevance of your search

•Adding initials to names (e.g. “Abergel C” ) (if you can) also reduces your output

•Write down the PubMed Identifier (the number in the PMID field) of that interesting paper you just find. It could be very useful in your subsequent search for related items such as associated gene and protein sequences



•Spelling mistakes, wrong field restrictions or Limits setting can occur. These may be the problem.

•Use abstracts to enlarge your vocabulary and look for synonyms: some papers on dUTPase might use dUTP pyrophosphatase instead!

•The “related papers” button (on the extreme right of the PubMed output). Try it from time to time, to enlarge a search that is not giving you enough references



•Storing your PDFs,•Memory is cheap, access is sometimes strange…•Storing your favourite PDF is a good idea

•Which name on your disk?

•THE MEDLINE ID NUMBER !!!

•With a reference manager like EndNote



GenBank:

What is the Sequence of my

Gene ?


GenBank: an Overview





EMBL

DDBJ

GenBank

EMBL, GenBank and DDBJ are the same database. They are synchronized every day.



GenBank contains EVERY piece of DNA that has been sequenced and made publicly available.

It contains GOOD and BAD data

There is a Historical Aspect in the GenBank data:

-Complex Genes are spread in many entries:


GenBank Entries Are Complex because Genes are complex

Prokaryotic Example

GenePromoter RBS

Protein

ORF

mRNASTOPATG


GenBank Entries Are Complex because Genes are complex

Gene

Promoter

Protein (form2)

Protein (form1)

mRNA (form1)

mRNA (form2)

exonexon exon exon exonexon


What is the Sequence of the E. Coli dUTPase ?

Using GenBank: Asking a question


Using GenBank: Asking a questionThe Naive Way

This search reports EVERY GenBank entry that contains these two words.

Most Bacterial Genomes Entries (annotated by similarity) Contain these two words

Escherichia coli dUTPase


Using GenBank: Asking a questionThe Right Way

Escherichia coli[organism] dUTPase[definition]


Using GenBank: And There Is Plenty More where It comes from…

If a Gene is published more than once, Each publication gets its own entry

This can mean MANY ENTRIES if you have SNPs or ESTs

GenBank Is Redundant:


HeaderContains all the practical Information


FeaturesContains Experimental

Information and Predictions


Extra GeneThis is common in GenBankentries


What is the Sequence of the Human dUTPase ?

Using GenBank: Asking a question

What is the Sequence of the E. Coli dUTPase ?


Using GenBank: Finding the Human dUTPase

2-Check box here to exclude ESTs

1-Request Limits



The Gene does NOT appear in a single entry




Using GenBank: Reconstructing your gene


Some Good News…

-This Information is complicated because it is RAW Information

-It is necessary to keep UNINTERPRETED Experimental Information available

-There are SIMPLER alternatives to using this RAW Information:

-Gene Centric Databases-Protein Databases


RefSeq/LocusLink:

What Is There To know about This

Gene?


Using LocuLink


What Can I find about the DUT Gene ?

Using LocusLink: Asking a question


EnterGene name

SelectLocusLink


Using LocusLink: Asking a question about a Gene


Using LocusLink: Asking a question about a Gene


OMIM:

Is There A disease Associated to This

Gene?


OMIM: Finding Out About The Phenotype of a Gene



OMIM™: Online Mendelian Inheritance in Man

A catalog of human genes and genetic disorders

Contains a summary of literature, pictures, and reference information. It also contains numerous links to articles and sequence information.




NCBI-GENOME:

What is the Context of my Gene In Its

Genome?


NCBI-GENOME


NCBI-GENOME: The Virus Section


NCBI-GENOME: The Virus Section


NCBI-GENOME: The Bacteria Section


NCBI-GENOME: The Bacteria Section


ENSEMBL:

Where is my Gene in the Human

Genome (who are its neighbors) ?


Using ENSEMBL


My Gene:

A Summary


Gathering Everything you need on a gene

GenBank: What is the Sequence ?

LocusLink: What about this Gene?

ENSEMBL: What is the Context?

MEDLINE: Are There Papers?

OMIME: Are There Illnesses?


SwissProt:

What Do We Know About My Protein ?


The Protein Databases

GenBank: A Big Bag of DNA

PREDICTION+

EXPERIMENT

Generic Non Redundant Protein

DatabasesNR

trEMBLSpecialized Protein

DatabasesSwissProt

PIR


What Is SwissProt ?


What Is SwissProt ?

Fully-annotated (manually), non-redundant, cross-referenced, documented protein sequence database.

~100 ’000 sequences from more than 6’800 different species; 70 ’000 references (publications); 550 ’000 cross-references (databases); ~200 Mb of annotations.

Collaboration between the SIB (CH) and EMBL/EBI (UK)


Using SwissProt: Asking a question

We hear the word EPO quite often these days, but whatexactly is known about it ?


Using SwissProt: Asking a question

A Simple SwissProt Text Query

EPO HUMAN


Using SwissProt: Reading an Entry









Structure Information




The Protein Databases

GenBank: A Big Bag of DNA

PREDICTION+

EXPERIMENT

Specialized Protein DatabasesSwissProt

PIRUniProt

Generic Non Redundant Protein

DatabasesNR

trEMBL





SwissProt

How Good is Good ?




PDB:

What is the Structure of my

Protein ?


PDB: The Protein Database


PDB: The Protein Database

Managed by Research Collaboratory for Structural Bioinformatics (RCSB) (USA).

Contains macromolecular structure data on proteins, nucleic acids, protein-nucleic acid complexes, and viruses.

Currently there are ~16’000 structure data for about 4’000 different molecules, but far less protein families (highly redundant) !


Using PDB: Asking a question

Does tolB have a known Structure? And If the answer is Yes, How can I look at it ?


Using PDB: Asking a question

Query: TolB


Using PDB: Viewing a Structure

View Structure








Using PDB: Downloading Data

Coordinates


Interpro:

Are There Domains In my Protein ?


Interpro: The Idea of Domains


Interpro: The Idea of Domains


Interpro: A Federation of Databases


Using InterPro: Asking a question

Which Domains does the oncogene FosB contain?






Using CDsearch: Asking a question


Using CDsearch: Asking a question


Using Domains: Some Statistics

• 10 most common protein domains for H. sapiens

Immunoglobulin and major histocompatibility complex domainZinc finger, C2H2 typeEukaryotic protein kinaseRhodopsin-like GPCR superfamilyPleckstrin homology (PH) domainRING fingerSrc homology 3 (SH3) domainRNA-binding region RNP-1 (RNA recognition motif)EF-hand familyHomeobox domain


My Protein:

A Summary


Gathering Everything you need on a Protein

trEMBL: What is the Sequence ?

MEDLINE: Are There Papers?

PDB: Which Structure?

INTERPRO: Which Domains?

SwissProt:What about the Function


SRS:

Can I search Many Databases

Simultaneously ?


Using SRS


Using SRS


A Few Databases in Bulk






A Few Addresses


A few Databases

Cédric Notredame (20/09/2015) Finding What you Need in Biological Databases Cédric Notredame.

Documents