C-reactive protein induces p53- mediated cell cycle arrest in H9c2 cardiac … · 2020-06-29 · 2 CRP-treated H9c2 cardiac myocytes displayed cell cycle arrest in G0/G1 phase. CRP

C-reactive protein induces p53-

mediated cell cycle arrest

in H9c2 cardiac myocyte

Ji-Won Choi

Department of Medical Science

The Graduate School, Yonsei University

C-reactive protein induces p53-mediated cell cycle arrest in H9c2 cardiac myocyte

Directed by Professor Seok-Min Kang

The Master's Thesis submitted to the Department of Medical Science,

the Graduate School of Yonsei University in partial fulfillment of the requirements for the

degree of Master of Medical Science

Ji-Won Choi

December 2010

This certifies that the Master's Thesis of Ji-Won Choi is approved.

------------------------------------ Thesis Supervisor : Seok-Min Kang

------------------------------------ Thesis Committee Member#1 : Hoguen Kim

------------------------------------ Thesis Committee Member#2 : Sungha Park

The Graduate School Yonsei University

December 2010

ACKNOWLEDGEMENTS

I am really grateful to my thesis supervisor Dr. Seok-Min

Kang for encouragement and support. I would like to thank

Dr. Hoguen Kim and Sungha Park for their advice and

concern. I want to show my sincere gratitude to Dr. Ji Hyung

Chung for advice and concern and Kyung Hye Lee for help

and support from experimental guidance to discussion. I wish

to thank those colleagues who have worked at SIRIC: Hyun

Ju Jeon, Soo-Young Kim, Beom Seob Lee, Da Jeong Lee, Bo

Hyun Kim, Sun-Ju Lee, Il-Kwon Kim, Byeong-Wook Song,

Min-ji Cha, EunJu Choi, Onju Ham, Se Yeon Lee, Chang

Yeon Lee, Jun Hee Park, Eun Hye Lee, Hyung-Ho Moon,

Dong Kyu Kim, Sook Kyoung Kim, Pil Sung Yang, Su-

hyouck Kim, Eun Young Choi, Eun Sook Kim.

Finally, I would like to give my gratitude to my family for

their understanding and sacrifice especially my husband

Chang Hyun Park.

TABLE OF CONTENTS

ABSTRACT .................................................................................... 1

I. INTRODUCTION ....................................................................... 3

II. MATERIALS AND METHODS ................................................ 5

1. MATERIALS ........................................................................... 5

2. METHODS ................................................................................ 5

A. Cell culture .............................................................................. 6

B. Measurement of cell viability and proliferation ...................... 6

C. Caspase-3 activity assay ........................................................ 8

D. Cell cycle analysis ................................................................... 8

E. Western blot ............................................................................. 9

F. RT-PCR ............................................................................... 10

G. DNA-PK activity assay ......................................................... 12

H. siRNA transfection .............................................................. 13

III. RESULTS ............................................................................... 14

1. Effect of CRP on viability, proliferation, and apoptosis of H9c2

cardiac myocytes .................................................................... 14

2. Effect of CRP on cell cycle progression of H9c2 cardiac

myocytes .............................................................................. 17

3. Effect of CRP on cell cycle related proteins, p21, and p53

expression ............................................................................. 19

4. CRP-induced p53 activation depends on ERK pathway ...... 24

5. Intracellular signaling mechanism of CRP through FcγIIIa

receptor ................................................................................. 27

IV. DISCUSSION ....................................................................... 29

V. CONCLUSION ...................................................................... 35

REFERENCES ............................................................................. 36

ABSTRACT(IN KOREAN) ......................................................... 43

LIST OF FIGURES

Fig. 1. CRP inhibits cell viability and cell proliferation .... 15

Fig. 2. CRP has no effect on apoptosis .................................. 16

Fig. 3. CRP induces G0/G1-phase cell cycle arrest .............. 18

Fig. 4. Effects of CRP on regulated proteins related to cell

cycle ................................................................................ 20

Fig. 5. CRP induced p53, p21 expression and

phosphorylation level of p53 ........................................... 22

Fig. 6. CRP-induced p53 activation via ERK pathway ..... 25

Fig. 7. CRP activates ERK pathway and inhibits cell

proliferation ................................................................................ 26

Fig. 8. FcγRIIIa-mediated cell cycle arrest of H9c2 cardiac

myocytes by CRP ...................................................................... 28

1

ABSTRACT

C-reactive protein induces p53-mediated cell cycle arrest

in H9c2 cardiac myocyte

Ji-Won, Choi

Department of Medical Science

The Graduate School, Yonsei University

(Directed by Professor Seok-Min Kang)

C-reactive protein (CRP) is one of the most important biomarkers for

cardiovascular diseases. Recent studies have shown that CRP regulates cell survival,

differentiation, and hypoxia-induced apoptosis. However, the effect of CRP on cell

cycle has not been studied yet. Therefore, our study investigated whether CRP

would regulate cell cycle progression in H9c2 cardiac myocytes.

CRP (10-3 50 μg/ml) inhibited the proliferation of H9c2 cardiac

myocytes dose dependently. Apoptotic analysis demonstrated no effect of CRP on

apoptosis of H9c2 cardiac myocytes. However, flow cytometry analysis showed that

2

CRP-treated H9c2 cardiac myocytes displayed cell cycle arrest in G0/G1 phase. CRP

reduced cell cycle related proteins such as, cdk4 and cdk6, as well as resulted in

increased p53 phosphorylation and p21. CRP-induced activation of p53 was

reduced by extracellular signal-regulated kinase (ERK) inhibitor, U0126 and CRP

also activated ERK activity. We demonstrated that H9c2 cardiac myocytes highly

expressed high amount of FcγRIIIa receptor with activation after CRP treatment.

Silencing FcγRIIIa receptor by siRNA suppressed CRP-mediated ERK, p53, p21

activation and resulted in normalization of cdk6 expression.

These results suggest that activation of ERK and p53 are involved in CRP-

mediated H9c2 cardiac myocytes cell cycle arrest via FcγRIIIa receptor. Our

findings implicate potential effect of CRP on cardiac myocyte survival in

cardiovascular diseases.

Key words : C-reactive protein, cell cycle arrest, cardiac myocyte

3

C-reactive protein induces p53-mediated cell cycle arrest

in H9c2 cardiac myocyte

Ji-Won, Choi

Department of Medical Science

The Graduate School, Yonsei University

(Directed by Professor Seok-Min Kang)

I. INTRODUCTION

CRP (C-reactive protein), an acute phase protein, which belong to the

pentraxin family of protein is a marker of inflammation and a risk factor in

cardiovascular diseases (CVD).1 Previous studies have implicated that CRP acts as a

potential mediator of CVD. CRP is induced in endothelial dysfunction, relative to

atherosclerotic lesion and triggers plaque rupture. CRP is a direct partaker in

pathogenesis as vascular endothelium, coagulation pathway, plaque remodeling, and

complement pathway.2-5 CRP mediates its biological effects in various cell lines via

up-regulation of the FcγI, II, and III. For example, CRP interacts to FcγI receptor in

macrophage-like cell line.6 In human monocytic cell line U-937, CRP interacts to

4

FcγI receptor specifically.7 CRP induces adhesion molecule expression in human

endothelial cells, therefore CRP plays an important role directly in promoting the

inflammatory component of atherosclerosis.8 Moreover, CRP attenuates the

angiogenic and arteriogenic functions of human endothelial progenitor cells (EPCs).

These results cause dysfunction and the vascular regenerative capacity of EPCs.9 In

addition, CRP inhibits EPC survival, differentiation, and function.10 Recently,

inhibition of CRP limits myocardial damage during acute myocardial infarction in

rat models, which suggests that CRP may play an important role in the progression

of cardiac function. Yang et al. demonstrated that CRP augments hypoxia-induced

apoptosis through mitochondrion-dependent pathway in rat neonatal

cardiomyocytes.11 In CRP transgenic mice model, CRP promotes cardiac fibrosis

and inflammation under high Ang II conditions.12 However, the precise underlying

mechanisms of CRP on cardiac myocytes were not completely clear. Furthermore,

the effect of CRP on cell cycle of cardiac myocytes has not been studied yet.

In this study, we investigated the molecular mechanisms of CRP effects on

cell cycle to determine how intracellular signaling pathways are regulated in CRP-

treated H9c2 cardiac myocytes.

5

II. MATERIALS AND METHOD

1. MATERIALS

Human CRP protein purified from pleural fluid was used in this study (cat. no.

AG723, Millipore Co, Bedford, MA, USA). 0.1% NaN3 was removed from purified

human CRP by several dialysis of buffer containing 100mM NaCl, 10mM Tris-HCl

and 2mM Ca2+. To examine the role of kinases in this study, several kinase

inhibitors were selected. ATM/ATR kinase inhibitor, DNA-PK inhibitor (DMNB),

JNK inhibitor (SP600125), PI3K/AKT inhibitor (LY294002) and MEK/ERK

inhibitor (U0126) were obtained from Calbiochem (San Diego, CA, USA). PFT-α,

an inhibitor of p53 transactivation was purchased from Sigma-Aldrich (St. Louis,

MO, USA). Mouse monoclonal antibodies to CDK6, cdc2, and CyclinA and rabbit

polyclonal antibodies to Bcl-2, Bax, p21, CDK2, CyclinE and p21 were acquired

from Abcam (Cambridge, MA, USA). Mouse monoclonal antibody to CyclinD1 and

rabbit polyclonal antibodies to p53 and phospho-specific p53 were obtained from

Cell Signaling Technology (Danvers, MA, USA). Mouse monoclonal antibodies to

phospholyated -ERK, and β-actin and rabbit polyclonal antibodies to Cdk4,

cyclinD1, cyclinB1, Akt, phospholyated -Akt, and ERK were purchased from Santa

Cruz biotechnology (Santa Cruz, CA, USA). HRP-conjugated secondary antibodies

to mouse and rabbit were also acquired from Santa Cruz biotechnology.

2. METHODS

6

A. Cell culture

H9c2 cardiac myocytes from Rattus norvegicus embryo myoblast

myocardium were used in this study. H9c2 cardiac myocytes obtained from

American Type Culture Collection (ATCC, Manassa, VA, USA). Cells were

maintained at 37℃ in a 5% CO2-95% air humidified atmosphere, in Dulbecco’s

modified Eagle’s medium (DMEM, GIbco, Grand Island, NY, USA) supplemented

with 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY, USA) and

1% antibiotics (100 Units/ml of penicillin and 100μg/ml streptomycin) (Gibco,

Grand Island, NY, USA). Cells were plated 2.0 x 104/cm2 every subculture. All

experiments were performed using cells between passage numbers 10 to 25.

B. Measurement of cell viability and proliferation

Cell viability was monitored by the classical 2-(4,5-dimethyltriazol-2-yl)-

2,5-diphenyl tetrazolium bromide (MTT) assay (amresco, Solon, OH, USA). H9c2

cardiac myocytes (2 x 104 cells/well) were incubated for 24 hours in 48-well tissue

culture plate and changed to 0.5% FBS DMEM media for 20 hours starvation. After

starvation, it was treated with CRP of following dose; from 1 ng/ml to 50 μg/ml

during 24 hours, 48 hours, and 72 hours. After treatment, the media was removed

and the media containing 5 mg/ml MTT reagent was added to each well. After

incubation for 2 hours at 37℃, cell supernatants were discarded. MTT crystals were

dissolved with DMSO. Stained MTT was eluted and transferred to 96-well cell

culture plate. The samples were read on 570 nm wave length by ELISA reader (Bio-

7

Rad, Hercules, CA, USA). All assays were performed in triplicate, and the data are

presented as average ± S.D. value. Percent viability was defined as the relative

absorbance of treated versus untreated control cells.

Cell proliferation was determined with Bromodeoxyuridine (BrdU) assay.

BrdU is incorporated into newly synthesized DNA strands of actively proliferating

cells. It is detected immunochemically population of synthesizing DNA. H9c2

cardiac myocytes were plated in 96-well tissue culture plate at 1 x 104 cells/well of

appropriate DMEM and changed 0.5% FBS DMEM for starvation. After starvation

cells were treated with CRP from 1 ng/ml to 50 μg/ml during 24 hours. After then,

cells were detected by BrdU assay kit (Millipore Co, Bedford, MA, USA). Diluted

BrdU addition was 2 hours prior to the end of the CRP incubation. It is necessary to

fix the cells and denature the DNA using the fixing solution. Remove media in plate,

Add 200 μl/well of the fixing solution and incubate at room temperature for 30

minutes. The plate was washed by washing buffer for three times. Then, 100 μl/well

of diluted anti-BrdU were added to the plate and incubated for 1 hour at room

temperature. It was washed three times with washing buffer. After washing, Goat

anti-Mouse IgG, peroxidase conjugate antibody was filtered using a 0.22 μm syringe

filter. This antibody was added 100 μl/well and incubated for 30 minutes at room

temperature. Once more washing step, the plate was included 100 μl/ml of 3,3’,5,5’-

tetramethyl benzidine (TMB) peroxidase substrate and incubated for 30 minutes at

room temperature in the dark. Finally, the plate was added the stop solution 100

μl/well and read using a spectrophotometer microplate reader set at 450 nm.

8

C. Caspase-3 activity assay

Caspase-3 activity assay was measured with ApoAlert® Caspase-3 assay

Kit (Clontech, Palo Alto, USA). It detected the emission shift of 7-amino-

4trifluoromethyl coumarin (AFC). The AFC-substrate conjugate usually emits blue

light at 485 nm. However, cleavage of the substrate fluoresces in yellow-green light

at 535 nm. Fluorometric detection for caspase-3 is performed using a 485 nm

excitation filter and 535 nm emission filter. After plating H9c2 cardiac myocytes on

60 mm cell culture dish, CRP was treated from 0.1 μg/ml to 50 μg/ml during 24

hours. Cells were harvested and centrifuged at 7000 rpm for 3 minutes twice. Then,

cells were suspended 50 μl of chilled cell lysis buffer and incubated on ice for 30

minutes. Cells were centrifuged at 14000 rpm for 1 hour at 4℃ and transferred

supernatants to new microcentrifuge tubes. Protein in supernatants was determined

concentration using bicinchoinic acid (BCA) assay reagent kit as standard with

bovine serum albumin (Sigma, St. Louis, MO, USA). 20 μg of protein mixed 2x

reaction buffer containing 20 mM HEPES (pH 7.4), 100 mM NaCl, 0.5% NP-40, 10

mM DTT, and 1 mM PMSF and 5 μl of 1 mM caspase-3 substrate to each tube. The

mixture was incubated at 37℃ for 2 hours in a water bath. Finally, it is read in a

fluorometer with a 485 nm excitation filter and 535 nm emission filter (multilaverl

counter VICTOR 3, Perkin Elmer, MA, USA).

D. Cell cycle analysis

9

To analyze cell cycle, cells were stained with propidium iodide (PI). PI

was stained whole cells or nucleus that conjugated main groove of double-stranded

DNA, therefore it generated fluorescent. PI was also conjugated double-stranded

RNA, so protected this phenomenon, its mixture were added with RNase. After

treatment 50 μg/ml CRP during 24 hours, cells were washed by PBS twice and

released by trypsinization. It was harvested by centrifuge and washed by PBS for

remove trypsin. Cells were then fixed in 70% ethanol overnight at -20℃. After

centrifugation, ethanol was removed and incubated RNase at 37℃ for 20 minutes.

Cells were subsequently stained with PI and subjected to DNA content analysis

FACS caliber (BD, Ramsey, MN, USA).

E. Western blot

CRP treated cells were suspended in cell lysis buffer containg 40 mM

HEPES (pH 7.5), 120 mM NaCl, 1 mM EDTA, 10% Triton-x100, and 1tablet

EDTA-free protease inhibitor cocktail and incubated on ice for 30 minutes. Cells

were centrifuged at 14000 rpm for 1 hour and supernatants were transferred to new

tubes. Protein concentration of the cell samples was determined using the BCA

assay reagent kit with bovine serum albumin as standard. For Western blot analysis,

10 ~ 30 μg of protein was denatured by heating 95℃ for 5 minutes in SDS sample

buffer, loaded onto 8 ~ 12% SDS polyacrylamide gels, and then transferred

electrically to a poly vinylidene difluoride (PVDF) membrane. (Millipore Co,

10

Bedford, MA, USA) The membrane was blocked in 5% skim milk TBS-tween 20

(TBS-T, 0.1% tween 20) buffer for 1 hour. After blocking the membrane, it was

rinsed three or four times with TBS-T buffer and incubated with primary antibodies

for overnight at 4℃ or 1 hour room temperature. The membrane was washed four

or five times with TBS-T buffer for 7 minutes, and then incubated for 1 hour at

room temperature with horseradish peroxidase (HRP)-conjugated secondary

antibodies. After then, it was visualized for immunoreactivity using an ECL

reagent.(KPL, DC. USA)

F. RT-PCR (Reverse Transcription Polymerase Chain Reaction)

F.1. Isolation of total RNA

Total RNA from H9c2 cardiac myocytes was extracted by Tri-reagent

(Sigma, St. Louis, MO, USA) 1 ml per 100 mm dish and poured chloroform above

Tri-reagent, voltexing a sample about 15 seconds. Then, samples were centrifuged

at 13000 rpm, 4℃ for 15 minutes. The upper layer was transferred into in new tubes

and chloroform was added again. After centrifugation, 2-propanol added to the

upper aqueous phase, and the samples centrifuged at 13000 rpm, 4℃ and 1 hour.

The pellet was washed by 75% ethanol-mixed diethylpyrocarbonate (DEPC) water.

It was centrifuged at 7500g, 4℃ and 5 minutes, supernatants were removed, then

dried on room temperature about 10 minutes. Finally, the RNA pellet was dissolved

11

with 30 μl RNase-free water, and measured by OD260/OD280 with spectrophotometer

(Eppendorf ) for quality and quantity of RNA.

F.2. cDNA synthesis

Complementary DNA (cDNA) was synthesized with ImProm-IITM reverse

transcription system (Promega, Madison, WI, USA). The mixture of 1 μg total RNA

and oligo dT was incubated in heat block at 70℃ for 5 minutes and cooled at ice for

5 minutes. It was added to 5x reaction buffer, dNTP mixture, reverse transcriptase

and NFW and incubated in heat block at 25℃ for 5 minutes. Then the samples were

incubated in heat block at 42℃ for 1 hour, finally reverse transcriptase in the

samples was inactivated at 70℃ for 15 minutes.

F.3. PCR analysis

The cDNA reaction mixture, each 10 pmol primer (forward and backward),

0.1 mM dNTP mixture, 1.25 U of taq polymerase and 10x reaction buffer were

mixed with NFW to final volume of 50 μl. PCR condition was designed as follows:

one cycle of denaturing at 95℃ for 3 minutes followed by number of 25 to 30

cycles of denaturation at 95℃ for 30 seconds, annealing at 58℃ to 60.4℃ for 40

seconds, and elongation at 72℃ for 30 seconds.

The following primer sequence was used: p53 sense primer (5' –GTCATGGAG

GATTCACAGTCGGAT - 3') ; p53 anti-sense primer (5' –TCCTTCCACCCGGATA

12

AGATGTTG- 3') ; FcγR I sense primer (5' –GATAAGAAAGTGTACAATGTGG

CT- 3') ; FcγR I anti-sense primer (5' -GCTGCCCATGTAGAAGGAGAAGTA- 3');

FcγR II sense primer (5' -ATGGACAGCAACAGGACTGTCGTC- 3') ; FcγR II

anti-sense primer (5' -AATCGTCAATACCGGCAACGA- 3') ; FcγR IIIa sense

primer (5' -ATGACTTTGGAGACCCAGATG- 3') ; FcγR IIIa anti-sense primer (5'

-GAACCACACTAGAGAGCTGGT- 3'); GAPDH sense primer (5' –AATGCATCC

TGCACCACCAACTGC- 3') ; GAPDH anti-sense primer (5' –GGAGGCCATGT

AGGCCATGAGGTC- 3'). PCR product was separated by electrophoresis in a

1.0% agarose gel and visualized in Gel- Doc system after staining with Gel-red

(Biotium, Hayward, CA, USA).

G. DNA-PK activity assay

To quantitate DNA-dependent protein kinase activity, SignaTECT® DNA-

Dependent protein kinase (DNA-PK) assay System(a) was used. Using [α-32P]ATP,

phosphorylated DNA-PK was bound to SAM2® membrane. Whole-cell lysates were

prepared from H9c2 cardiac myocyte. 25μg of protein lysate were mixed with

deionized water upto 25μl. It was incubated at 30℃ for 5 minutes and added to

termination buffer. This sample was spotted 10μl onto the SAM2® membrane. It was

washed with 2M NaCl and heated 5 minutes under a heat lamp. This membrane was

detected using liquid scintillation countor LS6500 (Beckman, Pasadena, CA, USA)

adding scintillation fluid.

13

H. siRNA transfection

For silencing FcγR IIIa in H9c2 cardiac myocytes, siRNA was synthesized

based on the selected target sequence: 5' - CTGACTAAGGTCTTGTTGT - 3'. After

plating H9c2 cardiac myocytes in 60 mm dish, Fcγ receptor IIIa siRNA 20nM was

transfected into H9c2 cells using G-fectin reagents (genolution) 7 μl. After 24 hours

incubation, the cells were starved for 20 hours and treated with CRP 50 μg/ml for

RT-PCR and western blot.

14

III. RESULTS

1. Effect of CRP on viability, proliferation, and apoptosis of H9c2 cardiac

myocytes

To investigate the effect of CRP on cell viability, cells were cultured with

various concentration of CRP for 24, 48, 72 hours. CRP was not an effective

inhibitor of viability until 48 hours. However, at 72 hours incubation, CRP inhibited

viability of cells in dose-dependent manner up to 50 μg/ml. (Fig. 1A) To exaine the

effect of CRP on the proliferation of cells, cells were cultured with various

concentration of CRP for 24 hours. CRP inhibited significantly 10 % FBS-

stimulated proliferation of cells. (Fig. 1B) However, caspase-3 activity was not

significantly changed in CRP treated H9c2 cardiac myocytes up to 50 μg/ml. (Fig.

2A) Also, Bcl-2 and Bax expression were not significantly changed by CRP

treatment. (Fig. 2B) Taken together, CRP had an inhibitory effect of CRP on

viability and proliferation, but did not have an effect on apoptosis of H9c2 cardiac

myocytes.

15

Fig. 1. CRP inhibits cell viability and cell proliferation.

A. Cells were serum-starved for 20 hours and then were treated CRP from 1 ng/ml

to 50 μg/ml for 24 hours, 48 hours, and 72 hours. After then, cells were measured

using MTT assay. B. Cells were serum-starved for 20 hours and were treated CRP

for 24 hours. Cell proliferation was confirmed detecting by BrdU assay. (* P < 0.01

vs control)

16

Fig. 2. CRP has no effect on apoptosis.

A. Cells were serum-starved for 20 hours and then were treated with 0.1, 1, 10, and

50 μg/ml of CRP for 24 hours. After treated, cells were harvested and quantified

protein. It was incubated with mixture and measured by fluorometric detector. B.

Cells were serum-starved for 20 hours and incubated with 0.1, 1, 10, and 50 μg/ml

CRP for 48 hours. After incubation, cells were harvested and whole cell lysate was

collected. Bcl-2, Bax and β-actin were detected by western blot. The optical density

is expressed in arbitrary units normalized against a control. Data in histograms

represent means±SD from 3 experiments.

17

2. Effect of CRP on cell cycle progression of H9c2 cardiac myocytes

Next, we investigated relationship between CRP and cell cycle

progression using FACS analysis. Cell cycle analysis showed that 50 μg/ml of CRP

led to increase in the percentage of cells in G0/G1 phase about 15% and decrease in

the percentage of S and G2/M phase about 15% (Fig. 3). This finding suggests that

CRP induces G0/G1 phase cell cycle arrest in H9c2 cardiac myocytes.

18

Fig. 3. CRP induces G0/G1-phase cell cycle arrest.

Cells were plated at 1 x 105 cells/well and serum-starved for 20 hours and incubated

with 1 and 50 μg/ml CRP for 24 hours in 10% FBS. Then, cells were fixed for

alcohol and strained PI solution. Cells were analyzed by means of a FACS Calibur

cytometer. A representative set of data from one of three independent experiments is

shown. A. Shown the cell number and DNA content in graph. B.

19

3. Effect of CRP on cell cycle related proteins, p21, and p53 expression

To investigate the change of cell cycle related proteins, we performed

western blots for CDK2, CDK4, CDK6, cdc2, cyclin A, cyclin B1, cyclin D1, cyclin

E. Among them, levels of CDK4 and CDK6 were decreased significantly following

CRP treatment in dose-dependent manner. Compared with untreated cells, cyclin D1

and CDK2 were also significantly decreased at 50 μg/ml of CRP. (Fig. 4)

The cell cycle proteins are regulated by upstream regulator, p21 mediated by p53.

As shown in Fig. 5A, 50 μg/ml of CRP induced phosphorylation of p53

dramatically after 48 hours incubation, so we performed further study with 48 hours

incubation. Expression of p53 and p21 and phosphorylation level of p53 were

increased dose dependently in CRP treated H9c2 cardiac myocytes. (Fig. 5B)

Moreover, RT-PCR product of p53 expression was also steadily increased after CRP

treatment. (Fig. 5C)

20

21

Fig. 4. Effects of CRP on regulated proteins related to cell cycle.

Cells were serum-starved for 20 hours and incubated with 0.1, 1, 10, and 50 μg/ml

CRP for 24 hours. After incubation, the cells were harvested and whole cell lysate

was collected. Expression of CDK4, CDK6, clyclin D1, cyclin E, CDK2, cyclin A,

cdc2, cyclin B1, and β-actin were detected by western blot. The optical density is

expressed in arbitrary units normalized against a control. Data in histograms

represent means±SD from 3 experiments. (* P < 0.01 vs control)

22

23

Fig. 5. CRP induced p53, p21 expression and phosphorylation level of p53.

Cells were incubated with 50 μg/ml CRP for 24, 48, 72 hours. After treatment cell

lysates were detected p-p53, p53, p21 and β-actin using western blot. B. Cells were

incubated with 0.1, 1, 10 and 50 μg/ml CRP during 48 hours. Western blot was

executed with whole cell lysates. C. CRP were treated with cells and incubated for

24 hours. Isolation of total RNA was used chloroform and 2-propanol and cDNA

synthesis was used reverse transcription system kit. The optical density is expressed

in arbitrary units normalized against a control. Data in histograms represent

means±SD from 3 experiments.

24

4. CRP-induced p53 activation depends on ERK pathway.

p53 are activated by various upstream kinases, such as ATM/ATR, DNA-

PK, JNK, ERK, AKT. To determine which of these kinases is responsible for the

activation of p53, inhibitor experiments for kinases were performed. The levels of

p21 expression and p53 phosphorylation were decreased after only DNA-PK

inhibitor (5 M), EKR inhibitor, U0126 (5 M) and AKT inhibitor, LY294002 (2

M) pre-treatment in CRP treated H9c2 cardiac myocytes. (Fig. 6A) We set out

further study to determine which kinases are responsible for inhibitory effect of

CRP on cell proliferation. Fig. 6B shows that the inhibitory effect of CRP on cell

proliferation and CDK4 were disappeared after pre-treatment of U0126 (5 M), but

not after LY294002 pre-treatment. In addition, DNA-PK activity was not change

incubating with CRP (Fig. 6C). Therefore, we suggest that CRP induced p53

activation via ERK activation. We next examined the level of expression and

phosphorylation of ERK in CRP treated H9c2 cardiac myocytes. The level of

phosphorylated ERK was increased dramatically after 4 hours, 12 hours, 24 hours,

and 48 hours (Fig. 7A). The level of phosphorylated Akt was also increased only

after 48 hours. (data not shown)

We also determined the effects of U0126 and PFT-α (p53 inhibitor) on the

phosphorylation level of 53 and p21 expression. The increased level of

phosphorylated p53 and p21 expression by CRP were dramatically attenuated by

U0126 and PFT-α pre-treatment (Fig. 7B). Fig. 7C shows that the inhibitory effect

of CRP on cell proliferation was also disappeared after pre-treatment of PFT-α.

25

Fig. 6. CRP-induced p53 activation via ERK pathway.

A. Inhibitors were pretreated with the cells and incubated for 1 hour. (2 μM

ATM/ATR inhibitor, 5 μM DNA-PK inhibitor, 2 μM JNK inhibitor, 5 μM U0126,

and 2 μM LY294002) Then, 50 μg/ml of CRP were incubated with the cells during

48 hours. Western blot was executed with whole cell lysates. B. Inhibitors were

pretreated with the cells and incubated for 1 hour. (5 μM, U0126 and 2 μM,

LY2946002) After pre-treatment, 50 μg/ml of CRP were incubated with the cells

during 48 hours. BrdU assay and western blot were executed with whole cells.

(**P<0.05 vs control) C. Cells were incubated with 0.1, 1, 10 and 50 μg/ml CRP

during 48 hours. DNA-PK activity was executed with whole cell lysates using

DNA-PK assay system kit.

26

Fig. 7. CRP activates ERK pathway and inhibits cell proliferation.

A. Cells were incubated with 50 μg/ml CRP for 30 minutes, 1 hour, 4 hours, 12

hours, 24 hours, 48 hours. Whole cell lysates were executed for western blot

analysis to detect changes in phosphorylated ERK, and ERK. B. 5 μM of U0126

and 5 μM of PFT-α were pretreated with the cells and incubated for 1 hour. 50

μg/ml of CRP were incubated with the cells during 48 hours. Western blot was

executed with whole cell lysates. C. Cells were plated in 96-well tissue culture

plates. Inhibitors were pretreated with the cells and incubated for 1 hour (5 μM of

U0126 and 5 μM of PFT-α). After then, 50 μg/ml of CRP were incubated with cells

during 48 hours. BrdU assay was executed with whole cells. The optical density is

expressed in arbitrary units normalized against a control. Data in histograms

represent means±SD from 3 experiments. (**P < 0.05 vs control)

27

5. Intracellular signaling mechanism of CRP through FcγIIIa receptor.

First, we investigated the presence of CRP receptors with RT-PCR in

H9c2 cardiac myocytes. We found that expression of FcγIIIa receptor was certainly

detected and its expression was more increased after treatment with 50 μg/ml of

CRP. (Fig. 8A) To verify intracellular signaling mechanism of CRP through FcγIIIa

receptor, H9c2 cardiac myocytes were exposed to 20 nM of FcγIIIa small

interference RNA (siRNA) for 24 hours. Transient transfection with siRNA

attenuated CRP-induced expression of FcγIIIa receptor and p53 activity. In addition,

siRNA attenuated CRP-induced expression of phosphorylated p53, p21,

phosphorylated ERK, and CDK6.

28

Fig. 8. FcγRIIIa-mediated cell cycle arrest of H9c2 cardiac myocytes by CRP.

A. Each panel shows RT-PCR products for expression of Fcγ receptors. Cells were

incubated in the presence or absence of CRP for 24 hours. Cells were isolated into

mRNA and synthesized cDNA. PCR product was established by DNA

electrophoresis and visualized by Gel-red. Only FcγIIIa receptor was identified. B.

Cells were plated with FcγIIIa siRNA transfection during 24 hours, and starved for

20 hours. After starvation, cells were treated with 50 μg/ml of CRP and harvested

for RT-PCR and western blot. The optical density is expressed in arbitrary units

normalized against a control. Data in histograms represent means ± SD from 3

experiments.

29

IV. DISCUSSION

Numerous studies in the past few years have carried out on the value of CRP

as a risk factor or biomarker of cardiovascular diseases. In addition, recent evidence

from several cell types suggests that CRP is not only a serum marker but also plays

a key role in cell death, angiogenesis, and immune response.16-18 Although

increasing evidences suggest that, besides CRP’s role as a diagnostic and prognostic

marker, it may play important roles in pathophysiological processes against

different cells, little is known about the effect of CRP on cell cycle. The present

study revealed that CRP leads to G0/G1 phase cell cycle arrest via p53-dependent

pathways by ERK activation. Several major in vitro studies have shown that CRP

exerts a multitude of harmful effects on vascular endothelial cells.19-20 CRP also

elicits direct proatherogenic effects on vascular smooth muscle cells via

upregulation of angiotensin II type I receptor, stimulating reactive oxygen species

(ROS) production.21 Furthermore, CRP has recently emerged as an important factor

in the progression of cardiac dysfunction.11,22 However, direct biological effects of

CRP on cardiac myocytes were poorly studied. Because, in particular, terminally

differentiated mammalian tissues such as adult cardiomyocytes have been thought

as being definitively withdrawn from the cell cycle,23 it is not surprising that effects

of CRP for cell cycle of cardiac myocytes have remained neglected until recently.

Several evidences have shown that replication of cardiac myocytes is

required for the maintenance of cardiac mass under ischemic and non-ischemic

injury. Indeed, more studies have showed that transplantation of precursor cells,

30

such as cardiac, mesenchymal, or bone marrow stem cells, could improve cardiac

function.24-26 These results indicate that undifferentiated precursor cells can

contribute to the formation of new cardiac tissue, which is accompanied by cell

divisions with cell cycle progression.27 In contrast, changes of cell cycle proteins in

response to some types of cellular injury results in the cell cycle arrest that

subsequently induces cell division defect and cellular senescence, leading to cell

death.28 A number of studies have reported that CRP induces apoptosis in coronary

vascular smooth muscle cells and endothelial progenitor cells, via upregulation of

growth arrest gene and ROS production, respectively.16,29 On the other hand, CRP

alone does not induce apoptosis in cardiac myocytes under normal condition, even

though it can enhance apoptotic cell death in hypoxia-stimulated myocytes.11 Also,

in our results, CRP has no significant apoptotic effect on H9c2 cells which is

cardiac myoblasts derived from embryonic rat heart tissue, although the long-term

treatment of cells with CRP decreases cell viability. Thus, it is conceivable that CRP

may affect events leading to cell death in cardiac myocytes, mediated by different

action mechanisms (i.e. cell cycle arrest), rather than apoptotic cell death.

In the present study we have shown that CRP-treated H9c2 cells undergo

G0/G1 phase cell cycle arrest which is accompanied by decreases in CDK4, CDK6,

and cyclin D1. Cell cycle is one of the key factors contributing to cardiac growth

during early embryonic cardiac cells like H9c2 cells. Cell cycle progression of

cardiac myocytes at embryonic stage of heart is coupled with the sequential

expression and activation of cyclins and cyclin‐dependent kinases (CDKs) just like

31

basic events of the mammalian cell cycle.27 In our results, interestingly, p53 protein

levels increased following exposure to CRP in a dose-dependent manner. CRP

treatment could also lead to a significant increase in p53 phosphorylation on Ser15.

The p53 protein has a very short half-life and low levels under normal condition in

cells which exists in a largely inactive state. Activation of p53 in response to a

variety of stimuli is associated with an increase in its protein levels and post-

translational modifications such as phosphorylation, which induces to the activation

of a number of genes like p21, leading to trigger cell cycle arrest.30 We also

observed that CRP induces a significant increase in the level of p21 that is known to

inhibit the activity of cyclin D-CDK4 complex, thus leading to G0/G1 phase arrest.

These observations suggest that p53 may play a critical role in CRP-induced cell

cycle arrest in cardiac cells. Indeed, treatment with a specific p53 inhibitor PFT-α

restored the levels of CDK4, CDK6, and cyclin D1 reduced by CRP.

The N-terminal transcriptional activation domain of p53 contains several

phosphorylation sites including Ser15 and Ser20, crucial for its activation. Several

protein kinases have been shown to phosphorylate p53 at distinct sites in N-terminal

domain. Among N-terminal phosphorylation sites, Ser15 has been known to be one

of the key residues, which contributes to the stabilization and accumulation of p53

through disruption of mdm2 binding.30 Previous studies have been reported that

several protein kinases, such as DNA-PK and ATM are thought to be responsible for

Ser15 phosphorylation of p53.31,32 Recently, ERK has been shown to phosphorylate

p53 protein at Ser 15 in response to acrylamide and doxorubicin in neuroblastoma

32

and H9c2 cells, respectively.33,34 In this study, we found that significant increase

was detected in the phosphorylation level of ERK in CRP-treated cells. Furthermore,

pretreatment of a specific ERK inhibitor, U0126, resulted in decreased

phosphorylation at Ser15 of p53. These results strongly suggest that ERK acts as the

upstream kinase for CRP-induced p53 phosphorylation. In addition, change of p53

phosphorylation by ERK inhibitor was found to parallel the protein levels of p53

and p21, consecutive to reentry into the cell cycle. As a result, CRP-induced p53

phosphorylation through ERK activation thought to be correlated with total level of

p53, possibly implicating Ser15 in stabilization and activation of p53, and leading to

cell cycle arrest.

The p53 traditionally has been thought to be a key guardian of the genome.

It is well documented that p53 is activated in response to a variety of genotoxic

stimuli, such as ultraviolet light, ionizing radiation, and mutagenic chemical agents,

which cause DNA damage, resulting in cell cycle arrest or apoptosis.35 The cell

cycle arrest that occurs in response to diverse genotoxic stresses is indispensable for

DNA repair to maintain genomic integrity. If DNA damage cannot be successfully

repaired, activated p53 induces mechanisms that lead to apoptotic cell death in order

to block abnormal cell proliferation.30,35 However, recent studies demonstrated that

nongenotoxic compounds, such as RITA, Nutlin-3, and MI-219 also can induce

stabilization and accumulation of p53, resulting in the activation of p53 in absence

of DNA damage.36-38 In normal cells, the activation of p53 by a nongenotoxic agent

induces cell cycle arrest but not cell death.33 Recent work has suggested that a

33

nongenotoxic compound rather induces cellular senescence.39 It has been reported

that low dose of doxorubicin also slightly increases p53 protein, thereafter inducing

cellular senescence instead of apoptotic cell death in cultured neonatal rat

cardiomyocytes.40 Although relationship between p53 regulating cell cycle arrest

and apoptosis has been extensively studied, little is known about p53 involvement

in cellular senescence yet. The cell cycle arrest is a hallmark of cellular senescence

that is accompanied by changes in the expression of many proteins that regulates

cell cycle, cytoskeletal structures, and cellular morphology.41 H9c2 cells treated

with CRP presented morphological changes, such as flattened and enlarged cell

shapes, consistent with phenotypic characteristics of cellular senescence. Based on

these findings including CRP-induced p53 activation, we propose that cardiac cell

death in response to CRP is not due to the apoptotic mechanisms, but rather is the

result of cellular senescence, given that p53 is regarded as a typical inducer of

senescence, acting as the regulator of cell cycle. In particular, cardiac myoctyes are

continually exposed to stresses from many endogenous sources, and cellular

senescence is likely to be the factor responsible for the decrease in cardiac myocytes

number in aging heart.42 As elevation of CRP reflects the extent of myocardial death

and correlates with cardiac outcomes following AMI,43,44 cardiac cell senescence

may be affected by CRP, which induces cell death and net reduction in myocyte

number, subsequent pathological consequences of the heart, such as myocardial

infarction and heart failure. Further investigation is required to determine the

contribution of CRP to change cell fate through induction of cell cycle arrest and

34

cellular senescence in adult cardiomyocytes, given that no cell division or limited

proliferation particularly in response to pathological stimuli is observed in adult

myocardium.

Previous studies have reported that CRP binds to Fc-gamma (Fcγ) receptors,

such as CD16a (FcγRIIIa), CD32 (FcγRII), and CD64 (FcγRI) in various cells.45

However, to date, no reports have determined a CRP receptor on cardiomyoctyes. In

our study, we observed that FcγRIIIa was expressed in H9c2 cells, and its

expression level increased in response to CRP treatment. In addition, increased

phosphorylation of p53 and ERK induced by CRP is reversed considerably by

FcγRIIIa knock-down using siRNA. FcγRIIIa siRNA transfection also restored the

levels of cell cycle proteins. These results indicate that CRP binding to activating

FcγRIIIa may be necessary for the ERK signaling and thereby activating the p53-

mediated cell cycle arrest in H9c2 cells. Although additional studies are required to

determine specific signaling molecules between FcγRIIIa and ERK for CRP-

mediated p53 activation, our data have provided the first proposal on the novel

insights into how CRP directly affects pathophysiological processes such as cell

cycle and senescence in cardiac myocytes.

35

V. CONCLUSION

In conclusion, we found that CRP induces G0/G1 phase cell cycle arrest

through activation of ERK and p53 in H9c2 cardiac myocytes via FcγRIIIa receptor.

Therefore, our studies implicate potential effect of CRP on cardiac myocyte survival

and senescence in cardiovascular diseases.

36

REFERENCE

1. Tillett WS, Francis T. Serological reactions in pneumonia with a non-protein

somatic fraction of pneumococcus. J Exp Med. 1930; 30; 52: 561-71.

2. Jialal I, Devaraj S, Venugopal SK. C-reactive protein: Risk marker or Mediator in

atherothrombosis? Hypertension. 2004l; 44: 6-11.

3. Scirica BM, Morrow DA. Is C-reactive protein an innocent bystander or

proatherogenic culprit? The verdict is still out. Circulation. 2006; 113: 2128-34.

4. Blake GJ, Ridker PM. C-reactive protein: a surrogate risk marker or mediator of

therothrombosis? Am J Physiol Regul Integr Comp Physiol. 2003; 285: R1250-2.

5. Bisoendial RJ, Boekholdt SM, Vergeer M, Stroes ES, Kastelein JJ. C-reactive

protein is a mediator of cardiovascular disease. Eur Heart J. 2010; 31: 2087-91.

6. Tron K, Manolov DE, Röcker C, Kächele M, Torzewski J, Nienhaus GU. C-

reactive protein specifically binds to Fcgamma receptor type I on a macrophage-like

cell line. Eur. J. Immunol. 2008; 38: 1414–22

7. Crowell RE, Du Clos TW, Montoya G, Heaphy E, Mold C. C-reactive protein

receptors on the human monocytic cell line U-937. Evidence for additional binding

to Fc gamma RI. J Immunol. 1991; 15; 147 :3445-51.

8. Pasceri V, Willerson JT, Yeh ET. Direct Proinflammatory Effect of C-Reactive

Protein on Human Endothelial Cells. Circulation. 2000; 102: 2165-8.

9. Suh W, Kim KL, Choi JH, Lee YS, Lee JY, Kim JM, Jang HS, et al. C-reactive

37

protein impairs angiogenic functions and decreases the secretion of arteriogenic

chemo-cytokines in human endothelial progenitor cells. Biochem Biophys Res

Commun. 2004; 321: 65–71

10. Verma S, Kuliszewski MA, Li SH, Szmitko PE, Zucco L, Wang CH, et al. C-

reactive protein attenuates endothelial progenitor cell survival, differentiation, and

function: further evidence of a mechanistic link between C-reactive protein and

cardiovascular disease. Circulation. 2004; 109: 2058-67

11. Yang J, Wang J, Zhu S, Chen X, Wu H, Yang D, Zhang J. C-reactive protein

augments hypoxia-induced apoptosis through mitochondrion-dependent pathway in

cardiac myocytes. Mol Cell Biochem. 2008; 310: 215-26.

12. Zhang R, Zhang YY, Huang XR, Wu Y, Chung AC, Wu EX, et al. C-reactive

protein promotes cardiac fibrosis and inflammation in angiotensin II-induced

hypertensive cardiac disease. Hypertension. 2010; 55: 953-60.

13. Doronzo G, Russo I, Trovati M, Anfossi G. Sodium azide in commercially

available C-reactive protein preparations does not influence matrix

metalloproteinase-2 synthesis and release in cultured human aortic vascular smooth

muscle cells. Clin Chem. 2006; 52: 1200-1.

14. Swafford AN Jr, Bratz IN, Knudson JD, Rogers PA, Timmerman JM, Tune JD,

et al. C-reactive protein does not relax vascular smooth muscle: effects mediated by

sodium azide in commercially available preparations. Am J Physiol Heart Circ

Physiol. 2005; 288: H1786-95.

15. Lafuente N, Azcutia V, Matesanz N, Cercas E, Rodríguez-Mañas L, Sánchez-

38

Ferrer CF, et al. Evidence for sodium azide as an artifact mediating the modulation

of inducible nitric oxide synthase by C-reactive protein. J Cardiovasc Pharmacol.

2005; 45: 193-6.

16. Fujii H, Li SH, Szmitko PE, Fedak PW, Verma S. C-reactive protein alters

antioxidant defenses and promotes apoptosis in endothelial progenitor cells.

Arterioscler Thromb Vasc Biol. 2006; 26: 2476-82.

17. Schneeweis C, Gräfe M, Bungenstock A, Spencer-Hänsch C, Fleck E, Goetze S.

Chronic CRP-exposure inhibits VEGF-induced endothelial cell migration. J

Atheroscler Thromb. 2010; 17: 203-12.

18. Hanriot D, Bello G, Ropars A, Seguin-Devaux C, Poitevin G, Grosjean S, et al.

C-reactive protein induces pro- and anti-inflammatory effects, including activation

of the liver X receptor alpha, on human monocytes. Thromb Haemost. 2008; 99:

558-69.

19. Wang Q, Zhu X, Xu Q, Ding X, Chen YE, Song Q. Effect of C-reactive protein

on gene expression in vascular endothelial cells. Am J Physiol Heart Circ Physiol

2005; 288: H1539-45.

20. Li L, Roumeliotis N, Sawamura T, Renier G. C-reactive protein enhances LOX-

1 expression in human aortic endothelial cells: relevance of LOX-1 to C-reactive

protein-induced endothelial dysfunction. Circ Res. 2004; 95: 877-83.

21. Wang CH, Li SH, Weisel RD, Fedak PW, Dumont AS, Szmitko P, Li RK,

Mickle DA, Verma S. C-reactive protein upregulates angiotensin type 1 receptors in

vascular smooth muscle. Circulation. 2003; 107: 1783-90.

39

22. Pepys MB, Hirschfield GM, Tennent GA, Gallimore JR, Kahan MC, Bellotti V,

et al. Targeting C-reactive protein for the treatment of cardiovascular disease.

Nature 2006; 440: 1217-21.

23. Walsh S, Ponten A, Fleischmann BK, Jovinge S. Cardiomyocyte cell cycle

control and growth estimation in vivo - an analysis based on cardiomyocyte nuclei.

Cardiovasc Res. 2010; 86: 365-73.

24. Barile L, Chimenti I, Gaetani R, Forte E, Miraldi F, Frati G, et al. Cardiac stem

cells: isolation, expansion and experimental use for myocardial regeneration. Nat

Clin Pract Cardiovasc Med. 2007; 4: S9-S14.

25. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, et al.

Monolayered mesenchymal stem cells repair scarred myocardium after myocardial

infarction. Nat Med. 2006; 12: 459-65.

26. Zeng L, Hu Q, Wang X, Mansoor A, Lee J, Feygin J, et al. Bioenergetic and

functional consequences of bone marrow-derived multipotent progenitor cell

transplantation in hearts with postinfarction left ventricular remodeling. Circulation.

2007; 115: 1866-75.

27. Ahuja P, Sdek P, MacLellan WR. Cardiac myocyte cell cycle control in

development, disease, and regeneration. Physiol Rev. 2007; 87: 521-44.

28. Campisi J, d'Adda di Fagagna F. Cellular senescence: when bad things happen

to good cells. Nat Rev Mol Cell Biol. 2007; 8: 729-40.

29. Blaschke F, Bruemmer D, Yin F, Takata Y, Wang W, Fishbein MC, et al. C-

reactive protein induces apoptosis in human coronary vascular smooth muscle cells.

40

Circulation. 2004; 110: 579-87.

30. Lavin MF, Gueven N. The complexity of p53 stabilization and activation. Cell

Death Differ. 2006; 13: 941-50.

31. Achanta G, Pelicano H, Feng L, Plunkett W, Huang P. Interaction of p53 and

DNA-PK in response to nucleoside analogues: potential role as a sensor complex

for DNA damage. Cancer Res. 2001; 61: 8723-9.

32. Tritarelli A, Oricchio E, Ciciarello M, Mangiacasale R, Palena A, Lavia P, et al.

p53 localization at centrosomes during mitosis and postmitotic checkpoint are

ATM-dependent and require serine 15 phosphorylation. Mol Biol Cell. 2004; 15:

3751-7.

33. Okuno T, Matsuoka M, Sumizawa T, Igisu H. Involvement of the extracellular

signal-regulated protein kinase pathway in phosphorylation of p53 protein and

exerting cytotoxicity in human neuroblastoma cells (SH-SY5Y) exposed to

acrylamide. Arch Toxicol. 2006; 80: 146-53.

34. Liu J, Mao W, Ding B, Liang CS. ERKs/p53 signal transduction pathway is

involved in doxorubicin-induced apoptosis in H9c2 cells and cardiomyocytes. Am J

Physiol Heart Circ Physiol. 2008; 295: H1956-65.

35. Helton ES, Chen X. p53 modulation of the DNA damage response. J Cell

Biochem. 2007; 100: 883-96.

36. Secchiero P, Barbarotto E, Tiribelli M, Zerbinati C, di Iasio MG, Gonelli A, et al.

Functional integrity of the p53-mediated apoptotic pathway induced by the

nongenotoxic agent nutlin-3 in B-cell chronic lymphocytic leukemia (B-CLL).

41

Blood. 2006; 107: 4122-9.

37. Rinaldo C, Prodosmo A, Siepi F, Moncada A, Sacchi A, Selivanova G, et al.

HIPK2 regulation by MDM2 determines tumor cell response to the p53-reactivating

drugs nutlin-3 and RITA. Cancer Res. 2009; 69: 6241-8.

38. Shangary S, Qin D, McEachern D, Liu M, Miller RS, Qiu S, et al. Temporal

activation of p53 by a specific MDM2 inhibitor is selectively toxic to tumors and

leads to complete tumor growth inhibition. Proc Natl Acad Sci U S A. 2008; 105:

3933-8.

39. Efeyan A, Ortega-Molina A, Velasco-Miguel S, Herranz D, Vassilev LT, Serrano

M. Induction of p53-dependent senescence by the MDM2 antagonist nutlin-3a in

mouse cells of fibroblast origin. Cancer Res. 2007; 67: 7350-7.

40. Maejima Y, Adachi S, Ito H, Hirao K, Isobe M. Induction of premature

senescence in cardiomyocytes by doxorubicin as a novel mechanism of myocardial

damage. Aging Cell 2008; 7: 125-36.

41. Fridman AL, Tainsky MA. Critical pathways in cellular senescence and

immortalization revealed by gene expression profiling. Oncogene. 2008; 27: 5975-

87.

42. Bernhard D, Laufer G. The aging cardiomyocyte. Gerontology. 2008; 54: 24-31.

43. Sano T, Tanaka A, Namba M, Nishibori Y, Nishida Y, Kawarabayashi T, et al. C-

reactive protein and lesion morphology in patients with acute myocardial infarction.

Circulation. 2003; 108: 282-5.

44. Arruda-Olson AM, Enriquez-Sarano M, Bursi F, Weston SA, Jaffe AS, Killian

42

JM, et al. Left ventricular function and C-reactive protein levels in acute myocardial

infarction. Am J Cardiol. 2010; 105: 917-21.

45. Marnell L, Mold C, Du Clos TW. C-reactive protein: ligands, receptors and role

in inflammation. Clin Immunol. 2005; 117: 104-11.

43

ABSTRACT (IN KOREAN)

C-reactive protein 에 의한 p53 활성화와 심근세포의 세포주기억제

< 지도교수 강 석 민 >

연세대학교 대학원 의과학과

최 지 원

C-reactive protein (CRP)는 다양한 심혈관 질환에서 중요한

생체표지인자 중의 하나이다. 최근 연구들에서 CRP가 세포의 생존, 분화,

그리고 저산소 상태에서 유도된 세포사멸에 관여한다는 것을 보여주고

있다. 그러나 세포주기에 대한 CRP의 효과는 아직 연구 된 바가 없다.

본 연구에서는 CRP가 심근세포인 H9c2 세포에서 세포주기 진행에

관여하는지에 대해서 살펴보고자 한다.

CRP의 농도 (10-3 50 μg/ml)가 증가 함에 따라 H9c2 세포의

증식은 억제되었다. 이에 반해 CRP은 H9c2 세포의 세포사멸에는 효과가

없었다. 그러나, 유세포 분석에서는 CRP를 처리한 H9c2 세포에서 G0/G1

44

상의 세포주기가 억제되는 것을 관찰 할 수 있었다. CRP는 CDK4와

CDK6 같은 세포주기관련 단백질의 농도를 감소시켰고, p53과 p21의

활성을 증가시켰다. CRP로 인해 활성된 p53은 ERK 억제자인 U0126에

의해서 감소되었고, 또한 CRP는 ERK를 활성화시켰다. H9c2 세포에서

FcγIIIa 수용체의 발현을 확인하였고, CRP 처리 후 발현이 더 증가 되는

것을 알 수 있었다. siRNA를 이용한 FcγIIIa 수용체의 발현 억제는 CRP로

인해서 활성화된 ERK, p53, p21을 억제시켰고, CDK6의 발현을 정상화

시켰다.

결론적으로 본 연구에서는 CRP가 H9c2 세포의 FcγIIIa 수용체를

통하여 ERK와 p53의 활성화를 유도하고 이에 따른 CDK4와 CDK6 의

발현을 감소 시켜 G0/G1 상의 세포주기를 억제함을 알 수 있었다. 본

연구의 결과들은 다양한 심혈관 질환에서 심근세포의 생존에 대해

CRP가 영향을 미칠 수 있다는 가능성을 제시할 수 있을 것이다.

----------------------------------------------------------------------------------------------------------

핵심 되는 말 : C-reactive protein, 세포주기억제, 심근세포