1 Búsqueda de péptidos antimicrobianos nuevos en secreciones de piel de ranas TESIS PRESENTADA AL DEPARTAMENTO DE CIENCIAS BIOLÓGICAS DE LA UNIVERSIDAD DE LOS ANDES COMO REQUISITO PARCIAL PARA OPTAR AL TÍTULO DE DOCTOR EN CIENCIAS-BIOLOGÍA CAROLINA MUÑOZ CAMARGO Directora: HELENA GROOT, Directora del Laboratorio de Genética Humana,, Universidad de los Andes. Bogotá, Colombia. Co-director: EDUARDO MITRANI, Universidad Hebrea de Jerusalén. Jerusalén, Israel. Universidad de los Andes Departamento de Ciencias Biológicas Laboratorio de Genética Humana Bogotá, D.C. 2015
60
Embed
Búsqueda de péptidos antimicrobianos nuevos en secreciones ...
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
Búsqueda de péptidos antimicrobianos nuevos en secreciones de piel de ranas
TESIS PRESENTADA AL DEPARTAMENTO DE CIENCIAS BIOLÓGICAS DE LA UNIVERSIDAD DE LOS ANDES COMO REQUISITO PARCIAL PARA
OPTAR AL TÍTULO DE DOCTOR EN CIENCIAS-BIOLOGÍA
CAROLINA MUÑOZ CAMARGO
Directora: HELENA GROOT, Directora del Laboratorio de Genética Humana,, Universidad de los Andes. Bogotá, Colombia.
Co-director: EDUARDO MITRANI, Universidad Hebrea de Jerusalén. Jerusalén, Israel.
Universidad de los Andes
Departamento de Ciencias Biológicas
Laboratorio de Genética Humana
Bogotá, D.C.
2015
2
AGRADECIMIENTOS
A mi familia
A la Dra. Helena Groot,
Eduardo Mitrani,
Ester Boix
Vivian Salazar
A los evaluadores
Al grupo del Laboratorio de Genetica Humana
Martha Vives
A las fuentes finaciadoras
Fundación Bolivar Davivienda, Labbrands, Facultad de Ciencias, proyecto semilla, fondo de Helena Groot.
3
Búsqueda de péptidos antimicrobianos nuevos en secreciones de piel de ranas
Liquid Chromatography) que permite la integración de tecnologías moleculares en
ausencia de información en las bases de datos60. Ésta técnica requiere de
nanogramos a picogramos de secreciones para un completo análisis, lo cual indica
que con la secreción de una sola rana es posible hacer todo el estudio. Este punto
no solo simplifica considerablemente el análisis sino además protege de una
manera significativa a la biodiversidad del hábitat natural ocupado por estos
animales.
29
4.Objetivo General • Identificar nuevos péptidos antimicrobianos a partir de secreciones de piel
de ranas y caracterizar su actividad biológica.
4.1.Objetivos Específicos
-Determinar la actividad antibacteriana de los medios condicionados
obtenidos de micro-órganos de piel de ranas contra bacterias de interés
clínico.
-Evaluar la actividad citotóxica de los medios condicionados de ranas en
células somáticas.
-Evaluar la expresión del gen dermaseptina B4 en los cultivos de micro-
órganos .de una especie para la cual se haya reportado previamente
este gen.
-Determinar la actividad antiviral de los medios condicionados contra el
virus de la fiebre amarilla.
-Identificar precursores génicos de péptidos antimicrobianos a partir de
micro-órganos de las ranas con mejor actividad antimicrobiana.
-Identificar péptidos antimicrobianos con herramientas proteómicas y
bioinformáticas de las secreciones de las especies con potente actividad
antimicrobiana.
-Evaluar la actividad biológica de los candidatos identificados.
-Determinar las propiedades biofísicas de los candidatos con mejor
actividad biológica.
30
5. Capítulo 1 Los micro-órganos de piel de ranas secretan potentes agentes antimicrobianos en cultivo.
Los resultados de la primera parte del trabajo quedaron consignados en la siguiente publicación: Skin micro-organs from several frog species secrete a repertoire of powerful antimicrobials in culture, Journal of antibiotics, 2012.
5.1 Resumen En este artículo se describe la implementación de la técnica de cultivo de MOs
para la obtención de secreciones de piel de ranas. Se muestra que la estructura
histológica de la piel de las ranas permanece intacta en los MOs y que se
mantienen la secreción de sustancias con potente actividad antibacteriana.
Nuestra estrategia fue crear un banco de secreciones de piel de ranas de
diferentes especies, denominadas como medios condicionados. Este banco está
conformado por los medios condicionados de alrededor de 50 especies, algunas
de ellas de particular interés por ser endémicas y otras por estar en peligro de
desaparecer. Finalmente, mostramos los resultados antibacterianos de los medios
condicionados de las especies más potentes sin que presenten toxicidad contra
células somáticas.
ORIGINAL ARTICLE
Skin micro-organs from several frog species secretea repertoire of powerful antimicrobials in culture
Helena Groot1, Carolina Munoz-Camargo1, Johanna Moscoso1, Gina Riveros1, Vivian Salazar1,Franz Kaston Florez2 and Eduardo Mitrani3
This work is an attempt to take advantage of the rich biodiversity that exists in Colombia in order to start a systematic analysis
of antimicrobial substances that have emerged through amphibian evolution. For this purpose we have developed a technique
to grow intact frog skin derived micro-organs (SMOs) in vitro in the absence of serum. We show that in SMOs, the skin glands
remain intact and continue to secrete into the medium substances with potent antibacterial activity, for several days in culture.
Our strategy has been to create a bank of substances secreted by amphibian skin from different species. This bank contains at
present around 50 species and is of particular importance as some of the species are in danger of disappearing. We show that
some of the species tested displayed very strong antibacterial activity without being toxic to somatic cell lines, even at 10-fold
higher concentration.
The Journal of Antibiotics advance online publication, 4 July 2012; doi:10.1038/ja.2012.50
In spite of significant advances in molecular biology, more than 40%of compounds used by modern medicine are derived from nature. Incertain areas, such as antimicrobials, anticancer, antihypertensive andanti-inflammatory drugs, the numbers are even higher and constituteabout 75% of the total.1,2 Frogs and toads have developed a successfulstrategy for surviving microbe-laden hostile environments, which relyheavily on the secretion of chemical cocktails from specialized skinglands.3 These secretions not only produce large amounts ofbiologically active peptides that are similar to mammalianneuropeptides and hormones, but they also contain a rich arsenalof broad-spectrum, cytolytic antimicrobial peptides.4,5 Their highdegree of chemical complexity is evidenced by the fact that theycontain proteins, peptides, biogenic amines, alkaloids and other as yetuncharacterized biochemicals. Interestingly, peptides have o5 kDamolecular mass are the predominant molecules in the secretions ofmany frogs,6 Five thousand living anuran frog species may produceabout 100 000 different antimicrobial peptides. Colombia has B10%of the world’s biodiversity with more than 700 amphibian speciesrepresenting a ‘natural treasure trove’ for novel discovery.7,8
We have adapted the micro-organ (MO) technology to study thein vitro secretions of frog skin derived MOs (SMOs) in serum-free
defined-media. The technology is based on the fact that preservation
of the basic epithelial–mesenchymal interactions allows for highly
complex ex vivo function of epidermal cells. The approach is based on
the preparation of organ fragments that preserve the basic
microenvironment encountered by epithelial cells in vivo but with
geometry and dimensions that ensure appropriate diffusion of
nutrients and gases to all cells in culture.9,10 Such fragments have
been termed MOs to distinguish them from other tissue fragments
that do not encompass the true organ structure.9,11,12
In the present work we report the collection and initial character-ization of activities of frogs collected from highly varied habitats ofColombia. In addition we have collected DNA and RNA samples fromeach species for our records and for further analysis. We haveobtained both in vivo and in vitro secretions and we further showthat MOs prepared from frog skin (SMOs) can be successfullycultured for several days in vitro. During that period the frog SMOssecrete into the serum-free medium a whole repertoire of substanceswith powerful broad-spectrum antibacterial activities. Activitiesobtained from in vitro secretions were found, in most cases and thesame concentrations, to be higher per gram of tissue than the actualsecretions in vivo. More importantly, these active secretions werefound not to be toxic to somatic cells even at 10-fold higherconcentrations. We also confirmed that frog SMOs transcribe house-keeping genes when cultured for several days in serum-free medium.
MATERIALS AND METHODS
Frogs specimensWe have created a bank of skin secretions from 50 species of frogs collected
from different regions of Colombia including the Guajira, upper Magdalena
Valley, Amazone region, Andes piedmont and at the base of the eastern
1Laboratory of Human Genetics, Department of Biological Sciences, Universidad de los Andes, Bogota, Colombia; 2Fundacion Nativa, Bogota D.C., Colombia and 3Institute ofLife Sciences, Hebrew University of Jerusalem, Jerusalem, IsraelCorrespondence: Professor E Mitrani, Institute of Life Sciences, Hebrew University of Jerusalem, Silverman Building, Room 3-524, Givat Ram, Jerusalem 91904, Israel.E-mail: [email protected]
Received 2 March 2012; revised 9 May 2012; accepted 15 May 2012
The Journal of Antibiotics (2012) 00, 1–7& 2012 Japan Antibiotics Research Association All rights reserved 0021-8820/12
solution) were added to each well of the microtiter tray after 48 h of
incubation. The tray was then incubated at 37 1C for 4 h more. To dissolve
the formazan crystals, 70ml of dimethylsulphoxide was added to each well.
After shaking the tray for 10 min, whereby formazan crystals were completely
dissolved, the absorbance of the wells was read in a computer-controlled
microplate reader (Bio-Rad, Philadelphia, PA, USA) at 595 nm. The percentage
of viable treated cells was calculated in relation to untreated controls (viability
percentage¼OD-treated cells/OD control cells� 100%). The untreated
control was taken as 100%.
RT-PCR analysisFor each sample, total RNA was extracted from five equal-sized SMOs, with
acid-guanidine and phenol as described,17 and reverse-transcribed (Promega
Corporation, Madison, WI, USA). RT-PCR was done by running parallel
reactions for each set of primers. Dermaseptin B4 primers were designed based
on the published sequence of Phyllomedusa bicolor.18
Primer sets were as follows:
b-actin 50-CGGAACCGCTCATTGCC-30
50-ACCACAACTGTGCCCATCTA-30
Dermaseptin B4 50-GACCAGACATGGCTTTCCT-30
50-TTGCTCCCTTGATTTCCA-30
PCR products obtained were gel-purified, and sequenced using an ABI
Prism 310 automated sequencer (Applied Biosystems, Carlsbad, CA, USA).
The sequence obtained was subjected to homology search using the BLAST
tool available at the NCBI database.
Statistical analysisShapiro–Wilk normality tests were performed on all data and one-way analysis
of variances were applied after the distributions of data were found to meet the
assumptions for parametric tests. Student’s t-tests were used to compare the
significance of growth inhibition and Tukey tests were used to compare
significance of cytotoxicity effects. All statistics were performed using the
software Statistics version 9 (StatSoft, Tulsa, OK, USA).
Frog skin micro-organs secrete antimicrobialsH Groot et al
2
The Journal of Antibiotics
RESULTS
Xenopus SMOs remain viable for several days in cultureAs a first step we used Xenopus laevis as a source of SMOs. We foundthat Xenopus SMOs remain viable for at least 1 week in vitro whencultured in 70% DMEM in the absence of serum at 26 1C and 5%CO2. Figure 1a shows one SMO stained with MTT (right) ascompared with an unstained SMO on the left after 8 days in culture.Figures 1b and c show standard hematoxilin eosin 8mm histologysections of Xenopus SMOs after 8 days in culture at differentmagnifications, to indicate that both the epidermis remains stratifiedand the glands retain their intact architecture.
Frog skin secretes antibacterial substances for several days whencultured as SMOs in serum-free medium in vitroIn order to determine whether frog-derived SMOs secrete into themedium antibacterial activity, CM obtained as described in themethods section was tested against four strains of bacteria: S. aureus,Salmonella sp., E. cloacae and E. coli. For each assay the in vivo skinsecretions from each species was also collected as described above andtested in parallel to the in vitro secretions. In some cases as the oneshown in Figure 2, CM was more powerful than the in vivo secretion.In others (Figure 3), a more similar pattern of activity was observedfrom the in vivo secretions as compared with the in vitro secretions.SMO cultures have been prepared from all species collected and CMhas been systematically tested against the four bacterial strains asdescribed in the previous section. On the whole, antibacterial activitywas found in all species tested. Some of the species that showed morepowerful antibacterial activities were tested further for their effect onsomatic cell lines.
Figure 1 (a) MTT viability test of SMOs. (b) Light microscopic section of dorsal skin Xenopus laevis stained with haematoxilin-eosin. (c) Higher
magnification illustrating an intact serous granular gland. A full color version of this figure is available at The Journal of Antibiotics journal online.
Figure 2 Comparison of antibacterial activity from in vivo (IV) (a) whole skin
secretions and (b) SMOs in vitro secretion of Sphaenorhynchus lacteus.
Bacterial growth control—no CM added—(solid bar), increasing amounts of
CM 5% (light bar) and 25% (gray bar) of CM. The data are presented as
the mean of two replicate samples from two independent experiments.
*Po0.05.
Frog skin micro-organs secrete antimicrobialsH Groot et al
3
The Journal of Antibiotics
Secretions from SMOs in culture are not toxic to somatic cell lineseven at 10-fold higher concentrationsAs mentioned earlier, the major obstacle to the use of peptide-basedanti-infective agents as useful drugs is their toxicities, particularly ifthey are to be administered systemically.19 We were therefore interestedto determine the toxicity of in culture secretions of frog SMOs. To thatextent CM from the same species were tested in parallel against threedifferent vertebrate somatic cell lines: CHO-K1, COS-7 and MDCK.As shown in Figure 4, CM taken after 2 days (CM2 (A)) from SMOcultures of H. boans inhibited bacterial activity even when only 5% ofCM was added to the test system. Yet, as shown in Figure 4b CM2even at a concentration 10 times higher was found to have no effect oncell growth of any of the cell lines tested. Similarly CM4 (data notshown) from the same species was found not to inhibit cell growth ofthe CHO-K1 cell line, but had a roughly 50% decrease in the numberof COS-7 and MDCK cells as compared with untreated controls.Figure 5 shows that CM obtained from SMOs derived from D.truncatus after 3 days in culture (CM3) (Figure 5a) inhibited bacterialactivity in a dose-dependent manner. Yet no effect was observed with a50% concentration of the same conditioned medium (CM3) in theviability of any of the somatic cell lines tested (Figure 5b). Comparisonof Figures 6a and b show that CM obtained from P. pipa after 1 day inculture (Figure 6a) had a powerful antibacterial activity. This activitywas found not only not to be toxic to the somatic cell lines tested butalso to be stimulatory to MDCK cells (Figure 6b).
SMOs from P. bicolor transcribe a dermaseptin geneWe were particularly interested in determining if the frog-derivedSMOs were de-novo transcribing tissue-specific genes. To that extent
and in order to obtain a measure of integrity and viability of thecultures, SMO samples obtained from P. bicolor., S. lacteus, H. boansand D. truncatus (data not shown), were cultured as described above,samples removed every 24 h and total RNA prepared. Viability wasconfirmed by the integrity of the RNA during 1 week in culture. Allfour species transcribed at steady levels the housekeeping gene actinfor the whole culture period of 6 days (data not shown). Furthermore,Figure 7 shows that SMO cultures continue to transcribe mRNAs atsustained levels for a whole week in vitro.
Using primers directed to highly conserved regions of DermaseptinB4, bands were amplified, as expected, from SMOs derived fromP. bicolor. Interestingly, a band was also amplified in samples obtainedfrom S. lacteus. The identities of the bands obtained were confirmedby sequencing. Sequences from both species showed 98% identity onthe conserved region. The sequence of the variable region obtainedfrom P. bicolor was found to be 93% similar both in size and insequence to those reported for the Phyllomedusinae subfamily asexpected. However, the variable region obtained from S. lacteus wasfound to be considerably shorter and only 49% similar to that of thePhyllomedusinae subfamily (data not shown).
Patterns of bacterial inhibition do not seem to be related to specifichabitatsActivities of the different species tested have been summarized inTable 1. The table shows concentration of conditioned mediumrequired to bring about 50% inhibition of bacterial cell growth(bacterial inhibition LD50). Antibacterial activities are organized inTable 1 by species and their habitat and site of origin. No specificpatterns of activities could be assigned to particular habitats. For
Figure 3 Comparison of antibacterial activity from in vivo (IV) (a) whole skin
secretions and (b) SMOs in vitro secretion CM taken 1 day after culture of
Hypsiboas lanciformis. Bacterial growth control—no CM added—(solid bar),
increasing amounts of CM 5% (light bar) and 25% (gray bar) of CM. The
data are presented as the mean of two replicate samples from two
independent experiments. *Po0.05, **Po0.001.
Figure 4 Secretion from SMOs of Hypsiboas boans (a) inhibited bacterial
activity, CM obtained after 2 days, (b) with virtually no effect (CM2) on cell
viability. Bacterial growth control—no CM added—(solid bar), increasing
amounts of CM 5% (light bar and 25% (gray bar) of CM in antibacterial
assays, 10% (light bar) and 50% (gray bar) in cytotoxic assays. The data
are presented as the mean of two replicate samples from two independent
experiments. **Po0.001.
Frog skin micro-organs secrete antimicrobialsH Groot et al
4
The Journal of Antibiotics
example, CM1 of H. lanciformis found in Leticia (Amazon) displayedan LD50 of 5% in S. aureus and salmonella and of 25% in E. Cloacae.Yet, 70% CM1 was required to bring about the same level ofinhibition in E. coli. In contrast, a CM1 concentration of 35% wasrequired from Hypsiboas hobssi, found in the same habitat asH. lanciformis in order to achieve the same LD50 in all four bacterialspecies tested. CM1 derived from cultures of Scinax cruentommusobtained from the same area on the Amazon basin was found to havea much weaker antibacterial activity on all bacterial species tested(data not shown). If we now look at species collected in otherdifferent and varied habitats we see that some like Centrolene sp. werehighly active in all species tested while Scinax ruber showed varied butgenerally lower activities. Only 5% of CM3 of D. truncatus (from thesame habitat) was required for an LD50 for three of the species tested,and more than 70% was required to bring about the same LD50 inE. cloacae. In contrast, P. pipa obtained in Leticia (Amazon) displayedhigh activity for S. aureus and E. cloacae, and intermediate activityagainst Salmonella and against E. coli (see Table 1). Clearly, there doesnot seem to be any specific pattern that assigns specific activities tocertain habitats.
DISCUSSION
We have shown in the past that preservation of the epithelial–mesenchymal interactions in mammalian SMOs allows keratinocytesto continue to proliferate, and to transcribe epidermal-specific genesfor long periods when cultured in defined medium in the absence ofserum or exogenous factors.9,12 SMOs were found to retain thoseproperties irrespective of whether they were derived from new born oradult skin even though they were cultured in serum-free medium. In
the present work we show that in frog-derived SMOs, not only doepidermal cells continue to transcribe housekeeping and tissue-specificgenes, but also that whole secretory glands remain functional forseveral days in culture. In fact we show that secretions from frog SMOsin culture were, in several cases, more powerful antibacterial agentsthan those obtained from in vivo secretions. These results takentogether indicate that frog SMO culture can provide a powerfulmethod to identify secretory molecules from frog skin. As the SMOsact as bioreactors, the amount of secretion that can be obtained peranimal is amplified thus minimizing the number of specimensrequired for the characterization process.
Our strategy has been first to create a bank of substances secretedby amphibian skin from a variety species living in far and variedhabitats of Colombia. This bank is of particular importance as someof the species are in danger of disappearing. It is has been suggestedthat every species harbors a unique, specific collection of antimicro-bial peptides, tuned to defend the organism against microorganismsthat it is likely to encounter.13
As shown in Table 1, we do not seem to find any specific pattern,which assigns specific activities to certain habitats. In fact what seemsto be the case is the opposite. On second thoughts, this may beunderstood on the bases that the habitats visited are extremely rich inmicrobial diversity. Around 8000 species of prokaryotes have beendescribed but they form only a very small fraction of the truediversity.20 Techniques based on analysis of environmental DNA let tosuggest that the total number of species of bacteria (as based on thecurrent broad species definition) may be in the order of 109–1012.21
Thus, it is unlikely that amphibian species have become specializedbut rather have developed a broad-spectrum strategy in order to cope
Figure 5 Secretions from SMOs of Dendrobates truncatus CM3 (a) inhibit
bacterial in a dose-dependent manner and (b) are not toxic to somatic
amounts of CM3 5% (light bar) and 25% (gray bar). Cytotoxic assays: 10%
of CM3 (light bar), 50% of CM3 (gray bar). The data are presented as the
mean of two replicate samples from two independent experiments.
**Po0.001.
Figure 6 Secretions from SMOs of Pipa pipa (a) inhibited bacterial activity
while at the same time (b) stimulated growth of MDCK cells in culture. CM
was taken after first day of SMO culture (CM1). Antibacterial assay: no CM1
added (solid bar), increasing amounts of CM1: 5% (light bar) and 25%
(gray bar). Cytotoxic assay: 10% of CM1 (light bar), 50% of CM3 (gray bar).
The data are presented as the mean of two replicate samples from two
independent experiments. *Po0.05, **Po0.01.
Frog skin micro-organs secrete antimicrobialsH Groot et al
5
The Journal of Antibiotics
with such variety. It is this line of though that directed our approachnot towards individual substances but rather to a whole repertoire ofsubstances that act in synergism, with the mixture having up to a10-fold greater antibiotic activity than the peptides separately.13,22
The methodology presented here allows for in vitro production,analysis and characterization of the ‘natural mixture’ of compoundssecreted by different anuran species in order to cope with the highlyhostile environment in which they live. In this respect it should bepointed out that some of the activities reported here, as shown inFigures 5 and 6, were very potent against various pathogenic bacteriawithout having any toxic effects on somatic cells even at 10-foldhigher concentrations.
It is becoming clear that each ranin or hylid frog species producesits own set of antimicrobial peptides. Some of these peptides differ byonly a few amino acid substitutions or deletions and have similarbiochemical characteristics (that is, dermaseptins B1 and B2).23
Many infections that would have been cured easily by antibiotics inthe past now are resistant, resulting in sicker patients and longerhospitalizations. The economic impact of antibiotic-resistant infec-tions is estimated to be between $5 and $24 billion per year in theUnited States alone.24 There is therefore an urgent need for novelantibiotics, many peptides with antibacterial properties have beenidentified in the past from other species and several are in stage III ofclinical trials. A recent review lists seven companies involved in thedevelopment of antibacterial peptides as drugs.25 There are, however,
many challenges awaiting solution: in order to be a good candidatefor therapeutic use, a drug needs to show appropriate function, lowtoxicity, have stability in vivo and be reasonably inexpensive tomanufacture. So far only a few cationic peptides have made their wayto clinical trials and only two are used in topical creams andsolutions. A problem associated with administering cationicpeptides as a treatment for infection is the ability to direct thepeptides to the appropriate locations with the accuracy of white bloodcells after crossing the epidermal barrier.2 When injected i.v. thepeptides are required to infiltrate healthy tissue in order to reach theappropriate locations, which can be a very slow process. The host’ssystem can also act on the peptides; for example, the presence ofproteases can inactivate peptides before they reach their destination.26
A major problem that limits the systemic use of these compounds istoxicity.19 In the present work, we have started to address this latterpoint. We believe the reason that we found, on the one hand a strongantibacterial activity and on the other, hardly any toxicity is becauseof the approach taken where the whole repertoire of skin secretionsinstead of individual components was tested for activity. Thus, wehave screened for activities, which are likely the result of synergismbetween various substances secreted by the skin of the different frogspecies. The next step is to work with those species where the mostpowerful and specific activities (that is, no toxicity to somatic cells)have been obtained. Peptide composition of CM secreted by thesespecies is being characterized by LC MS/MS (data not shown).
Figure 7 Gene expression were produced in SMOs from Phyllomedusa bicolor. (a) Amplification for specific antimicrobial gene dermseptin B4
(GI:3256038). (b) Alignment of nucleotide sequence of encoding precursor of dermaseptin B4 (DB4), data base (db) and P. bicolor (ClustalW Tool). The
putative signal peptide (single-underlined), mature processed peptide (dashed line), processing site KR, stop codon (bold) and nucleotides conserved
(asterisks) are indicated.
Table 1 Comparison of the antibacterial activities from frog skin secretions of different regions of Colombia
Site of origin
Antibacterial inhibition LD50
Frog species Type of habitat S. aureus Salmonella E. cloacae E. coli
Frog skin micro-organs secrete antimicrobialsH Groot et al
6
The Journal of Antibiotics
Once the sequence identity of the various peptides is obtained, thepeptides will be synthesized and different cocktails tested again forantimicrobial activity. Furthermore, it is believed that comparison ofcombinations of peptides obtained in the different secretions vis a vistheir biological activity will help formulate better and more specificantibiotics.
ACKNOWLEDGEMENTSThis work was supported by a grant from Colciencias CODE 1204-343-19173,
and by the Fondo para las investigaciones Facultad de ciencias University of
los Andes. Bogota, Colombia.
1 Newman, D. J. & Cragg, G. M. Natural products as sources of new drugs over the 30years from 1981 to 2010. J. Nat. Prod. 75, 311–335 (2012).
2 Nakatsuji, T. & Gallo, R. L. Antimicrobial peptides: old molecules with new ideas.J. Invest. Dermatol. 132, 887–895 (2012).
3 Rollins-Smith, L. A., Reinert, L. K., Miera, V. & Conlon, J. M. Antimicrobial peptidedefenses of the Tarahumara frog, Rana tarahumarae. Biochem. Biophys. Res. Commun.297, 361–367 (2002).
4 Vanhoye, D., Bruston, F., Nicolas, P. & Amiche, M. Antimicrobial peptides from hylidand ranin frogs originated from a 150 million years old ancestral precursors with aconserved signal peptide but a hypermutable antimicrobial domain. Eur. J. Biochem.270, 2068–2081 (2003).
5 Conlon, J. M., Al-Ghaferi, N., Abraham, B. & Leprince, J. Strategies for development ofnaturally-occurring antimicrobial peptides into therapeutically valuable anti-infectiveagents. Methods 42, 349–357 (2007).
6 Chen, T., Zhou, M., Gagliardo, R., Walker, B. & Shaw, C. Elements of the granular glandpeptidome and transcriptome persist in air-dried skin of the South American Orange -legged leaf frog, Phyllomedusa hypocondrialis. Peptides 27, 2129–2136 (2006).
7 Acosta-Galvis, A. Ranas Salamandras y Caecilias (Tetrapoda: Amphibia) de Colombia.Biota Colombiana 1, 289–319 (2000).
8 Lynch, J. D. & Suarez-Mayorga, A. M. In: Colombia Diversidad Biotica IV: El Chocobiogeografico/Costa Pacıfica (ed. Orlando Rangel, J.) 633–667 (Instituto de CienciasNaturales, Ch. - Bogota, 2004).
9 Mitrani, E., Nadel, G., Hasson, E., Harari, E. & Shimoni, Y. Epithelial–mesenchymalinteractions allow for epidermal cells to display an in vivo-like phenotype in vitro.Differentiation 73, 79–87 (2005).
10 Revel, A., Laufer, N., Ben Meir, A., Lebovich, M. & Mitrani, E. Micro-organ ovariantransplantation enables pregnancy: a case report. Hum. Reprod. 26, 1097–1103(2011).
11 Hasson, E. et al. Skin-derived micro-organs induce angiogenesis in rabbits. J. Vasc.Res. 43, 139–148 (2006).
12 Voisine, P. et al. Skin-derived micro-organ autotransplantation as a novel approachfor therapeutic angiogenesis. Am. J. Physiol. Heart Circ. Physiol. 294, 213–219(2008).
13 Schadich, E., Cole, A. L., Squire, M. & Mason, D. Skin peptides of different life stagesof Ewing’s tree frog. J. Exp. Zool. A Ecol. Genet. Physiol. 313, 532–537 (2010).
14 Woodhams, D. C. et al. Population trends associated with skin peptide defenses against
chytridiomycosis in Australian frogs. Oecologia 146, 531–540 (2006).15 Lacombe, C. et al. Peptide secretion in the cutaneous glands of South American tree
frog Phyllomedusa bicolor: an ultrastructural study. Eur. J. Cell Biol. 79, 631–641(2000).
16 Klajnert, B. et al. Biological properties of low molecular mass peptide dendrimers. Int.J. Pharm. 309, 208–217 (2006).
17 Chomczynski, P. & Sachi, N. Single- step method of RNA isolation by acid guanidiniumthiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159 (1987).
18 Charpentier, S. et al. Structure, synthesis, and molecular cloning of dermaseptins B, afamily of skin peptide antibiotics. J. Biol. Chem. 273, 14690–14697 (1998).
19 Conlon, J. M. & Sonnevend, A. Antimicrobial peptides in frog skin secretions. MethodsMol. Biol. 618, 3–14 (2010).
20 Dykhuizen, D. E. Santa Rosalia revisited: why are there so many species of bacteria?Antonie Leeuwenhoek 73, 25–33 (1998).
21 Vaisman, N. & Oren, A. Salisaeta longa gen. nov., sp. nov., a red, halophilic member ofthe Bacteroidetes. Int. J. Syst. Evol. Microbiol. 59, 2571–2574 (2009).
22 Li, J. et al. Anti-infection peptidomics of amphibian skin. Mol. Cell Proteomics 6,
882–894 (2007).23 Nicolas, P. & El Amri, C. The dermaseptin superfamily: a gene-based combinatorial
library of antimicrobial peptides. Biochem. Biophys. Acta 1788, 1537–1550 (2009).24 Monaghan, R. L. & Barrett, J. F. Antibacterial drug discovery—then, now and the
genomics future. Biochem. Pharmacol. 71, 901–909 (2006).25 Davies, J. How to discover new antibiotics: harvesting the parvome. Curr. Opin. Chem.
Carolina Muñoz-Camargo1, Margarita Correa Méndez1, Vivian Salazar1, Johanna Moscoso1, Diana Narváez1,Maria Mercedes Torres1, Franz Kaston Florez2, Helena Groot1 and Eduardo Mitrani3
There is an urgent need to develop novel antimicrobial substances. Antimicrobial peptides (AMPs) are considered as promising
candidates for future therapeutic use. Because of the re-emergence of the Flavivirus infection, and particularly the yellow fever
virus (YFV), we have compared the antiviral activities from skin secretions of seven different frog species against YFV (strain
17D). Secretions from Sphaenorhynchus lacteus, Cryptobatrachus boulongeri and Leptodactylus fuscus displayed the more
powerful activities. S. lacteus was found to inhibit viral lysis of Vero E6 cells even at the highest viral concentration evaluated of
10 LD50. We also report the identification of a novel frenatin-related peptide from S. lacteus and found that this peptide—on its
own—can lead to 35% protection against YVF, while displaying no cytotoxicity against somatic cells even at fivefold higher
concentrations. These results are attractive and support the need for continued exploration of new sources of AMPs from frog
skin secretions such as those described here in the development of new compounds for the treatment of infectious diseases in
general and specific viral infections in particular.
The Journal of Antibiotics advance online publication, 6 April 2016; doi:10.1038/ja.2016.16
INTRODUCTION
Skin secretions of advanced frogs (suborder: Neobatrachia) are by farthe most important source of antimicrobial peptides (AMPs) withseveral of peptide antibiotics found in different frog species.1 Thesesecretions not only produce large amounts of biologically activepeptides that are similar to mammalian neuropeptides and hormones,but also contain a rich arsenal of broad-spectrum cytolytic AMPs.2,3
Amphibian AMPs have typical features like short length of amino-acidresidues (11–46), an amphipathic structure (α-helix) and a cationiccharge.4 These features have an important role in the antimicrobialactivity and have been effective against bacteria,5,6 fungi7,8 andviruses.9–11
The yellow fever virus (YFV) is a member of the Flaviviridae familythat has re-emerged with a large number of infections worldwide.12
This disease was recently described among one of the most lethal viraldiseases for which no approved antiviral therapy has yet beendiscovered.13 Infections with YFV cause a severe febrile disease withhemorrhage, multi-organ failure and shock, with a mortality rate up to50%.14,15 YFV is a zoonotic agent: even though there is a safe andefficient vaccine available, the virus is reintroduced from animalreservoirs into human populations.16 South America and Sub-SaharanAfrica are endemic regions with an estimated number of 200 000reported cases per year.17 Moreover, the recent increase in the densityand distribution of the urban mosquito vector, Aedes aegypti, hasraised the risk of infection and spread of YFV.16,18
On the basis of the above considerations, we have evaluated theanti-YFV activities of the skin secretions from seven frog species and
their cytotoxicity. We found that secretions from S. lacteus,C. boulengeri and L. fuscus have the most potent activity againstYFV infection in Vero cells. In S. lacteus secretions, we used rapidamplification (RACE)-PCR and degenerate primers, to elucidate thesequence of a novel frenatin-related AMP. We further show that thisnewly identified AMP can display—on its own—moderate cellularprotection against YFV-infected Vero cells without causing significantcytotoxicity, even at high peptide concentration.
MATERIALS AND METHODS
Frog skin micro-organs and secretionsWe used the skin secretions from different frogs collected around Colombia.These regions include the Guajira, the upper Magdalena Valley, the Amazonregion and the Andean piedmont. The selected species were Sphaenorhynchuslacteus, Cryptobatrachus boulengeri, Leptodactylus fuscus, Pristimantis medemi,Trachycephalus venulosus, Hypsiboas lanciformis and Hypsiboas fasciatus. Allprocedures were adhered to the license No. 2 of the 20th of January 2009, andrealized according to the access to genetic resources contract N° 26 of 2009from the Ministerio de Medio Ambiente, Colombia.The technique used to obtain frog skin micro-organs (SMOs) and frog skin
in vitro secretions, denominated as conditioned media (CM), was obtained byculturing the SMOs in serum-free media for 24 h as described previously.19
Total protein concentration from each CM culture ranged from 300 to600 μg ml− 1. It was determined using the peptide bradykinin standard curve(RPPGFSPFR) (Sigma Chemical, Houston, TX, USA).20 CM was tested atvarious concentrations ranging from 50% diluted with equal volume of serum-free culture media to 5% CM obtained by diluting the CM with 95% serum-free media.
1Laboratory of Human Genetics, Department of Biological Sciences, Universidad de los Andes, Bogotá, Colombia; 2Fundación Nativa, Bogotá, Colombia and 3Institute of LifeSciences, Hebrew University of Jerusalem, Givat Ram, Jerusalem, IsraelCorrespondence: H Groot, Laboratory of Human Genetics, Department of Biological Sciences, Universidad de los Andes, Cr. 1 Nº 18A-10 Building M1- 2 floor, Bogotá 110321,Colombia.E-mail: [email protected] 20 May 2015; revised 11 January 2016; accepted 20 January 2016
The Journal of Antibiotics (2016), 1–8& 2016 Japan Antibiotics Research Association All rights reserved 0021-8820/16www.nature.com/ja
Molecular cloning of cDNAs by 30RACE that may encode AMPsTotal RNA was extracted from five S. lacteus SMOs after 2 days in culture byTRIzol Reagent (Invitrogen, Carlsbad, CA, USA) as described previously.21
cDNA was synthesized by SMART Techniques using the SMART RACE cDNAAmplification Kit (Clontech, Palo Alto, CA, USA), according to the manu-facturer’s protocol. The 30RACE reactions employed a UPM primer(supplied with the kit) and a degenerate sense primer S1 (5′ACTTTCYGAWTTRYAAGMSCARABATG3′) that was designed previously.22
cDNAs from Phyllomedusa species. The PCR was performed under thefollowing conditions: 97 °C for 7 min; followed by 35 cycles at 95 °C for 45 s,52 °C for 30 s and 72 °C for 30 s and a final extension at 72 °C for 10 min. ThePCR products were cloned into the pGEM®-T Easy Vector System (Promega,Madison, WI, USA) using standard procedures. E. coli white positive colonieswere screened with M13 primers (Forward 5′-d(CGCCAGGGTTTTCCCAGTCACGAC)-3′, Reverse 5′-d(TCACACAGGAAACAGCTATGAC)-3′).Amplification products of the expected sizes (400–500 base pairs) were sequencedby the Applied Biosystems Genetic Analyzer (ABI PRISM 3500, CA, USA). Weused the program BLASTn (Smith-Waterman)23 from the National Center forBiotechnology (NCBI) and the ClustalW224 alignment program from TheEuropean Bioinformatics Institute (EMBL-EBI) to analyze the sequencesobtained.
Peptide synthesisThe frenatin 2.3S peptide (F2.3S GLVGTLLGHIGKILGG) described in thisstudy was synthesized by solid phase supplied by GL Biochem (Shanghai,China). The crude synthetic peptide was purified on a Venusil XBP-C18RP-HPLC column (4.6 mm×250 mm), eluting at a flow rate of 1 ml perminute by a linear gradient of acetonitrile in 0.1% trifluoroacetic acid in waterby reversed-phase HPLC. The purity (498%) and identity of the syntheticpeptide was confirmed by electrospray MS.
Cell culture and YFV stocksThe cell lines used to test the cytotoxicity of the CMs cultures were Chinesehamster (Cricetulus griseus) ovary cells (CHO-K1 ATCC CCL-61) and Africanmonkey (Cercopithecus aethiops) kidney cells (Vero E6 cell line ATCCCRL-1586). The CHO-K1 cell line was grown as a monolayer culture inRoswell Park Memorial Institute medium (RPMI-1640) and Vero E6 cell line inDubelcco’s Modified Eagle Medium (DMEM). Both media were supplementedwith 10% FBS, penicillin (1000 IU ml− 1), streptomycin (1000 IU ml− 1) andfungizone (1 μg ml− 1 amphothericin B). Both were maintained at 37 °C in ahumidified 5% CO2 atmosphere.Vaccine strain 17D (Stamaril, Pasteur Merieux, Connaught, Lyon, France)
was used as a source of YFV, which has been previously used to studyalternative treatments of yellow fever infections.25 This vaccine contains 1000mouse LD50 (lethal dose at which 50% of the subjects will die due to viralinfection) viral units and was adjusted at 0.1 LD50, 1 LD50 and 10 LD50, dilutedin DMEM non-supplemented.
MTT assayCitotoxicity assay. Cell monolayers were trypsinized, washed with culturemedium and plated in flat-bottomed 96-well microtiter trays with 3× 105 cellsper ml for CHO-K1 cells. After 24 h incubation, each diluted CM was added tothe appropriate wells and the plates were incubated for 48 h at 37 °C in ahumidified incubator with 5% CO2. The supernatants were removed from thewells, and cell viability was evaluated using the MTT technique described belowfor the antiviral colorimetric assay.
The percentage of viable treated cells was calculated in relation to untreatedcontrols (viability percentage= treated cells OD/untreated cells OD×100%).
YFV infection and antiviral colorimetric assay. The infectivity of the 17D strainover the Vero E6 cell line (3× 105 cells per ml) was evaluated in a 6- day timeinterval.25 Confluent Vero E6 cells in flat-bottomed, 96-well microtiter trayswere infected with YFV (vaccine) strain 17D at 0.1 LD50, 1 LD50 and 10 LD50,and incubated at 37 °C in humidified 5% CO2. Cell viability was measured dailyby the MTT colorimetric technique (3-(4,5-dimethylthiazol-2-yl)-2,5-diphe-nyltetrazolium bromide).26 Briefly, the supernatants were removed from the
wells and 10 μl of MTT (Sigma) (5 mg ml− 1 in PBS) was added to each well.The plates were incubated for 2 h at 37 °C, and 70 μl of DMSO was added tothe wells to dissolve de MTT crystals. The plates were placed on a shaker for15 min, and the optical density was determined at 595 nm (OD595) on amicroplate absorbance spectrophotometer (Bio-Rad, Philadelphia, PA, USA).
The antiviral assay was performed using confluent Vero E6 cell monolayersin flat-bottomed 96-well microtiter trays. Three dilutions of frog skin secretions(CMs) were prepared (at 5, 25 and 50%) and were added 1 h before viralinfection. Three viral concentrations (0.1 LD50, 1 LD50 and 10 LD50) were used,and these samples were incubated at 37 °C in a humidified 5% CO2
atmosphere. To determine the antiviral activity of the F 2.3S, confluent VeroE6 cell monolayers were first exposed to twofold serial dilutions (from20 μg ml− 1) of this peptide. In this assay, we used the high viral YFVconcentration 10 LD50 and incubation conditions as described above. Controlsconsisted of untreated infected, treated uninfected and untreated uninfectedcells. Finally, cell viability was evaluated by MTT as described above.
The 50% cytotoxic concentration (CC50) of the test CMs is defined as theconcentration that reduces the OD595 of treated uninfected cells to 50% ofuntreated uninfected cells. The 50% antiviral effective concentration, i.e., 50%inhibitory concentration of the viral effect (IC50), is expressed as theconcentration that achieves 50% protection of treated infected cells fromYFV induced destruction.
The percent protection was calculated by the following formula:
[(A−B)/C−B)× 100]
where A is the absorbance of the test sample, B is the absorbance of thevirus-infected control (no compound) and C is the absorbance of untreateduninfected cells, and it is expressed as ‘% of control’.26
Data analysisAll results were represented as means± s.d. of three replicates. Differencesamong data were determined by one-way analysis of variance (ANOVA)followed by Tukey and Dunnett’s test. Data were considered statisticallysignificant at a P-valueo0.05.
RESULTS
Frog skin in vitro secretions were obtained by culturing frog SMOs inserum-free media, for 24 h and collecting the CM as describedpreviously.19
Cytotoxicity of frog skin secretions in CHO-K1 cell lineAll evaluated CMs were not cytotoxic to the CHO-K1 cell line (Figure 1).CM from H. fasciatus was not toxic and moreover, was found tostimulate the growth of the CHO-K1 cells even at the highestconcentration tested of 50% CM.
YFV infectivity on Vero E6 cell lineThe infectivity of YFV was evaluated at three concentrations (0.1 LD50,1 LD50 and 10 LD50) on the Vero E6 cell line. All doses tested showeda marked cell death after 6 days (Figure 2), as a consequence ofmaximal viral infectivity in agreement with previous reports.27
Frog skin secretions protect Vero E6 cells from viral infection anddeathAs can be seen in Figures 3a and b, highly potent inhibition of YFVinfection was observed even at the highest viral concentration tested of10 LD50. In particular when infected cells were treated with 50% ofCM from S. lacteus and C. boulengeri. These CMs also had a protectiveeffect on Vero E6 cells viability in the presence of 0.1 LD50 and 1 LD50
YFV even at the lowest CM concentrations tested (5%). Similar resultswere observed when cells were infected and treated with CMs fromL. fuscus (Figure 3c). However, the protective effect was lowercompared with CM from S. lacteus and C. boulengeri.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
2
The Journal of Antibiotics
The other CMs evaluated (H. fasciatus, P. medemi, H. lanciformis andT. venulosus) were less effective against YFV infection. Nevertheless,significant antiviral activity was also detected (Figures 4a and d).The first panel of Figures 3a–c and 4a–d shows the cytotoxic effect
of different CMs on Vero E6 cells. Six out of seven CMs were found tobe not cytotoxic. Only CM from T. venulosus at the highestconcentration tested (50%) was found to display slight toxicity onVero E6 cells.
Frenatin 2.3S derived from S. lacteus has anti-YFV activityEncouraged by the anti-YFV results observed with secretions fromS. lacteus CM, we have attempted to characterize the composition ofthe AMPs present in these frog skin secretions. To that extent, we haveused a reverse genetics approach using degenerate primers based onconserved sequences of several AMPs secreted by Phyllomedusa,22 asdescribed in Materials and Methods section. Several clones wereisolated and three clones were selected for sequencing (Sl-5, Sl-11 andSl-16). The three clones were found to code for the same AMPprecursor (Figure 5).The cDNA sequence is 317-bp long with an open reading frame
(ORF) that encodes a peptide of 71 amino-acid residues in length. ABLASTn search in the Genbank Database revealed that our sequencehas the characteristic structure of anuran AMP precursors containing aputative signal peptide, an N-terminal acidic spacer domain, a Lys-Arg
(K-R) processing site and the mature AMP at the C-terminus. Thesignal peptide was identical in structure to frenatin 1.1 from Litoriainfrafrenata,28 but it shows differences in the region localized on theacidic spacer domain and also in the frenatin encoding regions.Alignments of both full-length nucleic acid sequences (Figure 6) madeusing the ClustalW software revealed that preprofrenatin exhibited anidentity of 66.7% at the amino-acid level. The new sequence wasdeposited in the database on 2012 (Accession no. AGB51284.1) andwas confirmed and further characterized by Conlon et al.5
To test the antiviral activity of the newly found AMP, wesynthesized the peptide based on the previously characterized F 2.3Sas described in Materials and Methods section. Figure 7a shows that ata concentration of 20 μg ml− 1 has a 35% protective effect in Vero E6cells infected with YFV (10 LD50). It should be noted that this peptidewas also tested and found not to be cytotoxic at 100 μg ml− 1 to VeroE6 cells as shown in Figure 7b.
DISCUSSION
In recent years, the Flavivirus genus has gained further attention dueto re-emergence and increasing incidence of YFV, Dengue and othersmember of this group.16 Infections with YFV are a global public healthproblem and there is an urgent necessity of more potent and safeantivirals. For this reason, our ‘biorational approach’29 is based onchemical prospecting which uses clues from amphibian physiologyand its interaction with the environment. The physiological structureof the skin of these organisms and their exposure to such variedhabitats with high microbial load is the reason why they areconsidered as an interesting model in the search of AMPs withpossible medical and biotechnological significance.In the present study, we evaluated frog skin secretions (CMs) from
seven species against YFV. The results showed that the secretionsfrom S. lacteus, C. boulongery and L. fuscus presented the best antiviralactivity (Figure 3). We found that the frog skin secretions fromS. lacteus had potent anti-YFV activity. We have also first identifiedthe complete precursor of F2.3S from SMOs of S. lacteus after 2 daysin culture, which was deposited in the GenBank accession no.AGB51284.1 and was then confirmed and characterized byConlon et al.5 This AMP is highly related in the signal peptide regionto the previous reported frenatin 1.1 from Litoria infrafrenata(Hylidae, Pelodryadinae), but shows limited similarity with themature peptide28 and also with frenatin 2D from Discoglossus sardus(Alyti-dae).30
Figure 1 Cytotoxic effect of frog skin secretions (CMs 5, 25 and 50%) from seven species in CHO-K1 cell line. Results are reported as percentage ofuntreated controls. The data are presented as the mean of three replicate samples. ANOVA *P-value o0.05.
Figure 2 Vero E6 cell viability after the infection with three viral doses: 0.1LD50, 1 LD50 and 10 LD50 over a period of 6 days. Dunnett’s test indicatedsignificant differences (*P-value o0.05) between each treatment in relationto control.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
3
The Journal of Antibiotics
Figure 3 Potent anti-YFV activity of conditioned media (CM) from (a) Sphaenorhynchus lacteus, (b) Criptobatrachus boulengeri and (c) Leptodactylus fuscuson Vero E6 cells. First panel: cytotoxic effect in Vero E6 cells of the CMs at different concentrations (5, 25 and 50%). The other three panels show Vero E6cells exposed to three concentrations of YFV (0.1 LD50, 1 LD50 and 10 LD50) treated with 5, 25 and 50% of CM. Tukey test *P-value o0.05, **P-valueo0.01, ***P-valueo0.001.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
4
The Journal of Antibiotics
We here further show that this F 2.3S has moderate anti-YFV cellprotective (35%) activity at the high concentration of 20 μg ml− 1. Thefact that total CM from S. lacteus has a much potent activity is notunexpected since most likely—as discussed previously19—antimicro-bial activity secreted by skin of amphibians is unlikely to be caused bya single peptide.31 Experiments are in progress to determine thesequence of other novel AMPs present in the active CMs using LCMS/MS analysis.Although there are no reports of frog AMPs against YFV or other
flaviviruses, there are relevant amphibian AMPs with antiviral proper-ties, like Magainin-1 and 2 (Xenopus laevis)32 and Dermaseptin S1-S5(Phyllomedusa sauvagei), which have activity against herpes simplexvirus type 1 and type 2,9 and caerin 1.1, caerin 1.9 and maculatin 1.1from different species of Australian tree frogs which inhibit HIVinfection.11 In addition, other authors16 found that ivermectin, a
broadly used anti-helminthic drug, presents a potent anti-YFV activity;however, it looses effectiveness against others flaviviruses. Given this,the synergism of this drug with AMPs would be an interesting form topotentiate the antiviral effect of both compounds. Recently, there havebeen reports of proinflammatory and immunomodulatory propertiesfrom S. lacteus frenatins, included F 2.3S5 in response to bacterialinfections. For this reason, we speculate that F2.3S could activate thesignal pathway to recognize and regulate a viral infection response.33
In this regard, AMPs exert broad-spectrum antimicrobial activity,apart from many other potential roles in innate immunity, andrepresent a promising class of antiviral agents including bothenveloped and non-enveloped viruses.34 Recent advances in under-standing the mechanisms of their antiviral action(s) indicate that theyhave a dual role in antiviral defense, acting not only directly on thevirion but also on the host cell.34
Figure 4 Moderate anti-YFV activity of conditioned media (CM) from (a) Hypsiboas fasciatus, (b) Pristimantis medemi, (c) Hypsiboas lanciformis and (d)Trachycephalus venulosus on Vero E6 cells. First panel: cytotoxic effect in Vero E6 cells of the CMs at different concentrations (5, 25 and 50%). The otherthree panels show Vero E6 cells exposed to three concentrations of YFV (0.1 LD50, 1 LD50 and 10 LD50) treated with 5, 25 and 50% of CM. Tukey test*P-value o0.05, **P-value o0.01, ***P-valueo0.001.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
5
The Journal of Antibiotics
It is important, however, to point out that activity of F 2.3S wasspecific against YFV and had no toxic effect in the somatic cells testedas shown in Figure 7.
Another important issue to evaluate in AMPs prospecting is thetoxicity in somatic cells. Consequently, we determined the effect of theCMs from the seven frog species in CHO-K1 and Vero E6 cells atdifferent CM dilutions. The results showed that just T. venulosusreduced the cell viability in CHO-K1 and Vero E6 (Figure 4d), but inboth cases this reduction was not superior to 50%. The other six-frogspecies’ CMs were not cytotoxic for CHO-K1 (Figure 1) and Vero E6(Figures 3 and 4). Additionally, we evaluated the cytotoxicity of F 2.3Sin Vero E6 cells and found that the peptide was not toxic at five timesthe concentration used in the antiviral assay.
Figure 5 Skin micro-organs cDNA sequence from S. lacteus Sl-11 cloneencoding a novel peptide. The amino-acid sequence is given in singleletters. Putative signal peptide sequence is single-underlined, acidicspacer domain is dotted-underlined, processing site K-R (lysine-arginine)is in bold letters, mature peptide sequence is bold-underlined andasterisk indicates stop codon.
Figure 6 Comparison of S. lacteus frenatin peptide (F 2.3S) with theirclose amphibian skin AMPs homolog, frenatin from Litoria genus (F 1.1).Peptide alignment is indicated as follow: (*) conserved amino-acidresidues, (:) amino-acid residues with similar properties, (.) amino-acidresidues dissimilar and (− ) gaps.
Figure 4 Continued
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
6
The Journal of Antibiotics
In summary, the results against YFV using CMs from differentfrog’s species demonstrated the antiviral potential of these secretions,especially from S. lateus, C. boulengeri and L. fuscus. Therefore, it canbe concluded that these CMs are good candidates for furtherproteomic and biological characterization. We have also identifiedencoding precursor for F 2.3S peptide from S. lacteus SMOs, whichmay be a key component on facilitating the strong anti-YFV activityfound in skin secretions of S. lacteus.Activity of F 2.3S was specific against YFV and had no toxic effect
against the actual somatic cells tested. We have not tested the activityof F 2.3S peptide against other viruses. However, it is rare that frogswould have developed a mechanism in which a single peptide eitherworks alone or is toxic to only one type of micro-organism. In spite ofthis, it is surprising that F 2.3S can display a 35% YFV inhibition on itsown. As shown here, total CM from S. lacteus has a much potentactivity than the isolated peptide. Most probable—as discussedpreviously19—antimicrobial activity secreted by skin of amphibiansis unlikely to be caused by a single peptide and it is the combinationsof various of them that provide a broader and effective antimicrobialeffect.Accordingly with this, other authors demonstrated that AMPs
individually have a certain spectra of antimicrobial activity, but theiractivity was considerably amplified upon combination with otherpeptides.35 In nature synergism within AMPs contributes to theexplanation of the presence of several peptides in most tissues indifferent species, in order to broaden the antimicrobial spectrumAMPs.36
CONFLICT OF INTERESTThe authors declare no conflict of interest.
ACKNOWLEDGEMENTS
This research was funded by COLCIENCIAS CODE 1204-343, by Comité de
Investigaciones y Postgrados, Facultad de Ciencias from Universidad de los
Andes, Colombia, Fundación Bolivar Davivienda, Labbrands and by a special
grant from the Hebrew University to E.M. We thank Dr Jhon Lynch,
Universidad Nacional de Colombia, Dr Andrew Crawford and Dr Adolfo
Amézquita, Universidad de los Andes for they kind help in the identification of
the species collected Jairo Mendez, Instituto Nacional de Salud for his advice
with the antiviral assays.
1 Waghu, F. H. et al. CAMP: collection of sequences and structures of antimicrobialpeptides. Nucleic Acids Res. 42, 1154–1158 (2014).
2 Conlon, J. M. & Mechkarska, M. Host-defense peptides with therapeutic potential fromskin secretions of frogs from the family pipidae. Pharmaceuticals (Basel) 7,58–77 (2014).
3 Vanhoye, D., Bruston, F., Nicolas, P. & Amiche, M. Antimicrobial peptides from hylidand ranin frogs originated from a 150-million-year-old ancestral precursor with aconserved signal peptide but a hypermutable antimicrobial domain. Eur. J. Biochem.270, 2068–2081 (2003).
4 Conlon, J. M. The contribution of skin antimicrobial peptides to the system of innateimmunity in anurans. Cell Tissue Res. 343, 201–212 (2011).
5 Conlon, J. M. et al. A family of antimicrobial and immunomodulatory peptides related tothe frenatins from skin secretions of the Orinoco lime frog Sphaenorhynchus lacteus(Hylidae). Peptides 56, 132–140 (2014).
6 Mechkarska, M. et al. An analog of the host-defense peptide hymenochirin-1Bwith potent broad-spectrum activity against multidrug-resistant bacteria andimmunomodulatory properties. Peptides 50, 153–159 (2013).
7 Conlon, J. M. et al. Isolation of peptides of the brevinin-1 family with potentcandidacidal activity from the skin secretions of the frog Rana boylii. J. Pept. Res. 62,207–213 (2003).
8 Conlon, J. M. et al. Evaluation of the Skin Peptide Defenses of the Oregon Spotted FrogRana pretiosa Against Infection by the Chytrid Fungus Batrachochytrium dendrobatidis.J. Chem. Ecol. 39, 797–805 (2013).
9 Bergaoui, I. et al. In vitro antiviral activity of dermaseptin S4 and derivatives fromamphibian skin against herpes simplex virus type 2. J. Med. Virol. 85,272–281 (2013).
10 Belaid, A. et al. In vitro antiviral activity of dermaseptins against herpes simplexvirus type 1. J. Med. Virol. 66, 229–234 (2002).
11 Vancompernolle, S. E. et al. Antimicrobial peptides from amphibian skin potentlyinhibit human immunodeficiency virus infection and transfer of virus from dendriticcells to T cells. J. Virol. 79, 11598–11606 (2005).
12 Rushika, P., Mansoora, K. & Richard, J. K. Closing the door on flaviviruses: entry as atarget for antiviral drug design. Antiviral Res. 80, 11–22 (2009).
13 Umamaheswari, A., Kumar, M., Pradhan, D. & Marisetty, H. Docking studies towardsexploring antiviral compounds against envelope protein of yellow fever virus. Interdiscip.Sci. Comput. Life Sci. 3, 64–77 (2011).
14 Monath, T. P. Yellow fever: an update. Lancet Infect. Dis. 1, 11–20 (2015).15 Staples, J. & Monath, T. Yellow fever: 100 years of discovery. J. Am. Med. Assoc. 300,
960–962 (2008).16 Mastrangelo, E. et al. Ivermectin is a potent inhibitor of flavivirus replication specifically
targeting NS3 helicase activity: new prospects for an old drug. J. Antimicrob.Chemother. 67, 1884–1894 (2012).
17 Hill, D. Mapping the risk of yellow fever infection. Curr. Infect. Dis. Rep. 14,246–255 (2012).
18 Ngoagouni, C. et al. Entomological profile of yellow fever epidemics in the CentralAfrican Republic, 2006–2010. Parasit. Vectors 5, 175 (2012).
19 Groot, H. et al. Skin micro-organs from several frog species secrete a repertoire ofpowerful antimicrobials in culture. J. Antibiot. 65, 461–467 (2012).
20 Rollins-Smith, L. A. et al. Activity of antimicrobial skin peptides from ranid frogs againstBatrachochytrium dendrobatidis, the chytrid fungus associated with global amphibiandeclines. Dev. Comp. Immunol. 26, 471–479 (2002).
21 Chomczynski, P. & Sacchi, N. Single-step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156–159 (1987).
22 Chen, T., Zhou, M., Gagliardo, R., Walker, B. & Shaw, C. Elements of the granular glandpeptidome and transcriptome persist in air-dried skin of the South American orange-leggedleaf frog, Phyllomedusa hypocondrialis. Peptides 27, 2129–2136 (2006).
Figure 7 Antiviral (a) and cytotoxic (b) effect of S. lacteus frenatin 2.3S peptide in Vero E6 cell line infected with YFV (10 LD50). Tukey *P-value o0.05,**P-value o0.01.
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
7
The Journal of Antibiotics
23 Altschul, S. F. et al. Gapped BLAST and PSI-BLAST: a new generation of proteindatabase search programs. Nucleic Acids Res. 25, 3389–3402 (1997).
24 Thompson, J. D., Gibson, T. J. & Higgins, D. G. Multiple Sequence Alignment UsingClustalW and ClustalX. Current Protocols in Bioinformatics. (John Wiley & Sons, Inc.,2002).
25 Neyts, J., Meerbach, A., Mckenna, P. & Declercq, E. Use of the yellow fever virusvaccine strain 17D for the study of strategies for the treatment of yellow fevervirus infections. Antiviral Res. 30, 125–132 (1996).
26 Sudo, K., Konno, K., Yokota, T. & Shigeta, S. A screening system for antiviralcompounds against Herpes Simplex Virus type 1 using the MTT method withL929 cells. Tohoku J. Exp. Med. 176, 163–171 (1995).
27 Leyssen, P., De Clercq, E. & Neyts, J. The anti-yellow fever virus activity of ribavirin isindependent of error-prone replication. Mol. Pharmacol. 69, 1461–1467 (2006).
28 Zhou, M., Chen, T., Walker, B. & Shaw, C. Novel frenatins from the skin of theAustralasian giant white-lipped tree frog, Litoria infrafrenata: cloning of precursorcDNAs and identification in defensive skin secretion. Peptides 26, 2445–2451 (2005).
29 Clarke, B. T. The natural history of amphibian skin secretions, their normal functioningand potential medical applications. Biol. Rev. Camb. Philos. Soc. 72,365–379 (1997).
30 Conlon, J. M. et al. An immunomodulatory peptide related to frenatin 2 from skinsecretions of the Tyrrhenian painted frog Discoglossus sardus (Alytidae). Peptides 40,65–71 (2013).
31 Chinchar, V. G. et al. Inactivation of viruses infecting ectothermic animals by amphibianand piscine antimicrobial peptides. Virology 323, 268–275 (2004).
32 Albiol Matanic, V. & Castilla, V. Antiviral activity of antimicrobial cationic peptidesagainst Junin virus and herpes simplex virus. J. Antimicrob. Agents 23,382–389 (2004).
33 Davies, J. & Davies, D. Origins and evolution of antibiotic resistance. Microbiol. Mol.Biol. Rev. 74, 417–433 (2010).
34 Klotman, M. E. & Chang, T. L. Defensins in innate antiviral immunity. Nat. Rev.Immunol. 6, 447–456 (2006).
35 Mor, A., Hani, K. & Nicolas, P. The vertebrate peptide antibiotics dermaseptins haveoverlapping structural features but target specific microorganisms. J. Biol. Chem. 269,31635–31641 (1994).
36 Cassone, M. & Otvos, L. Synergy among antibacterial peptides and betweenpeptides and small-molecule antibiotics. Expert Rev. Anti. Infect. Ther. 8,703–716 (2010).
anti-YFV activities from frog skin secretionsC Muñoz-Camargo et al
8
The Journal of Antibiotics
33
6.2.Conclusiones capítulo 2
-Los medios condicionados de S. lateus y C. boulengeri presentan una potente
actividad antiviral contra el virus de la fiebre amarilla y no son tóxicos para células
somáticas.
-Estos medios condicionados son buenos candidatos para posteriores caracterizaciones proteómicas y biológicas.
-De identificó el precursor completo del péptido F.2.3S derivado de MOs cultivados de S. lacteus.
-En los ensayos antivirales con F 2.3S se encontró que este péptido puede ser un componente importante para activar la respuesta inmune frente al virus de la fiebre amarilla.
-El péptido F2.3S no presenta toxicidad en células Vero E6 a concentraciones de hasta 100 µg/mL.
34
7. Conclusiones Generales
-Se implementó el cultivo de MOs como una nueva forma de obtener secreciones de piel de ranas en cantidades suficientes para análisis de actividad, identificación y caracterización de péptidos antimicrobianos.
-Se encontró que los medios condicionados obtenidos de cultivo de MOs, presentan potente actividad contra bacterias Gram+ y Gram-, el virus de la fiebre amarilla, sin causar daño en líneas celulares, lo cual es un indicador de la eficiencia en recuperación de compuestos de esta nueva técnica.
-A partir de medios condicionados y MOs se identificaron los siete péptidos nuevos y la buforina II en la especie S. lacteus, con lo cual se confirma que esta metodología también es útil para la identificación de PAM.
-Se demostró que los nuevos péptidos tienen potencial para aplicación en el tratamiento de enfermedades infecciosas y de forma interesante se encontró que la combinación de los 8P presentan actividad contra bacterias de interés clínico como P. aeruginosa y S. aureus.
-Los diferentes mecanismos de acción que se evidenciaron en los tres péptidos más potentes son un indicio de su actividad de amplio espectro que podría combatir bacterias multiresistentes, como las mencionadas anteriormente.
35
10. Referencias 1. Clarke BT. The natural history of amphibian skin secretions, their normal
functioning and potential medical applications. Biol Rev Camb Philos Soc. 1997;72(3):365-379. doi:10.1017/S0006323197005045.
2. Chen T, Farragher S, Bjourson AJ, Orr DF, Rao P, Shaw C. Granular gland transcriptomes in stimulated amphibian skin secretions. Biochem J. 2003;371(Pt 1):125-130. doi:10.1042/BJ20021343.
3. Simmaco M, Mignogna G, Barra D, Bossa F. Antimicrobial peptides from skin secretions of Rana esculenta. Molecular cloning of cDNAs encoding esculentin and brevinins and isolation of new active peptides. J Biol Chem . 1994;269 (16 ):11956-11961. http://www.jbc.org/content/269/16/11956.abstract.
4. Vanhoye D, Bruston F, Nicolas P, Amiche M. Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain. Eur J Biochem. 2003;270(9):2068-2081. doi:10.1046/j.1432-1033.2003.03584.x.
5. Waghu FH, Gopi L, Barai RS, Ramteke P, Nizami B, Idicula-Thomas S. CAMP: Collection of sequences and structures of antimicrobial peptides. Nucleic Acids Res. 2014;42(D1):1154-1158. doi:10.1093/nar/gkt1157.
6. Galeano S.P., Urbina J.C., Gutiérrez-C.P.D.A. R-CM y PVP. Los anfibios de Colombia, diversidad y estado del conocimiento. Tomo II. In: Informe Sobre El Avance En El Conocimientoy La Información de La Biodiversidad 1998 -2004. Instituto de Investigación de RecursosBiológicos Alexander von Humboldt. BogotáD.C., Colombia. 2 Tomos. Vol ; 2006:92-104.
7. Acosta Galvis A. Lista de los Anfibios de Colombia: Referencia en linea V.05.2015.0 (agosto 2015). http://www.batrachia.com/. 2015. http://www.batrachia.com/.
8. WHO. Antimicrobial resistance: global report on surveillance 2014. http://www.who.int/en/. 2014:257. WHO, Antimicrobial resistance: global report on surveillance 2014. http://www.who.int/drugresistance/documents/surveillancereport/en/, 2014: p. 257.
9. Groot H, Muñoz-Camargo C, Moscoso J, et al. Skin micro-organs from several frog species secrete a repertoire of powerful antimicrobials in culture. J Antibiot (Tokyo). 2012;65(9):461-467.
10. Mitrani E, Nadel G, Hasson E, Harari E, Shimoni Y. Epithelial-mesenchymal interactions allow for epidermal cells to display an in vivo-like phenotype in vitro. Differentiation. 2005;73(2-3):79-87. doi:10.1111/j.1432-0436.2005.07302002.x.
11. Park CBC, Kim MMS, Kim SCS. A novel antimicrobial peptide from Bufo bufo
36
gargarizans. Biochem Biophys Res …. 1996;218(1):408-413. doi:10.1006/bbrc.1996.0071.
12. Aminov RI, Otto M, Sommer A. A brief history of the antibiotic era : lessons learned and challenges for the future. 2010;1(December):1-7. doi:10.3389/fmicb.2010.00134.
13. Davies J, Davies D. Origins and Evolution of Antibiotic Resistance. Microbiol Mol Biol Rev. 2010;74(3):417-433. doi:10.1128/MMBR.00016-10.
15. Chopra I. The 2012 Garrod Lecture: Discovery of antibacterial drugs in the 21st century. 2013;17(November 2012):496-505. doi:10.1093/jac/dks436.
16. Levin BR, Bull JJ. Population and evolutionary dynamics of phage therapy. Nat Rev Micro. 2004;2(2):166-173. http://dx.doi.org/10.1038/nrmicro822.
17. Hancock REW, Sahl H-G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat Biotech. 2006;24(12):1551-1557. http://dx.doi.org/10.1038/nbt1267.
18. Conlon, J. Michael and Sonnevend A. Antimicrobial Peptides in Frog Skin Secretions. In: ANTIMICROBIAL PEPTIDES, Methods Mol Biol. Vol ; 2010:3-14. doi:doi: 10.1007/978-1-60761-594-1_1.
19. Conlon JM. The contribution of skin antimicrobial peptides to the system of innate immunity in anurans. Cell Tissue Res. 2011;343(1):201-212. doi:10.1007/s00441-010-1014-4.
20. Abraham E., Chain E. An enzime from bacteria able to destroy penicillin. Nature. 1940;146:837. doi:doi:10.1038/146837a0.
21. Walsh CT, Wencewicz TA. Prospects for new antibiotics : a molecule-centered perspective. 2013;67(1):7-22. doi:10.1038/ja.2013.49.
22. Tally FP, DeBruin MF. Development of daptomycin for Gram-positive infections. J Antimicrob Chemother. 2000;46(4):523-526. doi:10.1093/jac/46.4.523.
23. Gentry DR, McCloskey L, Gwynn MN, et al. Genetic characterization of Vga ABC proteins conferring reduced susceptibility to pleuromutilins in Staphylococcus aureus. Antimicrob Agents Chemother. 2008;52(12):4507-4509. doi:10.1128/AAC.00915-08.
24. Goldstein EJC, Citron DM, Sears P, Babakhani F, Sambol SP, Gerding DN. Comparative Susceptibilities to Fidaxomicin (OPT-80) of Isolates Collected at Baseline, Recurrence, and Failure from Patients in Two Phase III Trials of Fidaxomicin against Clostridium difficile Infection . Antimicrob Agents Chemother. 2011;55(11):5194-5199. doi:10.1128/AAC.00625-11.
25. Cohen J. Approval of Novel TB Drug Celebrated—With Restraint. Science (80- ). 2013;339(6116):130. http://science.sciencemag.org/content/339/6116/130.abstract.
37
26. Magiorakos a, Srinivasan A, Carey RB, et al. Bacteria : an International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Microbiology. 2011;18(3):268-281. doi:10.1111/j.1469-0691.2011.03570.x.
27. Boucher HW, Talbot GH, Bradley JS, et al. Bad Bugs, No Drugs: No ESKAPE! An Update from the Infectious Diseases Society of America. Clin Infect Dis. 2009;48(1):1-12. doi:10.1086/595011.
28. Falagas ME, Kasiakou SK, Saravolatz LD. Colistin: The Revival of Polymyxins for the Management of Multidrug-Resistant Gram-Negative Bacterial Infections. Clin Infect Dis. 2005;40(9):1333-1341. doi:10.1086/429323.
29. Centerwatch. 2016 FDA Approved Drugs. 2016. http://www.centerwatch.com/drug-information/fda-approved-drugs/year/2016.
30. Hancock RE., Lehrer R. Cationic peptides: a new source of antibiotics. Trends Biotechnol. 1998;16(2):82-88. doi:10.1016/S0167-7799(97)01156-6.
32. Wang G, Li X, Wang Z. APD2: The updated antimicrobial peptide database and its application in peptide design. Nucleic Acids Res. 2009;37(SUPPL. 1):933-937. doi:10.1093/nar/gkn823.
33. Thomas S, Karnik S, Barai RS, Jayaraman VK, Idicula-Thomas S. CAMP: a useful resource for research on antimicrobial peptides. Nucleic Acids Res . 2010;38 (suppl 1 ):D774-D780. doi:10.1093/nar/gkp1021.
34. Beisswenger C, Bals R. Functions of antimicrobial peptides in host defense and immunity. Curr Protein Pept Sci. 2005;6(3):255-264. doi:10.2174/1389203054065428.
35. Simmaco M, Mignogna G, Barra D. Antimicrobial peptides from amphibian skin: What do they tell us? Pept Sci. 1998;47(6):435-450. doi:10.1002/(SICI)1097-0282(1998)47:6<435::AID-BIP3>3.0.CO;2-8.
37. Brogden KA. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Micro. 2005;3(3):238-250. http://dx.doi.org/10.1038/nrmicro1098.
38. Bulet P, Stöcklin R, Menin L. Anti-microbial peptides: from invertebrates to vertebrates. Immunol Rev. 2004;198(1):169-184. doi:10.1111/j.0105-2896.2004.0124.x.
39. Guilhelmelli F, Vilela N, Albuquerque P, Derengowski LDS, Silva-Pereira I, Kyaw CM. Antibiotic development challenges: The various mechanisms of action of antimicrobial peptides and of bacterial resistance. Front Microbiol. 2013;4(DEC):1-12. doi:10.3389/fmicb.2013.00353.
40. Marsh ENG, Buer BC, Ramamoorthy A. Fluorine-a new element in the
38
design of membrane-active peptides. Mol Biosyst. 2009;5(10):1143-1147. doi:10.1039/B909864J.
42. Peschel A, Sahl H-G. The co-evolution of host cationic antimicrobial peptides and microbial resistance. Nat Rev Micro. 2006;4(7):529-536. http://dx.doi.org/10.1038/nrmicro1441.
43. Hankins J V, Madsen JA, Giles DK, Brodbelt JS, Trent MS. Amino acid addition to Vibrio cholerae LPS establishes a link between surface remodeling in gram-positive and gram-negative bacteria. Proc Natl Acad Sci U S A. 2012;109(22):8722-8727. doi:10.1073/pnas.1201313109.
44. Shireen T, Singh M, Das T, Mukhopadhyay K. Differential Adaptive Responses of Staphylococcus aureus to In Vitro Selection with Different Antimicrobial Peptides. Antimicrob Agents Chemother. 2013;57(10):5134-5137. doi:10.1128/AAC.00780-13.
45. Campos M a, Vargas M a, Regueiro V, Llompart CM, Albertí S, José A. Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides. Infect Immun. 2004;72(12):7107-7114. doi:10.1128/IAI.72.12.7107.
46. Mulcahy H, Charron-Mazenod L, Lewenza S. Extracellular DNA Chelates Cations and Induces Antibiotic Resistance in Pseudomonas aeruginosa Biofilms. PLoS Pathog. 2008;4(11):e1000213. doi:10.1371/journal.ppat.1000213.
47. Nicolas P, Vanhoye D, Amiche M. Molecular strategies in biological evolution of antimicrobial peptides. Peptides. 2003;24(11):1669-1680. doi:10.1016/j.peptides.2003.08.017.
48. Duda TF, Vanhoye D, Nicolas P. Roles of diversifying selection and coordinated evolution in the evolution of amphibian antimicrobial peptides. Mol Biol Evol. 2002;19(6):858-864.
49. Conlon JM. The therapeutic potential of antimicrobial peptides from frog skin. Rev Med Microbiol. 2004;15(1). http://journals.lww.com/revmedmicrobiol/Fulltext/2004/01000/The_therapeutic_potential_of_antimicrobial.3.aspx.
50. Chen T, Walker B, Zhou M, Shaw C. Dermatoxin and phylloxin from the waxy monkey frog, Phyllomedusa sauvagei: cloning of precursor cDNAs and structural characterization from lyophilized skin secretion. Regul Pept. 2005;129(1-3):103-108. doi:10.1016/j.regpep.2005.01.017.
51. Lequin O, Ladram A, Chabbert L, et al. Dermaseptin S9, an α-Helical Antimicrobial Peptide with a Hydrophobic Core and Cationic Termini†. Biochemistry. 2006;45(2):468-480. doi:10.1021/bi051711i.
52. Mangoni ML, Marcellini H. G. L, Simmaco M. Biological characterization and
39
modes of action of temporins and bombinins H, multiple forms of short and mildly cationic anti-microbial peptides from amphibian skin. J Pept Sci. 2007;13(9):603-613. doi:10.1002/psc.853.
53. Giovannini MG, Poulter L, Gibson BW, Williams DH. Biosynthesis and degradation of peptides derived from Xenopus laevis prohormones. Biochem J. 1987;243(1):113-120.
54. Rollins-Smith L a, Reinert LK, O’Leary CJ, Houston LE, Woodhams DC. Antimicrobial Peptide defenses in amphibian skin. Integr Comp Biol. 2005;45(1):137-142. doi:10.1093/icb/45.1.137.
55. Hasson E, Gallula J, Shimoni Y, Grad-Itach E, Marikovsky M, Mitrani E. Skin-derived micro-organs induce angiogenesis in rabbits. J Vasc Res. 2006;43(2):139-148. doi:10.1159/000090943.
56. Voisine P, Rosinberg A, Wykrzykowska JJ, et al. Skin-derived microorgan autotransplantation as a novel approach for therapeutic angiogenesis. Am J Physiol Heart Circ Physiol. 2008;294(1):H213-H219. doi:10.1152/ajpheart.00112.2007.
57. MITRANI E, PEARLMAN A, STERN B, et al. Biopump: Autologous skin-derived micro-organ genetically engineered to provide sustained continuous secretion of therapeutic proteins. Dermatol Ther. 2011;24(5):489-497. doi:10.1111/j.1529-8019.2012.01457.x.
58. Nägele E, Vollmer M, Hörth P, Vad C. 2D-LC/MS techniques for the identification of proteins in highly complex mixtures. Expert Rev Proteomics. 2004;1(1):37-46. doi:10.1586/14789450.1.1.37.
59. Ivanov VT, Yatskin ON. Peptidomics: a logical sequel to proteomics. Expert Rev Proteomics. 2005;2(4):463-473. doi:10.1586/14789450.2.4.463.
60. Wang L, Evaristo G, Zhou M, et al. Nigrocin-2 peptides from Chinese Odorrana frogs - Integration of UPLC/MS/MS with molecular cloning in amphibian skin peptidome analysis. FEBS J. 2010;277(6):1519-1531. doi:10.1111/j.1742-4658.2010.07580.x.
61. Leica. Performing a Hematoxylin and Eosin Stain - a Step by Step Guide. http://www.leicabiosystems.com/pathologyleaders/performing-a-hematoxylin-and-eosin-stain-a-step-by-step-guide/.
62. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162(1):156-159. doi:http://dx.doi.org/10.1016/0003-2697(87)90021-2.
63. Schadich E, Cole ALJ, Squire M, Mason D. Skin peptides of different life stages of Ewing’s tree frog. J Exp Zool Part A Ecol Genet Physiol. 2010;313 A(8):532-537. doi:10.1002/jez.582.
64. Li J, Xu X, Xu C, et al. Anti-infection peptidomics of amphibian skin. Mol Cell Proteomics. 2007;6(5):882-894. doi:10.1074/mcp.M600334-MCP200.
65. Lacombe C, Cifuentes-Diaz C, Dunia I, Auber-Thomay M, Nicolas P, Amiche M. Peptide secretion in the cutaneous glands of South American tree frog
66. Woodhams D, Rollins-Smith L, Carey C, Reinert L, Tyler M, Alford R. Population trends associated with skin peptide defenses against chytridiomycosis in Australian frogs. Oecologia. 2006;146(4):531-540. doi:10.1007/s00442-005-0228-8.
67. Charpentier S, Amiche M, Mester J, et al. Structure, Synthesis, and Molecular Cloning of Dermaseptins B, a Family of Skin Peptide Antibiotics. J Biol Chem . 1998;273 (24 ):14690-14697. doi:10.1074/jbc.273.24.14690.
68. Leyssen P, De Clercq E, Neyts J. The Anti-Yellow Fever Virus Activity of Ribavirin Is Independent of Error-Prone Replication. Mol Pharmacol . 2006;69 (4 ):1461-1467. doi:10.1124/mol.105.020057.
69. Neyts J, Meerbach A, Mckenna P, Declercq E. Use of the yellow fever virus vaccine strain 17D for the study of strategies for the treatment of yellow fever virus infections. Antiviral Res. 1996;30(2-3):125-132. doi:10.1016/0166-3542(96)89697-5.
70. Sudo K, Konno K, Yokota T, Shigeta S. A Screening System for Antiviral Compounds against Herpes Simplex Virus Type 1 Using the MTT Method with L929 Cells. Tohoku J Exp Med. 1995;176(3):163-171. doi:10.1620/tjem.176.163.
71. Chen T, Zhou M, Gagliardo R, Walker B, Shaw C. Elements of the granular gland peptidome and transcriptome persist in air-dried skin of the South American orange-legged leaf frog, Phyllomedusa hypocondrialis. Peptides. 2006;27(9):2129-2136. doi:10.1016/j.peptides.2006.04.006.
72. Conlon JM, Mechkarska M, Radosavljevic G, et al. A family of antimicrobial and immunomodulatory peptides related to the frenatins from skin secretions of the Orinoco lime frog Sphaenorhynchus lacteus (Hylidae). Peptides. 2014;56:132-140. doi:10.1016/j.peptides.2014.03.020.
73. Zhou M, Chen T, Walker B, Shaw C. Novel frenatins from the skin of the Australasian giant white-lipped tree frog, Litoria infrafrenata: Cloning of precursor cDNAs and identification in defensive skin secretion. Peptides. 2005;26(12):2445-2451. doi:10.1016/j.peptides.2005.05.019.
74. Pantic JM, Radosavljevic GD, Jovanovic IP, Arsenijevic NN, Conlon JM, Lukic ML. In vivo administration of the frog skin peptide frenatin 2.1S induces immunostimulatory phenotypes of mouse mononuclear cells. Peptides. 2015;71:269-275. doi:10.1016/j.peptides.2015.03.028.
75. Albiol Matanic V, Castilla V. Antiviral activity of antimicrobial cationic peptides against Junin virus and herpes simplex virus. J Antimicrob Agents. 2004;23(4):382-389. doi:http://dx.doi.org/10.1016/j.ijantimicag.2003.07.022.
78. Sol A, Skvirsky Y, Nashef R, et al. Actin Enables the Antimicrobial Action of LL-37 Peptide in the Presence of Microbial Proteases. J Biol Chem. 2014;289(33):22926-22941. doi:10.1074/jbc.M114.579672.
79. Beer I, Barnea E, Ziv T, Admon A. Improving large-scale proteomics by clustering of mass spectrometry data. Proteomics. 2004;4(4):950-960. doi:10.1002/pmic.200300652.
80. Jackway RJ, Pukala TL, Maselli VM, et al. Disulfide-containing peptides from the glandular skin secretions of froglets of the genus Crinia: Structure, activity and evolutionary trends. Regul Pept. 2008;151(1-3):80-87. doi:10.1016/j.regpep.2008.06.004.
81. King JD, Mechkarska M, Coquet L, et al. Host-defense peptides from skin secretions of the tetraploid frogs Xenopus petersii and Xenopus pygmaeus, and the octoploid frog Xenopus lenduensis (Pipidae). Peptides. 2012;33(1):35-43. doi:10.1016/j.peptides.2011.11.015.
82. Conlon JM, Coquet L, Leprince J, et al. Peptidomic analysis of skin secretions from Rana heckscheri and Rana okaloosae provides insight into phylogenetic relationships among frogs of the Aquarana species group. Regul Pept. 2007;138(2-3):87-93. doi:10.1016/j.regpep.2006.08.007.
83. Abbassi F, Oury B, Blasco T, et al. Isolation, characterization and molecular cloning of new temporins from the skin of the North African ranid Pelophylax saharica. Peptides. 2008;29(9):1526-1533. doi:10.1016/j.peptides.2008.05.008.
84. Haney EF, Nazmi K, Bolscher JGM, Vogel HJ. Structural and biophysical characterization of an antimicrobial peptide chimera comprised of lactoferricin and lactoferrampin. Biochim Biophys Acta - Biomembr. 2012;1818(3):762-775. doi:10.1016/j.bbamem.2011.11.023.
85. Singh PK, Tack BF, McCray PB, Welsh MJ. Synergistic and additive killing by antimicrobial factors found in human airway surface liquid. Am J Physiol Lung Cell Mol Physiol. 2000;279(5):L799-L805.
86. Cassone M, Otvos L. Synergy among antibacterial peptides and between peptides and small-molecule antibiotics. Expert Rev Anti Infect Ther. 2010;8(6):703-716. doi:10.1586/eri.10.38.
87. Lüders T, Birkemo GA, Fimland G, Nes IF, Lu T, Nissen-meyer J. Strong Synergy between a Eukaryotic Antimicrobial Peptide and Bacteriocins from Lactic Acid Bacteria Strong Synergy between a Eukaryotic Antimicrobial Peptide and Bacteriocins from Lactic Acid Bacteria. Appl Environ Microbiol. 2003;69(3):1797-1799. doi:10.1128/AEM.69.3.1797.
88. Zhou Y, Peng Y. Synergistic effect of clinically used antibiotics and peptide antibiotics against gram-positive and gram-negative bacteria. Exp Ther Med. 2013;6(4):1000-1004. doi:10.3892/etm.2013.1231.
89. Nishida M, Imura Y, Yamamoto M, Kobayashi S, Yano Y, Matsuzaki K.
42
Interaction of a Magainin−PGLa Hybrid Peptide with Membranes: Insight into the Mechanism of Synergism†. Biochemistry. 2007;46(49):14284-14290. doi:10.1021/bi701850m.
90. Shai Y. Mechanism of the binding, insertion and destabilization of phospholipid bilayer membranes by α-helical antimicrobial and cell non-selective membrane-lytic peptides. Biochim Biophys Acta - Biomembr. 1999;1462(1-2):55-70. doi:10.1016/S0005-2736(99)00200-X.
91. Park CB, Kim HS, Kim SC. Mechanism of action of the antimicrobial peptide buforin II: buforin II kills microorganisms by penetrating the cell membrane and inhibiting cellular functions. Biochem Biophys Res Commun. 1998;244(1):253-257. doi:10.1006/bbrc.1998.8159.
92. Nicolas P, El Amri C. The dermaseptin superfamily: A gene-based combinatorial library of antimicrobial peptides. Biochim Biophys Acta - Biomembr. 2009;1788(8):1537-1550. doi:10.1016/j.bbamem.2008.09.006.
93. Hao G, Shi Y-H, Tang Y-L, Le G-W. The membrane action mechanism of analogs of the antimicrobial peptide Buforin 2. Peptides. 2009;30(8):1421-1427. doi:10.1016/j.peptides.2009.05.016.
94. Park CB, Yi KS, Matsuzaki K, Kim MS, Kim SC. Structure-activity analysis of buforin II, a histone H2A-derived antimicrobial peptide: the proline hinge is responsible for the cell-penetrating ability of buforin II. Proc Natl Acad Sci U S A. 2000;97(15):8245-8250. doi:10.1073/pnas.150518097.
95. Elmore DE. Insights into buforin II membrane translocation from molecular dynamics simulations. Peptides. 2012;38(2):357-362. doi:10.1016/j.peptides.2012.09.022.
96. Gorr S-U, Sotsky JB, Shelar AP, Demuth DR. Design of bacteria-agglutinating peptides derived from parotid secretory protein, a member of the bactericidal/permeability increasing-like protein family. Peptides. 2008;29(12):2118-2127. doi:10.1016/j.peptides.2008.09.019.
97. Irie M, Nitta K NT. Biochemistry of frog ribonucleases. Cell Mol Life Sci. 1998;54(8):775-784.
98. Cruz J, Ortiz C, Guzmán F, Cárdenas C, Fernandez-Lafuente R, Torres R. Design and activity of novel lactoferrampin analogues against O157:H7 enterohemorrhagic escherichia coli. Biopolymers. 2014;101(4):319-328. doi:10.1002/bip.22360.
43
11. Anexo 1. Tabla de especies de ranas colectadas Nº Especie Lugar de colecta
Pensamos en las ranas como animales de sangre fría, que viven en su mayoría cerca de ríos, quebradas, lagos, estanques y charcos. Sin embargo, estos extraordinarios organismos son una muestra exitosa de adaptación a distintos tipos de hábitats. A lo largo de su evolución, las ranas han logrado ingeniárselas para manejar la deseca-ción en áreas desérticas, conquistar el suelo y las copas de los árboles, y hasta son capaces de tolerar condicio-nes de congelamiento extremo.
El éxito en la colonización de todos los continentes, con excepción de la Antártida, depende de muchas adaptaciones morfológicas, !siológicas, bioquímicas y de comportamiento. Por esto no deja de sorprendernos el importante papel de un órgano tan frágil como la piel de
[ notas. CIENCIAS BIOLÓGICAS ]
El secreto antimicrobiano de las histonasCarolina Muñoz CamargoM. Sc. Estudiante de doctorado en Ciencias Biológicas en la Universidad de los [email protected]
Valeriano LópezPh. D. Profesor de catedra del Departamento de Ciencias Biológicas de la Universidad de los [email protected]
Helena GrootM. Sc. Profesora titular del Departamento de Ciencias Biológicas de la Universidad de los [email protected]
Fuente: https://www.!ickr.com/photos/e_monk/
Universidad de los Andes, Facultad de Ciencias 15
estos animales, que a pesar de esa fragilidad, está diseñada para sortear adversidades como la desecación y les otorga pro-tección frente a amenazas de su propio hábitat, como puede ser la invasión de pequeños grandes enemigos, como son las bacterias y los hongos. Las moléculas que intervienen en su mecanismo de defensa frente a estos parásitos son de gran in-terés hoy en día, no solo por su importancia en la supervivencia propia de las ranas, sino también por su potencial como nuevos medicamentos para los humanos.
En la piel de las ranas se localizan las llamadas glándulas granulares, encargadas de la síntesis y el almacenamiento de estas moléculas de defensa. En ellas se sintetiza una gran va-riedad de moléculas, entre ellas los péptidos antimicrobianos (AMP). Los AMP son pequeñas moléculas peptídicas produci-das por organismos de todo tipo y que forman parte del sis-tema inmune innato. Entre las características más relevantes está su pequeño tamaño (están constituidas por entre 10 y 50 aminoácidos), lo que hace que puedan transportarse con enor-me facilidad. La mayoría tiene carga positiva (en general +2 a +9), y una buena proporción de los residuos son hidrofóbicos (más del 30%) [1, 2].
En cuanto a su mecanismo de acción, anteriormente se pensaba que radicaba en una única estrategia basada en el aumento de la permeabilidad de la membrana del patógeno. Hoy en día con-tamos con la descripción de varios mecanismos, algunos invo-lucrados en la formación de poros en la membrana, agregación de los lípidos de la membrana y de unión al ADN sin alteración de la membrana [3].
Hasta el momento se han registrado aproximadamente dos mil secuencias de péptidos y proteínas con actividad antimicro-biana, de origen natural muy diverso [4]. Pero el secreto mejor guardado de este tipo de moléculas es que se pueden producir a partir de fragmentos de proteínas con una función biológica
diferente a la de AMP. Hace algunas décadas se creía que las histonas solo tenían funciones en el núcleo de la célula como proteínas encargadas del empaquetamiento y la regulación de los genes en eucariotas. En la actualidad sabemos que tienen funciones extracelulares que están relacionadas con el siste-ma inmune innato. Su actividad como AMP se ha descrito en diferentes animales, como peces, mariscos y ranas. En estas últimas se descubrió la buforina, el primer AMP derivado de una histona del que se tuvo noticia, y cuyo nombre se debe a la rana Bufo gargarizans, en la que fue identi!cada.
La buforina, como los demás AMP, se genera como una pre-proteína, es decir, su forma activa es liberada una vez que se corta la histona H2A en un sitio de reconocimiento. Tras este procesamiento se genera el AMP con las características ante-riormente mencionadas, que posteriormente es secretado para cumplir su función antibacteriana. La buforina I es un AMP de 39 aminoácidos, idéntico al N- terminal de la histona H2A, y cuya función comprobada es la de actuar como efector del sistema inmune; en otras palabras, ayuda al sistema inmune a activarse ante infecciones [5].
Por otro lado, la buforina II, que consta de 21 aminoácidos, deriva de la buforina I y actúa directamente como un AMP de amplio espectro. De acuerdo con lo reportado, presenta activi-dad contra bacterias gram positivas, gram negativas, bacterias multirresistentes, hongos y células cancerígenas. La buforina II es uno de los AMP que cuentan con un mecanismo de acción independiente del rompimiento de la membrana de la bacteria. En este mecanismo juega un papel muy importante la prolina 11 (!gura 1). Se ha demostrado que este aminoácido está directa-mente involucrado en el paso del AMP a través de la membrana de las bacterias, con independencia de que exista un receptor, sin alterar la membrana. Luego de atravesar dicha membrana, interactúa con el ADN de la bacteria para, !nalmente, interrum-pir los procesos vitales de la misma [5].
Figura 1. Representación de la estructura de alfa hélice de la buforina II, péptido antimicrobiano derivado de la histona H2A. Fuente: [5]
A partir de los resultados de diferentes trabajos, encontramos que estas moléculas no solo pueden ser utilizadas como tra-tamiento individual, sino que también podrían ser usadas en sinergia con antibióticos convencionales, como inmunoestimu-ladores, para ayudar al sistema inmune a detectar infecciones difíciles y como agentes neutralizantes de toxinas, para evitar sepsis en los pacientes. Además, como en el uso de cualquier medicamento, debe existir un índice terapéutico, es decir, un equilibrio entre la efectividad del medicamento contra un blanco especí!co y los efectos adversos que pueda causar en el hos-pedero. Se ha observado que la buforina II no presenta actividad hemolítica contra eritrocitos humanos, incluso en concentracio-nes doscientas veces mayores a las requeridas para inhibir el crecimiento de bacterias [6].
A pesar de su potencial como nuevos antibióticos, hay dos in-convenientes puntuales para el uso de las buforinas y muchos otros AMP: la posibilidad de que sean degradados por proteasas y el costo de su producción. En lo que respecta a la degradación, hoy en día se trabaja en modi!car químicamente los AMP con el !n de evitar su degradación, y en utilizar un transportador que los libere en su blanco. En cuanto al costo, se busca una solu-ción que involucre la producción de los AMP en Escherichia coli, tratando de neutralizar la carga de los AMP para evitar la lisis de la bacteria en donde se producen.
Por otro lado, desde hace algunos años el Laboratorio de Gené-tica Humana de la Universidad de los Andes viene trabajando en
la identi!cación y el potencial terapéutico de los AMP en algunas especies comunes de ranas de Colombia. Este es un campo de investigación de amplias posibilidades para nuestro país, si se tiene en cuenta la biodiversidad de este grupo de animales y el potencial para la salud humana y animal en la actualidad, cuando los antibióticos convencionales están perdiendo la bata-lla contra las infecciones. •
REFERENCIAS
[1] Clarke BT. The natural history of amphibian skin secretions, their normal functioning and potential medical applications. Biological Reviews 1997; 72(3): 365-379.
[2] Melzer S, Clerens S, Bishop PJ. Skin gland morphology and secretory peptides in naturalized litoria species in New Zea-land. Journal of Herpetology 2013; 47(4): 565-574.
[3] Guilhelmelli F et al. Antibiotic development challenges: the va-rious mechanisms of action of antimicrobial peptides and of bacterial resistance. Frontiers in Microbiology 2013; 4: 353.
[4] Wang G, Li X, Wang Z. APD2: the updated antimicrobial pep-tide database and its application in peptide design. Nucleic Acids Res 2009; 37 (Database issue): D933-7.
[5] Cho JH, Sung BH, Kim SC. Buforins: histone H2A-derived an-timicrobial peptides from toad stomach. Biochim Biophys Acta 2009; 1788(8): 1564-1569.
[6] Kawasaki H, Iwamuro S. Potential roles of histones in host defense as antimicrobial agents. Infectious Disorders - Drug Targets 2008; 8(3): 195-205.