Biology

Study Questions

Introduction to Microbiology

1. Define microbiology? 1. Study of cells or organisms to small to be seen from the naked eye

2. Where do you find microorganisms? 1. everywhere

3. How many microorganisms are estimated to be on Earth?1. 5 x 10^30

4. How long have microorganisms been on Earth?1. Billions of years

5. Are the majority of microorganisms beneficial or harmful?1. beneficial

6. Do good or bad microorganisms get the most publicity? Why?1. Good, they have many impacts on our lives

7. How do microorganisms impact our lives through the following: A. Disease

i. Cure, prevention, and treatment of diseasesB. Agriculture

i. Symbiotic relationships converting atm nitrogen to fixed nitrogenC. Food

i. Cheeses, yogurt, dairies, food preservationD. Energy

i. Biofuels, methane, ethanolE. Bioremediation

i. Help clean toxic spills, clean pollutionF. Biotechnology

i. pharmaceuticals8. What are microorganisms made of?

1. Cytoplasm, cell membrane, ribosomes, DNA

Structure & Function

1. Name 6 characteristics of living cells.1. Metabolism2. Reproduction3. Communication4. Differentiation5. Movement6. evolution

2. Who was the first to use a microscope to see microorganisms? What did he see? What type of microscopy did he use?

1. Robert hooke 1665 mold, light3. Who was the first to use a microscope to see bacteria? How do we know he saw bacteria?

1. Antoni van leuwerisk, pepper water infusions 4. What type of microscopy did he use?

1. electron5. What are the four types of light microscopy?

1. Brightfield2. Phase contrast3. Darkfield4. fluorescense

6. What must be done to a microorganism to be able to see it with brightfield light microscopy?1. Must cut the cell, stain them as well. This kills the cells

7. Which types of light microscopy allow you to view a live sample? 1. Phase contrast and darkfield

8. What is the maximum resolution of a compound light microscope? Describe what that value means in practical terms when viewing a specimen.

1. .2 this means any two organisms next to each other wont be seen as next to each other . wont be seen as resolved and distinct

9. What are the two types of electron microscopy? When would you use one type instead of the other?1. Transmission—internal details2. Scanning –outside features

10. What is the maximum resolution of an electron microscope? 1. .2-4

11. What is the smallest microbial cell size discovered thus far? Would this cell have a high or low surface area-to-volume ratio compared to an average eukaryotic cell?

1. .2, high surface area to volume12. What is the significance of a cell having a high surface area-to-volume ratio?

1. Good for nutrient and waste exchange13. Discuss the problems a cell might have it were less than 0.2microns.

1. Wouldn’t have all cell components to live14. Compare and contrast a prokaryotic microbial cell and eukaryotic microbial cell.

1. Prok—smaller, no cell organelles, circular DNA, transcription and translation performed together. Have hopanoids in membrane

2. Euk—larger, transcription in nucleus and translation in cytoplasm. Organelles, have sterols in membrane15. What microorganisms have a phospholipid bilayer form their cytoplasmic membrane?

1. Prok and euk—have ester linkages with fatty acids16. What microorganisms have a lipid monolayer form their cytoplasmic membrane?

1. Archaea—have ether linkages17. Contrast the phospholipid bilayer with the lipid monolayer? What molecules make up each? What are the

different linkages characteristic of each?1. Bilayer—polysaccharides, ester linkages2. Monolayer—ether linkages b/t glycerol and hydrophobic side chains

18. What advantage would microorganisms with a lipid monolayer have over those with a lipid bilayer?1. Harder to break single attached molecule than two separate membranes, heat resistant as well.

19. What are the functions of the cytoplasmic membrane?1. Permeablility, energy conservation, transport. 2. Specific transport mechanisms for nutrients going against concentration gradient

20. Where is the cell wall located relative to the cytoplasmic membrane?1. Outside of membrane

21. What Bacteria lack a cell wall?1. Mycoplasma and chlamydia

22. What are most Bacteria cell walls made of?1. peptidoglycan

23. The amount of peptidoglycan in the cell walls of Bacteria distinguishes what types of Bacteria?1. Gram pos--thicker2. Gram neg—multilayer more complex

24. Describe the peptidoglycan structure.2 sugars: G and M bonded by a beta-1,4 bond. 4 amino acid crosslinkRepeating N-Acetylglucosamine and N-Acetylmuramic acid subunits with peptide crosslinks

25. The glycosidic bond between the two N-acetyl-glucose sugars in peptidoglycan can be cleaved by what enzyme? What is the significance of using that enzyme to cleave that bond?

1. Lysozyme—cell lysis, found in animal secretions, tears, saliva, as a defense for bacterial infections26. Describe what would happen if a bacterial cell were put in a solution with lysozyme added?

1. bursts27. Describe the Gram-positive cell wall.

1. Thick 2. Smooth3. Many layers of peptidoglycan

28. What is function of teichoic acids and lipoteichoic acids?1. Includes all cell wall, membranes, and capsule polymers containing glycerophosphate or ribitol phosphate

residues. Covalently bonded to muramic acid residues in cell wall peptidoglycan. 2. Negatively charged so responsible for Ca2 and Mg2 binding for transport into the cell.3. Lipoteichoic- some techoic acis covalently bound to membrane lipids.

29. Describe the Gram-negative cell wall.1. 10% peptidoglycan2. Most of cell is outer membrane, called lipopolysaccharide layer.3. Membrane; periplasm; peptidoglycan layer; periplasm; membrane made out of protein and

lipopolysaccharides); wavy30. What is the lipopolysaccharide layer?

1. Core polysaccharide and O polysaccharide

2. Repeated sugar sequences31. What part of the LPS is toxic? When is it toxic?

1. Lipid A2. It is toxic when ingested

32. Compare and contrast Archaea pseudomurein and Bacteria peptidoglycan.1. Differ in the glycosidic bonds between the sugar derivatives are B-1,3 instead of B-1,4 and the amino

acids are all of the L stereoisomer.2. Chemically dinstinct. Rose by convergent evolution maybe3. Pseudomurein has N-acytlglucosamine and N-acytltalosaminuronic

33. What types of cell walls are found in Archaea species?1. Pseudomurein (ex: methanobacterium)

i. N-acytlglucosamine and N-acytltalosaminuronic2. S-layers

i. Made of protein or glycoprotein, most common in archaea3. Polysaccharide (ex: halococcus)

i. Extreme halophile repeating 3 part polysaccharide cell wall structure with sulfate groups on uronic acid. Sulfate groups bind Na

34. What types of cell walls are found in Eukarya species?1. Cellulose, chitin, glycoprotein

35. What are the functions of the cell wall? How does the structure of a cell wall suit the functions?1. Protection, maintain cell shape, prevent osmotic lysis, interaction with the environment; it is rigid and

strong36. What are fimbriae? What does a prokaryotic cell do with fimbriae?

1. Short protein filaments2. Used for attachment3. Makes bacteria look hairy4. Eggs are sticky because of protein

37. What is a pilus? What does a prokaryotic cell do with a pilus?1. Hollow tube with genetic info (plasmid) that extends to other cells2. Exchange genetic info3. Used for conjugation

38. Where would an S-layer be found? What purpose does it serve?1. 2 dimensional array of protein2. Outside of a membrane3. Selective sieve

39. Can all Bacteria form a capsule?1. No only some bacterial cells have it

40. What is a capsule made of? How does a capsule’s composition suit its function?1. Polysaccharides or peptide layers2. Sticky3. Helps cell stick to surface

41. Slime is made for what purpose?1. Loose layer of polysaccharide used for gliding

42. What type of microorganisms make slime?1. Nonflagellated prokaryotes

43. Movement using slime secretion is called what?1. gliding

44. What are the 3 main parts of the prokaryotic flagellum? What is the purpose of each?1. Motor2. Hook3. filament-4. motor turns the hook and filament

45. Compare and contrast a prokaryotic and eukaryotic flagellum.1. Prokaryotic-

i. rotates in a circle; complex, filament rotated by hook attached to motor run by mot proteins with proton gradient energy source

ii. proton motive force drives the flagellum motor to rotate the flagellum filamentiii. 60 cell length/second can be achieved

2. Eukaryotic- i. whiplike; 2 micortubules surrounded by 9 pairs of microtubules; moved with motor proteins

46. Would you expect a Bacteria and Archaea flagellum to be the same or different?1. Somewhat similar, will have similarities to Eukaryotes

47. Identify the two types of flagellation.1. Polar

i. Flagella located at one or both ends of cell2. Peritrichous

i. Located everywhere on surface48. Describe the movement of a polar flagellated prokaryotic cell.

1. Rapid, spinning around from place to place49. Describe the movement of a peritrichous flagellated prokaryotic cell.

1. Movement typical slow and in straight line50. What are taxes? Give 3 examples of taxes.

1. Directed movment toward or away from a chemical or physical signal51. Describe an experiment to demonstrate chemotaxis.

1. chemicals52. Describe an experiment to demonstrate phototaxis.

1. light53. Describe an experiment to demonstrate aerotaxis.

1. Oxygen and some bacteria54. What does a cell use to sense the environment?

1. Receptorsi. Sensory proteins in cytoplasmic membrane detect environment then interact with cytoplasm

proteins to affect motion55. What are 2 other ways that a cell can move other than gliding and flagella?

1. Gas vesiclesi. Small gas filled structures made of proteins that fill up with air and make the cell lighter so it

floats2. Magnetosomes

i. Intracellular particles of magnetiteii. Magnetic, need to be down in sedimentiii. Aquatic microbes like magnetospirilumiv. Orients cells in direction

56. Describe how a cyanobacterium could move to obtain optimum wavelengths of light for photosynthesis.1. They sense the light gradient, release or hold in gas to float up and down

57. Where do Gram-negative purple sulfur bacteria store sulfur?1. periplasm

58. What does the carboxysome store for some bacteria and cyanobacteria?1. Carbon

59. Describe the process of sporulation.1. DNA becomes dense in vegetative cell2. Asymmetric cell division3. Endospore grows around protoplast4. Forspore formation5. Exosporium synthesis; primordial cortex formed between the two membranes; dehydration6. Ca2 incorporation; further dehydration, production of SASPS and dipicolinic acid; coat layers formed7. Maturation8. Lysis of cell and release of endospore

60. How does the structure of an endospore help it to be a survival structure?1. Has many layers to protect DNA also calcium diplonic acid and acid soluble protein2. Stabilizes DNA to heat denaturation

61. Where is an endospore formed? Does this vary depending on the microorganism?1. Inside the cell, where inside the cell depends on the micoorganism

62. Describe the process of germination.1. Spore transforms into vegetative cell genetically identical to the vegetative cell that made the spore

63. What age is the oldest known endospore to have germinated? Where was the endospore found?1. Millions years old2. hermoactinomyces

64. What are the organelles of a eukaryotic cell? What is the purpose of each organelle?1. Cytoplasm2. Cell membrane3. ER4. Ribosomes5. Nucleus6. Nucleolus

7. Nuclear membrane8. Golgi9. Cytoplasm10. Mitochondrion11. chloroplast

65. Describe the flow of information within the cell for a digestive enzyme starting with the DNA in the nucleus.1. Nucleus, rough ER, smooth ER, Golgi complex, lysosyme

66. Are viruses living cells?1. no

67. What is virus made of?1. Nucleocapsid made of nucleic acid surrounded by a protective protein coat (capsid)

68. What are the two forms of a virus? In which form does the virus do harm? 1. Extracellular—outside of host/ inert2. Intracellular—replicates inside host by taking over metabolic machinery of host

69. Describe the genome of a virus. How do viral genomes differ from the genomes of living cells known today?1. Very small; DNA or RNA; can be single or double stranded; linear or circular

70. What part of a virus gives the nucleocapsid its helical or icosahedral symmetry?1. Capsid proteins

71. What is a viral envelope? What cell structure is the viral envelope similar too?1. Outer membrane (lipid bilayer) around capside derived from host cell2. Either bursts host, or takes membrane of host with it, called budding (enveloped virus)3. Envelope virus similar to prokaryotic cell but its missing ribosome, so it cant do translation

72. What does it mean for a virus to have complex structure?1. It has multiple parts assembled separately

73. Distinguish between a viroid and a prion. Are they living? Are they viruses?1. Viroid

i. Smallest known pathogensii. Circular, single RNA, no proteiniii. Cause plant disease- potato spindle tuber viroid

2. Prioni. Protein particle, no nucleic acidii. Causes animal neurodegenerative diseaseiii. Creutzfeld + Jakob Diseaseiv. Bovine Spongiform Encophagy (mad cow)v. Chronic Wasting Disease

NOT living74. Describe the possible mechanism by which a prion causes disease.

1. Mutation2. Eat neuronal tissue of infected cow

Genetics

1. In what form (single or double stranded, linear or circular) are most prokaryotic genomes?-single, circular

2. In what form (single or double stranded, linear or circular) are most eukaryotic genomes?-multiple, linear

3. Describe the process of replication. How does replication differ in bacteria versus eukaryotes? Where does replication occur in the cell? What is the outcome of replication?-replication is the splitting of the double helix and synthesized with a complememtary strand.-in eukaryotes there are multiple origins of replication-in bacteria there is only one origin-they both are bidirectional, semiconservative, contain gyrase and helicase, and polymerase is added in the 5’-3’ direction.

4. What is the origin of replication? How many are there?-the origin of replication is where the double helix is pulled apart-eukaryotes: many-prokaryotes: one

5. Name the enzymes involved in replication and what they do during replication.-polymerase : help repair damaged DNA

Polymerase I: removes RNA primer and fills in gaps Polymerase III: Proofreading,main polymerizing enzyme 5’-3’ (attaches at 3’)

-gyrase: unwinds supercoils

-helicase: unwinds double helix-primase: adds RNA primer-ligase: repair missing DNA

6. Describe the process of transcription. How does transcription differ in bacteria versus eukaryotes? Where does transcription occur in the cell? What is the outcome of transcription? -transcription is the information from DNA RNA. Carried out by RNA polymerase. -Prokaryotes: The RNA polymerase is attached to the site with the sigma factor. Transcription begins and the sigma factor is released. RNA chain growth continues to the termination site. Once site is reached growth stops, polymerase and RNA are released. Occurs in the cytoplasm. Hairpin loops are formed.-Eukaryotes: Has 3 RNA polymerases (poly I-rRNA, poly II-mRNA, poly III-tRNA). Since polymerases cannot find start site by itself transcription factors help polymerase bind to promoter site (no sigma factors are found in eukaryotes). The TATA box is recognized by the transcription factor. Once introns are removed a methyl cap is added on 5’ end and poly A tail is added on 3’ end. Occurs in the nucleus and moved through pores to cytoplasm for translation.

7. What strand of the double stranded (ds) DNA is transcribed – 5’ to 3’ or 3’ to 5’ ?-5’-3’

8. Compare and contrast prokaryotic sigma factor with eukaryotic transcription factors.-sigma factor and transcription factor both help polymerase find the promoter site.-sigma factor is only one in prokaryotes-transcription factors are multiple in eukaryotes

9. How would a single gene be transcribed in a bacterial cell?-RNA polymerase and sigma factor attach to the promoter site and transcribe more than one coding region (multiple genes in one mRNA)

10. How would a single gene be transcribed in a eukaryotic cell?-transcription factors help polymerase find promoter site, introns are removed, methyl cap and poly A’ tail

11. How would multiple genes of an operon be transcribed in a bacterial cell?-polycistronic mRNA are transcribed, spacers are removed.

12. Are operons found in eukaryote genomes?-no

13. Using the arg operon, describe enzyme repression.A. When is the repressor bound to the operator?

-when arg is availableB. Under what condtions does transcription of the arg operon occur?

-when the arg in the repressor is used by the cellC. What is the outcome of transcribing the arg operon?

-production of argenine14. Using the lac operon, describe enzyme induction.

A. When is the repressor bound to the operator? -when lac is not present

B. Under what condtions does transcription of the lac operon occur?-when lac is present

C. What is the outcome of transcribing the lac operon?-production of lac protein

15. How does a repressor protein inhibit the synthesis of a specific mRNA?-a repressor attaches to the operator site and blocks transcription

16. How does a negatively controlled operon differ than a positively controlled operon?-a negatively controlled operon prevents transcription while positively controlled operon is an activation transcription.

17. Using the lac operon, describe catabolite repression.-both glucose and lactose are used in the catabolite repression. Glucose is used first, then once exhausted the organism grows on lactose.

18. How is the lac operon regulated by both catabolite repression and enzyme induction?-both glucose and lactose are used but glucose is absent therefore in order for transcription to occur cAMP must be present

19. Is catabolite repression of the lac operon positive or negative control of transcription?-positive??

20. When faced with several sugars as possible carbon sources, do E. coli cells use all of them at the same time or is there a preference and order to their use?-glucose is always used first (if available)

21. Using the mal operon, describe positive control of transcription.A. Under what conditions does transcription of the mal operon occur?

-when maltose is present

B. What is the outcome of transcribing the mal operon?-a product maltose protein

22. How does an activator protein differ from a repressor protein?-an activator protein blocks transcription if substrate is not available(also does not have a operator site). Repressor protein blocks if protein is available

23. Describe the process of translation. How does translation differ in bacteria versus a eukaryote? Where does translation occur in the cell? What is the outcome of translation? -translation is the coding of RNA to proteins. They both occur in the cytoplasm of the cell. And the outcome is proteins

24. In what direction does the ribosome translate mRNA – 5’ to 3’ or 3’ to 5’ ?-5’-3’

25. If you were given a ribonucleotide (ss mRNA) sequence how would you find the open reading frame? Find AUG start codon and go to stop codon (UAA,UGA,UAG)

5’ AGUCAUGUCAGUACCGAACUGAAAGC 3’26. If you were given a nucleotide (ds DNA) sequence how would you find the open reading frame?

Translate to RNA sequence, find start codon, find stop codon5’ AGTCATGTCAGTACCGTAGCG 3’3’ TCAGTACAGTCATGGCATCGC 5’

27. What three types of RNA are used for translation?tRNA, mRNA, and ribosomes

28. How does the ribosome differ in bacteria versus eukaryotes?-smaller

29. What part of the ribosome is used to determine which amino acid gets added to the polypeptide?-bacteria: N-formylmethionine-eukarya & archea: methionine

30. What amino acid does AUG code for in bacteria and eukaryotes?-aminoacyl tRNA

31. How do nonsense codons signal translation to stop?-they do not code for amino acids

32. Describe a way to get a lot of protein from a single mRNA transcript.-a polysome can translate several ribosomes on a single mRNA

Metabolism—no acid fermentation?? Replace with probiotic fermentation?

1. What is a redox reaction?Electron donor gives electrons to acceptor, donor is oxidized, acceptor reduced

2. What happens to a molecule that is reduced?It gains an electron. Accepter is reduced.3. What happens to a molecule that is oxidized?It loses an electron. Donor is oxidized.4. What does an electron carrier do?It transfers electrons from the donor to the acceptor.5. How can NAD+ act as an electron carrier?When the NAD+ attaches to an enzyme with a substrate,  it gains an electron to and becomes NADHGains electrons; product oxidized6. How can NADH act as an electron carrier?When NADH binds to an enzyme with a substrate, it donates electrons to the substrate and become NAD+.Loses electrons; product reduced7. What are examples of short term energy storage molecules?Adenosine triphosphate (ATP), and derivatives of coenzyme A – thioester bonds8. What are examples of long term energy storage molecules? How is each considered an energy storage

molecule?Glycogen, ploy-β-hydroxybutyrate, and elemental sulfur, They are deposited into the cell as large molecules that can be broken down in order to make new cell parts when there is no external energy source.They are insoluble polymers.9. Where does a chemoorganotroph get its energy and electrons?

It gets its energy and electrons from an organic molecule.10. Where does a chemolithotroph get its energy and electrons?

It gets its energy and electrons from an inorganic molecule.11. What type of phosphorylation occurs in glycolysis to make ATP?

Substrate level phosphorylation12. What type of phosphorylation occurs in fermentation to make ATP?

Substrate level phosphoylation13. What type of phosphorylation occurs in respiration to make ATP?

Substrate (from glycolysis) and Oxidative phosphorylation14. What type of phosphorylation occurs in photosynthesis to make ATP?Photo phosporylation. substrate level and oxidative (just like photosynthesis)15. What molecules can be fermented?

nucleic acids, proteins, polysaccharides, proteins, alcohols, and others16. What is syntrophy? When is Syntrophomonas capable of fermenting butyrate? What role would a methanogen

play in helping Syntrophomonas ferment butyrate?Microorganisms working together to degrade a compound;it can only do it if a methanogen is present; the methanogen uses the H2 that is created

17. If glucose is fermented, where does the ATP come from? What type of phosphorylation generated that ATP? What happens to pyruvate? Why is it necessary for pyruvate to be reduced to lactate or other fermention product?Pyruvates through glycolysis, SLP, Converted into various molecules to regenerate NAD+, To regenerate NAD+

18. Describe homolactic fermentation of glucose. What microorganisms are capable of this type of fermentation? Lactate product (2 lactate per glucose, 2 ATP); Gram positive, catalase negative Streptococcus and Lactococcus

19. Describe heterolactic fermentation of glucose. What microorganisms are capable of this type of fermentation? Lactate and other products (1 lactate per glucose, 1 ATP); Gram positive catalase negative Lactobacillus and Leuconostoc

20. What are the differences between homolactic and heterolactic fermentation?The products produced, Homolactic only produces lactic acid, heterolactic produces other products such as ethanol and CO2 along with lactate

21. Describe mixed acid fermentation. What microorganisms are capable of this type of fermentation? Would a broth culture of Escherichia coli fermenting glucose have an acidic (low), neutral, or alkaline (high) pH?Several acids are mixed together in the product, E. coli, low

22. Describe butanediol fermentation. What microorganisms are capable of this type of fermentation? Would a broth culture of Enterobacter aerogenes fermenting glucose have an acidic (low), neutral, or alkaline (high) pH?Same types of acids are produced, Enterobacter, neutral

23. How could you tell if an organism did mixed acid fermentation or butanediol fermentation?Mixed fermentation yields low pH and butanediol fermentation yields neutral pH

24. How is ATP made in a hydrogenosome? What product of glycolysis is used to make ATP in the hydrogenosome? What kind of microorganism has hydrogenosome? What organelle do these microbes lack?Pyruvate goes to acetyl CoA then to ATP and acetate; pyruvate is used; anaerobic eukaryotes; these organism lack mitochondria

25. What product of glycolysis feeds the citric acid cycle? pyruvate

26. Does the citric acid oxidize or reduce pyruvate to carbon dioxide?oxidize

27. Where do the NADH and FADH generated by redox reactions of the citric acid cycle go?They go to the electron transport system, creates proton motive force

28. What are the intermediates of the citric acid cycle, such as oxalacetate and α-ketoglutarate used for?They are used for biosynthesis

29. Aerobic and anerobic respiration differ in what way?Oxygen is needed from the environment for aerobic respiration

30. What is the terminal electron acceptor for aerobic respiration?O2

31. What is the terminal electron acceptor for anaerobic respiration?non-oxygen molecules

32. List 4 protein electron carriers. How many electrons and protons can each accept and donate?NADH dehydrogenases: accept 2e and 2 H+, donates 2e and 2H+;Flavoproteins:accept 2 e and 2 H+, donate2e; Iron-sulfur proteins: receive e and donate e; cytochromes: accepts and donates an e

33. Name a very common group of non-protein electron carriers. How many electrons and protons can it accept and donate?Quinones receive 2e and 2H+, donate 2e, NAD+ is freely diffusible nonprotein electron carrier able to accept 2 electrons and 2 protons.

34. Which electron carriers contribute to the proton motive force needed to make ATP?quinones, cytochromes, NADH dehydrogenase and flavoprotein

35. What are the components of an electron transport chain? What is the purpose (the outcome) of an electron transport chain? Primary electron donor, electron carriers, terminal electron acceptor; to generate ATP

36. In a eukaryotic cell, in what organelle would an electron transport chain be located? In what membrane? On which side of the membrane will protons accumulate? On which side of the membrane will ATP be made?mitochondria; intermembrane/matrix, outside, ATP made in the matrix,

37. In a prokaryotic cell, in what membrane would an electron transport chain be located? On which side of the membrane will protons accumulate? On which side of the membrane will ATP be made?Cytoplasmic, outside, inside

38. Facultative aerobes like E. coli have the ability to do aerobic respiration (Fig. 21.14a), anaerobic respiration (Fig. 21.14b), and fermentation (Fig. 15.23a). Which form of metabolism will E. coli use in an oxic environment? Which form of metabolism will E. coli use in an anoxic environment? Which form of metabolism used by E. coli can be thought of as a back-up way to make ATP, to be used when the others cannot be used?aerobic;anaerobic;fermentation

39. What term is used to describe the use of a proton motive force to generate ATP?Chemiosmosis

40. In what way is the ATP synthase similar to bacterial flagella?Both are similar rotating motor like proteins, It is rotated by hydrogen atoms as a “motor”

41. What is the energy source for a phototroph?Light

42. Name the pigments responsible for harvesting light energy for phototrophs. Where are these pigments located in a eukaryotic cell? In a prokaryotic cell?Chlorophylls/bacteriochlorophylls, carotenoids, phycobilins; eukaryotic-chloroplasts; prokaryotic-chlorosomes, cytoplasmic membrane, thylakoid membranes

43. What pigment resides in the photosynthetic reaction centers in an anoxygenic phototroph?bacteriochlorophylls

44. What pigment resides in the photosynthetic reaction centers in an oxygenic phototroph?chlorophylls

45. What do antenna pigments do?Absorb light energy, transfer energy to rxn center

46. Compare and contrast anoxygenic and oxygenic photosynthesis.Anoxygenic-does not produce oxygen; oxygenic- produces oxygen, Anoxygenic do not produce oxygen, have cyclic electron flow, light used to generate ATP, NADH generated by reverse electron flow, inorganic molecules are electron donors. Oxygenic produces oxygen, “z” scheme electron flow, ALSO uses light to generate ATP, NADH generated by “z” scheme electron flow, water is the electron donor.

47. What is the initial electron donor to anoxygenic photosynthesis?Inorganic molecule

48. What is the initial electron donor to oxygenic photosynthesis?water

49. How is oxygen generated in oxygenic photosynthesis?Water is split, and electrons are taken up, oxygen is released, Chlorophylls that have been excited by enough light energy take e- from H2O and O2 is released

50. How is NADH generated in anoxygenic photosynthesis?Reverse electron flow

51. How is NADH generated in oxygenic photosynthesis?Z-scheme electron flow

52. What process can use the NADH generated by anoxygenic and oxygenic photosynthesis?Electron transport chain

53. Name a model organism used to study anoxygenic photosynthesis.Rhodobacter capsulatus

54. Name a prokaryotic model organism used to study oxygenic photosynthesis.Cyanobacterium, Synechocystis

55. Name a eukaryotic model organism used to study oxygenic photosynthesis.eukaryotic green alga Chlorella

56. List all catabolic processes discussed in class.Calvin-Benson cycle, Reverse citric acid pathway, hydroxypropionate pathway, acetyl-CoA pathway

57. The short term energy (ATP) generated by these catabolic processes is used for what?Biosynthesis

58. Where can organisms get there carbon?CO2 and organic molecules

59. What name is given to an organism that can take carbon dioxide from the air other organic compounds?autotrophs

60. Where do heterotrophs get their carbon?From organic compounds that are not CO2

61. Explain why the Calvin-Benson cycle is often referred to as the dark reaction of photosynthesis.

Light is not required for this rxn to occur, however light does not hinder the rxn from occurring either62. If we split the term photosynthesis into “photo” and “synthesis,” which would be used to describe the Calvin-

Benson cycle?synthesis

63. The Calvin-Benson cycle is used by autotrophs to make _____________ .sugars

64. What is the initial reaction of the Calvin-Benson cycle?Fixing CO2, RubisCO (see below)

65. RubisCO fixes carbon dioxide (1 carbon) by binding it and ribulose 1,5-bisphosphate (5 carbons) to form two 3-carbon molecules of _______________.phosphoglycerate

66. RubisCO is an acronym. What does it stand for? What other molecule besides carbon dioxide can RubisCO bind? How could this be a problem?Ribulose-1,5,-bisphosphate carboxylase ozygenase, Hexose sugars or storage polymers like glycogen or starch, If RubisCO binds O2, it cannot bind sugar

67. What is the purpose of the Calvin-Benson cycle?make carbon molecules, fix co2 into sugar

68. What is the purpose of the reverse citric acid pathway?carbon molecules, cell material, Another pathway to do the same thing, it requires different enzyme

69. What is the purpose of the hydroxypropionate pathway?CO2 comes in to make cell material

70. What is the purpose of the acetyl-CoA pathway?Fix CO2 in acetogens

71. How are sugars made? What catabolic process is used? What catabolic process is used in reverse?glycogenesis; citric acid cycle; glycolysis is used in reverse

72. What are pentose sugars made from?Ribose and deoxyribose; made by removing CO2 from hexose

73. Use ADPG to explain “activated glucose”. How does this activated glucose provide the energy to add the glucose onto a polysaccharide of glucose like glycogen, starch, or cellulose?ADP is attached to a glucose. When the ADP is split from the glucose. The energy is used to attach the glucose to the polysaccharide, It carries energy, not at as good as ATP. It carries PO4 group that would be cleaved and releases enough energy to attach to another by covalent bond; glucose joins glycogen then ADP that can attach to another molecule

Microbial GrowthHighlighted questions are from articles

1. Distinguish between macronutrients and micronutrients.Macronutrients: elements required in fairly large amountsMicronutrients: elements needed in very small amounts

2. Give at least 6 examples of macronutrients.Carbon, Hydrogen, Oxygen, Nitrogen, Phosphorus, Sulfur, Potassium, Magnesium, Sodium, Calcium, Iron

3. Give at least 4 examples of micronutrients.Boron, Chromium, Cobalt, Copper, Iron b, Manganese, Nickel, Selenium, Tungsten, Vanadium, Zinc

4. How do growth factors differ from macronutrients and micronutrients?Organic compounds needed in very small amounts; vitamins. Ex. Lipoic acid

5. Name the 5 groups describing an organism’s relationship to oxygen.Obligate Aerobes: need O2 to make ATPFacultative Aerobes: prefer O2 to make ATP, can fermentMicroaerophilic Aerobes: use lower O2 levels because they don’t require high pressureAerotolerant Anaerobes: Ferment regardless of whether O2 is presentObligate Anaerobes: Ferment in only conditions in which O2 absent

6. What type of broth can be used to determine an organism’s oxygen requirement? What does this broth contain that makes it possible to determine an organism’s oxygen requirement?Thioglycolate broth – reducing agent; reacts with oxygen to form water; used to remove oxygen from broth

7. You inoculate the following organisms into tubes containing thioglycolate broth. Where would you expect to see growth in the tube?

a. Obligate aerobe – dense in oxic zone and top of anoxic zoneb. Obligate anaerobe – dense in bottom of anoxic zonec. Facultative aerobe – dense in oxic zone, yet evenly spread in anoxic zoned. Microaerophile – sparse in oxic zone, top of anoxic zone

e. Aerotolerate anaerobe – evenly spread throughout oxic and anoxic zones8. What accommodations need to be made to grow an aerobe in the lab?

Need culture medium oxygenated: allow exposure to air, vigorous shaking (250 rpm), bubbling sterile air into the medium

9. What accommodations need to be made to grow an anaerobe in the lab?Need oxygen to be excluded from culture medium: bottles/tubes completely filled with media and sealed; use a reducing agent; anoxic jars; anoxic glove boxes

10. During what process are toxic oxygen molecules generated?Respiration of peroxidases

11. How does an organism protect themselves from toxic oxygen molecules?Enzymes made by cells can neutralize toxic forms of oxygen: Catalase, peroxidase, superoxide dismutase, superoxide reductase, combination of superoxide dismutase and catalase

12. What enzyme combinations would detoxify superoxide (O2-)? In what organisms might those combinations be

found?Superoxide dismutase/catalase : obligate aerobes and facultative aerobesSuperoxide reductase : obligate anaerobes

13. Where can an organism get nitrogen?Atmospheric nitrogen; inorganic compounds (ammonia and nitrate)

14. Name a molecule that requires phosphorus. Where can a cell get phosphorus?Nucleic acids and phospholipidsPhosphate minerals and free phosphates

15. Name a molecule that requires sulfur. Where can a cell get sulfur?Amino acids (cysteine and methionine); vitamins; iron-sulfur proteins

16. Name a molecule that requires potassium. Where can a cell get potassium?Enzymes; used to maintain solute concentrationsFree potassium ions or potassium salts

17. Name a molecule that requires magnesium. Where can a cell get magnesium?Stabilizes ribosomes, membranes, and nucleic acids; required by many enzymesSalts in various minerals

18. Name a molecule that requires iron. What specialized molecule allows some organisms to sequester iron? What are two examples of siderophores?Electron transport chain proteins; siderophoresSiderophores – molecules bind iron and transport it into the cellEnterobactins: Escherichia coli and Salmonella typhimuriumAquachelin: marine bacteria

19. Name a structure that requires calcium. Where can a cell get calcium? (See Table 5.1)Stabilizes cell walls; endospores (calcium dipicolinic acid complex)Calcium ion in solution; calcium sulfate; other calcium salts

20. Name a structure that requires sodium. Where can a cell get sodium? (See Table 5.1) Can sodium motive force (instead of a proton motive force) be used by some organisms to generate ATP? Marine microorganisms; stabilizes cell walls; used by ATP synthaseSodium in solution; sodium chloride; other sodium salts, YES

21. Define growth as it pertains to microorganisms.Increase in the number of cells

22. What is the most common process by which prokaryotes grow?Binary fission

23. What genomic event must take place before a cell divides?DNA replication

24. What proteins are required to move the copies of DNA to opposite sides of the dividing cell?Min proteins

25. Following DNA replication, what must form for cell division to continue?Divisome

26. What proteins form the divisome? Where are these proteins located? How does there location correlate with where division will begin?Min proteins ensure divisome forms at cell centerFtsZ proteins form ring where cell division beginsFtsA proteins help hold FtsZ ring to cytoplasmic membrane

27. Does the divisome move?no

28. FtsZ protein has similar amino acid sequence to what eukaryotic cytoskeletal protein?tubulin

29. As the cell elongates new cell wall is laid down at certain sites determined by the location of what protein?

MreB proteinsFilamentous spiraled bands around inside of cell under cytoplasmic membrane direct new cell wall to be made at certain locations

30. As the cell elongates holes are made in the existing cell wall to make room for new cell wall material. What enzyme makes these holes? What happens if these holes are not quickly filled with new cell wall material? If a cell lacks FtsI proteins, what will happen once these holes are made?Autolysins create small openings in existing cell wallFtsI proteins (penicilling binding proteins) are transpeptidases that insert new peptidoglycan into expanding cell wallAutolysis (spontaneous cell lysis due to osmotic pressure) may occur if there is an error in inserting new cell wall material

31. How does the new peptidoglycan precursor differ from existing cell wall peptidoglycan?N-acetylglucosamine/ N-acetylmuramic acid/ pentapeptide5 amino acids attached to the peptidoglycan precursor (existing peptidoglycan units have 4 amino acids)

32. How does the new peptidoglycan precursor get to the expanding cell wall?Bactoprenol transports the precursor across the cytoplasmic membrane

33. What makes bactoprenol a good molecule to transport the new peptidoglycan precursor across the cytoplasmic membrane?*hydrophilic lipid alcoholsugars cannot go across the cytoplasmic membrane freely Makes the precursor sufficiently hydrophobic to pass through and interacts with glycolases to insert the precursors

34. FstI proteins catalyze what reaction?Transpeptidation: insertion of peptidoglycan precursors into existingwall

35. What happens to the peptidoglycan precursor during transpeptidation?Peptide bond formation between pentapeptide of peptidoglycan precursos and tetrapeptide of an existing peptidoglycan unit

36. In binary fission, where is new well wall added relative to the divisome?Cell wall material is added to many locations to the left and right of the divisome

37. Describe simple budding. How is simple budding different than binary fission? Give an example of a prokaryotic microorganism that divides by simple budding. Give an example of a eukaryotic microorganism that divides by simple budding.Simple budding: growth only occurs on one side of the cellWhen it’s big enough, DNA will be replicated and placed inside the bud, which will pinch off, producing two identical cellsYeastsPirella, Blastobacter Hyphomicrobium, rhodomicrobium, pedomicrobiumSaccharomyces cerevisiae, Chlamydomonas reinhardtii

38. Describe budding by hyphae. How is the new cell different than the parent cell? What is a swarmer cell capable of doing? Give an example of a prokaryotic microorganism that divides by budding by hyphae.Mother cell forms a hypha (extension of one side)Hypha lengthens, DNA replication occursDNA passes through the hyphaeSeptum forms before disconnectionDaughter cell FORMS FLAGELLA (swarmer cell)Mother cell hyphae continues to length, DNA replication can begin againCapable of swimming away, moving to a new location. Different and more plentiful nutrients available. Less competitionHyphomicrobium, Rhodomicrobium, Pedomicrobium

39. Describe cell division in stalked bacteria. How is the new cell different than the parent cell? Give an example of a prokaryotic microorganism that divides this way.Swarmer cell loses its flagellumSynthesis of stalkElongation of stalked cellSynthesis of flagellumCross band formationCell divisionCaulobacter

40. Compare and contrast cell division in stalked bacteria and budding by hyphae. Stalked bacteria attach to surface and the daughter cell disattaches and swims away whereas hyphae the parent is not attached, it simply replicates its DNA, the daughter then swims away with the flagella like the stalk

41. Describe the growth cycle. Do the growth phases always occur in the order presented in figure 6.10?

Populations of microorganisms show a characteristic growth pattern when inoculated into a fresh culture medium1. lag phase – transition period to allow synthesis of enzymes for biosynthesis2. exponential phase – regularly diving cells3. stationary phase – essential nutrient depleted, toxic products build up, growth stopsdeath phase – cells die

42. If you use a loopful of turbid culture of E.coli in stationary phase to inoculate a new broth culture, at what growth phase will the cells start?Lag. If an inoculum is taken from an old (stationary phase) culture and transferred into the same medium, there is usually a lag even if all the cells in the inoculum are alive

43. If you use a loopful of turbid culture of E.coli in exponential phase to inoculate a new broth culture, at what growth phase will the cells start?LagMircroorganisms always start back at the lag phase to matter the cirumstance

44. If you use a loopful of turbid culture of E.coli in lag phase to inoculate a new broth culture, at what growth phase will the cells start? Would it matter if the new broth culture was the same medium (same composition) or different medium?It would make no difference. The process will always begin back at lag phase.

45. Plot on a graph what the growth cycle would look like during the entire process described here: You grow an E.coli culture in glucose broth. Once it reaches stationary phase presumably due to consumption of all the glucose, you add additional glucose.

46. During exponential growth cells predictably ______________.** During exponential growth cells predictably double

47. Explain why generation time is often referred to as doubling time.The time required for ONE cell to form TWO cells

48. Graph the exponential growth examples on semilogarithmic graph paper, both of which are posted on Moodle. Be able to determine from the graphs, the generation time, how many cells after a period of time, and at what time would there be a certain number of cells.

49. Describe an everyday situation in which exponential growth would be relevant.Non-sterile, nutrient rich food products such as milk allowed to stand under ideal bacterial growth conditions..… at early exponential growth is not so bad.… during later times of exponential growth can mean spoilage.

50. Know when to use N=N02n. Be able to calculate the final cell number (N) if given the initial cell number and number of generations of growth. Be able to calculate the initial cell number (N0) if given the final cell number and number of generations of growth.N = No2n = final number of cellsNo = initial number of cellsn = number of generations

51. Know when to use g=t/n. Be able to calculate the generation time (g) if given the time of exponential growth and number of generations. Be able to calculate the amount of time of exponential growth (t) if given the generation time and number of generations. Be able to calculate the number of generations (n) if given the time of exponential growth and generation time.g = t/n = generation timet = time of exponential growth (hr, min)

52. Give an example of a batch culture.Fixed volume of culture mediumClosed systemUsed for routine laboratory procedures

53. How does a batch culture differ from a chemostat culture?Chemostat: Continuous culture devicesMaintain cell populations in exponential growth for long periods

54. What can be controlled in a chemostat that allows for a continuous culture to be maintained?Dilution rate and the concentration of limiting nutrients

55. What are the two types of cell counts? When would you use one type of cell count over the other?Total cell count: total number of cells, direct microscopic countViable count: viable (living, reproducing) cells; plate or colony count

56. What instrument is used for a total cell count?Counting chamber

57. Viable counts can be done in what 2 ways?Spread-plate methodPour-plate method

58. What procedure usually precedes a plate count? Why is this done?

Several 10fold dilutions of the sample are commonly done prior to plating because the initial concentration of bacteria in the sample is unknown

59. What property of the culture is being measured by turbidity measurements?The more turbid a suspension, the more cells presentIndirect measurement of cell count

60. What instrument is used for a turbidity measurement?Spectrophotometer

61. Turbidity is measure in _____________________ units.optical density

62. What exactly is the spectrophotometer measuring?Scattered light

63. Be able to interpret a graph of turbidimetric measurements as shown in figure 6.17b.

64. What does a standard curve represent? Correlates turbidity measurements with actual cell number or massMade for an organism growing in a particular mediumCan be used for estimating cell number of future cultures

65. Describe the procedure for creating a standard curve.Plate count to determine titer (cfu/ml) of original cultureTurbidimetric determination of dilutions of original cultureCalculate number of cells in each dilution based on the titer and absorbance of the original culture

66. Graph the standard curve examples on plain graph paper, both of which are posted on Moodle. From the graphs, be able to determine the optical density of a certain number of cells.

67. Distinguish between species richness and abundance. Species richness- variety of speciesSpecies abundance – a lot of the same kind of species

68. In what type of environment would you expect to have specie richness? Undisturbed organic-rich soils

69. In what type of environment would you expect to have specie abundance?Extreme environments

70. In the real world, how do microbes live? …as pure cultures?not as pure cultures, in communites, competive.

71. What term refers to where a microorganism lives?microenvironment

72. List 3 reasons microbes sometimes grow differently in the lab than they do in their natural habitat?Suboptimal resources or growth conditionsDistribution of nutrients not uniform in habitatMicrobes growing in mixed populations where competition exists

73. Where do biofilms form?Solid surfaces

74. Why do biofilms form? What advantages does living in a biofilm offer a microorganism?Provide defense by numberAllow cells to stay in a favorable nicheAllow cells to live in close association (metabolic cooperation between species)

75. List the stages of biofilm formation. What happens during each stage? At what stage would the biofilm look like a mushroom?Attachment: adhesion of a few cells to a suitable solid surfaceColonization: intercellular communication, growth and polysaccharide formation*Development: more growth and polysaccharidePsuedomonas aeruginosa mature biofilm “mushroom”

76. What problems are caused by biofilms?Cystic fibrosisPeriodontal diseaseInfections from implants (catheter, artificial joints)

Pipeline (oil, water) congestion and corrosionDegradation of submerged objects like offshore oil rigs and boats

77. Why are antimicrobial agents usually ineffective against biofilms?There are so many and they are constantly recruiting more bacterial cells

78. Name a signal molecule released by some microbes to encourage biofilm formation.Acylated homoserin lacton (AHL)

79. Communication amongst microbes that form biofilms is called ______________?Quorum sensing

80. How do acylated homoserine lactones promote biofilm formation?

81. What quorum sensing signaling molecule does Psuedomonas aeruginosa use?

82. Does Staphylococcus aureus use the same signaling molecule as P. aeruginosa?

83. What is absent from Delisea pulchra? What chemical is responsible for this?Biofilms; substituted furanones

84. How do furanones prevent biofilm formation? What stage of biofilm formation do furanones prevent?Furanones bind to bacteria cells at sites normally used by other signals and block signaling molecules from delivering the message Colonization

85. Name a researcher who studies biofilms. Name at least one thing she discovered. In what bacteria did she discover this?Bonnie Bassier, discovered quorum sensing in Vibrio fischeri

86. What can Vibrio fischeri and Vibrio harveyi do when enough cells get together?

87. What can Vibrio cholerae do when enough cells are present?

88. Are bacteria capable of knowing the cell next to them is like them or not?Yes

89. What micronutrient is found in AI-2? Boron

90. Where are most terrestrial microbes found?Surface of soil particles around plant roots in the rhizosphere

91. In aquatic environments, what types of microbes are found the upper depths and at the surface?Cyanobacteria and algae

92. In aquatic environments, what types of microbes are found the lower depths?Purple and green sulfur bacteria

93. Describe the events that take place in a river after the introduction of sewage or other high-nitrogen or high-phosphorus input. (see Figure 23.9)An increase in bacterial numbers and a decrease in oxygen occur immediately upon the spike in organic matter (sewage)

94. What happens to the oxygen concentration after the introduction of sewage or other high-nitrogen or high-phosphorus input? What microbes cause this? What metabolic process is responsible? When will the oxygen concentration return to previous levels? What microbes are responsible for this? What metabolic process is responsible?Oxygen levels decrease because the bacteria take up the nitrogen and phosphorus and go through the process of anaerobic respiration. The oxygen levels will return to previous levels when the nitrogen and phosphorus levels decrease. The organisms responsible for the increase in oxygen are algae and cyanobacteria going through aerobic respiration

95. What is “nonpoint pollution” referring to?Runoff from a wide area, not a single source

96. Where does fecal contamination of American beaches primarily come from?Because of booming growth in US coastal regions, much of the area near the shoreline is covered with impervious surfaces such as parking lots, roads, and side walks. When it rains, storm water runoff from these surfaces can carry animal feces and their accompanying microbes into drainage ditches that lead directly to lakes, streams, and beaches

97. Where would you find oxygenic phototrophs like cyanobacteria and algae within an aquatic environment?Photic zoneEpilimnionBetween the surface to 100m deep

98. Where would you find anoxygenic phototrophs like the purple and green sulfur bacteria within an aquatic environment? Why are they located here?

HypolimnionDeeper water, anoxic

99. Where in the water column do phototrophs, chemoorganotrophs, and chemolithotrophs each reside in a marine (i.e. an ocean) environment?

100. Phototrophs- Surface – 100 meters101. Chemoorganotrophs- 100- 1000 meters102. Chemolithotrophs- 1000- 5000 meters

103. What are terms used to describe an organism’s requirement for elevated pressure?Barotolerant- tolerate elevated pressure but grows best at low atmBarophile- grows best under high pressureExtreme barophile- required high pressure for growth, Moritella

104. Describe the environmental conditions in the deep sea.High pressure, low temp & nutrientsHydrothermal vents are deep sea hot springs where volcanic activity generates fluids containing large amounts of inorganic energy sources that can be used by autotrophic chemolithotrophs

105. What structures on the ocean floor provide warmth and inorganic nutrients to organisms that live down there?Hydrothermal vents

106. Where does the carbon dioxide come from that autotrophs use in the deep sea?CO1 comes from bicarbonate (sediments) and action of carbonic anhydrase

107. Define mutualism. Describe an example of a mutualistic relationship in the deep sea.Mutualism: an obligate relationship in which both organisms benefitMarine invertebrate/ BacteriaRitfia giant tube worm and sulfide-reducing bacteria

TEST 5 VIRIAL REPLICATION??108. Do viruses require a living host cell?

yes109. Is it common for a virus to be able to infect across domains (Bacteria, Archaea, Eukarya)?

no110. Name the two kinds of prokaryotic virus. Give an example of each.

Virulent virus- Bacteriophage T4Temperate virus- Bacteriophage Lambda)

111. What are the five steps in virulent phage life cycle?Attachment to a specific receptor on host cell, usually a membrane proteinPenetration of either the whole virus (eukaryotic) or just its genome (prokaryotic, injection)Synthesis of nucleic acid and protein host machinery replicates viral genomes and make viral protein (capsid proteins)Assemble and packaging of structural subunits and genomes in capsidRelease (lysis) by budding or lysis of host cell; new virions can infect new host cell

112. What are the steps in a temperate phage life cycle? How does the life cycle of a temperate phage differ from a virulent phage?A virulent virus goes through the lytic cycle immediately and doesn’t go through a stage of dormancy.

113. What term is used to describe the alternative pathway that temperate phages have?Lysogeny

114. What term is used to describe the temperate virus when it is incorporated into the DNA of the host cell?Prophage

115. What term is used to describe a host cell harboring a prophage?- Lysogen

116. Name two repressor proteins that determine whether bacteriophage lambda enters lysogeny. What does each repressor protein do?

C1 (lambda repressor)- represses genes involved in lysis and is required in low concentration to maintain lysogenyCro- represses genes involved in lysogeny and is needed in greater amounts than C1 to force lambda into lytic cycle

117. If both CI and Cro are simultaneously made by the virus, then how will levels of CI and Cro differ?C1 will be in low doses and force the cell to remain in lysogeny and if Cro is in high doses then the cell will lyse.

118. Under what host cell conditions, would lambda enter lysogeny? Will CI or Cro protein concentration be higher?

If the number of viruses is greater than the host cells, then a virus can continue to replicate as a prophage when its host cell divides. C1 protein concentration will be higher.

119. Under what host cell conditions, would lambda enter the lytic cycle? Will CI or Cro protein concentration be higher?If the cell has DNA damage (X-rays, UV, or chemicals) or in nutrient rich environments when many proteins are present in the host cell. Cro protein concentration will be higher.

120. Name and describe the 4 types of animal viruses. Which animal virus is similar to a virulent bacteriophage? Which animal virus is similar to a temperate bacteriophage?

Lytic- destruction of host cells; similar to virulentPersistent- new virions leave host by budding; cells don’t die, but remain infected and will produce virionsLatent- virus is not actively replicating, dormant; similar to temperateTransformation- virus can change normal cell into cancer cell; genetic changes that regulate growth

121. What is the most infamous human retrovirus?122. Describe of the structure of a typical retrovirus.123. What is the genome of a retrovirus? RNA or DNA? Single-stranded or double-stranded?124. What 3 enzymes are packaged inside the nucleocapsid of a retrovirus? What does each of these enzymes do for

the virus?125. Describe the retroviral replication cycle. At which points are reverse transcriptase, integrase and protease

needed?126. Name the 3 regions of the retroviral genome. Name and give the purpose of the proteins made from each region.

Gag- structural proteins and proteasePol- reverse transcriptase and integrase (DNA endonuclease)Env- envelope glycoproteins

127. With no translational machinery (ribosomes, tRNAs) encoded by the virus, how does the virus makes its proteins?The virus uses the tRNA found in the host cell. The virus inserts it’s genome into the host cell’s DNA and that is how it transcribed and translated.

128. How do new retrovirus virions leave the host cell?129. Where does the envelope come from that surrounds some viruses, like retroviruses?

The host’s cytoplasmic membrane130. How is the viral envelope similar to the host cells cytoplasmic membrane?

The viral envelope is the same cytoplasmic membrane that surrounds the host cell.131. How is the viral envelope different from the host cells cytoplasmic membrane?

The viral envelope is surrounded by glycoproteins.

Control of Microbial Growth

1. Describe two ways prokaryotes defend against viral infection.Restriction- using restriction endonucleases to cut viral dsDNA at specific sequencesMethylation- DNA methylases to methylate their own DNA to prevent cleavage by their own and viral restriction endonucleases

2. What type of DNA is susceptible to restriction endonuclease cleavage?Double stranded DNA

3. Will restriction be effective against RNA viruses? Against ssDNA viruses?No ssDNA and RNA viruses are unaffected by restriction systems.

4. How can viruses avoid host defenses?Double stranded DNA viruses modify DNA to avoid digestion by the host’s restriction endonucleasesGlucosylation- disguising with sugarMethylation Viral genomes encode proteins to inhibit host restriction systems

5. What occurs during the latent period of viral replication? (see Fig. 10.9)The virus is not actively replicating; dormant.

6. Describe RNA interference. What type (animal, prokaryotic, DNA, RNA, etc.) of virus is this effective against?Dicer- double stranded RNA nuclease dices the viral RNA molecule into small fragments. The RISC complex then binds to these short fragments to create single stranded RNA. The slicer chops up the complementary strands that match the RNA found in the RISC complex. The slicer uses single stranded RNA nuclease. Animals and plants use this type of immune system.

7. What is the primary way for humans to control the spread of viruses?By controlling attachment and in general vaccinations.

8. What kind of drugs can be used to treat viral infections? What do these medicines target? Can antibiotics be used to treat viral infections?Fusion inhibitors- synthetic peptide that binds to an HIV membrane protein preventing the viral membrane from binding to the host cell membrane

Reverse Transcriptase Inhibitors- block reverse transcriptionProtease inhibitors- bind HIV protease, preventing the protease from processing viral polypeptidesNo antibiotics can’t be used to treat viral infections, only used for bacteria

9. Who is Louis Pasteur? What hypothesis did he disprove?Louis Pasteur discovered the process of fermentation as well as pasteurization. He disproved the hypothesis spontaneous generation, which stated that living organisms can originate from non-living matter.

10. Is pasteurization the same as sterilization?Pasteurization is not the same as sterilization. Pasteurization reduces microbial load and kills most pathogens and inhibits growth of spoilage microorganisms. Sterilization is the killing of all organisms.

11. List the 4 methods of physical sterilization. Which is most widely used? Heat- most widely used method of sterilizationRadiationFiltrationCold (gas)

12. Why can’t heat be used to sterilize everything? Some things are heat resistant. endospores

13. The temperature needed for heat sterilization depends on the ______________ temperature of growth for an organism. Optimum

14. Define decimal reduction time. Would the decimal reduction time be more quickly achieved at lower or higher temperatures?

15. What equipment is used to heat sterilize? Autoclave

16. How does an autoclave sterilize?Uses steam heat under pressure; 121 degrees Celsius.

17. What factors determine the amount of autoclave time needed for sterilization?Number, size, density

18. List 4 factors that increase heat resistance.High pHHigh solute concentrationThermophileEndospores (high content of small acid soluble proteins and low water content)

19. What are the different types of radiation used for sterilization?Ultraviolet radiationIonizing radiation

20. Which kind of radiation is more lethal? Why?Ionizing radiation because is causes breaks in the DNA strands, breaks hydrogen bonds and disulfide bridges in proteins.

21. Compare the damage done by UV versus ionizing radiation.UV- Causes thymine dimers in DNAIonizing- Causes breaks in the DNA strands, breaks hydrogen bonds and disulfide bridges in proteins.

22. How does filter sterilization work?Filter is a device that has pores too small for microorganisms to fit through but large enough for the liquid or gas to passRemoves microorganisms from liquids that are heat sensitiveSterilizes air

23. How do depth filters differ from membrane filters?Depth filters are fibrous sheets or mats and they trap particles from liquids and the air. Membrane filters are very thin and act like sieves, trapping particles on the membrane surface.

24. What is commonly sterilized by depth filters?Quarantine rooms

25. What is commonly sterilized by membrane filters?Antibiotics and other pharmaceuticals

26. Distinguish cidal agents from static agents.Cidal agents are chemicals that kill organismsStatic agents inhibit growth of microorganisms

27. Compare and contrast bacteriocidal agents and bacteriolytic agents in general. (Use Fig. 27.9)Bacteriocidal agents bind tightly to their cellular targets, lysis does not occur, and triclosan blocks fatty acid synthesis in many BacteriaBacteriolytic agents kill cells by lysis and antibiotics such as penicillin inhibit cell wall synthesis

28. Primarily what are chemical antimicrobial agents used for by various industries such as paper, petroleum, air conditioning?

To prevent microbial growth29. Who is credited with the discovery that sterilizing surgical instruments increased the survival rate of surgery

patients?Joseph Lister

30. List the 4 categories of chemical antimicrobial agents used to control microorganisms considered to be harmful to humans. Give an example of each. (See Table 27.4)Sterilants- FormaldehydeDisinfectants- Chlorine Sanitizers- ChlorineAntiseptics and Germicides- Alcohol, silver nitrate

31. Who was the first to coin the term “chemotherapy”?Paul Ehrlich

32. Who is credited with the discovery of the first chemotherapeutic agent? What was it? What was it used to treat? Did it meet the criteria of selective toxicity? Paul Ehrlich discovered Salvarsan, which was the first chemotherapeutic antimicrobial drug used to treat Syphilis. Yes it did meet the criteria of selective toxicity.

33. How does a chemotherapeutic agent differ from an antiseptic?A chemotherapeutic agent is a chemical antimicrobial agent used inside the human body that kills or inhibits the growth of microorganisms.

34. In general, how do synthetic chemotherapeutic agents differ from antibiotics?Synthetic chemotherapeutics are man made.

35. Give examples of synthetic chemotherapeutic agents.Growth factor analogs- Sulfa drugs and IsoniazidNucleic acid base analogs- used to treat cancerQuinolones- ex. Fluoroquinolones

36. How does the sulfa drug, sulfanilamide, disrupt folic acid synthesis in bacteria?By tricking the cell into thinking it is taking up aminobenzoic acid, which is needed to make folic acid. The sulfa drug looks similar but doesn’t contain the carbon and oxygen necessary for folic acid.

37. How does isoniazid disrupt mycolic acid synthesis in Mycobacterium?The cell thinks it is taking up Nicotinamide, which is needed to make mycolic acid, but instead it picks up the Isoniazid drug, which is similar but has an extra nitrogen group, which disrupts the synthesis of mycolic acid.

38. How does 5-bromouracil alter the DNA in bacteria?5-bromouracil is a thymine analog that tricks the bacteria into thinking it is taking up thymine but instead takes up the 5-bromouracil, which will not be able to be transcribed into mRNA.

39. What is the mode of action for quinolones?Compounds that interact with bacterial DNA gyrase preventing the gyrase from supercoiling DNA.

40. What is the origin of all antibiotics?Secondary metabolites of other microorganisms

41. What term is used to describe the range of effectiveness for an antibiotic? Antimicrobial spectrum of activity

42. In general, distinguish broad spectrum antibiotics from narrow spectrum antibiotics.Broad spectrum antibiotics are effective against a wide variety of bacteria and narrow spectrum antibiotics are effective on a subset of bacteria. Beta lactam antibiotics are the most important clinical antibiotics.

43. What class of antibiotics has the broadest spectrum of activity?Beta lactam antibiotics are the most important clinical antibiotics.

44. Name an antibiotic with a narrow spectrum of activity.Polymxins- Gram-negative bacteria

45. What was the first antibiotic discovered? Who discovered it? What microorganism makes it? What microorganisms is it effective against? What class of antibiotics does it fall under?Penicillin G was discovered by Alexander Fleming. Penicillin is made by the fungus Penicilium and grew on the plate of Staphylococcus. Penicillin is effective against some Gram-negative, all Gram-positive, and some forms of Chlamydia bacteria. Penicillin belongs to the beta-lactam antibiotics.

46. Who won the Nobel Prize for mass producing penicillin G? What historical event was taking place at that time giving great significance to the mass production to penicillin G?In 1945 Alexander Fleming, Walter Florey, and Ernst Boris Chain received the Nobel Prize in medicine. World War II was going on at the time and Penicillin G saved the lives of many soldiers who received minor wounds that would have otherwise probably killed them.

47. What is the mode of action of β-lactam antibiotics? Are β-lactam antibiotics bacteriocidal, bacteriolytic, or bacteriostatic? What enzyme is capable of destroying β-lactam antibiotics with an accessible β-lactam ring?β-lactam antibiotics inhibit cell wall synthesis in bacteria by binding to transpeptidases. β-lactam antibiotics are bacteriocidal. β-lactamase is capable of destroying β-lactam antibiotics.

48. What are the 2 main types of β-lactam antibiotics?

Penicillin’s and Cephalosporin’s49. What is the origin of cephalosporin?

Made by the fungus Cephalosporium50. Name the 2 fungal-derived antibiotics.

Penicillin and Cephalosporins51. List 6 bacteria-derived antibiotics. What is the mode of action of each? What microorganisms are they effective

against?Aminoglycosides- bind to the 30s subunit of the ribosome and are effective against Gram-negative bacteriaMacrolides- bind to the 50s subunit of the ribosome and are effective against some Gram-negative, Gram-positive, and some Chlamydia bacteriaTetracyclines- bind to the 30s subunit of the ribosome and are effective against some Gram-negative, Gram- positive, Chlamydia, and Rickettsia bacteria. Vancomycin- binds to pentapeptide of the peptidoglycan precursor and are effective against Gram-positive bacteriaDaptomycin- binds to and causes depolarization of the cell membrane- disrupts proton gradient and ATP synthesis and it is effective against Gram- positive bacteriaPlatensimycin- inhibits fatty acid biosynthesis enzymes, which can inhibit cell growth and it is effective against Gram-positive bacteria, including MRSA and VRE

52. What genus of bacteria is responsible for most antibiotics? Name another genus of bacteria we get antibiotics from.Streptomyces; Amycolatopsis

53. List 5 resistant mechanisms and for each an example of an antibiotic that the resistant mechanism is used against.Reduced permeability- to reduce the uptake of the antibiotic; penicillinInactivation of antibiotic- enzymes that alter the makeup of the antibiotic; penicillinAlteration of target- affects ribosomes, DNA gyrase, RNA polymerase by changing the genetic makeup slightly so that antibiotics can’t attack the target; ErythromycinDevelopment of resistant biochemical pathway- the making of certain molecules by using resources from the environment instead of the mineral precursors that some antibiotics resemble; SulfonamidesEffux- getting rid of antibiotic out of porous membranes; tetracyclinesLack of structure- no cell wall bacteria will not be affected; penicillin

54. Describe how chromosomal mutation can make a bacterium resistant to an antibiotic.A mutation in the gene for the 30s ribosomal subunit that still allows the ribosome to function but prevents the antibiotic from binding to it.

55. Describe how resistance plasmids can make a bacterium resistant to an antibiotic.Resistance plasmids contain genes encoding enzymes that inactivate antibiotics, prevents uptake of antibiotics, and actively pumps antibiotics out of the cell.

56. Describe how a virus can make a bacterium resistant to an antibiotic.A virus can transfer DNA that has genes for resistance during the process called transduction

57. What kinds of proteins are encoded for by genes on resistant plasmids?58. If humans were not on Earth, would antibiotic resistance still occur?

Yes because bacteria still live in environments where the bacteria who produce certain antibiotics live in harmony with other bacteria that are resistant to the antibiotics they produce.

59. Having antibiotic resistance allows a bacterium to…?Survive and to pass on the antibiotic resistance to other bacterium.

60. What soil microorganisms would take over if it weren’t for other microorganisms having mechanisms of bacterial resistance?Streptomyces

61. How do humans impact microbial drug resistance?Resistance can be accelerated by the indiscriminate use of antimicrobial drugs. Humans don’t finish the doses given to them or they receive antibiotics for something that can’t be fixed by drugs.

62. Look at figure 27.28a, for which antibiotic are there more resistant fecal strains of bacteria. Explain why there are more resistant strains of bacteria to those antibiotics that are used most.Tetracycline; there are more resistant strains of bacteria to those antibiotics that are used most because the bacteria that was first introduced to these antibiotics that were resistant survived and reproduced and took the place of the susceptible bacteria.

63. How long does it take for resistant strains of a bacterium to emerge once an antibiotic is being used by the public?About 5 years

64. List at least 3 things you as a consumer of antibiotics can do to help minimize your impact on microbial drug resistance.Get a vaccinationAvoid unnecessary introduction (IV, catheters)

Wash handsAvoid contact with others

65. List at least 3 things medical physicians can do to help minimize your impact on microbial drug resistance.Target the pathogenUse least exotic antimicrobial agentFull course therapy

66. Why did pharmaceutical companies in the 1980s cut back on searching for new antibiotics? What is the lesson to be learned from this mistake?hey thought they had found enough drugs that would last forever and they didn’t think bacteria would grow resistance to these antibiotics. Bacteria strains that are resistant to antibiotics occur within five years of the introduction of the antibiotic so don’t slack.

67. Why must we continue to discover new antimicrobial compounds?There is always going to be bacteria that are resistant to antimicrobial agents so there needs to be a continuous search for new cutting edges medicines.

DIVERSITY1. How old is the Earth?

a. The earth is about 4.5 billion years old2. What is used to date the Earth to be that old?

a. Calculations, but there are rocks that date back to 3.86 billion years old. They are pillow lavas.3. Evidence for microbial life are found in rocks that date back 3.5 billion years ago.4. What are stromatolites? At what time during Earth’s history were all beaches likely covered in stromatolites?

a. Stromatolites are large groupings of cyanobacteria microorganisms growing together in rock formations. These date back to about 2.5 billion years ago.

5. What event occurred between 2.2-2.8 billion years ago? What effects did it have on the planet? What kind of microorganisms were involved?

a. The stromatolites and the oxygenic phototrophic cyanobacteria began to form large amounts of oxygen. This oxygenation oxidized the iron that was collecting in the oceans. This began the change of earth’s atmosphere from mostly carbon dioxide to mostly oxygen.

6. How did the banded iron formations form?a. Was produced due to the oxygenation of the iron in the oceans. The iron mixed with the oxygen to form

an insoluble iron oxide that sank to the bottom of the ocean.7. Was the first cell prokaryotic or eukaryotic?

a. Prokaryotic8. What theory explains the origin of the eukaryotic mitochondria and chloroplast?

a. The endosymbiosis theory9. Forming the primitive mitochondria there was symbiotic uptake of a cell with what type of metabolism?

a. The organism with a respiratory metabolism is believed to be the ancestor to the mitochondria 10. Forming the primitive chloroplast there was symbiotic uptake of what kind of cell?

a. The cell was capable of photosynthesis.11. Provide support for the mitochondria and chloroplasts having bacterial origins.

a. Mitochondria and Chloroplastsi. Have their own genomesii. Contain their own ribosomes

1. 70S like prokaryotes2. Antibodies are effective3. rRNA sequences are similar to prokaryotic rRNA

12. Describe the hydrogen hypothesis.a. The hydrogen hypothesis describles a hydrogen dependent archaea cell up taking a hydrogen producing

cell which was the precursor for the mitochondriab. Also, that a photosynthetic cyanobacterial cell was taken up to form a chloroplast

13. The sequence of what nucleic acid is compared to determine the evolutionary relationship between organisms?a. The SSU (small subunit) is used to determine evolutionary relationships.

14. Phylogenetic trees represent what type of relationship?a. A phylogenic tree represents ancestral and descendent relationships.

15. Answer the following questions using the phylogenetic tree below.a. To which organism is B most closely related?

i. Ab. To which organism is C most closely related?

i. Bc. Which organism is the most recent descent from the ancestor at internal node 2?

i. B

d. Which organism could be the outgroup?i. E because it is the least related to the rest.

16. Traditionally what phenotypic analyses were done to compare organisms? Are these still used today?a. Traditional analysis was done in the lab, checking morphology, motility, metabolism, physiology, cell

chemistry, and other traits like pigment and antibiotic sensitivity.17. Use information on GC ratio, DNA:DNA hybridization and 16S/18S rRNA sequence to answer the following

questions.a. What are the criteria for determining an organism is a new genus?

i. Having no more than 25% DNA in a hybridization match up.b. What are the criteria for determining an organism is a new species?

i. Having more than a 5% difference in GC ratio, and having less than 70% DNA matchup during hybridization.

18. What is the GC ratio of an organism?a. The GC ration is the percent of guanine plus cytosine in an organism… Also, the higher the GC ratio the

higher the denaturing temperature.19. What is the principle behind DNA:DNA hybridization?

a. DNA:DNA hybridization is the idea that the DNA of a known species can be denatured and mixed with the denatured DNA of an organism believed to be of the same species, and when mixed 70 to 100% of the two DNA should mix if they are in fact the same species.

20. An endoribonuclease is an enzyme that digests (cuts) RNA. For what test would this be used?a. This enzyme can be used in ribotyping.

21. In ribotyping, if you see the same pattern of bands on gel for your organism and the positive control organism, then what would be your conclusion?

a. My conclusion would be that the two organism are from the same species.22. How does multilocus sequence typing differ from 16S/18S rRNA sequence comparision? What is it useful for

distinguishing between?a. This test compares between the so called housekeeping genes. These genes are those that every living

thing must have to survive, like DNA polymerase, DNA gyrase… This test is useful for determining between different strains of the same species (Staph mutans/ staph pyrogen)

23. What is a biochemical analysis that will allow you to distinguish between two organisms?a. The Fatty Acid Methyl Ester (FAME) can be used to identify an organism from those in the database.

24. Can determining the fatty acid composition of an organism be useful in identifying the organism?a. Yes

25. List the taxonomic hierarchy.a. Domain, phylum, class, order, family, genius, species

26. What 2 things must a scientist do in order for a newly identified microorganism to be formally recognized by the scientific community?

a. The organism must have its name and description published into IJSEMb. Must have a sample of the organism in two international culture collections (so others can use the

organism to study)

HOST MICROBE INTERACTIONS1. Prior to birth, in the womb, were you sterile?

a. Yes2. Where do the microorganisms come from that first colonize a newborn human?

a. The microbes come from the air, the food/milk/water, and from physical contact with people.3. What decides which microorganisms become resident flora for the newborn human?

a. Competition between microorganisms decides which become resident flora.

Node 2

4. Where does the Escherichia coli come from that colonizes the gastrointestinal tract? Why would a newborn baby in a developing country likely be colonized by E. coli much sooner than a newborn baby in the United States or other developed nation?

a. The E. Coli comes from those who are physically touching the child, they will pass it on by not washing their hands well enough after using the bathroom.

b. Other countries aren’t as health conscious or as sanitary as the united states, so these E. Coli cells are passed to the child early on.

5. Do human pathogens colonize a newborn? What prevents them from causing disease? What would allow them to cause disease?

a. Yes, human pathogens can colonize a newborn.b. Most newborns are vaccinated for the most common disease causing pathogens for newborns. If a child

were not vaccinated it would have a chance of suffering from a disease.6. Distinguish between infection and disease.

a. Infection – any situation in which a microorganism is established and growing in a hostb. Disease- is damage or injury to the host that impairs host function.

7. Where does infection begin? Where on the human body can you find places like this?a. Infection begins on the mucosal surfaces (mouth, nose, ears….)

8. What prevents all places and surfaces of the human body from being colonized by microorganisms?a. Some microorganisms can’t survive with the variables of the area. (pH, salt levels, heat…)

9. Name four places in the human body that are sterile (microbe-free).a. The human organs should all be sterile from microbes… Heart, brain

10. Where on the skin do microbes colonize? In what ways are these places similar to mucosal surfaces? Why is the surface of the epidermis microbe free except for the occasional transient?

a. Microbes live on the superficial layers of the epidermis and are also located near hair follicles. b. The surface is mostly microbe free because the top layer is to dry and acidic for them to survive, and are

easily washed off.11. What glands are responsible to harboring microbes that cause body odor?

a. The sebaceous glands (around the face and forehead) The eccrine glands (sweat), and the aporine glands

12. List the 4 most commonly found microbial genera resident of the skin. Are these Gram-positive or Gram-negative? Which is the cause of acne?

a. The most common are Staphylococcus, Micrococci, Streptococcus… all gram positiveb. Staph causes acne

13. Are the majority of skin microflora resident or transient?a. Majority of skin mircoflora are resident.

14. What Gram-negative bacterium commonly colonizes the skin?a. Most common gram-negative bacteria include Enterobacter, E.Coli, and Acinetobacter.

15. List environmental and human host factors that influence skin microflora composition.a. Factors that influence composition include the temperature and moisture levels of skin, or the

environment around the skin, the age of the host, personal hygiene. 16. Upon entering your mouth perhaps on a piece of food, a bacterium would be exposed to what in your saliva that

could destroy the bacterium? How could a microbe survive exposure to the enzymes in your saliva to make it to your stomach?

a. The human mouth contains an enzyme that breaks down the bacteria wall causing death to the cell. 17. How does the microflora of the mouth differ before and after tooth formation?

a. The microbes that form after tooth formation thrive on the calcium of teeth. They attempt to decalcify the teeth so they can use it to grow.

18. What are the main microbes to colonize the mouth prior to tooth formation? After tooth formation? Why is there a change in the microflora before and after tooth formation?

a. Before teeth formation there are aerotolerant anaerobes: like Streptococcus and Lactobacillusb. After Teeth formation anaerobes grow: like Actinomyces, Bacteroides, Spirochetes, Streptococcus

19. What are biofilms on the surface of teeth called?a. Tooth biofilms are called plaque

20. Describe how Streptococci form dental plaque and provide for other microbes to join the biofilm.a. Streptococcus mutans use the saliva glycoprotein layer on teeth for attachment

21. Explain how anaerobic microbes predominant the mouth despite their being a constant influx of oxygen from breathing.

a. Anaerobes don’t require oxygen to survive. They use fermentation to produce energy, if there is leftover food in the mouth bacteria can use it as a carbon source to break down and ferment.

22. How does dental plaque result in dental caries?a. Dental plague is a buildup of bacteria, these bacteria produce organic acids, which decalcify tooth

enamel.

23. Upon ingestion of sucrose, describe how Streptococci form dental caries.a. Streptococci produce dextran polysaccharides that allows for attachment of more strep and any other

microbes that live in the mouth.24. How can dental caries be prevented? What can be used to clean the surface of teeth? What can be used to

clean between teeth and in the gingival crevices?a. They can be prevented by good hygiene practices. Like the use of fluoride, brushing teeth, and flossing

to clean gingival crevices.25. How does fluoride help prevent dental caries?

a. Fluoride helps by remineralizing teeth, from the normal break down.26. What 2 species of Streptococci primarily colonize teeth?

a. Streptococcus mutans and Streptococcus sanguis27. If there were no more toothbrushes or dental floss or fluorine left on Earth, what could Americans do to prevent

dental caries?a. Americans could cut down sugar intake, chew sugarless gum, have sealants, use mouthwash.

28. Find 2 things you eat or drink regularly that contain sucrose. (Read the label of your food/drink to determine if is has sucrose or look up the food/drink online.)

a. Junk foods, soda29. Would dental caries be considered infectious disease? Why?

a. Infectious diseases are caused by pathogenic disease causeing bacteria. So according to this definition yes, tooth issues can be infectious diseases.

30. How does the microflora that colonizes your gastrointestinal tract get there in the first place?a. They are picked up from other individuals

31. What organ is a chemical barrier to microbial growth?a. Gastric Acid

32. What makes the stomach unfriendly to microbes?a. The stomach is highly acidic

33. What is the most common microbe found in the stomach?a. The most common microbe is Helicobacterpylori .

34. Besides pH what factor influences the stomach microflora composition? Do beef-eaters and vegetarians have the same microflora?

a. No there is a difference between the two and their microflora.35. What is the primary difference between the stomach and the end of the small intestine that allows for larger

numbers of microbes to be present in the small intestine?a. The primary difference between the stomach and small intestine is the increase in the pH in the small

intestine making it easier for microbes to live.36. What is the oxygen requirement for most microbes living in the small and large intestines?

a. Most microbes in the small and large intestines are obligate anaerobes. Don’t need oxygen, the number of microbes increases into the large intestine.

37. Are the small and large intestines oxic or anoxic environments?a. Anoxic or lacking in oxygen

38. What is another name for the colon that tells you what the microbes are metabolically doing there?a. The organisms are anaerobic

39. How much bacteria per gram of fecal content is in the colon?a. 1/3 of the fecal material is bacteria.

40. The symbiotic relationship humans have with some of their intestinal flora is mutualistic. How do each benefit?a. The intestinal flora break down some of the food particles that the human body cannot so it can absorb

them, the human eats and supplies the bacteria with a food and energy supply. 41. Name 4 gases produced by microorganisms in the human intestine? Do any of these have an odor?

a. Methane, carbon dioxide, and hydrogen… Yes42. Back in human time before fire, did humans contribute to global warming?

a. No43. What percentage of feces is bacteria? Are the bacteria dead or alive or some of both?

a. Feces are 1/3 bacteria….. Both44. Is the large intestine like a batch culture or a chemostat?

a. Chemostat, because things are always going in and out, and it is never the same thing over and over.45. What is the growth rate of bacteria in the intestine lumen?

a. The growth rate is about 1-2 divisions a day.46. 10,000,000,000,000 What does this number represent?

a. 10^13 number of microbes in or on human body.47. Describe what antibiotics do to your intestinal microflora

a. Antibiotics inhibit the growth of the normal mircoflora, it causes the loss od antibiotic-susceptible tract.

48. Due to proximity to the exit of the gastrointestinal tract, many microbes that inhabit the gastrointestinal tract find their way to what other area of the body?

a. They enter the Urogenital tract.49. What part of the urogenital tract is sterile? What part is colonized?

a. The bladder is sterile, the urinary tract is partially colonized by bacteria.50. What lactic acid bacteria used to make yogurt is resident flora of the human female vagina? How does this

microorganism affect the pH of the vagina? During the lifetime of a human female when would Lactobacillus acidophilus expect to be resident of the vagina?

a. Lactobacillus acidophilus, this organism decreases the pH. It would be expected to live there from puberty to menopause

51. How do birth control pills effect the pH of the vagina? What are the microbial consequences?a. The birth control pill allows for the increase in growth of cells, thus making the area an inhospitable place

for a baby to grow.52. What part of the respiratory tract is sterile?

a. The trachea, bronchi, and lungs53. What 2 opportunistic pathogens often colonize the upper respiratory tract? Why do they not cause disease most

of the time?a. Flu, and streptococcus bacteria, most of the time the body naturally fights them off.

54. What type of cells line the respiratory tract? How do these cells help prevent microbes from reaching the lower respiratory tract?

a. Mucus cells and other resident flora take up residence so that the pathogens cannot get to the lower respiratory system.

55. Smoking damages the ciliated epithelium of the respiratory tract. What occurs due to this loss of function? Smokers cough in an attempt to do what? Are smokers more susceptible to microbial infections of the lower respiratory tract?

a. This loss of function opens up the possibility for pathogenic microbes to enter the respiratory system. They cough in an attempt to expel the microbes from settling in and colonizing. Smokers are more likely to get lower respiratory infections.

56. Following exposure to a pathogen, list the events of pathogenesis.a. Adherenceb. Invasionc. Colonized. Damage

57. List 4 adherence factors and an example of each.a. Adhesin- A surface structure or macromolecule that binds a bacterium to a specific surfaceb. Mucous- the mucopolysaccharide layer of glucosaminoglycans covering animal cell mucosal surfacesc. Biofilm- exopolysaccharide or slime produced by bacteria that attaches imbedded cells to a surfaced. Receptor-A complementary macromolecular binding site on a (eucaryotic) surface that binds specific

adhesins or ligands58. Describe invasion.

a. Invasion is the process of a pathogen infecting the body.59. Colonization is also known as microbial _growth_. Is microbial colonization dependent on location in the body?

a. Yes60. What type of virulence factors are siderophores?

a. Toxin61. Distinguish between localized and systemic bacterial infection. Which would be easier to treat with antibiotics?

a. Localized bacterial infection is a simple infected cut or scrap on a small part of the body, very easy to heal. A systemic infection is an infection throughout the entire body, usually causing death.

62. Is bacteremia a localized or systemic infection?a. Bacteremia is the bacterial infection of the blood, which is systemic.

63. Adherence, invasion, colonization are the steps describing infection. To cause disease what must happen?a. To cause disease the bacteria must cause damage through toxicity or invasiveness

64. Define toxicity and give an example of a toxin causing disease.a. Toxicity is the degree to which a substance is able to cause damage. The Clostridium tetani produces an

exotoxin that causes tetanus.65. Define invasiveness and give an example of an invasive factor helping a microorganisms cause disease.

a. Invasiveness helps the pathogen to invade the host tissue, an example is that Clostridium hyaaluronidase breaks down hyaluronic acid that holds the cell together.

66. What is the lethal dose50?a. Lethal dose50, is the median lethal dose, its the dose that needed to kill half of the population.

67. How many cells of a virulent human pathogen like Streptococcus pneumoniae are needed to kill?a. 100 cells kills a mouse

68. Describe the phenomenon of attenuation. How does a virulent strain become attenuated? Is an attenuated strain still deadly?

a. Attenuation is the process of taking a pathogen and reducing it to a less harmful or harmless form and used in a vaccine. The organism is cause to infect a foreign host. This will create a small change in the organism but making it less harmful to humans. This attenuated strain can cause some symptoms but is no longer dealy.

69. Viruses and bacteria can be attenuated. Attenuated viruses are given as vaccines of common childhood viruses that are deadly or that cause major harm to the human body.

70. What makes Salmonella such a virulent pathogen?a. Salmonella uses a variety of virulence factors to cause disease.

71. Distinguish between exotoxins, enterotoxins and endotoxins.a. Exotoxins- toxins that are secreted by living cellsb. Enterotoxins- are exotoxins that affect the small intestine, causing changes in intestinal permeability that

lead to diarrheac. Endotoxins- toxic bacterial structural component released upon bacterial death

72. Describe what a cytolytic exotoxin does to be toxic and give an example of cytolytic toxin.a. Cytolytic extotoxins cause the lysis of host cells, ex) Streptolysin O produced by Streptococcus

73. Describe how an AB exotoxin is toxic and give 3 examples of an AB exotoxin.a. An A-B toxin is composed of two proteins covalently bounded

i. The B subunit binds to the host cell and transfers the A subunit into the host cell to cause damage

ii. Ex.) Diptheria toxin produced by Corynebacterium diptheriae disrupts protein synthesis Tetanus toxin produced by Clostridium tetani prevents muscle relaxation Botulinum toxin produced by Clostridium botulinum inhibits muscel contraction

74. Describe how an enterotoxin is toxic and give 2 examples of enterotoxins. What is the main symptom associated with disease caused by an enterotoxin?

a. This toxin causes intestinal permeability problems, causing diarrhea.i. Vibrio cholera causes cholera toxin

75. Describe how an endotoxin is toxic and give an example of an endotoxin. What group of bacteria produce endotoxins?

a. Endotoxins are released upon death of gram-negative bacteria, causes fever. i. Ex.) Lipopolysacchardies derived from the outer membrane of gram-negative bacteria

76. List 4 risk factors that increase a person’s susceptibility to infection.a. Age, Stress, Diet, Lifestyle, and General health (sleep)

77. List 8 barriers that provide natural resistance to infection by pathogens. (see fig. 28.25)a. Lysozymes- in tears dissolve cell wallsb. Normal flora-creates competitionc. Skin-physical barrierd. Stomach- low acidicty/pHe. Flushing out of urinary tract decreases growthf. Mucus prevents attachment and growth

78. Provide an explanation for Clostridium tetani causing tetanus if introduced into a deep puncture wound but not causing any harm if ingested.

a. If the organism gets into a cut it thrives, however if it were ingested it would have to go through the acidic saliva, and stomach, and compete for room in the intestines which it isn’t likely it will get. But in the blood it can thrive and infect.

79. Provide an explanation for Salmonella causing gastroenteritis if ingested but not causing any harm if introduced in a puncture wound.

a. Salmonella is an anaerobe meaning it prefers no oxygen around, so it can thrive and grow in the intestinal tract, it cannot however infect anything if it were in a puncture wound because blood holds lots of oxygen.

80. Provide an explanation for why a mosquito can transmit malaria but a cockroach cannot.a. Malaria grows in blood, mosquito thrive on blood, having the ability to bite and pass it on the others.

Cockroaches don’t bite humans.81. Provide an explanation for why HIV is harmless on your skin but potentially lethal in your blood.

a. HIV cannot survive outside of the body, it needs a host cell to live.

Immunology

1. Name the leukocytes.Myeloid precursors, lymphoid precursors, monocytes, dentric cells, macrophages, granuolocytes, neutrophils, mast cells, T-cells, B-cells, plasma cells

2. Name the phagocytes.Dentric cells, monocytes, macrophages, neutrophils, mast cells

3. Name the lymphocytes.B-cells, T-cells, plasma cells

4. Where do all leukocytes come from?Bone marrow

5. What body fluid systems transport immune cells throughout the body?Blood stream and lymphatic system

6. What is the first line of internal defense against pathogens?Innate immunity (non specific immunity) (natural killer lymphocytes, phagocytes)

7. What do Natural Killer cells do? How do they kill?Find virus, bacterium, and tumor cells, Preforin and grandzymes

8. What do phagocytes do in innate immunity?Recognize pathogens, phagocytosis, and lysozme fuse with phagosome

9. What do phagocytes have on their cell surface to recognize pathogens?Phagocyte pattern recognition molecules (PRMs)

10. What part of a pathogen is recognized by a phagocyte?Pathogen pathogen associated molecular patterm (PAMP, ex. Lps, peptidoglycan, flagellin, etc)

11. What immune response precedes the adaptive immune response?12. What signaling proteins from the innate immune response activate B and T cells?13. Describe the events that take place following a macrophage encountering a foreign protein.14. What part of Gram-negative bacteria stimulates an immune response?15. Tumor necrosis factor-alpha (TNF-alpha) and interleukin-1 (IL-1) are what type of signaling proteins?16. What can happen if too much TNF-alpha and IL-1 are made?17. To what Drosophila melanogaster protein is part of IL-1 similar?18. What do Toll proteins do in Drosophila?19. Are there any Toll-like proteins in human in which the full-length human protein is similar to Toll?20. What does the acronym TLR stand for? 21. How many human TLRs are there?22. Where are TLRs located?23. What does TLR2 recognize? 24. What does TLR3 recognize? 25. What does TLR4 recognize? 26. What does TLR5 recognize?27. In general, what do TLRs recognize?28. Name 6 other organisms besides humans that have an innate immune response.29. What immune cells have Toll-like receptors?30. What would a mutation in TLR4 that abolishes TLR4 activity prevent an immune cell from doing?31. A drug that is a TLR4 activator would be capable of doing what to the inflammatory response?32. What potential is there in inhibiting TLRs for treating certain autoimmune diseases?33. What positive effect would a TLR inhibitor have on someone with an autoimmune inflammatory disease like

rheumatoid arthritis? 34. What negative effect would a TLR inhibitor have on someone with an autoimmune inflammatory disease like

rheumatoid arthritis? 35. How could activating TLRs aid in making a more effective vaccine? 36. What is an adjuvant?37. What would be a negative consequence of activating TLRs?38. Is phagocytosis sufficient to kill a pathogen? What does the phagocyte do to kill the pathogen?

No, Secretes enzymes to digest pathogen in phagolysosome (aka phagosome after lysosome is attached)39. What is a lysosome? What proteins are found inside a lysosome? What are these proteins use for? What other

molecules are in the lysosome that are used to damage pathogens?Vesicle filled with toxic oxygen products to digest bacteriaDigestive enzymes (H2O2, lysozyme, proteases, phosphatases, nuclease, and lipases)Digest bacteriaToxic oxygen products

40. Why are the contents of a lysosome contained within the lysosome instead of free in the cytoplasm of the phagocyte? To protect from DNA transduction or conjugation

41. What reaction follows phagocytosis?inflammation

42. Is inflammation harmful or helpful to the immune response?

Help (inflammation caused by cytokines and especially chemokine to attract macrophages), can be harmful when inflammation widespread

43. What cells make chemokines?neutrophils

44. Chemokines are chemoattractants. What do they attract?macrophages

45. What cells make cytokines? What is an example of a cytokine?Macrophages, interleukin

46. What do cytokines do? Contribute to all symptoms of inflammation

47. In what ways can a pathogen protect itself from phagocytosis?Pigments to neutralize singlet oxygen (carotenoids, protect from enzymes in lysosome)Molecules scavenge toxic oxygen (special cell wall glycolipids, protect from being destogyed in macrophages)Leukocidins (kill phagocyte)Capsule (prevents adherence of phagocyte to bacterial cell)

48. List the 3 properties of adaptive immunity and give an example of each.Specificity, memory, and tolerance

49. Explain the T-cell selection process.Positive- select for cells that react with selfNegative- kill cells that react too strongly with self

50. What T-cell characteristics are selected for in the thymus? React with self but not too strongly

51. Who coined the term autoimmunity?52. What cells are proactive in helping the body get rid of immune cells that inappropriately interact with the body’s

own tissues?53. What were T-regs originally named before they were even identified as CD25+ regulatory T cells? How was this

original name descriptive of what the T-regs do?54. What cytokine promotes T-reg function?55. What transcription factor is found in abundance in T-regs?56. Mutant mice with an inactive Foxp3 protein also lack what type of immune cell?57. If humans have a mutant Foxp3, what is the outcome? Does it matter if you are male or female? Why?58. Absence of T-regs causes what disease in mice? 59. In your intestines, what organisms do T-regs allow your body to tolerate?60. Chronic infection by Helicobacter pylori in the stomach could be from what action of T-regs?61. How might T-regs play a role in pregnant women in helping to protect the development fetus?62. What level of T-reg activity could be a cause of spontaneous abortion?63. Describe how T-regs could be used to help organ transplantation? (see fig.)64. Removal of some T-regs holds promise as a therapy for what kind of diseases?65. List 2 challenges to the developing medicines targeted at T-regs. How are these challenges being overcome?66. Is it possible to turn ordinary T-cells into T-regs? How?67. What type of leukocytes are involved in cell-mediated immunity?

Macrophages and dendric cells68. What type of T-Cells are involved in cell-mediated immunity?

Cytotoxic and helper 169. What type of leukocytes are involved in antibody-mediated immunity?

B cells70. What type of T-Cells are involved in antibody-mediated immunity?

Helper 271. When would T-cytotoxic cells be used?

When mchI on regular cell presents antigen72. What type of MHC protein is recognized by a T-cytotoxic cell?

MHC I73. When would T-helper 1 cells be used?

When macrophage or dendritic cells present antigen on MHC II74. What type of MHC protein is recognized by a T-helper 1 cell?

MCHI75. When would T-helper 2 cells be used?

When b-cell is presenting antigen76. What type of MHC protein is recognized by a T-helper 2 cell?

MCH277. Describe the events that take place when a T-cytotoxic cell is activated.

Apoptosis of target cell

Effector cell- apoptosis, memory- stays around to recognize future infections78. Describe the events that take place when a T-helper 1 cell is activated.

Signals for help from other macrophages Effector- carry out normal t cell functionsMemory- stay around for future infections

79. Describe the events that take place when a T-helper 2 cell is activated.Signals homologous b cells to turn into plasma cells and begin making antibodies; also create memory cells

80. What do MHC proteins, T-cell receptors and antibodies all have in common?All recognize eachother; similar structure; one constant region and one variable region

81. What are the 5 classes of antibodies? How is each defined?Made of four polypeptides; two heavy chains and two light chains; variable regions and constant domains; antigens bind to variable region; named after type of heavy chainIgG- major antibody, crosses placentaIgA- predominant antibody in secretions (saliva, breast milk, intestinal fluid); first response to viral infactionsIgM – first class ofantibody in response to infectionIgD- low concentration, functionally similar to IgMIgE- low concentration, but responsible for allergic reactions

82. What are kappa and lambda? Heavy chain types; constant region is either kappa or lambda

83. How are the light chains and heavy chains of an antibody connected?Disulfide linkages

84. How many types of antibodies are made by a single B cell?85. Overall, how many types of antibodies are possible to make?86. Describe the antibody-mediated immune response that occurs the first time you are exposed to an antigen.

B-cell receptor finds antigen, internalized, antigen displayed on MCH2; TH2 binds to MCH2 and releases cytokines that signal other b-cells with same receptors to make and release antibodies

87. What types of cells are made in response to initial antigen exposure? What do these cells do?Both memory and plasma cells, Memory is waiting for next exposure to antigenPlasma- makes free antibodies

88. How do plasma cells differ from memory cells?Plasma cells make free antibodies; memory cells have antibodies anchored to the actual cell

89. Describe the antibody-mediated immune response that occurs the second time you are exposed to an antigen. How does this differ from the initial antigen exposure immune response?Faster, doesn’t require t-cells, primary response not necessary

90. Describe the antibody-mediated immune response that occurs the third, fourth, fifth, etc. time you are exposed to an antigen.Immunity begins to decrease over time after secondary response; only have certain window that secondary immune response will work; after time memory cells die

91. Describe what the antibodies released from plasma cells do.Free antibodies; bind to antigen and signal classical complementary protein response; or increase phagocytosis

92. What are complement proteins used for?Destroy pathogens

93. What immune responses use complement proteins?Innate and adaptive (all basically)

94. Describe classical complement activation.Requires antibodies; antibodies signal for complement proteins to come and attach1. Antibody binds antigen and complement protein2. Sequential binding of other complement proteins3. Bacterial cell membrane damage and cell lysis95. Describe alternate complement activation.Does not require antibodies1. Host serum proteins (regularly found in blood) bind to bacterial cell surface2. C3 binding enhances phagocytosis96. How do the classical and alternative complement activation pathways differ? How are they the same?

Don’t both use antibodies, Both use complement proteins97. Define hypersensitivity with regard to the immune system.

Inappropriate immune response resulting in host damage98. Describe the four types of hypersensitivities.

I,II,III,IV99. Why is Type I called immediate hypersensitivity?

Occurs within minutes of secondary antigen exposure100. What common name is used to describe a Type I hypersensitivity?

Anaphylactic shock101. What name is given to the antigen that elicits a Type I hypersensitivity?

Allergen (allergens are not pathogens)102. What occurs during initial allergen exposure? (see fig. 30.5)

regular response103. What occurs during second and subsequent allergen exposure? (see last part of fig. 30.5)

mast cell recognizes allergen and releases molecules that cause allergy symptoms104. Name some things that can be done to treat the symptoms of an allergic response.

Removal of allergenAntihistamines to neutralize histaminsSteroids to reduce inflammationAdrenalin to counter effects of histamines/seretoninDesensitization- immunization with increasing does of allergen to shit antibody froduction from IgE to IgE

105. Why is Type IV also known as delayed hypersensitivity?Response occurs one to two days after secondary antigen exposure; poison ivy; driven by TH cells

106. How does Type IV differ from Type I hypersensitivity?Takes more time to happen

107. Are antibodies involved in a Type IV hypersensitive response?108. What is main symptom associated with a Type IV hypersensitive response?109. Can a pathogen elicit a hypersensitive response?110. Name at least 3 things that can elicit a Type IV hypersensitive response.111. What do Type II and III hypersensitivities have in common?112. Describe what occurs during a Type II hypersensitive response.113. Describe what occurs during a Type III hypersensitive response.114. What class of hypersensitivities do drug reactions (for example to penicillin) fall under?115. What are superantigens?

Secreted by microbes; elicit overreactive immune response116. How do superantigens elicit an abnormal immune response?

Bind to common parts of APC molecules and cause more TH cells than normal; causing too much cytokine; causing systemic inflammation

117. What is the main symptom associated with superantigen exposure?118. Compare and contrast active and passive immunities.

Active- your own body elicits response to pathogenPassive- use antibodies from alternate source other than you own body

119. Compare and contrast natural and artificial active immunities.Natural active immunity- your natural response to antigen, nothing addedArtificial active immunity- vaccine

120. Compare and contrast natural and artificial passive immunities.Natural passive immunity- antibodies passed from mother to childArtificial passive immunity- antibodies introduced via shot

121. What type of immunity do vaccinations provide? (active, passive, natural, artificial)Active artificial,

122. What did the English physician Edward Jenner do?123. Describe the concept of herd immunity. 124. What percentage of the population needs to be vaccinated to have herd immunity to measles?125. Describe 7 kinds of vaccines.126. Which vaccines contain no live pathogens?127. Which vaccines contain live pathogens?

Microbial Diseases

1. Perhaps make a table to answer these questions:a. To what diseases are we vaccinated against in early childhood? b. What causes each of these diseases? c. How are these pathogens transmitted?d. How does the pathogen cause disease? (virulence factors)e. What immune response (innate, cell-mediated, antibody-mediated, innate and cell-mediated, innate and

antibody-mediated, all three) is there to these pathogens?2. Many airborne-transmitted pathogens cause what type of infections?