Bioinformatics analysis and characterization of …...2017/10/23 · 104 PVA -degrading operon ( pva ) (11, 12 ). Furthermore, application of effective 105 PVA -degrading enzymes

1

Bioinformatics analysis and characterization of highly efficient 1

polyvinyl alcohol (PVA)-degrading enzymes from the novel PVA 2

degrader Stenotrophomonas rhizophila QL-P4 3

4

Yahong Weia#

, Jing Fub, c#

, Jianying Wua#

, Xinmiao Jiad#

, Yunheng Zhoua#

, Cuidan 5

Lib, c

, Mengxing Dongb, c

, Shanshan Wangb, c

, Ju Zhangb*

, Fei Chenb, c, e*

6

7

College of Life Sciences, Biomass Energy Center for Arid and Semi-Arid Lands, 8

State Key Laboratory of Crop Stress Biology for Arid Areas, Northwest A&F 9

University, Yangling, Shaanxi, Chinaa ; CAS Key Laboratory of Genome Sciences & 10

Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, 11

Chinab; College of Life Sciences, University of Chinese Academy of Sciences, 12

Beijing, Chinac; Central Research Laboratory, Peking Union Medical College 13

Hospital, Peking Union Medical College & Chinese Academy of Medical Sciences, 14

Beijing, Chinad; Collaborative Innovation Center for Genetics and Development, 15

Shanghai, Chinae. 16

17

Running title: PVA degradation by Stenotrophomonas rhizophila QL-P4 18

19

#These authors contributed equally to this paper as the first authors.

20

AEM Accepted Manuscript Posted Online 27 October 2017Appl. Environ. Microbiol. doi:10.1128/AEM.01898-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.

on Novem

ber 23, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

*Address correspondence to Fei Chen or Ju Zhang, [email protected] or 21

[email protected]. 22

23

Abstract 24

Polyvinyl alcohol (PVA) is used widely in industry, and associated environmental 25

pollution is a serious problem. Herein, we report a novel, efficient PVA degrader, 26

Stenotrophomonas rhizophila QL-P4, isolated from fallen leaves from virgin forest in 27

the Qinling Mountains. The complete genome was obtained using single-molecule 28

real-time (SMRT) technology and corrected using Illumina sequencing. 29

Bioinformatics analysis revealed eight PVA/OVA (vinyl alcohol oligomer)-degrading 30

genes. Of these, seven genes were predicted to be involved in the classical 31

intracellular PVA/OVA degradation pathway, and one (BAY15_3292) was identified 32

as a novel PVA oxidase. Five PVA/OVA-degrading enzymes were purified and 33

characterised. Among which, BAY15_1712, a PVA dehydrogenase (PVADH), 34

displayed high catalytic efficiency towards PVA and OVA substrate. All reported 35

PVADHs only have PVA-degrading ability. Most importantly, we discovered a novel 36

PVA oxidase (BAY15_3292) that exhibited highest PVA-degrading efficiency than 37

the reported PVADHs. Further investigation indicated that BAY15_3292 plays a 38

crucial role in PVA degradation in S. rhizophila QL-P4. Knocking out BAY15_3292 39

resulted in a significant decline in PVA-degrading activity in S. rhizophila QL-P4. 40

Interestingly, we found that BAY15_3292 possesses exocrine activity, which 41

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

distinguishes it from classical PVADHs. Transparent circle experiments further 42

proved that BAY15_3292 greatly affects extracellular PVA degradation in S. 43

rhizophila QL-P4. The exocrine characteristics of BAY15_3292 facilitate its potential 44

application to PVA bioremediation. In addition, we report three new efficient 45

secondary alcohol dehydrogenases (SADHs) with OVA-degrading ability in S. 46

rhizophila QL-P4, compared with only one OVA-degrading SADH as reported 47

previously. 48

49

Importance 50

With the widespread application of PVA in industry, PVA-related environmental 51

pollution is an increasingly serious issue. Because PVA is difficult to degrade, it 52

accumulates in aquatic environments and causes chronic toxicity to aquatic organisms. 53

Biodegradation of PVA, as an economical and environment-friendly method, has 54

attracted much interest. To date, effective and applicable PVA-degrading bacteria/ 55

enzymes have not been reported. Herein, we report a new efficient PVA degrader (S. 56

rhizophila QL-P4) that has five PVA/OVA-degrading enzymes with high catalytic 57

efficiency, among which BAY15_1712 is the only reported PVADH with both PVA- 58

and OVA-degrading abilities. Importantly, we discovered a novel PVA oxidase 59

(BAY15_3292) that is not only more efficient than other reported PVA-degrading 60

PVADHs, but also has exocrine activity. Overall, our findings provide new insight 61

into PVA-degrading pathways in microorganisms, and suggest S. rhizophila QL-P4 62

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

and its enzymes have potential for application to PVA bioremediation to reduce or 63

eliminate PVA-related environmental pollution. 64

65

Keywords: Stenotrophomonas rhizophila; single-molecule real-time (SMRT); 66

PacBio; polyvinyl alcohol (PVA); vinyl alcohol oligomers (OVA); biodegradation; 67

high-throughout sequencing; environmental microorganism. 68

69

Introduction 70

Polyvinyl alcohol (PVA) is a water-soluble synthetic polymer with excellent 71

physical properties such as thermostability, viscosity, film-forming, emulsifying, 72

tensile strength and flexibility (1). PVA has been widely used in coatings, adhesives, 73

films, and emulsion polymerisation (1). According to the Grand View Research (GVR) 74

market analysis, the global PVA market size was estimated at 1.124 million tons in 75

2016, almost half of which was consumed in China 76

(http://www.grandviewresearch.com/). 77

With the widespread use of PVA in multiple areas such as textiles, foods, medicine, 78

industry, construction and chemicals, associated environmental pollution has reached 79

serious proportions (2, 3). PVA is difficult to degrade in natural environments (4, 5), 80

hence it accumulates, especially in aquatic environments, where it poses a risk by 81

inducing hypoxia and metal poisoning, and causes chronic toxicity to aquatic 82

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

organisms. Consequently, it harms the entire food chain (1, 2). It is therefore urgent to 83

develop effective methods for PVA degradation and bioremediation. 84

At present, PVA industrial degradation methods mainly include physical-chemical 85

degradation and biodegradation (6). Since physical-chemical degradation has several 86

drawbacks such as low efficiency, high cost, and secondary pollution (5), 87

biodegradation (including microbial and enzymatic degradation) is attracting 88

increasing interest due to its economic and environmental protection advantages (7). 89

Two PVA biodegradation mechanisms are present in bacteria: intracellular and 90

extracellular degradation (1). Intracellular degradation plays a major role in PVA 91

biodegradation, whereas extracellular degradation plays a secondary role (1). In 92

intracellular degradation, PVA (or partially depolymerised PVA) is assimilated into 93

the periplasm where it is oxidised by intracellular PQQ-dependent PVA 94

dehydrogenase (PVADH) with cytochrome C as an electron acceptor (the first step), 95

then hydrolysed by oxidized PVA (oxiPVA) hydrolase (OPH) (8) or β-diketone 96

hydrolase (BDH) (9). In extracellular degradation, PVA is oxidised by secreted 97

secondary alcohol oxidase (SAO; first step) with O2 as an electron acceptor, and 98

oxiPVA is hydrolysed by secreted BDH (second step) (9). 99

Although the biodegradation characteristics of PVA have been known for a long 100

time (10), our knowledge of microbial and enzymatic degradation of PVA is 101

insufficient, and currently limited to Pseudomonas and Sphingomonads (1), of which 102

only Sphingopyxis sp. strain 113P3 has been precisely characterised in terms of its 103

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

PVA-degrading operon (pva) (11, 12). Furthermore, application of effective 104

PVA-degrading enzymes has been hampered by the fact that PVADH is expressed 105

mainly in inclusion bodies, with only a small amount in the supernatant or secreted 106

into the culture medium (13). 107

Due to limitations of DNA sequencing, the genome of only a single 108

PVA-degrading strain (Sphingopyxis sp. 113P3) has been completed (14), which has 109

impeded the in-depth mechanistic analysis of PVA biodegradation. However, the 110

rapid development of high-throughput DNA sequencing technologies offers 111

opportunities for discovering new PVA-degrading bacteria and enzymes. In 112

particular, single-molecule real-time (SMRT) DNA sequencing developed by Pacific 113

Biosciences is more suitable for bacterial genome sequencing and assembly than other 114

methods due to advantages including a longer average read length and no GC bias 115

(15). 116

Herein, we report the complete genome of a novel PVA-degrader, 117

Stenotrophomonas rhizophila QL-P4, determined using SMRT DNA sequencing, and 118

assess its PVA degradation ability. Based on sequence alignment with genes 119

reportedly involved in PVA degradation (11, 12, 16-19), we identified eight 120

PVA/OVA-degrading genes in the genome (OVA is one of the products of PVA 121

degradation (20)). Five of these enzymes (two PVADHs and three SADHs) were 122

purified and characterised, and enzyme kinetics experiments showed that all could 123

efficiently degrade PVA/OVA. Importantly, BAY15_3292 not only displayed high 124

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

catalytic efficiency, but was also expressed highly and solubly in the supernatant, and 125

could also be directly secreted. These advantages could facilitate potential industrial 126

and PVA biodegradation applications. In addition, we identified the only reported 127

PVADH (BAY15_1712) with both PVA and OVA degrading-abilities. Overall, our 128

findings expand our understanding of PVA-degrading pathways in microorganisms, 129

and suggest S. rhizophila QL-P4 and its enzymes may provide a novel resource for 130

the degradation of PVA, and further show feasibility of biodegradation to reduce and 131

eliminate industrial polymer associated environmental pollution. 132

133

Results and discussion 134

Isolation and characterisation of the novel PVA degrader Stenotrophomonas 135

rhizophila QL-P4 136

The new PVA-degrading strain was isolated from fallen leaves from virgin forest in 137

Qinling Mountains, Xi’an, Shaanxi, China, and named Stenotrophomonas rhizophila 138

based on 16S rRNA gene sequences (99.81% identity to S. rhizophila strain 139

DSM14405T, NCBI accession number CP007597) (21). Scanning electron 140

microscopy (SEM) revealed morphological features and confirmed typical bacilliform 141

cells with a rough surface due to irregular wrinkles (Figure S1, scale bar = 500 nm). 142

Bacterial growth and PVA degradation curves of S. rhizophila QL-P4 were 143

measured with medium containing different initial concentrations of PVA as single 144

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

carbon source (Figure 1). These results demonstrated that the strain grew well in PVA 145

medium, indicating that it was able to efficiently degrade PVA and utilise it as a 146

carbon source. On the fifth day of culturing, the percentages of PVA-degradation 147

were 46.2% and 36.1% with an initial PVA concentration of 0.1% and 0.5%, 148

respectively. We then compared our strain with other reported PVA-degrading 149

bacteria (Table S1). The percentages of PVA-degradation (at 24h) by S. rhizophila 150

QL-P4 were ~35% and ~30% with an initial PVA concentration of 0.1% and 0.5%, 151

respectively. The degradation ability of our strain was higher than other reported PVA 152

degraders (11, 22-26). This is the only reported Stenotrophomonas strain with 153

PVA-degrading ability, although some other biological properties of this 154

Stenotrophomonas genus have been established previously, including degradation of 155

chlorpyrifos, organophosphorus pesticides, hexavalent chromate, 156

dichlorodiphenyltrichloroethane (DDT) and CI Acid Red 1 (27-31). 157

158

Bioinformatics analysis of S. rhizophila QL-P4 reveals eight genes encoding 159

potential PVA-degrading proteins 160

The complete genome of S. rhizophila QL-P4 was obtained by SMRT sequencing 161

and corrected using Illumina sequencing. Bioinformatics analysis provided general 162

genome information (Figure S2 and Table S2), including GC content (66.85%), 163

genome size (4.20 Mb), and the number of predicted protein-coding genes (3,659). 164

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

Based on sequence alignment of genes and corresponding protein domains 165

reportedly involved in PVA degradation (11, 12, 16-19), we identified eight putative 166

PVA/OVA-degrading genes in the S. rhizophila QL-P4 genome (BAY15_1712, 167

BAY15_2325, BAY15_3292, BAY15_0976, BAY15_3123, BAY15_3143, 168

BAY15_0160, and BAY15_0291) (Figure 2; Figure S3; Table S3). Among them, 169

seven genes (BAY15_1712, BAY15_2325, BAY15_0976, BAY15_3123, 170

BAY15_3143, BAY15_0160 and BAY15_0291) are identified to own the domains of 171

PVA/OVA-degrading enzymes in the classical intracellular pathway through domain 172

analysis (Figure 2A). And one gene (BAY15_3292) is directly annotated as a PVA 173

oxidase (Figure 2A; Figure S3). Of the seven classical intracellular 174

PVA/OVA-degrading genes, six genes (BAY15_1712, BAY15_2325, BAY15_0291, 175

BAY15_0976, BAY15_3123 and BAY15_3143) are likely to participate in oxidation 176

of PVA/OVA (the first step), while BAY15_0160 might mediate hydrolysis of 177

oxiPVA (oxidised PVA with a β-diketone structure) in the second step of PVA 178

degradation (Figure 2B). Since we failed to find any SAO genes in the genome, 179

intracellular degradation of PVA appears to play a dominant role in this strain. 180

The first step of intracellular PVA degradation is the oxidation of PVA and 181

conversion into oxiPVA by PVADHs (1, 32, 33). Two predicted PVADHs 182

(BAY15_1712 and BAY15_2325) were identified encoding two quinoprotein alcohol 183

dehydrogenases with two types of PVADH domains; a quinoprotein alcohol 184

dehydrogenase-like domain, and a domain with pyrroloquinoline quinone (PQQ) 185

repeats (violet and light grey bars in BAY15_1712/2325, Figure 2A) (18). These 186

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

genes may therefore play a role in the oxidation of PVA in S. rhizophila QL-P4. In 187

addition, BAY15_0291 encodes an apparent 128 amino acid (aa) cytochrome C (blue 188

bar in BAY15_0291, Figure 2A) sharing 37% sequence identity with cytC in the pva 189

operon of Sphingomonas sp. 113P3 (14), which is a primary electron acceptor for 190

PVADHs in PVA oxidation (Figure 2A) (19, 34). We predict that BAY15_1712, 191

BAY15_2325 (oxidation) and BAY15_0291 (electron acceptor) may work together to 192

implement the first step of the oxidation of PVA in S. rhizophila QL-P4 (Figure 2B). 193

The second step of intracellular PVA degradation is the hydrolysis of oxiPVA and 194

cleavage of the C-C bond of the β-diketone of oxiPVA by OPH or BPH (1, 32, 33). 195

Sequencing analysis revealed that BAY15_0160 encodes a 331 aa protein with an 196

/- hydrolase fold similar to OPH and BPH (brown bar in BAY15_0160, Figure 2A) 197

(9, 35-38). It also contains a serine hydrolase motif comprising the lipase box 198

sequence Gly-X-Ser-X-Gly located in the catalytic domain of OPH (8). This suggests 199

that BAY15_0160 participates in cleavage of the C-C bond of the β-diketone of 200

oxiPVA (Figure 2B). 201

After the above two-step reaction, PVA can be degraded to OVA (20, 39). 202

BAY15_0976, BAY15_3123 and BAY15_3143 share the same domains as a 203

secondary alcohol dehydrogenase (SADH) in Geotrichum fermentans WF9101 that 204

reportedly possess OVA oxidation ability (polymerisation degree <50; Figure 2A) (20, 205

39). Thus, we infer that these three genes may function in the oxidation of OVA in S. 206

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

rhizophila QL-P4, which likely contributes to the complete degradation of PVA in 207

this strain (Figure 2B). 208

Interestingly, BAY15_3292 shares high sequence similarity (more than 70% 209

identity) with annotated polyvinyl alcohol dehydrogenases (PVADHs) in 210

Stenotrophomonas and Xanthomonas (NCBI accession numbers 211

CP007597.1/CP018756.1 and CP018728.1/AE008922.1, respectively), suggesting 212

that it participates in the first step of PVA intracellular degradation. Since this enzyme 213

does not contain classical PVADH domains (including quinoprotein alcohol 214

dehydrogenase-like and PQQ repeat domains), it may be a novel PVA-degrading 215

enzyme (Figure 2A). 216

In summary, our study identifies a single strain with PVA and OVA degradation 217

genes, while all previously reported strains contain either PVA or OVA degradation 218

genes (1). For example, the well-characterised PVA degrader Sphingopyxis sp.113P3 219

possesses only PVA degradation genes (pvaA, oph, cytC) (12, 18). The presence of 220

the identified enzymes might account for the high efficiency of PVA degradation by S. 221

rhizophila QL-P4 (Figure 1). 222

223

Enzyme kinetic analysis of classical intracellular PVA/OVA-degrading enzymes 224

from S. rhizophila QL-P4 225

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

Seven new genes (BAY15_1712, BAY15_2325, BAY15_0976, BAY15_3123, 226

BAY15_3143, BAY15_0160 and BAY15_0291) were predicted to be involved in the 227

classical intracellular PVA/OVA degradation pathway. Among these, four enzymes 228

(BAY15_1712, BAY15_0976, BAY15_3123, BAY15_3143) were successfully 229

expressed and purified (Figure S4), but expression of the other three (BAY15_2325, 230

BAY15_0160, BAY15_0291) was unsuccessful. The PVA/OVA-degrading activities 231

of the four expressed enzymes were measured (Table 1). Kinetic parameters (kcat and 232

Km) were derived from Eadie-Hofstee plots, and catalytic efficiency was determined 233

as kcat/Km. 234

As shown in Table 1, the predicted PVADH enzyme BAY15_1712 showed high 235

catalytic efficiency for PVA degradation (kcat/Km = 5.19×108 M

-1 min

-1), which was 236

~5000-fold higher than that reported for PVADH from Sphingopyxis sp. 113P3 237

(kcat/Km = 1.06×105 M

-1 min

-1) (40). This was mainly due to a large increase in kcat 238

(kcat ~4175.39 min-1

vs. 2.50 min-1

for BAY15_1712 and PVADH from Sphingopyxis 239

sp. 113P3). Furthermore, the affinity of BAY15_1712 was increased ~3-fold over that 240

of PVADH from Sphingopyxis sp. 113P3 (Km ~8.04 M vs. 23.6 M for 241

BAY15_1712 and PVADH from Sphingopyxis sp. 113P3). To investigate the catalytic 242

efficiency of BAY15_1712 towards OVA, kinetic assays were performed in the 243

presence or absence of PQQ (Table 1). The reactions were performed with a fixed 244

concentration of BAY15_1712 and excess of OVA substrates (Data are the mean ± 245

SD of three replicates). BAY15_1712 displayed high catalytic efficiency towards 246

OVA (kcat/Km = 1.76×107 M

-1 min

-1), which was unsurprising given that it includes 247

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

the shorter quinoprotein alcohol dehydrogenase-like domain found in OVA-degrading 248

enzymes (violet bar in BAY15_1712, Figure 2A). Incidentally, BAY15_1712 appears 249

to be a PQQ-dependent PVADH, since no PVA/OVA-degrading activity was detected 250

in the absence of PQQ (data not shown). 251

The catalytic efficiency of the three predicted OVA-degrading SADHs 252

(BAY15_0976, BAY15_3123 and BAY15_3143) was measured with excess of PVA 253

or OVA substrates, and all displayed OVA-degrading activity but no PVA-degrading 254

ability (Table 1), in agreement with previous research (39). All three enzymes showed 255

relatively high catalytic efficiency, with BAY15_3123 the most efficient, possibly due 256

to the additional GroES-like domain (short red bar in BAY15_3123, Figure 2). To 257

date, only one reported SADH from Geotrichum fermentans WF9101 has 258

OVA-degrading ability (1,39). 259

260

Enzyme kinetic and exocrine function analysis of a novel PVA oxidase 261

(BAY15_3292) 262

Although BAY15_3292 does not contain any classical PVA-degrading domains, it 263

shares high sequence identity with annotated PVADHs in Stenotrophomonas and 264

Xanthomonas, suggesting it could be a novel PVA oxidase. The enzyme was 265

successfully expressed and purified, and its PVA-degrading efficiency was tested. As 266

shown in Table 2, BAY15_3292 degraded PVA with a similar efficiency in the 267

presence and absence of PQQ, indicating that it is PQQ-independent. The catalytic 268

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

efficiency was ~3-fold higher than that of BAY15_1712. Moreover, compared with 269

the reported PVADH from Sphingopyxis sp. 113P3 (40), BAY15_3292 displayed 270

much higher PVA degradation ability (kcat/Km = 1.58×109

M-1

min-1

vs. 1.06×105 M

-1 271

min-1

). This was mainly due to a significant increase in catalytic rate (kcat ~2719.5

272

min-1

vs. 2.5 min-1

). Overall, BAY15_3292 showed the highest PVA-degrading 273

efficiency among the three PVADHs (BAY15_3292, BAY15_1712 and PVADH 274

from Sphingopyxis sp. 113P3). Incidentally, BAY15_3292 showed no 275

OVA-degrading activity (Table 2). 276

In order to validate the influence of BAY15_3292 on the PVA-degrading ability of 277

this strain, PVA degradation curves of S. rhizophila QL-P4 were measured with and 278

without BAY15_3292 in 0.1% PVA medium (Figure 3). The results showed that 279

knocking out BAY15_3292 resulted in a significant decline of PVA-degrading ability 280

in S. rhizophila QL-P4. On the fifth day of culturing, the percentage of PVA 281

degradation were 50.4% and 21.9% in the presence and absence of BAY15_3292, 282

respectively. This indicates that BAY15_3292 plays a crucial role in PVA degradation 283

in S. rhizophila QL-P4. 284

Most interestingly, we found that BAY15_3292 was mainly expressed in soluble 285

form in the supernatant (data not shown), while the classical PVADHs (including 286

BAY15_1712 and PVADH from Sphingopyxis sp. 113P3) were expressed mainly in 287

inclusion bodies (13). This indicates higher solubility for BAY15_3292, making it 288

more applicable for PVA biodegradation. 289

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

Since BAY15_3292 was expressed mostly in the supernatant and has a relatively 290

low molecular weight, we inferred that it may possess exocrine activity. To test this 291

hypothesis, we implemented protein mass spectrometry analysis of collected 292

extracellular proteins. Using 2D-LC-MS/MS on an Orbitrap Fusion mass 293

spectrometer, BAY15_3292 was identified based on eight unique peptides from the 294

band of the corresponding molecular weight excised from the SDS-PAGE gel (Figure 295

4). This result demonstrated that BAY15_3292 could be secreted. SAO is the only 296

extracellularly secreted PVA-oxidising enzyme reported previously (1, 41-43), but an 297

SAO-encoding gene was not identified in our strain. Thus, BAY15_3292 may 298

function as an extracellular PVA oxidase in S. rhizophila QL-P4. To further confirm 299

the extracellular PVA degradation ability of the secreted BAY15_3292 from S. 300

rhizophila QL-P4, we performed a transparent circle experiment (44). As shown in 301

Figure S5, the width of the transparent circle narrowed markedly when BAY15_3292 302

was knocked out, suggesting this protein has a distinct effect on the extracellular PVA 303

degradation ability of S. rhizophila QL-P4. 304

305

Conclusions 306

We report the complete genome of S. rhizophila QL-P4, a new and efficient PVA 307

degrader that has five PVA/OVA-degrading enzymes with a high catalytic efficiency, 308

among which BAY15_1712 is the only reported PVADH with both PVA- and 309

OVA-degrading abilities. Most importantly, we discovered a novel PVA oxidase 310

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

(BAY15_3292) that is not only more efficient than other reported PVA-degrading 311

PVADHs, but also has exocrine activity. Overall, our findings provide new insight 312

into PVA-degrading pathways in microorganisms, and suggest S. rhizophila QL-P4 313

and its enzymes have potential for application to PVA bioremediation to reduce or 314

eliminate PVA-related environmental pollution. 315

316

Materials and Methods 317

Isolation of the PVA-degrading strain 318

Fallen leaves were collected from virgin forest in the Qinling Mountains (Xi’an, 319

Shaanxi, China). Samples were ground and diluted with physiological saline. 320

Suspensions were subsequently spread onto agar plates containing 1.0 g/L PVA 321

(Sinopharm Chemical Reagent Company, Shanghai, China), 16 g/L agar, 1.4 g/L 322

K2HPO4, 0.27 g/L KH2PO4, 0.25 g/L MgSO4, 0.05 g/L CaCl2, 0.02 g/L FeSO4, 0.02 323

g/L NaCl, 0.2 g/L NaNO3, 0.2 g/L NH4NO3 (pH = 7.0) (11, 26). PVA with an average 324

polymerisation degree of 1750 ± 50 was the sole carbon source in the medium. After 325

cultivating at 30C for 27 days, bacterial plaques were picked and streaked 326

repeatedly on PVA agar plates to obtain mono-clones. After 35 rounds of selection, 327

mono-clones with PVA-degrading activity were isolated (26). 328

329

Evaluation of PVA degradation ability 330

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

S. rhizophila QL-P4 was cultivated in medium containing PVA with or without 331

yeast extract (26). The initial concentration of PVA was 0.1% or 0.5% (11, 26). The 332

residual PVA in the medium and the growth rate of S. rhizophila QL-P4 cells were 333

synchronously monitored by iodometry and UV/vis spectrophotometry (OD600), 334

respectively (45). The percentage of PVA-degradation of cells at 24 h in medium 335

containing 0.05% yeast extract was determined in cultures with different initial PVA 336

concentrations (11, 22-26). 337

338

Whole-genome sequencing and assembly 339

Whole-genome sequencing was implemented using the Pacific Biosciences RSII 340

sequencing platform (Pacific Biosciences, Menlo Park, CA, USA) that utilises P6/C4 341

chemistry (46). A 10 kb SMRTbell library was prepared from sheared genomic DNA 342

(>5 g), using the 10 kb template library preparation workflow according to the 343

manufacturer’s recommendation, with an additional bead clean-up step before primer 344

annealing (15). 345

One SMRT cell yielded more than 1,364 Mb of DNA from 99,322 reads, with a 346

mean read length of 13,736 bases and an average genome coverage of 148-fold. De 347

novo assembly of the genome was performed using Hierarchical Genome Assembly 348

Process 3 (HGAP3) (47) within the SMRT Analysis v2.2.0 software. Gap closing was 349

completed by PBJelly, and circularisation was achieved by manual comparison and 350

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

removal of regions of overlap (48). The final genome was confirmed by remapping of 351

sequencing data. 352

To correct the polymer errors produced during PacBio sequencing, we 353

re-sequenced the isolate using next-generation sequencing. Paired-end libraries were 354

prepared from 5 g of isolated genomic DNA using a TruSeq DNA sample prep kit A 355

(Illumina Inc., San Diego, California, USA), and sequenced with a read length of 2× 356

150 nucleotides using an Illumina Genome Analyzer IIx according to the 357

manufacturer’s instructions. Image analysis and base calling were performed in the 358

standard Illumina pipeline. Raw Illumina sequencing reads were trimmed at a 359

threshold of 0.01 (Phred score of 20). Filtered reads were mapped onto genome 360

sequences, which were assembled the HGAP.3 algorithm in the SMRT Portal (version 361

2.2.0) using BWA version 0.5.9 (49), and converted to sorted BAM format using 362

SAMtools version 0.1.9 (50). Pilon v.1.13 was subsequently employed to polish 363

genome sequences using the obtained alignments (51). 364

365

Gene annotation and prediction of genes encoding PVA-degrading enzymes 366

Annotation of rRNAs and tRNAs was performed using RNAmmer (52) and 367

tRNAscan-SE (53), respectively. Protein-coding genes were predicted using Prodigal 368

version 2.60 (46). Their functions were annotated by comparison with the NCBI 369

non-redundant (NR) database, and classified by searching against the Clusters of 370

Orthologous Groups (COG) database (54). Annotated protein sequences were aligned 371

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

with those of known PVA-degrading enzymes and protein domain analysis was 372

performed using Pfam (http://pfam.xfam.org) and InterPro 373

(http://www.ebi.ac.uk/interpro/). The results of functional annotation, sequence 374

BLAST searches and domain analysis were integrated to identify PVA-degrading 375

genes. 376

377

Gene cloning 378

Genes were amplified from S. rhizophila QL-P4 genomic DNA using primers with 379

appropriate recognition sequences and restriction endonuclease sites (Table 3). 380

Amplified fragments were digested with NdeI and HindIII (New England Biolabs 381

Beijing LTD, USA), and purified with a SanPrep PCR Purification Kit (Sangon 382

Biotech, Shanghai, China). Fragments were ligated into the digested pET-28a (+) 383

plasmid vector using T4 ligase, and constructed plasmids were confirmed by 384

sequencing. 385

386

Protein expression and purification 387

Recombinant pET-28a (+) plasmids were transformed into competent Escherichia 388

coli BL21 (DE3) cells (TransGene Biotech, Beijing, China), and expression of 389

His-tagged fusion proteins was induced with 1 mM IPTG. Recombinant proteins were 390

purified with Ni-NTA resin using an Immobilized Metal Affinity Chromatography kit 391

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

(Shanghai Roche Pharmaceuticals Ltd, Switzerland) from cell lysates in buffer A (50 392

mM potassium phosphate, 300 mM NaCl), and eluted using a linear gradient of 393

elution buffer containing 25 mM to 250 mM imidazole. Protein purity was evaluated 394

by SDS-PAGE. 395

In order to attenuate the influence of imidazole on enzyme activity, elution buffer 396

was exchanged by ultrafiltration at 4C using a centrifugal concentrator (Millipore, 397

Shanghai, China) with 50 mM potassium phosphate buffer (pH 7.2) for putative 398

PVADH, and with TRIS-HCl buffer (pH 8.0) for putative SADH. Protein 399

concentration was determined with a Pierce BCA Protein Assay kit (Thermo Fisher 400

Scientific, Shanghai, China). 401

402

Enzyme kinetic analysis of PVA-degrading enzymes 403

For putative PVADHs, recombinant proteins were pre-incubated with PQQ and 404

CaCl2 at 30C for 10 min. The enzyme solution was then mixed with substrate and 405

reaction buffer. The final reaction mixture (pH 7.2) contained 0.2 mM 406

2,6-dichlorophenolindophenol (DCIP), 1 mM CaCl2, 6 μM PQQ, 50 mM potassium 407

phosphate, and 0.06252 mg/ml substrate (40). The enzyme reactions were performed 408

at 30C, and the initial rate of reaction was measured by the decrease in A600 due to 409

the reduction of DCIP (ϵ600=1.9×104 M

-1cm

-1) with a UV-1800 spectrophotometer 410

(18, 40, 55). A reaction without substrate was used as a control. Besides, activities of 411

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

the putative PVADHs were also assayed in the absence of PQQ to estimate the PQQ 412

dependence of the enzymes. 413

For the putative SADHs, the recombinant proteins were pre-incubated with NAD+ 414

at 30C for 10 min. The final reaction mixture (pH 8.0) contained 5 mM NAD+, 50 415

mM Tris-HCl and 0.05-2 mg/mL substrate (39). The initial rate of reaction was 416

measured by the decrease in absorbance at 340 nm (A340) due to the reduction of 417

NAD+ (340 = 6.2×10

3 M

-1 cm

-1) with a UV-1800 spectrophotometer (39). A reaction 418

without substrate was used as a control. 419

All recombinant proteins were reacted with both PVA1750 and OVA with an 420

average polymerisation degree of ~20. OVA20 was prepared from PVA according to 421

the method reported by Mori et al. (1996) (20). Kinetic constants (Km, kcat and kcat/Km) 422

of enzymes were calculated from the initial velocities using the Michaelis-Menten 423

equation and Eadie-Hofstee plots, data are the mean ± SD of three replicates. 424

425

Genetic manipulation and mutagenesis of S. rhizophila QL-P4 426

In-frame, non-polar deletion of BAY15_3292 was performed by overlap extension 427

PCR. XhoI and XbaI restriction sites were engineered into the outer pair of primers for 428

cloning. The amplicon containing deletion was digested with the restriction 429

endonucleases and cloned into the suicide vector pDM4 using T4 ligase at 4C. 430

Recombinant plasmids were firstly transformed into E. coli S17-1, and subsequently 431

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

22

into S. rhizophila QL-P4 via conjunction with E. coli S17-1. Integrants in S. 432

rhizophila QL-P4 were selected with chloromycetin. Counterselection with sucrose 433

was performed, and clones (ΔBAY15_3292-QL-P4) was verified by sequencing of 434

PCR amplicons. 435

436

2D-LC-MS/MS identification of the secreted BAY15_3292 protein 437

Proteins secreted from S. rhizophila QL-P4 were precipitated from culture medium 438

containing 0.1% PVA with 90% ethanol at -80C overnight. Precipitated proteins 439

were re-dissolved in 50 mM potassium phosphate buffer (pH 7.2) and separated by 440

SDS-PAGE. Proteins with a molecular weight close to that expected for 441

BAY15_3292 were reduced, alkylated, and digested with trypsin at 37C for 16 h. 442

Peptides were extracted with acetonitrile (ACN) containing 0.1% formic acid (FA), 443

dried by vacuum, dissolved in 0.1% FA, delivered onto a nano RP column, and eluted 444

with a gradient (50–80%) of ACN over 60 min at a flow rate of 400 nL/min. Fractions 445

were injected into an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific, 446

Waltham, MA, USA) set to work in a data-dependent manner. Raw MS/MS data were 447

converted to MGF format using Proteome Discoverer 1.2 (Thermo Fisher Scientific, 448

Waltham, MA, USA). Exported MGF files were searched with Mascot v 2.3.01 449

against the annotated S. rhizophila QL-P4 protein database of with a tryptic 450

specificity allowing one missed cleavage. 451

452

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23

PVA plate assay 453

S. rhizophila QL-P4 and ΔBAY15_3292_QL-P4 cells were suspended in 454

physiological saline and spread on 0.1% PVA agar plates containing 0.05% yeast 455

extract. Plates were cultivated at 30C for 5 days, and residues were stained as 456

described previously by Song et al. (2016) (44). The width of transparent circles 457

surrounding bacterial plaques were measured to estimate the extracellular 458

PVA-degrading ability (56). E. coli cells incapable of degrading PVA were used as a 459

negative control. 460

461

Strain and nucleotide sequence submission 462

The S. rhizophila QL-P4 strain has been deposited in the China General 463

Microbiological Culture Collection Center (CGMCC) under accession number 464

CGMCC 1.15515. The complete genome sequence of QL-P4 has been deposited at 465

GenBank under accession number CP016294. 466

467

Conflict of Interest 468

The authors declare that they are inventors on the patent applications covering 469

various of S. rhizophila QL-P4 strain and the PVA/OVA-degrading enzymes. 470

Correspondence and requests for the materials should be addressed to F.C 471

([email protected]). 472

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

24

473

Acknowledgements 474

This research is funded by the Science & Technology Innovation Project of the 475

Yangling Agriculture High-tech Industrial Demonstration zone (No. 2015NY-07). The 476

funders had no role in study design, data collection and interpretation, or the decision 477

to submit the work for publication. Sincere thanks are also given to Prof. Hu Xiaoping 478

for giving constructive suggestion to this research. 479

480

References 481

1. Kawai F, Hu X. 2009. Biochemistry of microbial polyvinyl alcohol 482

degradation. Applied Microbiology and Biotechnology 84:227. 483

2. Chiellini E, Corti A, D'Antone S, Solaro R. 2003. Biodegradation of poly 484

(vinyl alcohol) based materials. Progress in Polymer Science 28:963-1014. 485

3. Stoica-Guzun A, Jecu L, Gheorghe A, Raut I, Stroescu M, Ghiurea M, Danila 486

M, Jipa I, Fruth V. 2011. Biodegradation of Poly(vinyl alcohol) and Bacterial 487

Cellulose Composites by Aspergillus niger. Journal of Polymers and the 488

Environment 19:69-79. 489

4. Cao Y, Hua Z, Chen J. 2005. Improvement of Biodegradability of Polyvinyl 490

Alcohol by Pre-treatment with Fenton Oxidation. Journal of Wuxi University 491

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

25

of Light Industry. 492

5. Xie B. 2002. PRACTICE OF TREATING PVA-BEARING DESIZING 493

WASTEWATER. Environmental Engineering 20:7-9. 494

6. Li C, Fan X, Wang Q, Jin H. 2007. Effects of poly (vinyl alcohol) in desizing 495

wasterwater and its degradation performance. TEXTILE AUXILIARIES 496

24:7-10. 497

7. Du G, Liu L, Song Z, Hua Z, Zhu Y, Chen J. 2007. Production of polyvinyl 498

alcohol-degrading enzyme with Janthinobacterium sp. and its application in 499

cotton fabric desizing. Biotechnology Journal 2:752-758. 500

8. Klomklang W, Tani A, Kimbara K, Mamoto R, Ueda T, Shimao M, Kawai F. 501

2005. Biochemical and molecular characterization of a periplasmic hydrolase 502

for oxidized polyvinyl alcohol from Sphingomonas sp. strain 113P3. 503

Microbiology (Reading, England) 151:1255-1262. 504

9. Sakai K, Hamada N, Watanabe Y. 1986. Degradation Mechanism of 505

Poly(vinyl alcohol) by Successive Reactions of Secondary Alcohol Oxidase 506

and β-Diketone Hydrolase from Pseudomonas sp. . Agricultural and 507

Biological Chemistry 50:989-996. 508

10. Nord FF. 1936. Über die Dehydrierungsleistungen von Fusarium lini B. 509

Naturwissenschaften 24:763-763. 510

11. Hu X, Mamoto R, Shimomura Y, Kimbara K, Kawai F. 2007. Cell surface 511

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

26

structure enhancing uptake of polyvinyl alcohol (PVA) is induced by PVA in 512

the PVA-utilizing Sphingopyxis sp. strain 113P3. Archives of Microbiology 513

188:235. 514

12. Hu X, Mamoto R, Fujioka Y, Tani A, Kimbara K, Kawai F. 2008. The pva 515

operon is located on the megaplasmid of Sphingopyxis sp. strain 113P3 and is 516

constitutively expressed, although expression is enhanced by PVA. Applied 517

microbiology and biotechnology 78:685-693. 518

13. Jia D, Yang Y, Peng Z, Zhang D, Li J, Liu L, Du G, Chen J. 2014. High 519

efficiency preparation and characterization of intact poly(vinyl alcohol) 520

dehydrogenase from Sphingopyxis sp.113P3 in Escherichia coli by inclusion 521

bodies renaturation. Applied biochemistry and biotechnology 172:2540-2551. 522

14. Ohtsubo Y, Nagata Y, Numata M, Tsuchikane K, Hosoyama A, Yamazoe A, 523

Tsuda M, Fujita N, Kawai F. 2015. Complete Genome Sequence of Polyvinyl 524

Alcohol-Degrading Strain Sphingopyxis sp. 113P3 (NBRC 111507). Genome 525

announcements. 3(5):doi:10.1128/genomea.01169-15. 526

15. Zhu L, Zhong J, Jia X, Liu G, Kang Y, Dong M, Zhang X, Li Q, Yue L, Li C, 527

Fu J, Xiao J, Yan J, Zhang B, Lei M, Chen S, Lv L, Zhu B, Huang H, Chen F. 528

2016. Precision methylome characterization of Mycobacterium tuberculosis 529

complex (MTBC) using PacBio single-molecule real-time (SMRT) technology. 530

Nucleic acids research 44:730-743. 531

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

27

16. Shimao M, Tamogami T, Kishida S, Harayama S. 2000. The gene pvaB 532

encodes oxidized polyvinyl alcohol hydrolase of Pseudomonas sp. strain 533

VM15C and forms an operon with the polyvinyl alcohol dehydrogenase gene 534

pvaA. Microbiology (Reading, England) 146 ( Pt 3):649-657. 535

17. Toyama H, Mathews FS, Adachi O, Matsushita K. 2004. Quinohemoprotein 536

alcohol dehydrogenases: structure, function, and physiology. Archives of 537

biochemistry and biophysics 428:10-21. 538

18. Hirota-Mamoto R, Nagai R, Tachibana S, Yasuda M, Tani A, Kimbara K, 539

Kawai F. 2006. Cloning and expression of the gene for periplasmic poly(vinyl 540

alcohol) dehydrogenase from Sphingomonas sp. strain 113P3, a novel-type 541

quinohaemoprotein alcohol dehydrogenase. Microbiology (Reading, England) 542

152:1941-1949. 543

19. Mamoto R, Hu X, Chiue H, Fujioka Y, Kawai F. 2008. Cloning and expression 544

of soluble cytochrome c and its role in polyvinyl alcohol degradation by 545

polyvinyl alcohol-utilizing Sphingopyxis sp. strain 113P3. Journal of 546

bioscience and bioengineering 105:147-151. 547

20. Tatsuma M, Michio S, Takashi K, Takuo S. 1996. Degradation of Vinyl 548

Alcohol Oligomers by Geotrichum sp. WF9101. Bioscience, biotechnology, 549

and biochemistry 60:1188-1190. 550

21. Alavi P, Starcher MR, Thallinger GG, Zachow C, Müller H, Berg G. 2014. 551

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

28

Stenotrophomonas comparative genomics reveals genes and functions that 552

differentiate beneficial and pathogenic bacteria. BMC genomics. 15(482. 553

doi:10.1186/1471-2164-15-482. 554

22. Suzuki T. 1973. Some characteristics of Pseudomonas O-3 which utilizes 555

polyvinyl alcohol. Report of the Fermentation Research Institute:23-37. 556

23. Sakazawa C, Shimao M, Taniguchi Y, Kato N. 1981. Symbiotic utilization of 557

polyvinyl alcohol by mixed cultures. Applied and environmental microbiology 558

41:261-267. 559

24. Tokiwa Y, Kawabata G, Jarerat A. 2001. A modified method for isolating 560

poly(vinyl alcohol)-degrading bacteria and study of their degradation patterns. 561

Biotechnology Letters 23:1937-1941. 562

25. Qian D, Du G, Chen J. 2004. Isolation and Culture Characterization of a New 563

Polyvinyl Alcohol-Degrading Strain: Penicillium sp. WSH02-21. World 564

Journal of Microbiology and Biotechnology 20:587. 565

26. Yamatsu A, Matsumi R, Atomi H, Imanaka T. 2006. Isolation and 566

characterization of a novel poly(vinyl alcohol)-degrading bacterium, 567

Sphingopyxis sp. PVA3. Applied Microbiology and Biotechnology 72:804. 568

27. Liu R, Jiang H, Xu P, Qiao C, Zhou Q, Yang C. 2014. Engineering 569

chlorpyrifos-degrading Stenotrophomonas sp. YC-1 for heavy metal 570

accumulation and enhanced chlorpyrifos degradation. Biodegradation 571

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

29

25:903-910. 572

28. Deng S, Chen Y, Wang D, Shi T, Wu X, Ma X, Li X, Hua R, Tang X, Li QX. 573

2015. Rapid biodegradation of organophosphorus pesticides by 574

Stenotrophomonas sp. G1. Journal of hazardous materials 297:17-24. 575

29. Ge S, Ge S, Zhou M, Dong X. 2015. Bioremediation of hexavalent chromate 576

using permeabilized Brevibacterium sp. and Stenotrophomonas sp. cells. 577

Journal of environmental management 157:54-59. 578

30. Pan X, Lin D, Zheng Y, Zhang Q, Yin Y, Lin C, Fang H, Yu Y. 2016. 579

Biodegradation of DDT by Stenotrophomonas sp. DDT-1: Characterization 580

and genome functional analysis. Sci Rep 6:21332. 581

31. Kumari L, Tiwary D, Mishra PK. 2016. Biodegradation of C.I. Acid Red 1 by 582

indigenous bacteria Stenotrophomonas sp. BHUSSp X2 isolated from dye 583

contaminated soil. Environmental science and pollution research international 584

23:4054-4062. 585

32. Matsumura S, Tomizawa N, Toki A, Toshima K. 1999. Enzymatic degradation 586

of poly(vinyl alcohol) and its copolymer, p 230-238. In Alexander S (ed), 587

Biochemical principles and mechanisms of biosynthesis and biodegradation of 588

polymers. Wiley-VCH, Weinheim. 589

33. Matsumura S, Tomizawa N, Toki A, Kimihito Nishikawa A, Toshima K. 1999. 590

Novel Poly(vinyl alcohol)-Degrading Enzyme and the Degradation 591

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

30

Mechanism. Macromolecules 32:7753-7761. 592

34. Shimao M, Onishi S, Kato N, Sakazawa C. 1989. Pyrroloquinoline 593

Quinone-Dependent Cytochrome Reduction in Polyvinyl Alcohol-Degrading 594

Pseudomonas sp. Strain VM15C. Applied and environmental microbiology 595

55:275-278. 596

35. Sakai K, Morita M, Hamada N, Watanabe Y. 1981. Purification and Properties 597

of Oxidized Poly(vinyl a1cohol)-Degrading Enzyme. Agricultural & 598


36. Sakai K, Hamada N, Watanabe Y. 1985. A New Enzyme, β-Diketone 600

Hydrolase: a Component of a Poly(vinyl alcohol)-degrading Enzyme 601

Preparation. Agricultural & Biological Chemistry 49:1901-1902. 602

37. Suzuki T, Tsuchii A. 1983. Degradation of diketones by polyvinyl 603

alcohol-degrading enzyme produced by Pseudomonas sp. .vol 18. 604

38. Kawagoshi Y, Fujita M. 1997. Purification and properties of the polyvinyl 605

alcohol-degrading enzyme 2,4-pentanedione hydrolase obtained from 606

Pseudomonas vesicularis var. povalolyticus PH. World Journal of 607

Microbiology and Biotechnology 14:95-100. 608

39. Mori T, Sakimoto M, Kagi T, Sakai T. 1998. Secondary alcohol dehydrogenase 609

from a vinyl alcohol oligomer-degrading Geotrichum fermentans; stabilization 610

with Triton X-100 and activity toward polymers with polymerization degrees 611

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

31

less than 20. World journal of microbiology & biotechnology 14:349-356. 612

40. Jia D, Li J, Liu L, Zhang D, Yang Y, Du G, Chen J. 2013. High-level 613

expression, purification, and enzymatic characterization of truncated 614

poly(vinyl alcohol) dehydrogenase in methylotrophic yeast Pichia pastoris. 615

Applied Microbiology and Biotechnology 97:1113-1120. 616

41. Morita M, Watanabe Y. 1977. A Secondary Alcohol Oxidase: a Component of 617

a Polyvinyl Alcohol Degrading Enzyme Preparation. Agricultural & 618


42. Shimao M, Taniguchi Y, Shikata S, Kato N, Sakazawa C. 1982. Production of 620

polyvinyl alcohol oxidase by a symbiotic mixed culture. Applied and 621

environmental microbiology 44:28-32. 622

43. Veteikytė A, Aštrauskaitė M, Gruškienė R, Tekorienė R, Matijošytė I. 2013. 623

Secondary alcohol oxidase activity identified in genus of Pseudomonas 624

isolated from the oil polluted soil. Biocatalysis and Agricultural Biotechnology 625

2:89-95. 626

44. Song Y, Zhou Y, Li S, Liu Y, Wei Y. 2016. Optimization of Poly(Vinyl 627

Alcohol)-Degrading Enzyme Production Condition in Bacillus 628

amyloliquefaciens HK1. Chinese Agricultural Science Bulletin. 629

45. Finley JH. 1961. Spectrophotometric determination of polyvinyl alcohol in 630

paper coatings. Analytical Chemistry 33:1925-1927. 631

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

32

46. Hyatt D, Chen G-L, LoCascio PF, Land ML, Larimer FW, Hauser LJ. 2010. 632

Prodigal: prokaryotic gene recognition and translation initiation site 633

identification. BMC Bioinformatics 11:119. 634

47. Chin CS, Alexander DH, Marks P, Klammer AA, Drake J, Heiner C, Clum A, 635

Copeland A, Huddleston J, Eichler EE. 2013. Nonhybrid, finished microbial 636

genome assemblies from long-read SMRT sequencing data. Nature Methods 637

10:563. 638

48. English AC, Richards S, Han Y, Wang M, Vee V, Qu J, Qin X, Muzny DM, 639

Reid JG, Worley KC, Gibbs RA. 2012. Mind the gap: upgrading genomes with 640

Pacific Biosciences RS long-read sequencing technology. PloS one 7:e47768. 641

49. Li H, Durbin R. 2010. Fast and accurate long-read alignment with 642

Burrows-Wheeler transform. Bioinformatics (Oxford, England) 26:589-595. 643

50. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, 644

Abecasis G, Durbin R, Genome Project Data Processing S. 2009. The 645

Sequence Alignment/Map format and SAMtools. Bioinformatics (Oxford, 646

England) 25:2078-2079. 647

51. Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo 648

CA, Zeng Q, Wortman J, Young SK, Earl AM. 2014. Pilon: an integrated tool 649

for comprehensive microbial variant detection and genome assembly 650

improvement. PloS one. 9(11):e112963. doi:10.1371/journal.pone.0112963. 651

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

33

52. Lagesen K, Hallin P, Rødland EA, Staerfeldt H-H, Rognes T, Ussery DW. 652

2007. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. 653

Nucleic acids research 35:3100-3108. 654

53. Schattner P, Brooks AN, Lowe TM. 2005. The tRNAscan-SE, snoscan and 655

snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic Acids 656

Research 33:686-9. 657

54. Galperin MY, Makarova KS, Wolf YI, Koonin EV. 2015. Expanded microbial 658

genome coverage and improved protein family annotation in the COG 659

database. Nucleic acids research 43:D261-9. 660

55. Hatanaka T, Asahi N, Tsuji M. 2008. Purification and Characterization of 661

Poly(vinyl alcohol) Dehydrogenase from Pseudomonas sp. 113P3. Bioscience 662

Biotechnology & Biochemistry 59:1813-1816. 663

56. Hao XH, Yi XP, Li D. 2015. Research on the Screening of Degrading Fungi 664

for Poly (vinyl alcohol) Film and the Effect of Additives. Advanced Materials 665

Research 1096:80-88. 666

667

668

Table and Figure legends 669

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

34

Figure 1. Cell growth and polyvinyl alcohol (PVA) degradation curves of 670

Stenotrophomonas rhizophila QL-P4 with an initial PVA concentration of (A) 0.1% 671

and (B) 0.5% as a sole carbon source. The PVA concentration (g/L) was measured 672

based on a standard curve of PVA (g/L) vs. absorbance at 690 nm (OD690). Bacterial 673

growth was measured by the OD600 value. 674

675

Figure 2. Eight genes in the S. rhizophila QL-P4 genome predicted to participate in 676

PVA degradation: (A) Identification of eight putative PVA-degrading enzymes 677

through domain comparison. The three predicted PVA oxidases, one predicted 678

electron acceptor, one predicted hydrolase and three predicted vinyl alcohol oligomer 679

(OVA)-degrading enzymes are separately shown as blue, red and orange bold letters 680

on the left. As controls, PVADH/Cytochrome C/OPH from Sphingopyxis sp. 113P3, 681

the annotated PVADH (WP_019184176.1) from Stenotrophomonas maltophilia, and 682

SADH from Thermoanaerobacter ethanolicus are displayed as black bold letters. 683

Domains were searched against the InterPro database (http://www.ebi.ac.uk/interpro/), 684

and are shown as different coloured bars. Different domains are colour-coded and 685

shown at the bottom. Each grey rectangle represents a protein predicted to participate 686

in PVA degradation, and IDs of their corresponding genes are included on the left. 687

Numbers under grey rectangles indicate the relative positions of amino acids counting 688

from the N-terminus. (B) Proposed roles of the eight predicted PVA degradation 689

pathway genes. The first step of intracellular PVA degradation is the oxidation of 690

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

35

PVA by PVADHs (BAY15_2325/1712/3292) with cytochrome C as an electron 691

acceptor (BAY15_0291). The second step is the hydrolysis of the β-diketone of 692

oxiPVA by OPH or BPH (BAY15_0160) to produce a methyl ketone and an aldehyde. 693

OVA, another product of PVA degradation, is intracellularly degraded by SADHs 694

(BAY15_3143/3123/0976). 695

696

Figure 3. PVA degradation curves of S. rhizophila QL-P4 with and without 697

BAY15_3292 in the presence of 0.1% PVA as a sole carbon source. 698

699

Figure 4. SDS-PAGE identification of the secretion of BAY15_3292 by 700

2D-LC-MS/MS. (A) Secreted S. rhizophila QL-P4 proteins in medium containing 0.1% 701

PVA. Lane M, protein markers; Lane BAY15_3292, purified BAY15_3292; Lane 702

Secreted proteins, S. rhizophila QL-P4 secreted proteins. (B) 2D-LC-MS/MS 703

identification of BAY15_3292 among proteins secreted from S. rhizophila QL-P4. 704

The two representative spectra show the b-/y- ions used for identification of unique 705

BAY15_3292 peptides. 706

707

Table 1. Kinetic parameters of the four classical PVA degradation enzymes 708

identified in S. rhizophila QL-P4a. 709

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

36

aKinetic analysis of enzymes was performed with an excess of PVA or OVA substrate. 710

The initial velocity at each substrate concentration was used to produce an 711

Eadie-Hofstee plot, and kcat and Km values were obtained from the y-intercept and 712

slope, respectively. Data are the mean ± SD of three replicates. 713

bThe enzyme do not show the catalytic activity for the substrate. 714

715

Table 2. Kinetics parameters of the novel PVA oxidase (BAY15_3292) with 716

different substratesa. 717

aKinetics analysis of this enzymes were proceeded with an excess amount of the 718

different substrates. The initial velocities at each substrate concentration were used to 719

generate an Eadie-Hofstee plot. The kcat and Km values were deduced from the y 720

intercepts and slopes, respectively. All the data represent mean ± SD of three 721

replicates. 722

bThe enzyme do not show the catalytic activity for the substrate. 723

724

Table 3. Primers used in this research. 725

Note: underlined sequences indicate restriction enzyme cleavage sites 726

727

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 1. Kinetics parameters of four classical PVA degradation enzymes in S.

rhizophila QL-P4a

Substrate Km (μM) kcat(min-1

) kcat/Km

(M-1

min-1

)

BAY15_1712

PVA(1750) 8.0±0.7 4175.4±315.1 5.2×108

OVA(20) 139.8±20.7 2462.0±230.9 1.8×107

BAY15_3123

PVA(1750) Nb N N

OVA(20) 360.3±8.0 1093.6±18.3 3.0×106

BAY15_3143

PVA(1750) N N N

OVA(20) 524.4±25.0 107.3±2.7 2.1×105

BAY15_0976

PVA(1750) N N N

OVA(20) 168.8±2.0 396.7±23.4 2.4×106

aKinetics parameters of four classical PVA degradation enzymes found in S. rhizophila QL-P4.

Kinetics analysis of these enzymes were proceeded with an excess amount of the different

substrates (PVA/OVA). The initial velocities at each substrate concentration were used to produce

an Eadie-Hofstee plot. The kcat and Km values were obtained from the y intercepts and slopes,

respectively. All the data represent mean ± SD of three replicates.

bThe enzyme do not show the catalytic activity for the substrate.

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 2. Kinetics parameters of a novel PVA oxidase (BAY15_3292) in S. rhizophila

QL-P4a

Substrate Cofactor Km(μM) kcat (min-1

)

kcat/Km

(M-1

min-1

)

BAY15_3292

PVA(1750) PQQ 1.7±0.1 2719.5±83.7 1.6×109

PVA(1750) / 1.7±0.3 2684.0±282.4 1.6×109

OVA(20) PQQ Nb N N

OVA(20) / N N N

aKinetics parameters of the novel PVA oxidase (BAY15_3292) with different substrates. Kinetics

analysis of this enzymes were proceeded with an excess amount of the different substrates. The

initial velocities at each substrate concentration were used to generate an Eadie-Hofstee plot. The

kcat and Km values were deduced from the y intercepts and slopes, respectively. All the data

represent mean ± SD of three replicates.

b The enzyme do not show the catalytic activity for the substrate.

Table 3. Primers used in this research

Oligo Name Sequence Length (bp）

BAY15_1712-sense GGAATTCCATATGATG AAG CAG ATG GTC ATG ATC AAG 1209

BAY15_1712-antise CCCAAGCTTTTA TTG TGC CAA CCG GAA TGC

BAY15_2325-sense GGAATTCCATATGATG TCC GCT GTG CCG A 2550

BAY15_2325-antise CCCAAGCTTCTA CCG CGG GCT CTG AC

BAY15_0291-sense GGAATTCCATATGATG CGG TTA CCG CGC CG 387

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

BAY15_0291-antise CCCAAGCTTCTA CGG CTG TTC CTT CAG GTA TT

BAY15_3292-sense GGAATTCCATATGATG GCG GCT TTG CAG CAG 858

BAY15_3292-antise CCCAAGCTTTCA GCG CGC CGC CTT G

BAY15_0976-sense GGAATTCCATATGATG GCG CAG CAA ACA ATG A 1038

BAY15_0976-antise CCCAAGCTTTCA GTT CCA GCT CAG GAC C

BAY15_3123-sense GGAATTCCATATGATG AAA TCC CGT GCT GCC 1110

BAY15_3123-antise CCCAAGCTTTCA GTA GTG GAC GAC CGA G

BAY15_3143-sense GGAATTCCATATGATG TCC CTC GCC CAT GGC TAT 1053

BAY15_3143-antise CCCAAGCTTTCA TGC CGC CAA CGT TGC C

BAY15_0160-sense GGAATTCCATATGATG CGT TGC GCT GTG TTG 996

BAY15_0160-antise CCCAAGCTTTCA TGG CGC CTT CTC CC

3292F1 GCTCTAGACATTCATGGCGACTCTTC

290

3292R1 CTGATCCTCACCTGACCGAACGTATTC

3292F2 CGGTCAGGTGAGGATCAGGCTGTTGGT

303

3292R2 CCGCTCGAGCACGGCTTCAGTTGATTC

Note: underlined sequences indicate restriction enzyme cleavage sites

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

on Novem


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Bioinformatics analysis and characterization of …...2017/10/23 · 104 PVA -degrading operon ( pva ) (11, 12 ). Furthermore, application of effective 105 PVA -degrading enzymes

Documents