Barcode of life: simple laboratory and analysis workflows for 16S and CO1 analysis Genus- and species-level identification by 16S or CO1 analysis made easy using a rapid laboratory protocol for adapter attachment and new data-analysis workflow Fig. 1 Laboratory workflow for barcoded 16S and CO1 sequencing It is often desirable to be able to identify the species present in a complex mixture. This can be achieved by amplifying the bacterial 16S or mammalian cytochrome oxidase (CO1) loci, and comparing the results with a reference database. PCR amplification of specific loci can allow enrichment of the target region in the presence of a large background of other organisms. By modifying the 5’ ends of standard PCR primers used for amplification of these loci we have developed a protocol that attaches our sequencing adapters to the amplicons in approximately 5 minutes, enabling more rapid species identification (Fig. 1). In the 16S analysis workflow, reads are compared to the NCBI 16S bacterial database using the Basic Local Alignment Search Tool (BLAST), immediately after each read has been basecalled. To validate the workflow, we prepared 1D 16S libraries by PCR amplification of the ZymoBIOMICS Microbial Community DNA Standard, sequenced the libraries on MinION TM flowcells and passed the basecalled results through the analysis workflow (Fig. 2). We were able to classify all eight bacteria in the mock community to genus level. We calculated the precision at genus level to be 99% for 1D data. Locus-specific PCR coupled with rapid adapter attachment for 16S and CO1 Analysis workflow and report simplifies amplicon-based species identification Fig. 2 Analysis report for species identification, shown here for Staphylococcus 16S Fig. 3 Comparison of whole-genome and 16S identification at a) genus and b) species levels We generated whole genome and 16S data from the ZymoBIOMICS Microbial Community DNA Standard and compared the number of calls from the WIMP and 16S workflows at the genus (Fig. 3a) and species (Fig. 3b) levels. As expected for a quantitative workflow, the gDNA WIMP calls agree well with the theoretical levels. The identity calls from the 16S data correlate closely with those from the gDNA data, particularly at genus level, but the correct abundance of genera and species is not reflected in the 16S data, possibly due to PCR bias. This is most noticeable for Pseudomonas, to which our 16S primers had mismatches. At species level, the 16S data reveals some false positive calls, reflecting the similarity of the 16S sequences of some genera. 16S compared to whole genome identification at genus and species levels © 2017 Oxford Nanopore Technologies. All rights reserved. P17001 - Version 4.0 Staphylococcus Bacillus Listeria Enterococcus Lactobacillus Salmonella Escherichia Shigella Klebsiella Enterobacter Alignment count over 80% accuracy 0 10,000 20,000 30,000 40,000 Selection summary 139,329 Reads analysed 139,237 Classification 1,320 Unique taxa Staphylococcus Distribution of alignment accuracies 80 90 100 0 1,000 2,000 3,000 Alignment accuracy Lineage NCBI Taxonomy ID: Rank: Average alignment accuracy: Alignments at this node: Alignments (including child nodes): 1279 NCBI organism overview NCBI taxonomy overview genus 88.5 % 0 40477 superkingdom: phylum: class: order: family: Bacteria Firmicutes Bacilli Bacillales Staphylococcaceae genus: Staphylococcus 16S BLASTN report a) b) Salmonella Escherichia Pseudomonas Listeria Bacillus Staphylococcus Enterococcus Lactobacillus Saccharomyces Cryptococcus 0 15 30 16S_1D gDNA_1D Relative abundance 0 8 16 S. aureus B. mojavensis B. subtilis [Brevibacterium] haloterans L. innocua L. welshimeri L. monocytogenes E. faecalis L. fermentum S. cerevisiae C. neoformans S. enterica E. coli P. aeruginosa Relative abundance 16S_1D gDNA_1D The highlighted row is also selected in the Selection summary to the right 16S gene – uses most accurate classification of each read Species identification – key figures Top classifications Fig. 4 DNA extraction, followed by CO1 PCR and library prep on VolTRAX Sample to result: identification of insect species by CO1 sequencing using VolTRAX In some situations it is an advantage to be able to identify species outside of a laboratory environment. VolTRAX is a portable device which is designed to perform the necessary steps to convert a raw biological sample to a form ready for analysis on a nanopore sensing device, without the need for human intervention. We extracted DNA from the invasive ladybird species Harmonia axyridis by bead-beating, and loaded the crude extract onto VolTRAX. We performed PCR of a 650 bp region of the cytochrome oxidase gene followed by addition of sequencing adapters using our rapid-attachment chemistry, on VolTRAX, and sequenced the resulting library for 1 hour (Fig. 4a). BLAST analysis of the reads confirmed the identity of the sample (Fig. 4b). Contact: [email protected] More information at: www.nanoporetech.com and publications.nanoporetech.com F R Sample Resuspension in buffer Cell lysis by bead-beating (e.g. Omnilyse) Attachment of rapid- sequencing adapters (5 min) Bead-washing and elution Loading Locus-specific PCR with barcoded rapid-attachment primers Load onto VolTRAX Rapid amplicon kit Performed on VolTRAX Sequence a) DNA extraction, PCR and 20-cycle PCR library preparation + Bead-beating and DNA isolation b) BLAST results Distribution of the top 100 Blast Hits on 100 subject sequences Mouse over to see the title, click to show alignments ? <40 50–80 80–200 > = 200 40–50 Query Color key for alignment scores 1 100 200 300 400 500 600 Description Max score Total score Query cover E value Ident Accession Harmonia axyridis mitochondrion, partial genome 809 809 99% 0 89% KR108208.1 Harmonia axyridis voucher BIOUG<CAN>:TDWG-0189 cytochrome oxidase subunit 1 (COI) gene, partial cds; mito 742 742 92% 0 89% HQ978629.1 Harmonia axyridis voucher 08SOCOL-0010 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial 740 740 92% 0 89% KM850971.1 Harmonia axyridis voucher BIOUG01807-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial 738 738 92% 0 89% KR482422.1 Harmonia axyridis voucher GBOL_Col_FK_0266 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial 738 738 92% 0 89% KM447361.1 Harmonia axyridis voucher BIOUG01771-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial 737 737 92% 0 89% KR482435.1 Coccinellidae sp. BOLD:AAB5640 voucher BIOUG17323-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mito 737 737 92% 89% KR480860.1 Harmonia axyridis voucher 08SOCOL-0113 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial 737 737 92% 0 89% KM849820.1 0 Harmonia axyridis voucher ADU004 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial 737 737 92% 89% KC135950.1 Harmonia axyridis mitochondrial partial COI gene for cytochrome c oxidase subunit I, individual 1 737 737 92% 0 89% AM403518.1 0 Query 7 Sbjct 1273 ACATCGTTAAGTATTTTAATTCGG-TAG----ATGAACTAGAGGAAGATTAATTGGCAAC |||||||||||||||||||||||| ||| | |||||||||||||||||||||| ||| ACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAAC GACCAAATTTTTA--ATTATTGCGACAGCTCATGCTTTCATTATAATTATCTTTATAGTA |||||||||| || || |||| |||||||||||||||||||||||| ||||||||||| GACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTA ATAC---TTTTAATTGGGGGTTTT-GAAATTGATTAGTTCC-TTAATAATT-GAGC-CCT |||| || |||||||||||||| |||||||||||||||| ||||||||| |||| ||| ATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCTCCT ATCATAAAGATATTGGAACATTATACTTTTTACTTGGAATATGGGGCAGGA--TGTAGGA |||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||| ATCATAAAGATATTGGAACATTATACTTTTTATTTGGAATAT-GGGCAGGAATAGTAGGA 1331 64 Query 65 Sbjct 1332 Query 120 Sbjct 1392 Query 178 Sbjct 1452 119 1391 177 1451 230 1511