b-Catenin Pathway Is a Transcriptional Regulator of CYP2E1 ...molpharm.aspetjournals.org/content/molpharm/86/6/624.full.pdf · methyl-1H-imidazol-2-yl)pyrimidin-2-yl)am ino)ethyl)amino)

1521-0111/86/6/624–634$25.00 http://dx.doi.org/10.1124/mol.114.094797MOLECULAR PHARMACOLOGY Mol Pharmacol 86:624–634, December 2014Copyright ª 2014 by The American Society for Pharmacology and Experimental Therapeutics

The WNT/b-Catenin Pathway Is a Transcriptional Regulator ofCYP2E1, CYP1A2, and Aryl Hydrocarbon Receptor GeneExpression in Primary Human Hepatocytes

Sabine Gerbal-Chaloin, Anne-Sophie Dumé, Philippe Briolotti, Sylvie Klieber, Edith Raulet,Cédric Duret, Jean-Michel Fabre, Jeanne Ramos, Patrick Maurel, and Martine Daujat-ChavanieuInstitut de Recherche en Biothérapie, INSERM, U1040 (S.G.C., A.S.D., P.B., E.R., C.D., P.M., M.D.C.); UMR 1040, UniversitéMontpellier 1 (S.G.C., A.S.D., P.B., E.R., C.D., P.M., M.D.C.); Drug Disposition Domain, Sanofi Aventis (S.K.); Department ofDigestive Surgery, CHU Saint Eloi (J.M.F.); Pathological Anatomy Department, CHU Gui de Chauliac (J.R.); and Institut deRecherche en Biothérapie, CHU Montpellier, (M.D.C.), Montpellier, France

Received July 18, 2014; accepted September 16, 2014

ABSTRACTThe wingless-type MMTV integration site family (WNT)/b-catenin/adenomatous polyposis coli (CTNNB1/APC) pathway has beenidentified as a regulator of drug-metabolizing enzymes in therodent liver. Conversely, little is known about the role of thispathway in drug metabolism regulation in human liver. Primaryhuman hepatocytes (PHHs), which are the most physiologicallyrelevant culture system to study drug metabolism in vitro, wereused to investigate this issue. This study assessed the link betweencytochrome P450 expression and WNT/b-catenin pathway activityin PHHs by modulating its activity with recombinant mouse Wnt3a(the canonical activator), inhibitors of glycogen synthase kinase 3b,and small-interfering RNA to invalidate CTNNB1 or its repressorAPC, used separately or in combination. We found that the WNT/b-catenin pathway can be activated in PHHs, as assessed by

universal b-catenin target gene expression, leucine-rich repeatcontaining G protein–coupled receptor 5. Moreover, WNT/b-catenin pathway activation induces the expression of CYP2E1,CYP1A2, and aryl hydrocarbon receptor, but not of CYP3A4,hepatocyte nuclear factor-4a, or pregnane X receptor (PXR) in PHHs.Specifically, we show for the first time that CYP2E1 is transcription-ally regulated by the WNT/b-catenin pathway. Moreover, CYP2E1induction was accompanied by an increase in its metabolic activity,as indicated by the increased production of 6-OH-chlorzoxazoneand by glutathione depletion after incubation with high doses ofacetaminophen. In conclusion, the WNT/b-catenin pathway isfunctional in PHHs, and its induction in PHHs represents a powerfultool to evaluate the hepatotoxicity of drugs that are metabolized byCYP2E1.

IntroductionThe liver performs many different functions thanks to the

organization of hepatocytes in different functional groups, aremarkable property known as functional zonation. Hepato-cytes present highly specialized metabolic functions from theportal space to the centrilobular vein and based on theirlocalization are defined, respectively, as periportal and pericentralhepatocytes. Recently, the wingless-type MMTV integration sitefamily (WNT)/b-catenin-adenomatous polyposis coli (APC) path-way has been identified as the major liver “zonation-keeper”(Benhamouche et al., 2006; Colnot and Perret, 2010).The expression and localization of b-catenin (CTNNB1) are

tightly regulated. In the absence of WNT ligand stimulation,

CTNNB1 is phosphorylated by a protein complex that includesglycogen synthase kinase 3b (GSK3b) and APC, leading to itsproteasomal degradation. In the presence of WNT ligands,CTNNB1 remains unphosphorylated and accumulates in thecytosol. It then translocates into the nucleus where it trans-activates target genes by binding to transcriptional activatorsof the T-cell factor/lymphoid-enhancing factor (TCF/Lef) family(MacDonald et al., 2009). In parallel to its transcriptionalactivity, CTNNB1 participates in adherens junction formationby interacting with E-cadherin and a-catenin, linking cadherinsto the actin cytoskeleton (Vinken et al., 2006).Detoxification of exogenous compounds is one of the liver

major metabolic functions and is mediated by a large family ofproteins, including the phase I cytochrome P450 enzymes(P450). P450 expression is regulated by transcription factors,including hepatocyte nuclear factor-4a (HNF4a) and nuclearreceptors such as constitutive androstane receptor (CAR,NR1I3,

This work was supported by the InnovativeMedicine Initiative Joint Undertaking(IMI JU) [Grant 115001] (MARCAR project, URL:http://www.imi-marcar.eu/).

dx.doi.org/10.1124/mol.114.094797.

ABBREVIATIONS: AhR, aryl hydrocarbon receptor; APAP, acetaminophen; APC, adenomatous polyposis coli; CHIR99021, CHIR, 6-((2-((4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2-yl)amino)ethyl)amino) nicotinonitrile; CTNNB1, b-catenin; DKK-3, Dickkopf-3; GLUL,glutamine synthetase; GSH, glutathione; GSK3b, glycogen synthase kinase 3b; HNF4a, hepatocyte nuclear factor-4a; KRT19, cytokeratin 19;LGR5, leucine-rich repeat containing G protein–coupled receptor 5; P450, cytochrome P450; PHH, primary human hepatocyte; PXR, pregnane Xreceptor; RIF, rifampicin; siRNA, small-interfering RNA; TCF/Lef, T-cell factor/lymphoid-enhancing factor transcriptional activator; RT-qPCR,reverse transcription real-time quantitative polymerase chain reaction; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxine; WNT, wingless-type MMTVintegration site family.

624

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

nuclear receptor subfamily 1, group i, member 3), pregnane Xreceptor (PXR, NR1I2), and aryl hydrocarbon receptor (AhR) ofthe basic Helix-Loop-Helix/Per-ARNT-Sim (bHLH/PAS) recep-tor family, which are the major regulators of drug disposition(Kohle and Bock, 2009).Histologic analysis of liver sections (Hailfinger et al., 2006;

Sekine et al., 2006; Braeuning et al., 2009), microarray andreal-time quantitative polymerase chain reaction analysis ofenriched periportal and centrilobular hepatocytes (Braeuninget al., 2006; Sekine et al., 2006) have shown that, in the mouse,Cyp2e1, Cyp1a2, and AhR are expressed in pericentralhepatocytes, where the Wnt/b-catenin pathway is mostlyactivated.Genetic manipulation of animals is a powerful tool to

dissect the complexity of liver zonation. In hepatocyte-specificCtnnb1 knockout mice, loss of expression of several P450enzymes, especially Cyp2e1 and Cyp1a2, has been observed(Sekine et al., 2006). Moreover, the basal expression of mostdrug metabolism-related genes and the response to NR1I3and AhR agonists are also reduced in these mice (Braeuninget al., 2009; Ganzenberg et al., 2013). Similarly, acetamino-phen (APAP)-induced toxicity is abolished in Ctnnb12/2 mice(Sekine et al., 2006). Conversely, several P450 isoenzymes areup-regulated in liver tumors harboring CTNNB1-activatingmutations (Loeppen et al., 2005). Liver-specific Apc loss causesthe de novo expression of b-catenin–positive pericentral genesand the suppression of b-catenin–negative periportal targetgenes (Benhamouche et al., 2006).Primary human hepatocytes (PHHs) are the most physio-

logically relevant culture system to study drug metabolism invitro. However, when hepatocytes are seeded in culture, zonalorganization is lost, and P450 expression progressively decreases.As nothing is known about the link between P450 expression andb-catenin pathway activity in PHHs, we decided to investigatethis aspect using our in vitro model of PHHs. We demonstratedthat the b-catenin pathway can be activated in PHHs, despite theloss of the organization, to restore the expression of its targetgenes. We identified CYP2E1, CYP1A2, and AhR as CTNNB1target genes, whereas CYP3A4, HNF4a, and PXR are notdirectly regulated by this pathway. Moreover, CYP2E1 in-duction is accompanied by an increase of APAP-induced toxicityin PHHs.

Materials and MethodsHuman Liver Samples and Preparation of Primary Human

Hepatocytes. Liver samples were obtained from liver resectionsperformed in adult patients for medical reasons unrelated to ourresearch program. The use of human specimens for scientific purposeswas approved by the French National Ethics Committee. Written ororal informed consent was obtained from each patient or family beforesurgery. The clinical characteristics of the liver donors are presentedin Table 1. PHHs were prepared and cultured as described previouslyelsewhere (Pichard et al., 2006). PHHs were seeded in collagen-coateddishes at 1.7 � 105 cells/cm2 in a hormonally and chemically definedmedium consisting of a mixture of William’s E and Ham’s F-12 (1:1 involume) and additives as described by Ferrini et al. (1997). PHHswere cultured in a 5% CO2 humidified atmosphere at 37°C.

Chemicals. CHIR99021 (CHIR) [6-((2-((4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2-yl)amino)ethyl)amino) nicotinonitrile]was obtained from BioVision (Milpitas, CA). TCDD (2,3,7,8-tetrachlorodibenzo-p-dioxine), rifampicin (RIF), and lithium chloridewere purchased from Sigma-Aldrich (Saint-Louis, MO), and mWnt3awas obtained from Peprotech (Neuilly-Sur-Seine, France).

Cell Lines. The HepaRG cell line was grown and differentiated asrecommended by Parent et al. (2004). Briefly, cells were seeded at2.6 � 104 cells/cm2 and expanded in growth medium for 2 weeks, thendifferentiated by the addition of 1.5% dimethylsulfoxide for 2 weeks.HepG2-C3 (American Type Culture Collection, Manassas, VA) andHuH7 (Japanese Collection of Research Bioresources Cell Bank, Osaka,Japan) cells were cultured as recommended. CHIR was added toHepG2-C3 and HuH7 cells when they reached 80% confluence and todifferentiated HepaRG cells. Cell lines were cultured in a 5% CO2

humidified atmosphere at 37°C.Small-Interfering RNA Transient Transfection. Adherent

PHHs were transfected with 20 nM nontargeting small-interferingRNA (siRNA) (scrambled, siSC) or siRNA specific for CTNNB1, APC,or AhR (Dharmacon, Lafayette, CO) at day 1 and day 3 after seedingusing Lipofectamine RNAiMAX (Life Technologies, Carlsbad, CA).At day 5 after seeding, PHHs were treated for 48 hours.

DNA and Reporter Gene Expression Assays. PHHs in suspen-sion were transfected with Lipofectamine 2000 transfection reagent(Life Technologies) according to the manufacturer’s instructions beforeplating. Briefly, 2.7 � 104 PHHs were transfected with either 500 ngof firefly luciferase reporter plasmids SuperTOPflash (Wnt responseelement, WRE) or SuperFOPflash (mutated WRE) (Staal et al., 1999)and 250 ng of pTK-luc Renilla control vector (Promega, Madison, WI).PHHs were then plated in 24-well plates in DNA:liposome mix inchemically defined medium. After 24 hours, the medium was renewed,and the cells were treated with 3 mM CHIR, 200 ng/ml mWnt3a, or20 mM LiCl for 24 hours.

RNA Isolation and Reverse Transcription Polymerase ChainReaction. After extraction with TRIzol reagent (Invitrogen/Life Tech-nologies, Carlsbad, CA), 500 ng of total RNA was reverse-transcribedusing a random hexaprimer and the MMLV Reverse Transcriptase Kit(Invitrogen). Quantitative polymerase chain reaction was performedusing the Roche SYBERGreen reagent and a LightCycler 480 apparatus(Roche Diagnostic, Meylan, France). Amplification specificity was evaluatedby determining the product melting curve. Results are expressed asindicated in the figure legends. The primers used were listed in Table 2.The following program was used: one step at 95°C for 10 minutes,50 cycles of denaturation at 95°C for 10 seconds, annealing at 65°C for15 seconds, and elongation at 72°C for 15 seconds.

Protein Analysis. Total protein extracts were prepared usinga radioimmunoprecipitation assay buffer supplemented with a pro-tease inhibitor cocktail (Santa Cruz Biotechnology, Santa Cruz, CA).The protein concentration was determined by the bicinchoninic acidmethod, according to the manufacturer’s instructions (Pierce Chem-ical, Rockford, IL). Bovine serum albumin (Pierce Chemical) was usedas standard. We separated 20 mg of total proteins on precast SDS-polyacrylamide gels (4–16%) (Bio-Rad Laboratories, Marnes la Coquette,

TABLE 1Clinical characteristics of the liver donors

Liver Identification Sex Age Pathology

PHH351 M 75 Metastasis of urothelial cancerPHH353 M 60 Metastasis of colorectal cancerPHH354 F 53 Metastasis of neuroendocrine tumorPHH356 M 42 Organ donorPHH358 F 45 Metastasis of endocrine tumorPHH359 M 58 Hepatocellular carcinomaPHH361 F 67 CholangiocarcinomaPHH365 M 70 Abscess of engrafted liverPHH366 M 62 Metastasis of colorectal cancerPHH367 M 59 CholangiocarcinomaPHH374 F 41 AdenomaPHH376 M 77 Hepatocellular carcinomaPHH377 M 58 CholangiocarcinomaPHH378 M 72 CholangiocarcinomaPHH381 M 70 Metastasis of colorectal cancerPHH382 M 70 Metastasis of GISTPHH383 F 37 Angioma

b-Catenin Regulates Drug Metabolism 625

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

France), then transferred them onto polyvinylidene fluoride membranes(Bio-Rad Laboratories). Membranes were incubated with rabbit polyclonalanti-CYP2E1 (Millipore, Molsheim, France) or anti-CTNNB1 (Abcam,Cambridge, UK), mouse monoclonal anti-CYP1A2 (Santa Cruz Bio-technology), or goat polyclonal anti-actin (Santa Cruz Biotechnology)antibodies. Microsomes from human lymphoblastoid cells transfectedwith the human CYP2E1 (Gentest, Woburn, MA) were used as standards.

Immunohistochemistry. Paraffin-embedded human liver tissuesections (4 mm thick) were incubated at 4°C with rabbit antibodiesagainst CYP3A4 (Epitomics, Burlingame, CA), cytokeratin 19 (KRT19,Epitomics), CYP2E1 (Millipore), glutamine synthetase (GLUL) (AbnovaCorporation, Taipei, Taiwan), or mouse antibody against CYP1A2 (SantaCruz Biotechnology). Immunohistochemical staining was performedusing the EnVisionTM1 System (Dako, Glostrup, Denmark) accordingto the manufacturer’s recommendations. Finally, sections were lightlycounterstained with Harris hematoxylin. Slides were scanned(Montpellier RIO Imaging Facility, INM Montpellier, France) usingaNanozoomer Slide Scanner (Hamamatsu Photonics, Massy, France), andvirtual slides were viewed using the NDP.view software (HamamatsuPhotonics, Massy, France).

Measurement of Chlorzoxazone Hydroxylation. After 72 hoursof treatment with 3 mM CHIR, the PHH culture medium was renewedin the presence of 15 mM chlorzoxazone (Sigma-Aldrich). Six hourslater, extracellular medium and cells were collected, and the 6-OHchlorzoxazone content was measured by liquid chromatography withtandem mass spectrometry using an Acquity UPLC System I-Classequipped with aWaters Acquity UPLCBEHC18 column (2.1mm i.d.�100 mm length, 1.7-mm particle size) coupled to a Quattro Premiermass spectrometer (all from Waters Corporation, Milford, MA) used inelectrospray ion negative mode.

Measurement of Glutathione Content. After a 72-hour incubationwith 3 mM CHIR, the PHH culture medium was renewed, and 20 or50 mM APAP was added (Sigma-Aldrich). Six hours later, the cellswere collected, and the glutathione (GSH) content was measuredusing a glutathione assay kit (Cayman Chemical, Ann Arbor, MI)according to the manufacturer’s instructions. Results are expressedas the quantity of GSH lost in APAP-treated cells compared withnontreated cells.

Statistical Analysis. The values of mRNA expression were expressedas the mean 6 standard error of the mean (S.E.M.). Statistical analysisbetween groups was performed by using the paired t test. Analysis of thevariance was used to determine statistical differences, and the Tukey’smultiple comparison test was performed to compare three groups.Differences were considered statistically significant when P, 0.05 (*P,0.05, **P, 0.01, ***P, 0.001). Data were analyzed by using GraphPadPrism, version 4.0, 2003 (GraphPad Software, San Diego, CA).

ResultsThe Canonical Wnt/b-Catenin Pathway Is Functional

in PHHs. When human hepatocytes are seeded in culture,zonation is lost, and P450 expression progressively decreases.As in vivo zonation is mainly controlled by theWNT/b-catenin

pathway, we first determined whether this pathway can stillcontrol gene transcription in PHHs independently of zonalorganization. To this end, we monitored the expression ofleucine-rich repeat containing G protein–coupled receptor 5(LGR5 orGPR49), a universal b-catenin target gene (Yamamotoet al., 2003), in PHHs that were cultured according to ourestablished long-term culture conditions (Pichard et al., 2006).LGR5 expression was progressively and strongly reducedduring culture. Conversely, the expression of APC andGSK3b,which are involved in CTNNB1 proteasomal degradation, andDickkopf-3 (DKK3), a member of the DKK family of WNTantagonists, increased over time (Fig. 1A). These results suggestthat CTNNB1 signaling is gradually down-regulated duringPHH culture.Then, to determine whether the WNT/b-catenin pathway

could be activated in PHHs, we exposed the cells or not torecombinant mouse Wnt3a (mWnt3a, the canonical activatorof this pathway) or to the GSK3b inhibitors CHIR99021(Ring et al., 2003) and LiCl (Abu-Baker et al., 2013) for 48hours (day 2 to day 4 of culture); we then analyzed the mRNAexpression of the target gene LGR5 by reverse-transcriptionreal-time quantitative polymerase chain reaction (RT-qPCR).As expected,LGR5was induced by all these compounds, but itsexpression was not affected by TCDD or RIF, the prototypicalAhR and PXR activators, respectively (Fig. 1B). Moreover, thePHH response to GSK3b inhibition or to mWnt3a showeda significant interindividual variability (Fig. 1, C and D).To demonstrate the ability of CTNNB1 to activate the TCF/

Lef responsive element after exposure to mWnt3a, LiCl,or CHIR, PHHs were transfected with TOP-luc (black bars)or FOP-luc plasmids (white bars) that harbor consensus ormutated TCF/Lef responsive elements, respectively. Afterincubation with 3 mM CHIR for 24 hours, a 3-fold increase inluciferase activity was observed in TOP-luc transfected cellscompared with untreated cells, but it remained unchanged inFOP-luc transfected cells (Fig. 2A). Induction of the WNT/b-catenin pathway by the canonical CTNNB1 activatormWnt3a or LiCl also stimulated luciferase activity, althoughto a lesser extent than CHIR.The involvement of the WNT/b-catenin pathway in Wnt3a-

and CHIR-mediated LGR5 up-regulation was confirmed bysiRNA-mediated down-regulation of CTNNB1 or APC in PHHs.APC is involved in CTNNB1 degradation, and its inactivationresults in CTNNB1 accumulation, thereby mimicking theactivation of the WNT/b-catenin pathway (Colnot et al.,2004; Burke et al., 2009). The specific siRNAs efficientlyknocked down APC (by 70%) and CTNNB1 (by 90%) mRNAexpression in PHHs (data not shown). Wnt3a- and CHIR-mediatedLGR5 up-regulation was abolished (Fig. 2B) in CTNNB1-silenced

TABLE 2Primer pair sequences

Gene Name Forward Primers Reverse Primers

AhR ATCAGTGCCAGCCAGAACCTC AGGTCTGGCTTCTGACGGATGAPC CACACTTCCAACTTCTCGCAACG AGGCTGCATGAGAGCACTTGTGCYP1A2 CATCCCCCACAGCACAACAA TCCCACTTGGCCAGGACTTCCYP2E1 GACTGTGGCCGACCTGTT ACTACGACTGTGCCCTTGGCYP3A4 GCCTGGTGCTCCTCTATCTA GGTGTTGACCATCATAAAGDKK3 GTGCATCATCGACGAGGACTGT TGGTCTCCACAGCACTCACTGTGSK3b CCGACTAACACCACTGGAAGCT AGGATGGTAGCCAGAGGTGGALGR5 CCTGCTTGACTTTGAGGAAGACC CCAGCCATCAAGCAGGTGTTCAPXR GGACCAGCTGCAGGAGCAAT CATGAGGGGCGTAGCAAAGG

626 Gerbal-Chaloin et al.

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

PHHs but not in control cells (scrambled siRNA, siSC). Conversely,LGR5 basal expressionwas significantly increased inAPC-silencedPHHs in comparison with siSC controls (Fig. 2B), confirming thatLGR5 is aWNT/b-catenin pathway target and thatCHIR-mediated

LGR5 up-regulation is dependent on CTNNB1. Similar resultswere obtained using hepatic cell lines in which the WNT/b-catenin pathway is functional, such as HuH7 cells anddifferentiated HepaRG cells, or that harbor CTNNB1-activating

Fig. 1. The b-catenin pathway can be activated in PHHs. (A) RT-qPCR analysis of LGR5, APC, GSK3b, and DKK3 gene expression over time (maximalexpression was arbitrary fixed to 100) (n = 3). (B) RT-qPCR analysis of LGR5 mRNA expression after 48 hours of incubation with 10 or 20 mM LiCl,100 or 200 ng/ml mWnt3a, 1 or 3 mM CHIR, 10 nM TCDD, or 10 mM RIF (n = 4). RT-qPCR analysis of LGR5 mRNA expression in PHHs from differentliver donors (PHH365, PHH359, and PHH366) incubated at day 2 after seeding with (C) 1, 3, or 10 mM CHIR (D) 100, 200, or 400 ng/ml mWnt3a for48 hours. D, day; FIH, freshly isolated hepatocytes; nd, not detected; UT, untreated.

Fig. 2. The b-catenin pathway can beactivated in PHHs. (A) Luciferase activitymeasurement in PHHs transfected withthe TK-FOP-luc (white bars) or TK-TOP-luc (black bars) plasmids and incubated24 hours later with 3 mM CHIR, 20 mMLiCl, or 200 ng/ml mWnt3a for 24 hours.(B) RT-qPCR analysis of LGR5 expressionin PHHs after siRNA-mediated CTNNB1silencing and incubation with 200 ng/mlmWnt3a or 3 mMCHIR for 24 hours (n = 5)or after siRNA-mediated APC silencing(n = 3). (C) RT-qPCR analysis of LGR5mRNA expression in HepG2-C3A, HuH7or differentiated HepaRG cells incubatedwith 3 mM CHIR for 48 hours. nd, notdetected.

b-Catenin Regulates Drug Metabolism 627

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

mutations, such as HepG2-C3 cells (de La Coste et al., 1998).Incubationwith 3mMCHIR for 48 hours increased the expressionof LGR5 in HuH7 and HepaRG cells but not in HepG2-C3 cells,confirming that the response to CHIR relies on a functionalWNT/b-catenin pathway (Fig. 2C).These findings indicate that in PHHs the canonical WNT/

b-catenin signaling pathway is still functional and can beactivated directly by the canonical activator mWnt3a orindirectly by the GSK3b inhibitor CHIR.P450s Regulation by the WNT/b-Catenin Signaling

Pathway. P450 expression is zonated in human liver tissue.Immunohistochemical analysis of human liver tissue serialsections showed that CYP2E1, CYP1A2, and CYP3A4 are ex-pressed in pericentral hepatocytes (Fig. 3A), similarly to GLUL,a well known pericentral marker. Conversely, cytokeratin19-positive (KRT191) biliary cells are indicative of periportalareas. As observed for the CTNNB1 target gene LGR5 (Fig. 1A),P450 expression was progressively down-regulated in culturedPHHs (Fig. 3B). Therefore, we asked whether this resulted fromthe loss of CTNNB1-mediated gene transcription.CYP2E1. CYP2E1 is expressed in pericentral hepatocytes

[Fig. 3 for human; Loeppen et al. (2005), Hailfinger et al.(2006), and Sekine et al. (2006) for mouse liver] where theWNT/b-catenin pathway is mostly active (Benhamouche et al.,2006). To assess the effect of the WNT/b-catenin pathwayactivation on CYP2E1 expression in PHHs, we incubatedcultures with mWnt3a (the canonical CTNNB1 activator) orwith GSK3b inhibitors (LiCl and CHIR). Upon induction of theWNT/b-catenin pathway, CYPE21 mRNA expression increased

in a dose-dependent manner compared with untreated cells.As expected,CYPE21mRNA expression was not affected by TCDDor RIF (Fig. 4A). Up-regulation of CYP2E1 by mWnt3a- and CHIRwas abolished in PHHs in which CTNNB1 was silenced by siRNAdown-regulation, indicating that this effect is dependent onCTNNB1 (Fig. 4B). Conversely, APC silencing increasedCYP2E1basal expression (Fig. 4B), as observed for LGR5 (Fig. 2B),compared with control cells (siSC). These findings demonstratethat the canonical activator mWnt3a and the GSK3b inhibitorCHIR can regulate CYP2E1 mRNA expression in a CTNNB1-dependentmanner. As CHIR was themost efficient and easy touse activator of the WNT/b-catenin pathway, we preferentiallyemployed it in the subsequent experiments.Analysis of 14 different PHH cultures confirmed that CHIR

strongly inducedCYP2E1mRNA expression (mean fold changeandmedian: 12.6 and10.0) comparedwithuntreated cells (Fig. 5A).Like for LGR5 (Fig. 2C) and as previously described for otherhumanP450s (Gomez-Lechon et al., 2007), a strong interindividualvariation was observed. However, there was no correlationbetween the clinical characteristics of the liver donor and thelevel of CYP2E1 induction in PHHs. CYP2E1 mRNA (Fig. 5B)and protein (Fig. 5C) expression were followed in PHHs culturedfor 4 to 5 days. BasalCYP2E1 expression decreased rapidly overtime; however, exposure to 3 mM CHIR from day 2 of culturesignificantly increased CYP2E1 mRNA and protein levels.CHIR-mediated CYP2E1 protein induction was abolished bysiRNA-mediated CTNNB1 down-regulation, but it was mark-edly increased after silencing of APC (Fig. 5D). Moreover,CYP2E1 enzymatic activity in PHHs was confirmed by adding

Fig. 3. Pericentral expression of CYP2E1, CYP1A2,and CYP3A4. (A) Analysis of CYP2E1, CYP1A2,CYP3A4, GLUL, and KRT19 expression in serialhuman liver tissue sections by immunohistochemis-try. Scale bars = 1 mm. (B) RT-qPCR analysis ofCYP2E1, CYP1A2, and CYP3A4 gene expressionover time (expression in FIH was arbitrary fixed to100) (n = 3). CT, control without antibody; D, day;FIH, freshly isolated hepatocytes.

628 Gerbal-Chaloin et al.

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

chlorzoxazone, a CYP2E1-specific substrate, to the cultures.A 5-fold increase in the production of its metabolite 6-OH-chlorzoxazone was observed in cells incubated with CHIR for72 hours compared with untreated cells (Fig. 5E).CYP2E1 also contributes to APAP metabolism by catalyz-

ing the production of the reactive intermediate N-acetyl-p-benzoquinoneimine, which is normally rapidly detoxified byglutathione (GSH) conjugation in the liver. Therefore, in caseof APAP overdose, this intermediate can lead to GSH depletionand to hepatotoxicity (James et al., 2003). Conversely, Ctnnb12/2

mice are resistant to APAP-induced toxicity (Sekine et al., 2006).Quantification of the GSH content in PHHs stimulated withCHIR for 72 hours and incubated with 20 or 50 mMAPAP forthe last 6 hours showed a strong GSH depletion comparedwith controls cells (untreated cells, no CHIR stimulation)(Fig. 5F).In hepatic cell lines, basal CYP2E1 mRNA expression was

low and was up-regulated in response to CHIR exposure onlyin differentiated HepaRG cells, but not in HepG2-C3 andHuH7 cells (Fig. 5G). This suggests that activation of theWNT/b-catenin pathway is not sufficient per se to induceCYP2E1 expression and underlines the importance of a dif-ferentiated hepatic context for full regulation.These findings demonstrate for the first time that CYP2E1

is transcriptionally up-regulated after CTNNB1 activation inPHHs.CYP1A2. CYP1A2mRNA expression also was increased in

PHHs after incubation with mWnt3a exposure, suggestingthat CTNNB1 participates in the regulation ofCYP1A2 expressionin PHHs (Fig. 6A). We evaluated the role the Wnt/b-cateninpathway in CYP1A2 regulation also by siRNA-mediated down-regulation of CTNNB1, APC, and AhR (as a positive controlbecause CYP1A2 is a known AhR target gene). CYP1A2 basalexpressionwas not affected byCTNNB1 down-regulation (Fig. 6B),but CYP1A2 mRNA and protein expression (Fig. 6B and 6C) werestrongly increased upon APC silencing compared with thecells transfected with scrambled siRNA (siSC). As previouslydescribed elsewhere (Lee et al., 2011), AhR down-regulationsignificantly decreased basal CYP1A2 mRNA expression(Fig. 6B). Similarly, CYP1A2 up-regulation upon incubationwithTCDD (dioxin)was not affected by siRNA-mediatedCTNNB1silencing, but it was increased upon APC down-regulation

compared with control cells (siSC). As expected, CYP1A2 in-duction was strongly reduced in AhR-silenced cells (Fig. 6D)because TCDD needs to bind to AhR to act as a transcriptionalregulator (Fujii-Kuriyama and Mimura, 2005). Finally, weassessed whether AhR expression was also regulated byCTNNB1 in PHHs. AhR mRNA expression was increasedin a dose-dependent manner by incubation with mWnt3acompared with untreated cells. A similar effect was observedafter APC silencing (Fig. 6F), but CTNNB1 down-regulationhad no effect compared with control siRNA.CYP3A4. Differently from CYP2E1 and CYP1A2, CYP3A4

mRNA expression in PHHs was not induced by incubationwith mWnt3a, the canonical activator of the CTNNB1 pathway.Conversely, and as expected, it was strongly induced by RIF,a well known PXR activator, compared with untreated cells (Fig.7A). Thus, although in vivo CYP2E1 and CYP3A4 showed similarzonal expression (Fig. 3), the basal expression of CYP3A4 inPHHs does not seem to be regulated by the CTNNB1 pathway.Similarly,CYP3A4 induction byRIFwasnot affected byCTNNB1down-regulation or activation via APC siRNA silencing (Fig. 7B).PXRmRNA expression also was not affected byCTNNB1 orAPCdown-regulation, or incubation with Wnt3a (not shown). More-over, expression of HNF4, another factor involved in CYP3A4regulation (Jover et al., 2001), was not affected by CTNNB1 orAPC silencing or stimulation with Wnt3a (not shown). Theseresults indicate that CYP3A4 basal expression and its PXR-mediated induction are independent of CTNNB1 and APC in ourmodel of PHH culture.

DiscussionWe evaluated the impact of the WNT/b-catenin pathway,

which has been described as the main zonation keeper inthe liver lobule (Benhamouche et al., 2006), on P450 geneexpression in PHHs. When hepatocytes are seeded in culture,zonation is lost, and the expression of WNT/b-catenin targetgenes and P450s is concomitantly reduced. We thus hypoth-esized that by restoring the activity of the WNT/b-cateninpathway we could restore P450 expression in PHHs, despitethe loss of the zonal organization. Here, we show that theexpression of the CTNNB1 target gene LGR5 can be restoredin PHHs upon activation of the WNT/b-catenin signaling

Fig. 4. CYP2E1 is a CTNNB1 target gene. (A) RT-qPCR analysis ofCYP2E1mRNA expression after incubation with 10 or 20mMLiCl, 100 or 200 ng/mlmWnt3a, 1 or 3 mMCHIR, 10 nM TCDD, or 10 mMRIF. (B) RT-qPCR analysis of CYP2E1mRNA expression in PHHs after siRNA-mediated CTNNB1 orAPC down-regulation and incubation with CHIR 3 mM or 200ng/ml mWnt3a. ND, not determined.

b-Catenin Regulates Drug Metabolism 629

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

pathway. Moreover, we report for the first time that CYP2E1expression is transcriptionally regulated by CTNNB1 and thatis a true marker of CTNNB1 activity in PHHs.The activity of theWNT/b-catenin pathway has been studied

in various in vitro cell models, such as colon cancer cell lines(Verma et al., 2003), embryonic stem cells (Kielman et al., 2002;Sato et al., 2004), or isolated mouse hepatocytes (Hailfingeret al., 2006). Here, we show that the WNT/b-catenin pathwaycan also be reactivated in PHHs by stimuli that trigger thissignaling cascade at different levels. First, we used the canonicalactivator WNT. However, the effect of WNT depends on theexpression level of positive/negative effectors of theWNT/b-cateninpathway, which can vary with time in PHHs. For instance, the

progressive increase of DKK3 expression, an antagonist of theWNT/b-catenin pathway (Veeck and Dahl, 2012), during PHHculture could explain the lower ability of mWnt3a to activate theWNT/b-catenin pathway in comparison with other compoundsused in thiswork. Thenwe inhibitedGSK3b byusingCHIR99021,which is considered one of the most specific GSK3b inhibitors(Cohen and Goedert, 2004) and has been widely used in stemcell studies (Li et al., 2012). Finally, we down-regulated APC.APC inhibits b-catenin–dependent transcription by providinga scaffold for the destruction complex, by promoting its exportfrom the nucleus and by reducing its interaction with TCF.Moreover, APC expression in cancer cells causes nuclear andcytoplasmic translocation of b-catenin to the cell membrane

Fig. 5. CYP2E1 is a CTNNB1 target gene. (A) CYP2E1 induction in PHHs after incubation with 3 mMCHIR for 48 hours. Results are expressed as foldchange relative to untreated cells (UT) (n = 14). CYP2E1 mRNA (B) and protein (C) expression in PHHs before and after addition (or not) of 3 mMCHIRat day 2. One pmol of recombinant CYP2E1 (rCYP2E1) was used as control. (D) CYP2E1 protein expression in siRNA-transfected PHHs after incubationor not with 3 mM CHIR for 48 hours. (E) CYP2E1-mediated 6-OH chlorzoxazone production in PHHs (n = 2). (F) GSH content depletion in PHHsincubated or not with 3 mMCHIR for 72 hours and incubated with 20 or 50 mMAPAP for 6 hours. (G) RT-qPCR analysis ofCYP2E1mRNA expression inHepG2-C3A, HuH7 or differentiated HepaRG cells after incubation with 3 mM CHIR for 48 hours. Results are expressed as percentage of the CYP2E1mRNA expression level in PHHs at day 1 post-seeding. FIH, freshly isolated hepatocytes.

630 Gerbal-Chaloin et al.

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

(Aoki and Taketo, 2007). The increase of APCmRNA expressionin parallel with PHHs adhesion and polarization (Gondeau et al.,2014) could contribute toWNT/b-catenin pathway down-regulationin PHHs (Hanson and Miller, 2005).CYP2E1 has been extensively studied because of its

implication in many toxicologic and carcinogenic processes(Butura et al., 2009). CYP2E1metabolizes chemicals, includingAPAP, carbon tetrachloride, dimethylsulfoxide, and ethanol.We demonstrate for the first time that CYP2E1 expression andmetabolic activity can be restored through activation of theWNT/b-catenin pathway in PHHs, as indicated by the pro-duction of 6-OH chlorzoxazone and GSH depletion after exposureto APAP. This can thus constitute a useful model for studying

the role of CYP2E1 in the hepatotoxicity induced by APAP andother drugs.CYP2E1 protein and activity are often induced by its own

substrates through posttranscriptional mechanisms (Gonzalez,2007). Posttranscriptional regulation involves also CYP2E1mRNAstabilization (Woodcroft et al., 2002). In parallel,CYP2E1gene transcription is under the control of HNF1a in rathepatocytes (Liu and Gonzalez, 1995; Woodcroft et al., 2002),or interleukin-4 in a human hepatoma cell line (Lagadic-Gossmann et al., 2000). Here, we show that CYP2E1 can alsobe transcriptionally regulated by the WNT/b-catenin path-way in PHHs. Specifically, CYP2E1 expression was signif-icantly up-regulated in response to GSK3b inhibition (CHIR,

Fig. 6. CYP1A2 regulation in PHHs. (A) RT-qPCR analysis of CYP1A2 expression in PHHs after incubation, or not, with 100 or 200 ng/ml mWnt3a(n = 4). (B)CYP1A2mRNA expression afterCTNNB1, APC, orAhR silencing. (C) CYP1A2 protein expression in PHHs after siRNA-mediatedAPC silencing.(D) CYP1A2 mRNA expression after CTNNB1, APC, or AhR silencing and incubation with 10 nM TCDD for 24 hours. Results are expressed as foldchange relative to untreated hepatocytes (UT). (E) RT-qPCR analysis of AhR expression in PHHs after incubation or not, with 100 or 200 ng/ml mWnt3a.(F) AhR mRNA expression after CTNNB1, APC, or AhR silencing. siSC, scrambled siRNA.

b-Catenin Regulates Drug Metabolism 631

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

LiCl) or CTNNB1 stimulation (mWnt3a, APC silencing),demonstrating that CYP2E1 is a true CTNNB1 target gene.This is in agreement with data obtained in Ctnnb12/2 micewhere CYP2E1 gene expression is lost (Sekine et al., 2006;Tan et al., 2006) but its expression is increased in mouse(Loeppen et al., 2005) and human (Schmidt et al., 2011) livertumors harboring Ctnnb1-activating mutations. Moreover,CYP2E1 expression is induced in primary mouse hepatocytesincubated in conditionedmedium frommWnt3a-producing 3T3fibroblasts (Hailfinger et al., 2006).However, the direct effect of b-catenin on the CYP2E1

promoter and the presence of a functional TCF/Lef responsiveelement need to be demonstrated. Indeed, direct binding ofTCF4 (coactivator for b-catenin) on the 5000-bp region spanningthe CYP2E1 promoter could not be demonstrated (Liu et al.,2012). Recently, using Chip-seq analysis, Gougelet et al. (2014)identified a WREmotif in a 100-kpb region in the upstream andintragenic regions of mouse Cyp2e1 but did not demonstrate itsfunctionality. An indirect effect via HNF1a transcriptionalactivity was also proposed (Gonzalez, 2006).Moreover, we demonstrated that CYP2E1 transcriptional

regulation by the WNT/b-catenin pathway is dependent onthe cell context. Its expression is induced in PHHs and indifferentiated HepaRG cells but not in hepatoma cell lines(HepG2-C3 andHuH7). The b-catenin pathway is constitutivelyactive in HepG2-C3 (very high LGR5 expression) withoutsignificant expression of CYP2E1 (Fig. 5G). Moreover, HNF1aexpression inHepG2-C3 cells and PHHs is comparable (Funakoshiet al., 2011).Thus, CYP2E1 is transcriptionally regulated by CTNNB1

inadirect or indirectmanner, and thepresence of other coregulatorsis certainly needed and has to be investigated. Whether theseobservations obtained in PHHs can be extrapolated to thephysiologic condition in human liver remains to be proven, butthe fact that CYP2E1 is expressed according to the b-cateninactivation in the liver lobule is in favor of this statement.CYP1A2 expression also is induced by mWnt3a in PHHs

(2- to 4-fold) and is strongly up-regulated upon APC down-regulation (100-fold), demonstrating a strong repressive activitymediated by APC. Cyp1a2 mRNA expression can be increasedby mWnt3a in isolated mouse hepatocytes and its expression isreduced in Ctnnb12/2mouse liver (Sekine et al., 2006; Braeuninget al., 2011).

CYP1A2 expression and induction are under the control ofnuclear receptors and transcription factors. AhR mRNA ex-pression in PHHs was increased by incubation with mWnt3aand after APC silencing. Centrilobular expression of AhR waspreviously reported (Lindros et al., 1997), and AhR expressionis increased inApc2/2 and decreased inCtnnb12/2mouse livers(Torre et al., 2011; Gougelet et al., 2014). As AhR participatesin CYP1A2 basal and induced expression, the positive effect ofb-catenin activation on CYP1A2 expression could therefore bedirect or indirect via AhR up-regulation, as recently suggested(Gougelet et al., 2014). AhR may therefore participate inb-catenin–mediated CYP1A2 regulation and pericentral zona-tion. Moreover, several studies suggest a cross-talk betweenb-catenin and AhR that seems to be very complex. Specifically,b-cateninmay act as a coactivator of AhR inmouse hepatocytes(Braeuning et al., 2011), and AhR participates in b-catenindegradation in mouse intestine (Kawajiri et al., 2009). Moreover,sustained activation of AhR by TCDD reduces the level ofb-catenin targets genes in WB-F344 cells (Prochazkova et al.,2011).On the other hand, our results indicate that, despite its

centrilobular expression in vivo (Ratanasavanh et al., 1991),CYP3A4 transcriptional regulation in PHHs is independentof b-catenin and APC expression and/or stimulation. This isin agreement with the finding that in early Ctnnb12/2 mice,Cyp3a11 mRNA expression is not affected (Sekine et al.,2006), whileCyp3a is slightly induced in male mice (Braeuninget al., 2009). Conversely, Cyp3a expression is reduced in theliver of male Ctnnb1loxP/loxP/TTR-Cre1 mice when Ctnnb1 isinvalidated in adulthood by injection of tamoxifen (Ganzenberget al., 2013). As observed for CYP3A4 induction by RIF inPHHs, Cyp3a induction by pregnenolone-a-carbonitrile was notaffected in Ctnnb12/2 mice (Braeuning et al., 2009). CYP3A4expression in PHHs might therefore be regulated throughother mechanisms. Indeed, CYP3A4 mRNA expression is up-regulated by the medium flow in PHHs (Vinci et al., 2011), andthe oxygen tension in rat hepatocytes (Allen and Bhatia, 2003).Alternatively, Cyp3a localization could also be regulated ina RAS/MAPK/ERK (Hailfinger et al., 2006; Braeuning et al.,2007), Dicer- (Sekine et al., 2009) or morphogen-dependentmanners (Gebhardt andHovhannisyan, 2010). Like forCYP3A4,expression of NR1I2 is independent of b-catenin and APC inPHHs, but can be moderately induced by mWnt3a in mouse

Fig. 7. CYP3A4 regulation in PHHs. (A) RT-qPCR analysis of CYP3A4 expression in PHHs after incubation or not with 100 or 200 ng/ml mWnt3a or10 mM RIF (n = 4). (B) CYP3A4 mRNA expression after CTNNB1 or APC silencing and treatment with 10 mM RIF for 24 hours. UT, untreated.

632 Gerbal-Chaloin et al.

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

hepatocytes (Braeuning et al., 2011) and is inhibited in femalesCtnnb12/2 mice (Braeuning et al., 2009).Finally, in contrast to observations in Ctnnb12/2 mice

(Sekine et al., 2006),CTNNB1 silencing in PHHs did not seemto have an effect on CYP2E1 and CYP1A2 basal expression.CTNNB1 silencing by siRNAs is a 4-day-long process, andduring this time the basal expression of CYP2E1 and CYP1A2progressively decreases in culture. Therefore, CTNNB1 invalida-tion has no further effect.However,AhRmRNAexpression,whichdid not change during PHH culture, was also unaffected byCTNNB1 silencing. As this gene is ubiquitously expressed inmost mammalian tissues (Le Carrour et al., 2010), its basalexpression is likely to be b-catenin independent, and othertranscription factors might contribute to its transcriptionalregulation. Similar observations were reported using ratWB-F344 progenitors cells (Prochazkova et al., 2011).In conclusion, the Wnt/b-catenin pathway is functional in

PHHs and constitutes a new regulatory network of drugmetabolism in human hepatocytes. CYP2E1, CYP1A2, andAhR are transcriptionally regulated by this pathway, whileCYP3A4, PXR, and HNF4a are not. Induction of the Wnt/b-catenin pathway in PHHs represents a powerful tool toevaluate hepatotoxicity of drugs that are metabolized byCYP2E1.

Authorship Contributions

Participated in research design: Gerbal-Chaloin, Daujat-Chavanieu.Conducted experiments: Gerbal-Chaloin, Dume, Briolotti, Klieber,

Raulet, Duret.Contributed new reagents or analytic tools: Fabre, Ramos.Performed data analysis: Gerbal-Chaloin, Daujat-Chavanieu.Wrote or contributed to the writing of the manuscript:Gerbal-Chaloin,

Maurel, Daujat-Chavanieu.

References

Abu-Baker A, Laganiere J, Gaudet R, Rochefort D, Brais B, Neri C, Dion PA,and Rouleau GA (2013) Lithium chloride attenuates cell death in oculopharyngealmuscular dystrophy by perturbing Wnt/b-catenin pathway. Cell Death Dis 4:e821.

Allen JW and Bhatia SN (2003) Formation of steady-state oxygen gradients in vitro:application to liver zonation. Biotechnol Bioeng 82:253–262.

Aoki K and Taketo MM (2007) Adenomatous polyposis coli (APC): a multi-functionaltumor suppressor gene. J Cell Sci 120:3327–3335.

Benhamouche S, Decaens T, Godard C, Chambrey R, Rickman DS, Moinard C,Vasseur-Cognet M, Kuo CJ, Kahn A, and Perret C et al. (2006) Apc tumor sup-pressor gene is the “zonation-keeper” of mouse liver. Dev Cell 10:759–770.

Braeuning A, Ittrich C, Köhle C, Hailfinger S, Bonin M, Buchmann A, and SchwarzM (2006) Differential gene expression in periportal and perivenous mouse hepa-tocytes. FEBS J 273:5051–5061.

Braeuning A, Köhle C, Buchmann A, and Schwarz M (2011) Coordinate regulation ofcytochrome P450 1a1 expression in mouse liver by the aryl hydrocarbon receptorand the beta-catenin pathway. Toxicol Sci 122:16–25.

Braeuning A, Menzel M, Kleinschnitz EM, Harada N, Tamai Y, Köhle C, BuchmannA, and Schwarz M (2007) Serum components and activated Ha-ras antagonizeexpression of perivenous marker genes stimulated by beta-catenin signaling inmouse hepatocytes. FEBS J 274:4766–4777.

Braeuning A, Sanna R, Huelsken J, and Schwarz M (2009) Inducibility of drug-metabolizing enzymes by xenobiotics in mice with liver-specific knockout of Ctnnb1.Drug Metab Dispos 37:1138–1145.

Burke ZD, Reed KR, Phesse TJ, Sansom OJ, Clarke AR, and Tosh D (2009) Liverzonation occurs through a beta-catenin-dependent, c-Myc-independent mechanism.Gastroenterology 136:2316–2324.e1–3.

Butura A, Nilsson K, Morgan K, Morgan TR, French SW, Johansson I, Schuppe-Koistinen I, and Ingelman-Sundberg M (2009) The impact of CYP2E1 on the de-velopment of alcoholic liver disease as studied in a transgenic mouse model.J Hepatol 50:572–583.

Cohen P and Goedert M (2004) GSK3 inhibitors: development and therapeutic po-tential. Nat Rev Drug Discov 3:479–487.

Colnot S, Decaens T, Niwa-Kawakita M, Godard C, Hamard G, Kahn A, Giovannini M,and Perret C (2004) Liver-targeted disruption of Apc in mice activates beta-catenin sig-naling and leads to hepatocellular carcinomas. Proc Natl Acad Sci USA 101:17216–17221.

Colnot S and Perret C (2010) Liver zonation, inMolecular Pathology of Liver Diseases(Monga SPS and Cagle PT, eds) pp 7–16, Springer, New York.

de La Coste A, Romagnolo B, Billuart P, Renard CA, Buendia MA, Soubrane O, FabreM, Chelly J, Beldjord C, and Kahn A et al. (1998) Somatic mutations of the beta-catenin gene are frequent in mouse and human hepatocellular carcinomas. ProcNatl Acad Sci USA 95:8847–8851.

Ferrini JB, Pichard L, Domergue J, and Maurel P (1997) Long-term primary culturesof adult human hepatocytes. Chem Biol Interact 107:31–45.

Fujii-Kuriyama Y and Mimura J (2005) Molecular mechanisms of AhR functions inthe regulation of cytochrome P450 genes. Biochem Biophys Res Commun 338:311–317.

Funakoshi N, Duret C, Pascussi JM, Blanc P, Maurel P, Daujat-Chavanieu M,and Gerbal-Chaloin S (2011) Comparison of hepatic-like cell production from hu-man embryonic stem cells and adult liver progenitor cells: CAR transductionactivates a battery of detoxification genes. Stem Cell Rev 7:518–531.

Ganzenberg K, Singh Y, and Braeuning A (2013) The time point of b-cateninknockout in hepatocytes determines their response to xenobiotic activation of theconstitutive androstane receptor. Toxicology 308:113–121.

Gebhardt R and Hovhannisyan A (2010) Organ patterning in the adult stage: the roleof Wnt/beta-catenin signaling in liver zonation and beyond. Dev Dyn 239:45–55.

Gómez-Lechón MJ, Castell JV, and Donato MT (2007) Hepatocytes—the choice toinvestigate drug metabolism and toxicity in man: in vitro variability as a reflectionof in vivo. Chem Biol Interact 168:30–50.

Gondeau C, Briolotti P, Razafy F, Duret C, Rubbo PA, Helle F, Rème T, Ripault MP,Ducos J, and Fabre JM et al. (2014) In vitro infection of primary human hepa-tocytes by HCV-positive sera: insights on a highly relevant model. Gut 63:1490–1500.

Gonzalez FJ (2006) Role of beta-catenin in the adult liver. Hepatology 43:650–653.Gonzalez FJ (2007) The 2006 Bernard B. Brodie Award Lecture. Cyp2e1. Drug MetabDispos 35:1–8.

Gougelet A, Torre C, Veber P, Sartor C, Bachelot L, Denechaud PD, Godard C,Moldes M, Burnol AF, and Dubuquoy C et al. (2014) T-cell factor 4 and b-cateninchromatin occupancies pattern zonal liver metabolism in mice. Hepatology 59:2344–2357.

Hailfinger S, Jaworski M, Braeuning A, Buchmann A, and Schwarz M (2006) Zonalgene expression in murine liver: lessons from tumors. Hepatology 43:407–414.

Hanson CA and Miller JR (2005) Non-traditional roles for the adenomatous polyposiscoli (APC) tumor suppressor protein. Gene 361:1–12.

James LP, Mayeux PR, and Hinson JA (2003) Acetaminophen-induced hepatotoxicity.Drug Metab Dispos 31:1499–1506.

Jover R, Bort R, Gómez-Lechón MJ, and Castell JV (2001) Cytochrome P450 regulationby hepatocyte nuclear factor 4 in human hepatocytes: a study using adenovirus-mediated antisense targeting. Hepatology 33:668–675.

Kawajiri K, Kobayashi Y, Ohtake F, Ikuta T, Matsushima Y, Mimura J, Pettersson S,Pollenz RS, Sakaki T, and Hirokawa T et al. (2009) Aryl hydrocarbon receptorsuppresses intestinal carcinogenesis in ApcMin/1 mice with natural ligands. ProcNatl Acad Sci USA 106:13481–13486.

Kielman MF, Rindapää M, Gaspar C, van Poppel N, Breukel C, van Leeuwen S,Taketo MM, Roberts S, Smits R, and Fodde R (2002) Apc modulates embryonicstem-cell differentiation by controlling the dosage of beta-catenin signaling. NatGenet 32:594–605.

Köhle C and Bock KW (2009) Coordinate regulation of human drug-metabolizingenzymes, and conjugate transporters by the Ah receptor, pregnane X receptor andconstitutive androstane receptor. Biochem Pharmacol 77:689–699.

Lagadic-Gossmann D, Lerche C, Rissel M, Joannard F, Galisteo M, Guillouzo A,and Corcos L (2000) The induction of the human hepatic CYP2E1 gene by in-terleukin 4 is transcriptional and regulated by protein kinase C. Cell Biol Toxicol16:221–233.

Le Carrour T, Assou S, Tondeur S, Lhermitte L, Lamb N, Reme T, Pantesco V,Hamamah S, Klein B, and De Vos J (2010) Amazonia!: an online resource to Googleand visualize public human whole genome expression data. Open Bioinform J 4:5–10 DOI: 10.2174/1875036201004010005.

Lee YC, Oslund KL, Thai P, Velichko S, Fujisawa T, Duong T, Denison MS, and Wu R(2011) 2,3,7,8-Tetrachlorodibenzo-p-dioxin-induced MUC5AC expression: aryl hy-drocarbon receptor-independent/EGFR/ERK/p38-dependent SP1-based transcrip-tion. Am J Respir Cell Mol Biol 45:270–276.

Li W, Jiang K, and Ding S (2012) Concise review: a chemical approach to control cellfate and function. Stem Cells 30:61–68.

Lindros KO, Oinonen T, Johansson I, and Ingelman-Sundberg M (1997) Selectivecentrilobular expression of the aryl hydrocarbon receptor in rat liver. J PharmacolExp Ther 280:506–511.

Liu S, Yeh TH, Singh VP, Shiva S, Krauland L, Li H, Zhang P, Kharbanda K, Ritov V,and Monga SP et al. (2012) b-Catenin is essential for ethanol metabolism andprotection against alcohol-mediated liver steatosis in mice.Hepatology 55:931–940.

Liu SY and Gonzalez FJ (1995) Role of the liver-enriched transcription factor HNF-1alpha in expression of the CYP2E1 gene. DNA Cell Biol 14:285–293.

Loeppen S, Koehle C, Buchmann A, and Schwarz M (2005) A beta-catenin-dependentpathway regulates expression of cytochrome P450 isoforms in mouse liver tumors.Carcinogenesis 26:239–248.

MacDonald BT, Tamai K, and He X (2009) Wnt/beta-catenin signaling: components,mechanisms, and diseases. Dev Cell 17:9–26.

Parent R, Marion MJ, Furio L, Trépo C, and Petit MA (2004) Origin and characterizationof a human bipotent liver progenitor cell line. Gastroenterology 126:1147–1156.

Pichard L, Raulet E, Fabre G, Ferrini JB, Ourlin JC, and Maurel P (2006) Humanhepatocyte culture. Methods Mol Biol 320:283–293.

Prochazkova J, Kabatkova M, Bryja V, Umannova L, Bernatik O, Kozubik A,Machala M, and Vondracek J (2011) The interplay of the aryl hydrocarbon receptorand beta-catenin alters both AhR-dependent transcription and Wnt/beta-cateninsignaling in liver progenitors. Toxicol Sci 122:349–360.

Ratanasavanh D, Beaune P, Morel F, Flinois JP, Guengerich FP, and Guillouzo A(1991) Intralobular distribution and quantitation of cytochrome P-450 enzymes inhuman liver as a function of age. Hepatology 13:1142–1151.

Ring DB, Johnson KW, Henriksen EJ, Nuss JM, Goff D, Kinnick TR, Ma ST, ReederJW, Samuels I, and Slabiak T et al. (2003) Selective glycogen synthase kinase 3inhibitors potentiate insulin activation of glucose transport and utilization in vitroand in vivo. Diabetes 52:588–595.

b-Catenin Regulates Drug Metabolism 633

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from

Sato N, Meijer L, Skaltsounis L, Greengard P, and Brivanlou AH (2004) Mainte-nance of pluripotency in human and mouse embryonic stem cells through acti-vation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med10:55–63.

Schmidt A, Braeuning A, Ruck P, Seitz G, Armeanu-Ebinger S, Fuchs J, WarmannSW, and Schwarz M (2011) Differential expression of glutamine synthetase andcytochrome P450 isoforms in human hepatoblastoma. Toxicology 281:7–14.

Sekine S, Lan BY, Bedolli M, Feng S, and Hebrok M (2006) Liver-specific loss of beta-catenin blocks glutamine synthesis pathway activity and cytochrome p450 ex-pression in mice. Hepatology 43:817–825.

Sekine S, Ogawa R, Mcmanus MT, Kanai Y, and Hebrok M (2009) Dicer is requiredfor proper liver zonation. J Pathol 219:365–372.

Staal FJ, Burgering BM, van de Wetering M, and Clevers HC (1999) Tcf-1-mediatedtranscription in T lymphocytes: differential role for glycogen synthase kinase-3 infibroblasts and T cells. Int Immunol 11:317–323.

Tan X, Behari J, Cieply B, Michalopoulos GK, and Monga SP (2006) Conditionaldeletion of beta-catenin reveals its role in liver growth and regeneration. Gastro-enterology 131:1561–1572.

Torre C, Benhamouche S, Mitchell C, Godard C, Veber P, Letourneur F, Cagnard N,Jacques S, Finzi L, and Perret C et al. (2011) The transforming growth factor-a andcyclin D1 genes are direct targets of b-catenin signaling in hepatocyte proliferation.J Hepatol 55:86–95.

Veeck J and Dahl E (2012) Targeting the Wnt pathway in cancer: the emerging role ofDickkopf-3. Biochim Biophys Acta 1825:18–28.

Verma UN, Surabhi RM, Schmaltieg A, Becerra C, and Gaynor RB (2003) Smallinterfering RNAs directed against beta-catenin inhibit the in vitro and in vivogrowth of colon cancer cells. Clin Cancer Res 9:1291–1300.

Vinci B, Duret C, Klieber S, Gerbal-Chaloin S, Sa-Cunha A, Laporte S, Suc B, MaurelP, Ahluwalia A, and Daujat-Chavanieu M (2011) Modular bioreactor for primaryhuman hepatocyte culture: medium flow stimulates expression and activity ofdetoxification genes. Biotechnol J 6:554–564.

Vinken M, Papeleu P, Snykers S, De Rop E, Henkens T, Chipman JK, Rogiers V,and Vanhaecke T (2006) Involvement of cell junctions in hepatocyte culture func-tionality. Crit Rev Toxicol 36:299–318.

Woodcroft KJ, Hafner MS, and Novak RF (2002) Insulin signaling in the transcriptionaland posttranscriptional regulation of CYP2E1 expression. Hepatology 35:263–273.

Yamamoto Y, Sakamoto M, Fujii G, Tsuiji H, Kenetaka K, Asaka M, and Hirohashi S(2003) Overexpression of orphan G-protein-coupled receptor, Gpr49, in humanhepatocellular carcinomas with beta-catenin mutations. Hepatology 37:528–533.

Address correspondence to: Sabine Gerbal-Chaloin, Institut de Rechercheen Biothérapie, INSERM U1040, Hôpital St Eloi–80, Avenue Augustin Fliche,34295 Montpellier Cedex 5 France. E-mail: [email protected]

634 Gerbal-Chaloin et al.

at ASPE

T Journals on A

ugust 29, 2019m

olpharm.aspetjournals.org

Dow

nloaded from