Author's personal copy - dyu.edu.twsbb.dyu.edu.tw/chinese/downlaodfile/teach/10.pdfA million tons of chicken feathers from poultry processing plants are produced as wastes annually

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

http://www.elsevier.com/copyright

Author's personal copy

Production of keratinolytic enzyme by an indigenousfeatheredegrading strain Bacillus cereus Wu2

Wei-Hsun Lo, Jui-Rze Too, and Jane-Yii Wu*

Department of BioIndustry Technology, Da-Yeh University, No. 168, University Rd., Dacun, Changhua 51591, Taiwan, ROC

Received 3 July 2012; accepted 24 July 2012Available online 19 September 2012

A novel feather-degrading microorganism was isolated from a poultry farm in Taiwan, and was identified Bacilluscereus Wu2 according to 16S rRNA sequencing. The isolated strain produces keratinolytic enzyme using chicken featheras the sole carbon and nitrogen source. The experimental results indicated that the extra carbon sources (glucose,fructose, starch, sucrose, or lactose) could act as a catabolite repressor to the enzyme secretion or keratinolytic activitywhen keratinous substrates were employed as protein sources. However, addition of 2 g/L of NH4Cl to the feathermedium increased the enzyme production. The optimum temperature and initial pH for enzyme production were 30�Cand 7.0, respectively. The maximum yield of the enzyme was 1.75 kU/mL in the optimal chicken feather medium; thisvalue was about 17-fold higher than the yield in the basal hair medium. The B. cereus Wu2 possessed disulfide reductaseactivity along with keratinolytic activity. The amino acid contents of feathers degradated by B. cereus Wu2 were higher,especially for lysine, methionine and threonine which were nutritionally essential amino acids and usually deficient inthe feather meal. Thus, B. cereus Wu2 could be not only used to enhance the nutritional value of feather meal but is alsoa potential bioinoculant in agricultural environments.

� 2012, The Society for Biotechnology, Japan. All rights reserved.

[Key words: Keratin; Feather-degrading; Bacillus cereus; Keratinase; Poultry waste]

A million tons of chicken feathers from poultry processing plantsare produced as wastes annually throughout the world (1). Formature chicken, feather accounts up to 5%e7% of the live weight andis composed of over 90% crude protein, the main component beingkeratin, a fibrous and insoluble protein (2). Keratins are insolublefibrous proteins highly cross-linked with disulfide bridges, hydrogenbonds, and hydrophobic interactions. The tightly packed super coiledpolypeptide chains result in high mechanical stability and resistanceto proteolysis by common proteases such as trypsin, pepsin, andpapain (3,4).

At present, feathers are converted to feather meal, a digestibledietary protein for animals, using physical and chemical treatments(5). These physico-chemical conversion methods involve costlytreatments under harsh temperature and pressure conditions thatresult in a loss of certain heat sensitive amino acids, e.g., methionine,lysine and tryptophan (6). Heat treatment also adds to non-nutritiveamino acids such as lysinoalanine and lanthionine (3,7). The micro-bial degradation of feather represents an alternative eco-friendlytechnology to improve the nutritional value of feather-meal. Never-theless, feathers do not accumulate in nature, since structural keratincan be degraded by some microorganisms (3,8). Known keratinasesare mainly produced by some species of saprophytic and parasiticfungi (9,10), actinomycetes (11e13), and some species of Bacillusproduce feather-degrading enzymes (14e17), such asBacillus pumilus

(18), Bacillus subtilis (19), and Bacillus licheniformis (20). It has beenproposed that use of crude keratinase prepared from B. licheniformissignificantly increased the total amino acid digestibility of rawfeathers and commercial feather meal (20). This enzyme increaseddigestibility of a commercial feathermeal up to 82% and could replaceup to 7% of the dietary protein for growing chickens (21). It wasconcluded that not only feather meal (keratin) could be used asprotein for animal food but also the biomass of the enzyme-producing strain as well. These keratinolytic enzymes may haveimportant applications in biotechnological and industrial processesinvolving keratin-containing wastes from the poultry and leatherindustries through the development of non-polluting processes anddehairing of skin and hides (3,7,8).

Keratinolytic enzymes have been studied from a variety of fungiand, to a lesser extent, bacteria. Much current research is centered onthe potential use of keratinase which was produced from bacteria.Moreover, the low pH requirement for an optimum activity of theenzymes and the long growth period are the disadvantages of usingfungi. This study attempted to isolate some bacterial strains, whichpossessed the ability to grow on feather hydrolyzate as a sole sourceof carbon and nitrogen. Therefore, the aim of this study was toinvestigate factors affecting feather degradation by this bacteriumand to evaluate nutritional values of degraded feather.

MATERIALS AND METHODS

Isolation and screening of the feather degrading microorganisms Thesoil samples were collected from a poultry farm in Changhua, Taiwan. For each

* Corresponding author. Tel.: þ886 4 851 1888/1630; fax: þ886 4 851 1320.E-mail address: [email protected] (J.-Y. Wu).

www.elsevier.com/locate/jbiosc

Journal of Bioscience and BioengineeringVOL. 114 No. 6, 640e647, 2012

1389-1723/$ e see front matter � 2012, The Society for Biotechnology, Japan. All rights reserved.http://dx.doi.org/10.1016/j.jbiosc.2012.07.014


sample, 1 g of soil was suspended in 50 mL sterile distilled water. The supernatantwas diluted and then laid on a casein agar plate containing the following (in the unitof g/L): casein (10.0), peptone (1.0), urea (0.3), (NH4)2SO4 (1.4), KH2PO4, (2.0), CaCl2,(0.344), MgSO4$7H2O (0.3), FeSO4$7H2O (0.005), ZnSO4$7H2O (0.014), MnSO4$7H2O(0.0098), CoCl2$6H2O (0.002), and agar (18.0). After incubation at 37�C for 48 h,clearing zones around the colony were observed to signify the protease production.A single colony with a clearing zone was picked up and inoculated on an agar platecontaining the following (g/L): feather meal (10.0), NaCl (0.5), K2HPO4 (0.3), andKH2PO4 (0.4). The isolated strain, which formed a clearing zone on the feather mealagar plate, was then cultured in a liquid mediumwhich consisted of (g/L): NaCl (5.0),peptone (10.0), and yeast extract (5.0). Meanwhile the isolated strain was main-tained as a suspension in 20% (v/v) glycerol at �20�C for later use.

Taxonomic studies and 16S rRNA sequencing Bacterial identification wasconducted based on morphological and biochemical tests. The 16S rRNA gene of theisolated strain was sequenced after genomic DNA extraction and PCR amplificationas described in Riffel and Brandelli (22). Two bacterial 16S rRNA primers, F8(AGAGTTTGATCCTGGCTCAG) and R1510 (GGTTACCTTGTTACGACTT), were used forgene amplification and sequencing. PCR was run for 40 cycles under the followingsteps: 94�C for 30 s, 55�C for 30 s, and 72�C for 2 min 20 s. An ABI 3730XL DNA

FIG. 1. Phylogenetic tree analyzed by 16S rRNA sequences with the neighbor joiningmethods.

FIG. 2. Time courses of pH, ammonia-nitrogen, and keratinase activity when B. cereus Wu2 was cultivated under various conditions. (a) Temperature and (b) various initial pHs.Symbols: (a) closed circles, 30�C; open circles, 37�C; closed triangles, 40�C; closed squares, 55�C; (b): closed circles, pH 3; open circles, pH 5; closed triangles, pH 7; closed squares,pH 9; open triangles, pH 11.

VOL. 114, 2012 FEATHER-DEGRADING STRAIN B. CEREUS Wu2 641


Analyzer (Life Technologies, USA) was used for sequencing. The 1426-bp sequencewas submitted to the GenBank. The nucleotide sequence of the strain wascompared to any similar database sequence in the GenBank using the programBLAST version 3.2 via the NCBI site. The 16S rRNA sequences were aligned, andthe phylogenetic tree was booted by the BioEdit version 7.0 and MEGA 3.0 software.

Culture conditions for enzyme production The isolated bacteria werecultivated at 37�C for 4 days in a medium with whole feathers as a sole source ofcarbon and nitrogen. The medium contained the following (g/L): raw chickenfeathers (10.0), MgSO4$7H2O (0.2), K2HPO4 (1.0), CaCl2 (0.1), and KH2PO4 (0.4). ThepH of the medium was adjusted to 7.0 with 6 N HCl or 6 N NaOH. The influence oftemperature onmicrobial growth and keratinase productionwas examined at 30, 37,40, and 55�C. The keratinase productionwas also investigated in media with variousinitial pHs (3.0, 5.0, 7.0, 9.0 and 11.0). Different keratin sources, includingcommercial feather meal, chicken feather powder, chicken feather, human hair andgoose feather, were used as substrates, each with a concentration of 10 g/L to replacethe raw feathers. The effect of carbohydrate (glucose, fructose, sucrose, lactose orsoluble starch) on the keratinase production was also examined by adding 5 g/L ofeach into the fermentation medium. The effect of nitrogen on the keratinaseproduction was investigated by adding 10 g/L of each of peptone, urea, NH4Cl, andNaNO3. All experiments were done in triplicate. Testing samples were taken fromeach flask and centrifuged to remove the cells and insoluble residues, and the pHvalue, protein and free amino acid contents, and keratinase activity for the super-natant were determined. The insoluble residues were observed and examined withFTIR and SEM. The protein content was measured by the method of Lowry withbovine serum albumin as a standard (23).

Keratinase activity Keratinase activity was measured using the modifiedazocasein hydrolysis method of Tomarelli et al. (24). The reaction mixture thatcontained 0.2 mL of an enzyme and 0.8 mL of azocasein solution was incubated ina water bath at 70�C for 30 min. The reaction was terminated by the addition of0.2 mL of 20% trichloroacetic acid. The absorbance of the filtrate was measuredphotometrically at 440 nm. One unit of keratinase activity is defined as theamount of the enzyme that liberates 1 mmole of sulfanilic acid per minute at 70�C.

Amino acid analysis The method of amino acid analysis of White et al. (25)was used to determine the amino acid contents for the unprocessed and fermentedfeather meals. Each sample, equivalent to about 0.2 g of protein, and norleucine (asan internal standard) were weighed accurately in a 250-mL round-bottomed flask.Next, 100 mL of 6 N hydrochloric acid containing 0.1% phenol were added. Thesample was then heated at 110�C on a heating mantle and refluxed for 24 h. Aftercooling, the content of each flask was quantitatively transferred to a 200-mLvolumetric flask and made up to the mark. Hydrochloric acid was removed fromthe sample by drying under vacuum at room temperature. The sample was thenredried from 10 mL redrying reagent (95% ethanol: water: triethylamine ¼ 2:2:1).Derivatization was initiated by adding 20 mL of freshly prepared reagent (95%ethanol: water: triethylamine: phenylisothiocyanate ¼ 7:1:1:1), which was mixedusing a vortex mixer and allowed to stand at room temperature for 20 min. Theentire reagent was then removed under vacuum. It was essential to dry thesample thoroughly at this stage to remove excess reagent and by-products, whichgave interfering peaks in the chromatogram. The derivatized sample wasredissolved in sample diluent (5 mM sodium phosphate buffer (pH 7.4):acetonitrile ¼ 95:5), and amino acid analysis was then performed on a PICO$TAGAmino Acid Analysis System (Waters, Milford, MA, USA).

Fourier transform infrared spectroscopy (FTIR) analysis The change offunction groups of unprocessed and fermented feather were observed by FTIR, thatwas carried out according to Wojciechowska et al. (26). An IR spectroscopic analysiswas performed using the FTIR 8400S, Shimadzu (with the resolution of 2 cm�1). Thefeather samples used for the FTIR tests were prepared in the following way: 3 mgfeather powdered were mixed with KBr (dried in the temperature of 120�C) in theamount complementary to the final 300 mg. Next, in order to make the testmaterial more uniform they were carefully rubbed in an agate mortar inconditions which made water absorption impossible. For the spectroscopic tests,samples of 150 mg were taken from previously prepared mixture. Next they weredeaerated and treated with the process of ironing under the pressure of 8 tons for1 min. For each individual sample 9 scans were done.

Scanning electron microscope (SEM) studies To examine the change offeathers during the fermentation process, the feathers were observed by a scanningelectron microscopy (SEM). The feathers were collected and fixed in a 0.2-M caco-dylate buffer (pH 7) containing 1% glutaraldehyde at 4�C for 6 h. The moisture in eachsample was replaced by ethanol, and this step was repeated six times. The sampleswere then dried with a Hitachi HCP-2 critical point dryer and plated with an Eiko IB-5ion coater. The residues of feather were observed by Field Emission Gun ScanningElectron Microscopy (FE-SEM, Model JSM-6700F, JEOL, Tokyo, Japan) at 5 kV.

RESULTS AND DISCUSSION

Identification and characterization of feather-degradingmicroorganisms The purpose of this study was to isolatebacterial strains which utilized feather as carbon and nitrogen

sources to grow and produce keratinase. Soil samples werecollected from a poultry farm in Changhua, Taiwan. Twenty-threeisolated strains were able to form clear zones on casein agar platessince casein was hydrolyzed by the extracellular proteolyticenzyme secreted by the isolated strains. Of these, three strainsgrew well on feather meal agar plates. Especially, strain Wu2was selected for further study because of its highest keratinaseactivity.

The morphological analysis showed that strain Wu2 was a fila-mentous, rod-shaped gram-positive bacterium, forming endo-spores and no capsule. In addition, analysis of 16S rRNA of thisstrain showed a high sequence identity to Bacillus cereus (Fig. 1).Therefore, based on these biochemical, physiological (data notshown) and 16S rRNA analyses, the isolated strain was identifiedand named as B. cereusWu2. The 16S rRNA sequence of strain Wu2was deposited by the NCBI Nucleotide Sequence Database with theaccession number JF267369.

Effect of temperature on keratinase production To explorethe effect of temperature on keratinolytic activity, B. cereusWu2wascultivated under various temperatures (30�C, 37�C, 40�C and 55�C)in a medium containing 1% feather for 96 h. The time courses of pH,ammonia-nitrogen, and keratinase activity are shown in Fig. 2a. Theincrease trend in pH values and ammonium nitrogenwere observedwith feather degradation. For these four temperatures, keratinase

FIG. 3. Effects of (a) carbon source and (b) nitrogen source on pH value, ammonia-nitrogen, and keratinase activity of B. cereus Wu2. Symbols: (a) closed circles, blank;open circles, glucose; closed triangles, fructose; closed squares, starch; open triangles,sucrose; open squares, lactose; (b) closed circles, blank; open circles, peptone; closedtriangles, urea; closed squares, NH4Cl; open triangles, NaNO3.

642 LO ET AL. J. BIOSCI. BIOENG.,


activity was detected and reached the maximum value (711 U/mL)after cultured for 90 h at 40�C. Nevertheless, the keratinaseactivity suddenly decreased to 25 U/mL at 55�C for 42 h. TheBacillus species typically are mesophilic and grow well withina temperature range of 30e40�C. The optimum culturedtemperature in this study was similar to those in the previousreports (27). Lin et al. (28) indicated that the optimal range oftemperature for keratinase production by feather-degradingB. licheniformis was between 40�C and 45�C, which was lower thanthe best temperature range for proteolysis on milkplates (50e55�C). Streptomyces thermonitrificans, thermophilicactinomycetes, was isolated from soil and had the maximal activityafter 48 h of incubation at 50�C (29). In addition, Streptomyces sp.S.K1-02 produced a high keratinolytic activity at 70�C (30).

Effect of initial pH on keratinase production Fig. 2b showsthe time courses of pH, ammonia-nitrogen, and keratinase activityas B. cereusWu2was cultivated in feather mediawith various initialpH values (3.0 5.0, 7.0, 9.0 and 11.0). The optimum initial pH forkeratinolytic enzyme production was pH 5.3; meanwhile theactivity reached 2024.4 U/mL after 78 h of cultivation. Theoptimum initial pH obtained in this study was similar to those ofB. subtilis, e.g., B. pumilus (27), B. cereus MCM B-326 (31), andBacillus horikoshii (32). Furthermore, the pH values increased asfeather was degraded, and a similar result was observed in theprevious research with high keratinolytic activities (33). Thetrend of pH value may be associated with proteolytic activity,consequent deamination reactions and the release of excessnitrogen to form ammonium ions following utilization of aminoacids and soluble peptides as a metabolic fuel for growth andmicrobial maintenance (as shown in Fig. 2b). The increase in pH

FIG. 4. Time courses of pH, ammonia-nitrogen, and keratinase activity when B. cereusWu2 was cultivated in media containing various keratinous substrates for 96 h.Symbols: open circles, feather meal; closed circles, commercial feather meal; closedtriangles, chicken feather; open squares, goose feather; closed squares, hair.

TABLE

1.Aminoacid

contents

ofunp

rocessed

andprocessed

feathersin

this

studyco

mpared

withthosein

theliterature.

Unprocessed

Deg

raded

byW

u2

Feather-lysate

Purified

keratinase

EFM

EHM

Feather

hyd

rolyzates

160�C

for15

min

Unprocessed

207kP

afor24

min

WCH

(mg/10

0g)

(%)

(relative

concentration,%

)(g

aminoacid

/10

0gCP)

(gam

inoacid

/l00gCP)

(mol%)

(g/kg)

(g/kg)

(mgam

ino

acid/g

CP)

Non

-essen

tial

aminoacids

Asp

111

209.86

7.82

7.21

ee

5.78

55.2

41.8

55.9

61.4

Glu

142.76

293.5

9.88

10.29

ee

9.22

97.2

82.2

72.3

117.5

Ser

76.91

170.06

10.78

9.44

11.42

4.94

10.83

100

87.3

72.1

118

Gly

74.37

180.89

6.18

21.7

8.69

7.87

5.96

68.7

51.8

50.7

71His

67.34

96.47

0.38

7.14

0.86

2.26

0.93

5.7

2.3

8.6

7.7

Arg

90.11

167.66

7.14

6.97

6.11

4.67

8.43

6167

.662

.579

.6Ala

61.39

120.95

3.82

5.9

ee

5.42

39.6

28.8

37.7

53.4

Pro

87.69

186.45

e1.71

ee

5.28

88.4

73.9

74.8

e

Cys

54.91

75.44

6.16

0.64

7.21

2.01

6.51

42.9

65.8

48.7

55.5

Tyr

75.74

99.84

2.07

2.33

ee

3.29

ee

33.1

Essential

aminoacids

Thr

64.65

112.6

4.28

5.2

4.71

3.63

3.66

40.2

34.5

36.5

51.2

Val

79.19

155.8

7.22

3.3

8.19

5.07

8.56

59.6

5344

82.3

Met

65.84

90.13

0.67

1.28

0.83

1.56

1.7

6.5

7.1

6.3

4.6

Ile

66.53

113.17

4.67

2.1

4.98

3.87

6.28

42.3

39.4

41.3

64.6

Leu

74.31

152.51

7.23

4.92

7.98

6.33

9.69

70.9

56.9

68.8

98.3

Phe

72.15

118.63

4.37

3.34

4.69

3.32

5.42

42.1

34.6

40.1

58.3

Lys

84.79

144.27

1.47

6.52

1.8

4.78

2.41

18.8

15.4

22.6

26.7

Referen

ces

Inthis

study

2349

5556

5758

5960



during cultivation is pointed as an important indication of thekeratinolytic potential of microorganisms (9).

Effects of carbon and nitrogen sources on keratinaseproduction To examine the influence of carbon source on kera-tinolytic activity, B. cereus Wu2 was cultivated in a medium con-taining 1% feather and another carbon source at 40�C for 96 h(Fig. 3a). As shown in this figure, the highest enzyme production(671 U/mL) was obtained at the control experiment (without extracarbon source). This fact indicated that the extra carbon sources(glucose, fructose, starch, sucrose, or lactose) could act asa catabolite repressor to the enzyme secretion or keratinolyticactivity when keratinous substrates were employed as proteinsources. These results were in agreement with the earlier research,for example, the glucose practically suppresses the proteasesecretion (34). Initial surveys on the role of individual carbon

sources on keratinase production showed that exogenouscarbohydrates suppressed enzyme production of diverse bacteria(35,36). In a similar manner, adding glucose and methanol ina medium generally suppressed Bacillus sp. FK46 growth andkeratinase production, and consequently inhibited featherdegradation (37). Sugar suppression of enzyme activity commonlyappears in fungi and other microorganisms. The proteolyticactivity of S. thermonitrificans has been shown to be suppressed byglucose (29). The catabolite repression of protease by sucrose hasbeen shown in Neurospora crassa (38) as has repression by fructosein Trichophyton rubrum (39).

To investigate the effect of nitrogen source on keratinaseproduction, media containing various nitrogen sources and 1% rawfeather were used to cultivate B. cereus Wu2. Fig. 3b shows thatexcept ammonium chloride, supplementing other nitrogen sourcesin the medium not only did not yield better keratinase activity but

FIG. 5. Optical and scanning electron micrographs of a native feather degraded by B. cereus Wu2 for 96 h. The left is the optical photo, and the SEM is on the right. Bar: 50 mm.



also inhibited the activity. The maximum keratinase production(3.5 kU/mL)was obtainedwith 2 g/L of NH4Cl as the nitrogen sourceafter 54 h of culture. These results were similar to those in someprevious investigations. For instance, extra NH4Cl and yeast extractas nitrogen sources have been shown to have a favorable effect onkeratinase production by B. pumilus FH9 (40). Nilegaonkar et al. (31)reported that increased level of keratinase production by B. cereusMCM B-326 was observed to be up due to the addition of ammo-nium chloride and sodium nitrite compared with other inorganicnitrogen sources. Moreover, the microbial growth and keratinaseproduction of B. licheniformis PWD-1was encouraged byNH4Cl (14).

Effect of keratinous substrate on keratinaseproduction Most keratinases are largely inducible, requiringkeratin as an exogenous inducer (8). The duration and intensity ofkeratinase secretion were strongly influenced by variouskeratinous substrates (41). Different keratinous substrates such ascommercial feather meal, chicken feather, human hair, and goosefeather were used to investigate the effect of the keratinoussubstrate on the keratinase production by B. cereus Wu2 (Fig. 4).The highest keratinase activity (1.75 kU/mL) was observed withchicken feather powder, and whole chicken feather was thesecond (0.75 kU/mL). These results are in accordance with thefindings of Cheng et al. (34) with B. licheniformis PWD-1, El-Refaiet al. (40) with B. pumilus FH9, Park and Son (42) with Bacillusmegaterium F7-1, and Cai et al. (43) with B. subtilis. However, thecommercial feather meal was a poor substrate for keratinaseinduction. The molecular structure, which might be important tokeratinase induction, of commercial feather meal might have beendestroyed during the preparation (34). Keratinase induction byvarious keratinous substrates was also observed by Singh (44) withTrichophyton simii which was induced by buffalo skin and humannails to produce keratinase. Besides, Trichophyton mentagrophytesvar. erinacei showed the highest keratinase production with wooland Aspergillus flavus with chicken feather, and the keratinaseactivity was the highest for C. pannicola and M. gypseum ina culture medium induced with human hair (45).

Analysis of amino acid content The waste chicken featherswere degraded by B. cereus Wu2 under the optimum culturedcondition. During the period of cultivation, the culture broth wascollected for determining the content of amino acids, and the residualfeathers were observed by SEM and Fourier transform infraredspectrum (FTIR). In this study, B. cereus Wu2 could utilize wastedfeathers as the sole carbon and nitrogen sources and meanwhilerelease substantial amounts of soluble protein in the broth. Table 1shows the amino acid contents of the unprocessed feather and thefermented feather broth. The hydrolyzate in the fermented broth isrich in glutamic acid, aspartic acid, proline, glycine and serine; onthe opposite, the tyrosine, cysteine, histidine, and methionine werescarce in the hydrolyzate. Compared with the unprocessed feathers,the amino acid contents of feathers degradated by B. cereus Wu2were higher, especially for lysine, methionine and threonine whichwere nutritionally essential amino acids and usually deficient in thefeather meal. These results were similar to those reported inprevious studies (46e48). For instance, a purified product obtainedfrom a feather culture of Aspergillus oryzae contained a higherproportion of glycine (21.7%), glutamic acid (10.3%) and serine(9.44%) (49). To increase free amino acids such as asparagine,glycine, proline and lysine in the fermentation broth when woolwas degraded by the isolated strain 4 M using wool as the solecarbon and nitrogen sources (50).

Feather degradation observed by SEM and FTIR The degra-dation of whole feathers by B. cereus Wu2 was observed by SEM.The feather surface was only slightly damaged after 24 h of culti-vation (data not shown). As shown in Fig. 5, the barbules of feathersbecame cracked after 48 h, and the rachis were attacked by the

strain after 96 h. In a previous study, the feather degradation byChryseobacterium sp. strain kr6 was observed by SEM (51). Otherresearchers (33,43,52) also used SEM to observe the keratinattacked by microorganisms.

The functional groups of the feather were detected by FTIR, andthe result is given in Fig. 6. FTIR spectra of degraded feather dis-played that transmittance peaks nearby 500, 1100, 1544, 1650, 2960and 3420 cm�1. The peak located in the range of 2700e3100 cm�1

indicates the presence of CH groups, and the broad peak around3400 cm�1 is usually caused by the vibration of hydrogenbonded eOH groups (53). The transmittance peaks for the amide I(1650 cm�1) and amide II (1547 cm�1) suggest the presence of ana-helix structure in the sample, moreover the amide I (1638 cm�1)and amide II (1515 cm�1) indicate the presence of a b-sheet type (26).The peak near 1100 cm�1 was observed, and this fact indicated thatCeC groups existed in each of the two samples (53). Additionally, asshown in Fig. 6, compared with the processed (incubated withWu2)and unprocessed feather meal, the peaks of the disulphide bonds ofthe processed feather weaker than the native feather meal wasobserved, it exhibited the disulphide bond structure of the featherwas attacked byWu2. Disulphide bonds owing to the SeS stretchingvibrations show a peak in the 500e550 cm�1 (53,54). The peaksappeared in the range of 480e560 cm�1 as shown in Fig. 6 repre-sented disulphide bonds existing in the sample.

Poultry feathershavebeen generated in a hugequantityas awasteafter the process of chickens and could lead to the potent pollutingimplications. Additionally, limitations to feather utilization arise dueto its poor digestibility, low biological value, and the deficiencies ofnutritionally essential amino acids such as methionine, lysine, histi-dine and tryptophan (46e48). According to these results, develop-ment of an alternative technology with prospects for environmentalfriendliness, nutritional enhancement or compatibility, bioresourcesoptimization and cost effectiveness seems an urgent need. In thisstudy, a feather-degrading bacterium, B. cereus Wu2, was isolatedfrom the soil of a poultry farm via a two-step screening strategy. Thecondition for feather degrading by this strainwas optimized, and theoptimum condition included 40�C, an initial pH of 5.3 with an incu-bation time of 96 h. In addition, the keratinase could be produced byB. cereusWu2 in conditionswithwide ranges of pH and temperature,and various keratinous substrates. These are regarded as favorablecharacteristics for industrial applications of this enzyme. Moreover,some essential amino acids such as methionine, histidine, and lysinethat are deficient in feather keratin were obtained in the culturedbroth of B. cereus Wu2.

FIG. 6. IR spectra of degraded feathers (dotted line) and native feather meal (solidline). Peak A, 3400 cm�1 (eOH); peak B, 2960 cm�1 (asymmetric eCH3); peak C,1665 cm�1 (amide I); peak D, 1550 cm�1 (amide II); peak E, 1150 cm�1 (eCeCe);peak F, 500 cm�1 (eSeSe).



References

1. Daroit, D. J., Corrêa, A. P. F., and Brandelli, A.: Production of keratinolyticproteases through bioconversion of feather meal by the Amazonian bacteriumBacillus sp. P45, Int. Biodeterior. Biodegrad., 65, 45e51 (2011).

2. Ismail, A. M. S., Housseiny, M. M., Abo-Elmagd, H. I., El-Sayed, N. H.,and Habib, M.: Novel keratinase from Trichoderma harzianum MH-20 exhibitingremarkable dehairing capabilities, Int. Biodeterior. Biodegrad., 70, 14e19 (2012).

3. Brandelli, A., Daroit, D. J., and Riffel, A.: Biochemical features of microbialkeratinases and their production and applications, Appl. Microbiol. Biotechnol.,85, 1735e1750 (2010).

4. Riffel, A., Daroit, D. J., and Brandelli, A.: Nutritional regulation of proteaseproduction by the feather-degrading bacterium Chryseobacterium sp. kr6, Nat.Biotechnol., 28, 153e157 (2011).

5. Riffel, A. and Brandelli, A.: Isolation and characterization of a feather-degrading bacterium from the poultry processing industry, J. Ind. Microbiol.Biotechnol., 29, 255e258 (2002).

6. Queiroga, A. C., Pintado, M. E., and Malcata, F. X.: Potential use of wool-associated Bacillus species for biodegradation of keratinous materials, Int.Biodeterior. Biodegrad., 70, 60e65 (2012).

7. Tiwary, E. and Gupta, R.: Medium optimization for a novel 58 kDa dimeric ker-atinase from Bacillus licheniformis ER-15: biochemical characterization andapplication in featherdegradationanddehairing ofhides, Bioresour. Technol.,101,6103e6110 (2010).

8. Onifade, A. A., Al-Sane, N. A., Al-Musallam, A. A., and Al-Zarban, S.: Potentialsfor biotechnological applications of keratin-degrading microorganisms andtheir enzymes for nutritional improvement of feathers and other keratins aslivestock feed resources, Bioresour. Technol., 66, 1e11 (1998).

9. Kaul, S. and Sumbali, G.: Keratinolysis by poultry farm soil fungi, Mycopa-thologia, 139, 137e140 (1997).

10. Gradisar, H., Kern, S., and Friedrich, J.: Keratinase of Doratomyces microsporus,Appl. Microbiol. Biotechnol., 53, 196e200 (2000).

11. Böckle, B., Galunsky, B., and Muller, R.: Characterization of a keratinolyticserine proteinase from Streptomyces pactum DSM 40530, Appl. Environ.Microbiol., 61, 3705e3710 (1995).

12. Santos, R. M. D. B., Firmino, A. A. P., De Sa, C. M., and Felix, C. R.: Keratinolyticactivity of Aspergillus fumigatus fresenius, Curr. Microbiol., 33, 364e370 (1996).

13. Garcia-Kirchner, O., Bautista-Ramirez, M. E., and Segura-Granados, M.:Submerged culture screening of two strains of Streptomyces sp. with highkeratinolytic activity, Appl. Biochem. Biotechnol., 70, 277e284 (1998).

14. Williams, C. M., Richester, C. S., Mackenzi, J. M., and Shih, J. C. H.: Isolation,identification and characterization of a feather degrading bacterium, Appl.Environ. Microbiol., 56, 1509e1515 (1990).

15. Zerdani, I., Faid, M., and Malki, A.: Feather wastes digestion by new isolatedstrains Bacillus sp. in Morocco, Afr. J. Biotechnol., 3, 67e70 (2004).

16. Ramnani, P., Singh, R., and Gupta, R.: Keratinolytic potential of Bacilluslicheniformis RG1: structural and biochemical mechanism of feather degrada-tion, Can. J. Microbiol., 51, 191e196 (2005).

17. Manczinger, L., Rozs, M., Lgyi, V. G., and Kevei, F.: Isolation and character-ization of a new keratinolytic Bacillus licheniformis strain, World J. Microbiol.Biotechnol., 19, 35e39 (2003).

18. Kumar, A. G., Swarnalatha, S., Gayathri, S., Nagesh, N., and Sekaran, G.:Characterization of an alkaline active-thiol forming extracellular serine kerati-nase by the newly isolated Bacillus pumilus, J. Appl. Microbiol., 104, 411e419(2008).

19. Pillai, P., Mandge, S., and Archana, G.: Statistical optimization of productionand tannery applications of a keratinolytic serine protease from Bacillus subtilisP13, Process Biochem., 46, 1110e1117 (2011).

20. Lee, G. G., Ferket, P. R., and Shih, J. C. H.: Improvement of feather digestibilityby bacterial keratinase as a feed additive, FASEB J., 59, 1312 (1991).

21. Shih, J. C. H.: Biodegradation and utilization of feather keratin, pp. 165e171,in: Proceedings of 1999 animal waste Management Symposium. North CarolinaState University, Raleigh, NC (1999).

22. Riffel, A. and Brandelli, A.: Keratinolytic bacteria isolated from feather waste,Braz. J. Microbiol., 37, 395e399 (2006).

23. Williams, C. M., Lee, C. G., Garlich, J. D., and Shih, J. C. H.: Evaluation ofa bacterial feather fermentation product, feather-lysate, as a feed protein,Poult. Sci., 70, 85e94 (1991).

24. Tomarelli, R. M., Charney, J., and Harding, M. L.: The use of azoalbumin asa substrate in the colorimetric determination of peptic and tryptic activity,J. Lab. Clin. Med., 34, 428e433 (1949).

25. White, J. A., Hart, R. J., and Fry, J. C.: An evaluation of theWaters Pico-Tag systemfor the amino-acid analysis of food materials, J. Automat. Chem., 8, 170e177(1986).

26. Wojciechowska, E., Rom, M., Włochowicz, A., Wysocki, M., and Wesełucha-Birczy�nska, A.: The use of Fourier transform-infrared (FTIR) and Ramanspectroscopy (FTR) for the investigation of structural changes in wool fibrekeratin after enzymatic treatment, J. Mol. Struct., 704, 315e321 (2004).

27. Kim, J. M., Lim, W. J., and Suh, H. J.: Feather-degrading Bacillus species frompoultry waste, Process Biochem., 37, 287e291 (2001).

28. Lin, X., Inglis, G. D., Yanke, L. J., and Cheng, K. J.: Selection and character-ization of feather degrading bacteria from conola meal compost, J. Ind.Microbiol. Biotechnol., 23, 149e153 (1999).

29. Mohamedin, A. H.: Isolation, identification and some cultural conditions ofa protease-producing thermophilic Streptomyces strain grown on chickenfeather as a substrate, Int. Biodeterior. Biodegrad., 43, 13e21 (1999).

30. Letourneau, F., Soussote, V., Bressollier, P., Branland, P., and Verneuil, B.:Keratinolytic activity of Streptomyces sp. S. KI-02: a new isolated strain, Lett.Appl. Microbiol., 26, 77e80 (1998).

31. Nilegaonkar, S. S., Zambare, V. P., Kanekar, P. P., Dhakephalkar, P. K.,and Sarnail, S. S.: Production and partial characterization of dehairingprotease from Bacillus cereus MCM B-326, Bioresour. Technol., 98, 1238e1245(2007).

32. Joo, H. S., Kumar, C. G., Park, G. C., Kim, K. T., Paik, S. R., and Chang, C. S.:Optimization of the production of an extracellular alkaline protease fromBacillus hirikoshii, Process Biochem., 38, 155e159 (2002).

33. Mabrouk, M. E. M.: Feather degradation by a new keratinolytic Streptomycessp. MS-2, World J. Microbiol. Biotechnol., 24, 2331e2338 (2008).

34. Cheng, S. W., Hu, H. M., Shen, S. W., Takagi, H., Asano, M., and Tsai, Y. C.:Production and characterization of keratinase of a feather degrading Bacilluslicheniformis PWD-1, Biosci. Biotechnol. Biochem., 59, 2239e2243 (1995).

35. Singh, C. J.: Optimization of an extracellular protease of Chrysosporium kera-tinophilum and its potential in bioremediation of keratin wastes, Mycopatho-logia, 156, 151e156 (2002).

36. Anbu, P., Gopinath, S. C. B., Hilda, A., Lakshmipriya, T., and Annadurai, G.:Optimization of extracellular keratinase production by poultry farm isolateScopulariopsis brevicaulis, Bioresour. Technol., 98, 1298e1303 (2007).

37. Suntornsuk, W. and Suntornsuk, L.: Feather degradation by Bacillus sp. FK 46in submerged cultivation, Bioresour. Technol., 86, 239e243 (2003).

38. Drucker, H.: Regulation of exocellular proteases in Neurospora crassa. Induc-tion and repression of enzyme synthesis, J. Bacteriol., 110, 1041e1049 (1972).

39. Meevootisom, V. and Niederpruem, D. J.: Control of exocellular proteases indermatophytes and especially Trichophyton rubrum, Sabouraudia, 17, 91e106(1979).

40. El-Refai, H. A., AbdelNaby, M. A., Gaballa, A., El-Araby, M. H., and AbdelFattah, A. F.: Improvement of the newly isolated Bacillus pumilus FH9 kerati-nolytic activity, Process Biochem., 40, 2325e2332 (2005).

41. Siesenop, U. and Bohm, K. H.: Comparative studies on keratinase production ofTrichophyton mentagrophytes strains of animal origin, Mycoses, 38, 205e209(1995).

42. Park, G. T. and Son, H. J.: Keratinolytic activityof Bacillus megaterium F7-1,a feather-degrading mesophilic bacterium, Microbiol. Res., 164, 478e485(2009).

43. Cai, C. G., Lou, B. G., and Zheng, X. D.: Keratinase production and keratindegradation by amutant strain of Bacillus subtilis, J. ZhejiangUniv. Sci. B., 9, 60e67(2008).

44. Singh, C. J.: Characterization of an extracellular keratinase of Trichophytonsimii and its role in keratin degradation, Mycopathologia, 137, 13e16 (1997).

45. Muhsin, T. M. and Hadi, R. B.: Degradation of keratin substrates by fungiisolated from sewage sludge, Mycopathologia, 154, 185e189 (2001).

46. Baker, D. H., Blitenthal, R. C., Boebel, K. P., Czarnecki, G. L., Southern, L. L.,and Wilis, G. M.: Protein amino acid evaluation of steam-processed feathermeal, Poult. Sci., 60, 1865e1872 (1981).

47. Papadopoulos, M. C., El-Boushy, A. R., and Ketelaars, E. H.: Effect of differentprocessing conditions on amino acid digestibility of feather meal determinedby chick assay, Poult. Sci., 64, 1729e1741 (1985).

48. Dalev, P., Ivanov, I., and Liubomirova, A.: Enzymic modification of featherkeratin hydrolysates with lysine aimed at increasing the biological value, J. Sci.Food Agric., 73, 242e244 (1997).

49. Farag, A. M. and Hassan, M. A.: Review-Purification, characterization andimmobilization of a keratinase from Aspergillus oryzae, Enzyme Microb. Tech-nol., 34, 85e93 (2004).

50. Gousterova, A., Braikova, D., Goshev, I., Christov, P., Tishinov, K., Tonkova, V. E.,Haertle, T., and Nedkov, P.: Degradation of keratin and collagen containingwastes by newly isolated thermoactinomycetes or by alkaline hydrolysis, Lett.Appl. Microbiol., 40, 335e340 (2005).

51. Riffel, A., Lucas, F., Heeb, P., and Brandelli, A.: Characterization of a newkeratinolytic bacterium that completely degrades native feather keratin, Arch.Microbiol., 179, 258e265 (2003).

52. Nam, G. W., Lee, D. W., Lee, H. S., Lee, N. J., Kim, B. C., Choe, E. A.,Hwang, J. K., Suhartono, M. T., and Pyun, Y. R.: Native-feather degra-dation by Fervidobacterium islandicum AW-1, a newly isolated kerati-nase-producing thermophilic anaerobe, Arch. Microbiol., 178, 538e547(2002).

53. Akhtar, W. and Edwards, H. G. M.: Fourier-transform raman spectroscopy ofmammalian and avian keratotic biopolymers, Spectrochim. Acta A Mol. Spec-trosc., 53, 81e90 (1997).

54. Wojciechowska, E., Włochowicz, A., Wysocki, M., Pielesz, A., and Wesełucha-Birczy�nska, A.: The application of Fourier-transform infrared (FTIR) and Ramanspectroscopy (FTR) to the evaluation of structural changes in wool fibre keratin



after deuterium exchange and modification by the orthosilicic acid, J. Mol.Struct., 614, 355e363 (2002).

55. Kim, W. K. and Patterson, P. H.: Nutritional value of enzyme- or sodiumhydroxide-treated feathers from dead hens, Poult. Sci., 79, 528e534 (2000).

56. Kim, W. K. and Patterson, P. H.: Recycling dead hens by enzyme or sodiumhydroxide pretreatment and fermentation, Poult. Sci., 79, 879e885 (2000).

57. Sangali, S. and Brandelli, A.: Feather keratin hydrolysis by a Vibrio sp. strainkr2, J. Appl. Microbiol., 89, 735e743 (2000).

58. Wang, X. and Parsons, C. M.: Effect of processing systems on protein quality offeather meal and hog hair meals, Poult. Sci., 76, 491e496 (1997).

59. Latshaw, J. D., Musharf, N., and Retrum, R.: Processing of feather to maxi-mize its nutritional value for poultry, Anim. Feed Sci. Technol., 47, 179e188(1994).

60. Grazziotin, A., Pimentel, F. A., de Jonng, E. V., and Brandelli, A.: Nutritionalimprovement of feather protein by treatment with microbial keratinase, Anim.Feed Sci. Technol., 126, 135e144 (2006).


Author's personal copy - dyu.edu.twsbb.dyu.edu.tw/chinese/downlaodfile/teach/10.pdfA million tons of chicken feathers from poultry processing plants are produced as wastes annually

Documents