Association of COMT and PRODH gene variants with intelligence quotient (IQ) and executive functions in 22q11.2DS subjects

Page 1

lable at ScienceDirect

Journal of Psychiatric Research xxx (2014) 1e8

Contents lists avai

Journal of Psychiatric Research

journal homepage: www.elsevier .com/locate/psychires

Association of COMT and PRODH gene variants with intelligencequotient (IQ) and executive functions in 22q11.2DS subjectsq

Miri Carmel a,b,*, Omer Zarchi a,c, f, Elena Michaelovsky a,b, Amos Frisch a,b,Miriam Patya a,b, Tamar Green a,c,d, Doron Gothelf a,c, Abraham Weizman a,b,e

a Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israelb Felsenstein Medical Research Center, Petah Tikva, Israelc The Child Psychiatry Unit, Edmond and Lily Safra Children’s Hospital, Sheba MedicalCenter, Tel Hashomer, Ramat Gan, IsraeldNes-Ziyyona-Beer Yaakov Mental Health Center, Beer Yaakov, IsraeleGeha Mental-Health Center, Petah Tikva, IsraelfRabin Medical Center, 49100 Petah Tikva, Israel

a r t i c l e i n f o

Article history:Received 27 January 2014Received in revised form23 April 2014Accepted 24 April 2014

Keywords:22q11.2DSIntelligence quotient (IQ)Executive function (EF)COMT

q Work was performed at the Felsenstein MedicalIsrael and the Behavioral Neurogenetics Center, Sheb* Corresponding author. Felsenstein Medical Rese

Faculty of Medicine, Tel Aviv University, Rabin MedicIsrael. Tel.: þ972 3 9376793; fax: þ972 3 9211478.

E-mail addresses: [email protected], MIRICgmail.com (M. Carmel).

http://dx.doi.org/10.1016/j.jpsychires.2014.04.0190022-3956/� 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Carmel M,functions in 22q11.2DS subjects, Journal of P

a b s t r a c t

The 22q11.2 deletion syndrome (22q11.2DS) carries the highest genetic risk factor for the development ofschizophrenia. We investigated the association of genetic variants in two schizophrenia candidate geneswith executive function (EF) and IQ in 22q11.2DS individuals.

Ninety two individuals with 22q11.2 deletion were studied for the genetic association between COMTand PRODH variants and EF and IQ. Subjects were divided into children (under 12 years old), adolescents(between 12 and 18 years old) and adults (older than 18 years), and genotyped for the COMT Val158Met(rs4680) and PRODH Arg185Trp (rs4819756) polymorphisms. The participants underwent psychiatricevaluation and EF assessment. Our main finding is a significant influence of the COMT Val158Metpolymorphism on both IQ and EF performance. Specifically, 22q11.2DS subjects with Met allele displayedhigher IQ scores in all age groups compared to Val carriers, reaching significance in both adolescents andadults. The Met allele carriers performed better than Val carriers in EF tasks, being statistically significantin the adult group. PRODH Arg185Trp variant did not affect IQ or EF in our 22q11.2DS cohort. Inconclusion, functional COMT variant, but not PRODH, affects IQ and EF in 22q11.2DS subjects duringneurodevelopment with a maximal effect at adulthood. Future studies should monitor the cognitiveperformance of the same individuals from childhood to old age.

� 2014 Elsevier Ltd. All rights reserved.

1. Introduction

Common variants in several psychiatric risk genes were found topredict brain structure at birth which may interfere with normalneurodevelopment, affect cognitive functions and predispose topsychiatric pathologies (Knickmeyer et al., 2014). One of the majorcandidates among these genes is the catechol-O-methyltransferase(COMT) gene the variants of which were implicated in neuro-behavioral phenotypes in healthy and unhealthy individuals. The

Research Center, Petah Tikva,a Medical Center.arch Center (FMRC), Sackleral Center, 49100 Petah Tikva,

[email protected], miri.carmel@

et al., Association of COMT ansychiatric Research (2014), h

enzyme coded by the COMT gene participates in the inactivation ofcatecholamines such as dopamine, and its main pro-cognitive effectis in the prefrontal cortex. The most widely studied variation in theCOMT gene is a functional single-nucleotide polymorphism(rs4680) coding for Val158Met. The Met variant has significantlylower COMTactivity than the Val allele. It is thought that this COMTactivity affects human prefrontal cortical functions such as cogni-tion via dopamine neurotransmission (Rasetti and Weinberger,2011; Gaysina et al., 2013).

1.1. COMT and cognition in healthy individuals

The effect of the COMT gene and especially the Val158Metpolymorphism on IQ and executive function (EF) in healthy in-dividuals has been extensively studied (Barnett et al., 2008;Squarcione et al., 2013). A range of studies have shown that theVal158Met polymorphism has a small but significant impact on

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019

Page 2

M. Carmel et al. / Journal of Psychiatric Research xxx (2014) 1e82

prefrontal cognitive performance, with the Met allele-carrying in-dividuals performing better than Val allele carriers (Barnett et al.,2007b, 2009; Farrell et al., 2012; Parasuraman and Jiang, 2012).On the other hand other studies did not replicate these findings(Blanchard et al., 2011; Diaz-Asper et al., 2008).

1.2. COMT and cognition in 22q11.2DS individuals

The 22q11.2 deletion syndrome (22q11.2DS) which is charac-terized by a hemizygous deletion in chromosome 22 leaving onlyone copy of about 60 genes, among them COMT, is an interestingmodel to study the role of COMT variants and other genes thatreside in the deleted region on cognition (Karayiorgou et al., 2010).These 22q11.2DS individuals are expected to have lower COMTactivity than healthy individuals because they have only one allele(Val or Met) while normal individuals have three possible geno-types (Val/Val, Val/Met, Met/Met).

Few studies have examined the effect of COMT genotype oncognitive functions and found that 22q11.2DS subjects carrying theMet allele performed significantly better than those carrying theVal allele in IQ test and EF tasks (Bearden et al., 2004; Shashi et al.,2006). However, other studies failed to demonstrate differences inthese COMT allele groups (Baker et al., 2005; Glaser et al., 2006a;Barnett et al., 2008).

1.3. PRODH

Another gene located on chromosome 22 and is hemizygouslydeleted in 22q11.2DS is PRODH. PRODH encodes for proline dehy-drogenase, a mitochondrial rate-limiting enzyme in the prolinedegradation process. Homozygous mutations in the PRODH genelead to hyperprolinemia type I, a rare neurologic disorder withvariable manifestations such as seizures, mental retardation, psy-chiatric and behavioral disorders. Hemizygous deletions of PRODHin 22q11.2DS have been found to be associated with elevated pro-line levels (Drew et al., 2011).

PRODH has a considerable number of functional SNPs. Multiplestudies in human and mouse models of 22q11.2DS indicate thatPRODH polymorphisms are associated with the risk of schizo-phrenia or schizophrenia-like behavior, although their role in thepathogenesis is not clear. Some of the common functional variantsof PRODH have been characterized and it was found that the SNPsinfluence a wide range of enzymatic activity from a decrease tobelow 30% of the activity to an increase of 120%. We focused onrs4819756 (Arg185Trp) located on exon 5 because it was reportedthat this SNP alters the PRODH enzymatic activity by the reductionof 30e70% (Bender et al., 2005).

Raux et al. (2007) reported that 22q11.2DS patients with severehyperprolinemia performed significantly worse on a large numberof cognitive tasks and exhibited a higher prevalence of psychosiscompared to other 22q11.2DS subjects.

1.4. Interaction between COMT and PRODH

Since both COMT and PRODH variants have been implicated inmodulating cognitive functions and susceptibility to psychiatricmanifestations in healthy and 22q11.2DS individuals, it was inter-esting to examine their combined effect on our 22q11.2DS subjects.

The reduction of COMTactivity may lead to increased dopamineavailability (Bender et al., 2012; Witte and Flöel, 2012) while thereduction of PRODH activity may increase the presence of prolineleading to the elevation in glutamatergic signaling in the hippo-campus causing a release of dopamine in the prefrontal cortex(PFC) (Vorstman et al., 2009; Paterlini et al., 2005).

Please cite this article in press as: Carmel M, et al., Association of COMT anfunctions in 22q11.2DS subjects, Journal of Psychiatric Research (2014), h

The effect of interactions between COMT and PRODH onschizophrenia has been investigated. Paterlini et al. (2005) reportedthat the reduced enzymatic activities of COMT and PRODH cause anincrease in dopamine activity that may predispose to psychosis andschizophrenia. Raux et al. (2007) found that in the PRODH deficientmouse model possessing both hyperprolinemia and the Met-COMTallele the animals were at risk for a broad spectrum of psychoticdisorders. It was shown in a mouse model, that alterations in COMTactivity in the PFC may affect the GABA signaling-related genes, asystem relevant to the pathophysiology of schizophrenia (Kimotoet al., 2012).

The goal of this study was to assess the effect of the functionalCOMT and PRODH SNPs, rs4680 and rs4819756, jointly and sepa-rately, on cognitive capacity in 22q11.2DS subjects. We attemptedto further clarify the possible role of these variations on cognitivefunctions, IQ and executive function, that are relevant to thephenotype of schizophrenia and other mental disorders associatedwith cognitive deficits in 22q11.2DS individuals.

2. Methods

2.1. Subjects

Ninety two subjects with 22q11.2DS were recruited from theBehavioral Neurogenetics Center, a large tertiary referral center inIsrael. The 92 participants were divided into three age groups(Table 1). The study protocol was approved by the InstitutionalReview Board. Written informed consent was obtained from allparticipants and/or their parents after the nature of this study wasexplained to the subjects and their parents or guardians.

2.2. Psychiatric assessment

22q11.2DS subjects and their parents were interviewed by achild psychiatrist (DG and TG) using the Hebrew version of theSchedule for Affective Disorders and Schizophrenia for School-AgeChildren, Present and Lifetime version (K-SADS-PL). The adultswere interviewed with the Structured Clinical Interview for Axis IDSM-IV (SCID). All diagnoses were established according to DSM-IV-TR.

2.3. IQ and EF assessments

IQ was measured using the age-appropriate versions of WISCIIIandWAIS-III (Caplan et al., 1997;Wechsler,1991). EF evaluationwasassessed by the Flanker Fish Tasks (FF) as previously described indetails (Diamond et al., 2007; Zarchi et al., 2013b).

2.4. Genotyping

Diagnosis of all subjects with 22q11.2DS was confirmed by thefluorescence in situ hybridization test and the multiplex ligation-dependent probe amplification technique. COMT Val158Met poly-morphism (rs4680) was genotyped by the C25746809-50 TaqMankit (Applied Biosystems Incorporated, Foster City, CA) using the ABI7000 instrument. Results were validated by RFLP using the NlaIIIrestriction enzyme (Daniels et al., 1996). PRODH-exon 5 Arg185Trppolymorphism (rs4819756) was genotyped by amplification of a409 bp fragment (primers: F:50caaggccactatgcttggag30;R:50aacagtgagggacccaagtg30) followed by digestion by BseNI andanalysis by gel electrophoresis.

According to NCBI dbSNP (Build 37.5) the global minor allelefrequency (MAF) for COMT: A ¼ 0.390 and PRODH: A ¼ 0.257. In our22q11.2DS cohort 50 individuals had the COMT Met (A) allele (50/92 ¼ 0.543) and 23 had the PRODH Trp (A) allele (23/92 ¼ 0.25).

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019

Page 3

Table 1Demographic and clinical data of the study population stratified by age in the 22q11.2DS subjects.

Alla Children (age < 12 yrs) Adolescents (aged 12e18) Adults (age > 18 yrs) c2test

Nb n ¼ 92 n ¼ 32 n ¼ 28 n ¼ 32Age (mean � SD, yrs) 17.61 � 10.72 8.06 � 2.37 14.64 � 1.73 29.75 � 8.64Gender M/F (%/%) 49/43 (53.3/46.7) 21/11 (65.6/34.4) 15/13 (53.6/46.4) 13/19 (40.6/59.4) c2 ¼ 4.02, df ¼ 2, p ¼ 0.13Psychotic disorder (%) 13/84 (15.5) 0/22 (0) 4/31 (12.9) 9/31 (29) c2 ¼ 8.54, df ¼ 2, p ¼ 0.014c

OCD (%) 8/84 (9.5) 1/22 (4.5) 3/31 (9.7) 4/31 (12.9) c2 ¼ 1.04, df ¼ 2, p ¼ 0.593MDD (%) 8/84 (9.5) 0/22 (0) 4/31 (12.9) 4/31 (12.9) c2 ¼ 3.14, df ¼ 2, p ¼ 0.208ADHD (%) 41/84 (48.8) 19/22 (86.4) 15/31 (48.4) 7/31 (22.6) c2 ¼ 20.96, df ¼ 2, p ¼ 0.000d

ADHD ¼ attention deficit hyperactivity disorder, MDD ¼ major depressive disorder, OCD ¼ obsessive compulsive disorder.a Eight subjects did not undergo a psychiatric evaluation, thus 84 out of the 92 underwent a psychiatric assessment.b At IQ evaluation.c Children vs. adults: c2 ¼ 5.79, df ¼ 1, p ¼ 0.016.d Children vs. adults: c2 ¼ 6.96, df ¼ 1, p ¼ 0.008.

M. Carmel et al. / Journal of Psychiatric Research xxx (2014) 1e8 3

2.5. Statistical analysis

Data were statistically analyzed using the SPSS software, Chi-cago, IL (ver. 17). The distribution of psychiatric morbidity andgenderwere calculated by c2 test. The effect of the SNP variants andage on IQ and FF scores was analyzed using multivariate GeneralLinear Model (GLM). IQ score difference among all age groups wasexamined by analysis of variance (ANOVA) test.

3. Results

Our study population consisted of 92 22q11.2DS individualswith the psychiatric morbidity distribution as follows: 13 in-dividuals with psychotic disorders [schizophrenia (n ¼ 6), schizo-affective disorder (n¼ 2), major depressive disorder with psychoticfeatures (n ¼ 2) and psychotic disorder NOS (n ¼ 3)], 8 withobsessive compulsive disorder (OCD), 8 suffered from majordepressive disorder (MDD) and 41 had attention deficit hyperac-tivity disorder (ADHD). Their age ranged from 4 to 55 years. Wedivided our 22q11.2DS individuals into 3 age groups according totheir developmental stage: children, adolescents and adults. Asshown in Table 1, as expected, significantly higher rates of psychoticdisorders were found in the adult compared to the children’s group(p ¼ 0.016) whereas the ADHDwas observedmore in the children’sgroup than the adults (p ¼ 0.008).

Fig. 1. Full scale (FSIQ), verbal (VIQ) and performance (PIQ) IQ scores (Mean � SD) inthe 22q11.2 deletion syndrome subjects at 3 developmental stages. Assessment of IQ inour 22q11.2DS population, showed a steady decline in the IQ scores from childrenthrough adolescents to adults: VIQ 83.72 � 12.31, 75.68 � 12.00, 73.22 � 11.67respectively; F ¼ 6.66, df ¼ 2,89, p ¼ 0.002. PIQ 80.78 � 15.61, 75.14 � 9.46,69.22 � 10.35 respectively; F ¼ 7.17, df ¼ 2,89, p ¼ 0.001. FSIQ 78.94 � 13.31,73.73 � 9.65, 69.19 � 11.36 respectively; F ¼ 6.81, df ¼ 2,89, p ¼ 0.002. **p < 0.003 vs.adults; *p < 0.03 vs. adolescents.

Please cite this article in press as: Carmel M, et al., Association of COMT anfunctions in 22q11.2DS subjects, Journal of Psychiatric Research (2014), h

3.1. Association of COMT Val158Met genetic variant with IQ and EFin the 22q11.2DS subjects

3.1.1. IQThe assessment of IQ in our 22q11.2DS population showed a

steady decline with age in the IQ scores (for details see Fig. 1).In order to examine the factors that affect the IQ value, we

performed a multivariate GLM with COMT genotype and age asfixed factors, gender as covariate and PIQ and VIQ as dependentvariables (Table 2). We found that the COMT genotype (p ¼ 0.01)and age (p ¼ 0.0001) each one independently, affected PIQ with nosignificant interaction between them. Gender did not affect eitherPIQ or VIQ. Post-hoc analysis revealed that subjects with the COMTMet allele had higher IQ scores than the Val carriers in all agegroups, reaching statistical significance in both adolescent (PIQ,p ¼ 0.017) and adult (PIQ, p ¼ 0.007; VIQ, p ¼ 0.012) groups(Fig. 2).

3.1.2. EFEF was assessed by the Flanker Fish Tasks (FF) (Diamond et al.,

2007). We performed multivariate GLM with COMT alleles and ageasfixed factors, genderas covariate andFFblue, FFpink andFFmixedas dependent variables. The results are shown in Table 3. As shownby the corrected GLM model both FF pink (p ¼ 0.009) and mixed(p ¼ 0.019) components of EF were affected by other examinedfactors, while the FF blue component approached significance(p¼ 0.067). Themain factor influencing the three FF tasks examinedwas age (FF blue, pink and mixed p ¼ 0.027, 0.008, 0.008, respec-tively). Adolescents outperformed children in all three FF perfor-mance tests (FF blue, pink and mixed p ¼ 0.043, 0.008 and 0.009,respectively). No differences were found between other age groups.

COMT also affected FF performance, but a significant effectwas expressed only in the mixed condition (p ¼ 0.041), the most

Table 2Multivariate General linear model (GLM) for the effect of the COMT Val158Metvariant and age on PIQ and VIQ scores. Bold indicates values close to or less than�0.05.

Source Dependentvariable

df Mean square F Sig.

Corrected model VIQ 6 486.090 3.499 .004PIQ 6 582.333 4.148 .001

Gender VIQ 1 12.390 .089 .766PIQ 1 204.742 1.459 .231

COMT VIQ 1 481.028 3.463 .066PIQ 1 983.366 7.005 .010

Age VIQ 2 975.977 7.026 .001PIQ 2 1262.211 8.992 .000

COMT � Age VIQ 2 229.754 1.654 .197PIQ 2 130.514 .930 .399

PIQ ¼ performance IQ; VIQ ¼ verbal IQ.

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019

Page 4

Fig. 2. Effect of COMT Val158Met variant on performance (PIQ; A) and verbal (VIQ; B)IQ scores (Mean � SD) in the 22q11.2 deletion syndrome subjects. Subjects with theCOMT Met allele had higher PIQ scores than the Val carriers in both adolescents(p ¼ 0.017) and adults (p ¼ 0.007). VIQ was significantly higher in adults carrying theMet allele (p ¼ 0.012).

Table 3Multivariate general linear model shows the effect of the COMT Val158Met variantand age on the Flanker Fish task.The Flanker Fish (FF) tasks examine working memory, inhibition and cognitiveflexibility. There are three levels of difficulty: the congruent, incongruent and mixedconditions that correspond to the three sub-tests FF Blue, FF Pink and FF Mixedrespectively (Diamond et al., 2007; Zarchi et al., 2013b). Bold indicates values closeto or less than �0.05.

Dependentvariable

Type III sumof squares

Meansquare

F df Sig.

Corrected Model FF Blue .607a .101 2.22 6 .067FF Pink 1.062b .177 3.54 6 .009FF Mixed .532c .089 3.03 6 .019

Gender FF Blue .045 .045 0.99 1 .328FF Pink .002 .002 0.04 1 .840FF Mixed .024 .024 0.82 1 .371

COMT FF Blue .023 .023 0.50 1 .486FF Pink .194 .194 3.88 1 .058FF Mixed .133 .133 4.55 1 .041

Age FF Blue .370 .185 4.06 2 .027FF Pink .569 .284 5.69 2 .008FF Mixed .331 .166 5.66 2 .008

COMT � Age FF Blue .263 .131 2.88 2 .071FF Pink .369 .184 3.69 2 .037FF Mixed .111 .056 1.90 2 .166

a R Squared ¼ .301 (Adjusted R Squared ¼ .165).b R Squared ¼ .407 (Adjusted R Squared ¼ .292).c R Squared = .369 (Adjusted R Squared = .247).

Fig. 3. Effect of COMT Val158Met variant on accuracy in the Flanker Fish (FF) mixedcondition (an executive function task) of the 22q11.2DS age groups. Accuracy wassignificantly higher (p ¼ 0.027) in the adults Met carriers than the Val carriers.

M. Carmel et al. / Journal of Psychiatric Research xxx (2014) 1e84

difficult level of the task. No significant gender effect orCOMT � age interaction was detected for any of the FF tasks. BothCOMT and age, independently, had a significant impact on theperformance in the mixed condition of the FF. The achievementsof the carriers of the two COMT alleles were similar in the chil-dren’s group (Val carriers 0.55 � 0.2 vs. Met carriers 0.54 � 0.23,t ¼ 0.046, df ¼ 15, p ¼ 0.963, NS) (Fig. 3). A non-significant dif-ference in the FF mixed condition performance was detected inthe adolescent group: Met carriers performed better than Valcarriers (0.81 � 0.04 vs. 0.69 � 0.14, respectively; t ¼ 2.12, df ¼ 11,p ¼ 0.06, NS). A significant difference between the Val and Metcarriers in the FF mixed performance was revealed only in theadult group (Met carriers 0.80 � 0.11 vs. Val carriers 0.54 � 0.13;t ¼ 2.914, df ¼ 6, p ¼ 0.027) (Fig. 3).

Please cite this article in press as: Carmel M, et al., Association of COMT anfunctions in 22q11.2DS subjects, Journal of Psychiatric Research (2014), h

3.2. Association of PRODH Arg185Trp genetic variant with IQ and EFin the 22q11.2DS population

In order to examine whether PRODH Arg185Trp affects IQ score,we performedmultivariate GLM analysis with PRODH genotype andage as fixed factors, gender as covariate and PIQ and VIQ asdependent variables (data not shown). No significant effects wererevealed. PRODHArg185Trp genotype did not affect FSIQ, PIQ or VIQin our 22q11.2DS subject sample. Namely, there was no significantdifference between subjects with Arg allele and subjects with Trpallele in IQ performance.

We further assessed the influence of PRODH on EF as evaluatedby the FF tasks. We performed a multivariate GLM with PRODH andage as fixed factors, gender as covariate and FF blue, FF pink and FFmixed as dependent variables (results are not shown). PRODHArg185Trp genotype had no significant effect on any of the FF tasks(FF blue, FF pink or FF mixed) in our sample. Namely, there was nosignificant difference between PRODH Arg carriers and Trp carriers

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019

Page 5

M. Carmel et al. / Journal of Psychiatric Research xxx (2014) 1e8 5

in the FF tasks performance. No interaction was found betweenPRODH genotype and age. Despite the lack of effect of PRODH ge-notype on cognitive function we analyzed the interaction betweenthe effects of COMT and PRODH variants on EF and IQ, and no sig-nificant interaction was detected (data not shown).

No association was found between the various alleles and themental diagnoses (data not shown). Due to the small sample size ofeach diagnostic group and the heterogeneity of agewewere unableto analyze reliably the possible moderating role of diagnosis in ourcohort.

4. Discussion

In this study, we investigated the impact of COMT and PRODHpolymorphisms on IQ and EF performance in 22q11.2DS subjects.Our main findings are a significant and selective influence of theCOMT Val158Met polymorphism on both IQ and EF: (i) 22q11.2DSsubjects with Met allele had a higher IQ score in all age groupscompared to Val carriers, reaching statistical difference in bothadolescent and adults (ii) 22q11.2DS Met carriers performed betterthan Val carriers in EF performance tasks, the statistical significancewas revealed in the adult group, but the tendency started atyounger age. (iii) PRODH Arg185Trp variant did not affect IQ or EF inour 22q11.2DS subject sample.

4.1. Effect of age on IQ

The majority of subjects with 22q11.2DS are known to haveborderline IQ levels (the mean IQ in 22q11.2DS is typically around75), but the IQ range can vary from as low as 40 to more than 100(Gothelf et al., 2013; Squarcione et al., 2013). These data may in-fluence and contribute to the large standard deviation obtained inthe IQ test.

In general, IQ assessment of our 22q11.2DS population, irre-spective of genotype and gender, showed a steady decline with agein the IQ scores. The children’s group had the highest FSIQ score, theadolescent had intermediate, while the adults had the lowest IQscores. The same observation was maintained in the PIQ and VIQsub-tests. A similar observation has previously been reported inlongitudinal studies. Gothelf et al. (2005) followed up for 5 yearstwenty four 22q11.2DS individuals from childhood (age 13.3 � 3.7)to adolescence (age 18.1 � 3.4) and showed a decline from baselinein VIQ in the 22q11.2DS population cohort. In a more recent study,Gothelf et al. (2013), enlarged the sample number and for four yearsfollowed up 125 subjects with 22q11.2DS. As in their previous study,they found a significant decline in IQ scores that was similarly sig-nificant for both VIQ and PIQ scores in children and adolescents.However, the decline was less robust for VIQ in adults. Anotherlongitudinal study examining seventy 22q11.2DS individuals for 3years from childhood (mean age 11.8 years) into mid-adolescence(mean age 15.0 years), demonstrated a general decrease in IQ(Antshel et al., 2010). Duijff et al. (2012) reported a similar obser-vation in 22q11.2DS children at a younger age; they found a meansignificant decline of 9.7 FSIQ points between 5.5 and 9.5 years ofage. Similar results were also obtained from cross-sectionalresearch. Niarchou et al. (2014) reported that older children with22q11.2DS had lower IQs than younger children, ranging from 6.6 to14.1 years of age; this age-related decline was restricted to22q11.2DS subjects only and was not observed in control subjects.

4.2. Effect of age on EF

22q11.2DS is characterized by variable decline in EF perfor-mance, developmental delay and learning disabilities (Gothelfet al., 2013; Zarchi et al., 2013a; Shashi et al., 2012; Bish et al.,

Please cite this article in press as: Carmel M, et al., Association of COMT anfunctions in 22q11.2DS subjects, Journal of Psychiatric Research (2014), h

2005; Simon et al., 2005; Takarae et al., 2009). It was shown thatchildren with 22q11.2DS had greater variation (as shown by largerstandard deviations) in cognitive performance with relation totheir healthy siblings or typically developed individuals (Niarchouet al., 2014; Shapiro et al., 2012; Sobin et al., 2004). EF perfor-mance in our 22q11.2DS subjects, as measured by the FF tasks, wassignificantly better in adolescents compared to children, with nofurther improvement in adults.

A recent study that compared 22q11.2DS subjects to normaltypically developed children aged 7e14 years, showed that the22q11.2DS children performed EF tasks similarly to the matchingage group of typically developed children. Significant differencesbetween the two groups began to emerge only in the older children(Shapiro et al., 2013). The same researchers in an earlier studyshowed that young childrenwith 22q11.2DS demonstrated reducedperformance on tasks of attention compared to their older coun-terparts (Shapiro et al., 2012). Stoddard et al. (2011) revealed thatchildren with 22q11.2DS demonstrated age-related impairment inthe executive control of attention and children in the third agetertile (12.3e14.9 years) performed better in the incongruentflanker task compared to younger age tertile. Age of the individualsstudied is the key to EF performance because major changes inbrain structure and development over time (Philip and Bassett,2011).

4.3. Effect of COMT variants on IQ

COMT genotype affected IQ, with no significant interaction withage or gender. Namely, subjects with Met allele had higher IQ scorein all age groups compared to Val carriers (significant in adoles-cents and adults). Our results are consistent with previous reports.Shashi et al. (2006) found that children (aged 7e16) with 22q11DSwho have the Met allele have higher FSIQ and VIQ (more than 12points), as compared with those with the Val allele.

There are some works that are inconsistent with our findings:Baker et al. (2005) found in their 22q11.2DS population, that theCOMTMet allele is associatedwithmore than a 10-point decrementin IQ; however, the difference did not reach statistical significance.Bearden et al. (2004) screened 44 subjects with 22q11.2DS, meanage of 11.1 years, 28 of themwere Val hemizygous and 16 were Methemizygous and found that in this study group there was a ten-dency toward higher FSIQ in Val-hemizygous subjects(mean¼ 77.6�10.5 versus 71.8� 11.4, respectively). But when theycontrolled the IQ effect, they found that Met-hemizygous subjectsperformed better than Val-hemizygous individuals.

There are several longitudinal studies that examined the effectof COMT genotype on IQ in healthy population. Barnett et al.(2007a) surveyed 8707 normal boys and girls at age 8 and 10years and found that COMT genotype significantly affected VIQ. Thiseffect was expressed primarily in pubertal boys; the children whowere Met allele carriers had higher VIQ than Val carriers.Dumontheil et al. (2011) confirmed similar results in their longi-tudinal study of 260 typically developed individuals with benefit ofthe Met allele emerging after 10 years of age.

A recent longitudinal study of Gaysina et al. (2013) which fol-lowed upmore than 2000 healthy individuals from the British 1946birth cohort and compared IQ outcomes tests between the samechildren aged eight and 15 did not corroborate the previous find-ings and found no association between COMT variation and IQ inchildhood and adolescence.

Concerning the effect of gender on 22q11.2DS subjects, asalready mentioned in our 22q11.2DS cohort, gender did not affecteither PIQ or VIQ. There are studies that demonstrated gender effecton IQ in 22q11.2DS individuals (Barnett et al., 2007a; Duijff et al.,2012), but recent reports have concluded that gender does not

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019

Page 6

M. Carmel et al. / Journal of Psychiatric Research xxx (2014) 1e86

affect IQ either in 22q11.2DS or in healthy individuals (Niarchouet al., 2014; Bearden et al., 2004; Gaysina et al., 2013).

4.4. Effect of COMT variants on EF

A significant effect of COMT allele was detected only in the FFmixed condition, the most difficult level of the task. In the chil-dren’s group the EF performance of the two COMT allele carrierswere similar. A non-significant difference in FF mixed conditionperformance was obtained in the adolescent group in which Metcarriers performed better then Val carriers. A significant differencein FF mixed performance was revealed only in the adult group,adult Met carriers performed much better than Val carriers. Otherstudies in the healthy population reported on the effect of COMTgenotype on EF, namely, Met allele carriers have advantage over theVal carriers (Barnett et al., 2007b; Farrell et al., 2012). A meta-analysis (Barnett et al., 2007b) of healthy individuals showed thatthe Met/Met homozygous individuals performed better than Val/Val individuals in EF and gender did not affect this cognitive per-formance. Farrell et al. (2012) compared executive performance of16 Met to Val COMT homozygous healthy men aged 18 to 50 andfound that Met/Met-COMT subjects outperformed their Val/Val-COMT counterparts. Dumontheil et al. (2011) demonstrated in apopulation of typically developed 6e20 year-old subjects that thecognitive benefit of the Met allele emerges after 10 years of age.Similar findings were found in patient populations. Diaz-Asperet al. (2008), assessed the working memory/EF in schizophreniaprobands (n ¼ 325), their non-psychotic siblings (n ¼ 359), andnormal control subjects (n¼ 330) in participants aged 18e60. Theirfindings support the contention that COMT Val158Met genotypeinfluences EF, with Met homozygotes demonstrating the bestperformance.

Similar results were reported by Shashi et al. (2006) andBearden et al. (2004): Met-hemizygous 22q11.2DS children out-performed Val carriers on a compositemeasure of EF. Unfortunatelyin both studies there is no comparison of the performance of22q11.2DS children and their adolescent counterparts.

In contrast, there are some studies that are inconsistent with ourfindings. Gaysina et al. (2013) used data from the British 1946 birthcohort and investigated the effect of five COMT SNPs, among themVal158Met, on cognitive function in the same boys and girls at twotime-points (age 8 and 15 years). They found no significant asso-ciation between the Val158Met polymorphism and cognitivefunctioning. An earlier meta-analysis also failed to demonstrate asignificant effect of the Val158Met SNP on frontal-related cognitivetasks (Barnett et al., 2008). Glaser et al. (2006a) found no evidenceof an effect of COMT Val158Met genotype on EF in children andadults with 22q11.2DS.

4.5. Effect of PRODH variants on IQ and EF

Although PRODH gene appeared to be a candidate gene withgreat potential to influence IQ and EF in the general population andespecially in 22q11.2DS, we found no effect of PRODH Arg185Trpgenotype on FSIQ, PIQ or VIQ and EF performance in our 22q11.2DSsubjects.

A 3 SNPs haplotype, rs4819756-rs2870983-rs450046, contain-ing our PRODH Arg185Trp SNP, is significantly associated withquantitative changes in striatal activity and fronto-striatal con-nectivity during performance of cognitive tasks (Kempf et al.,2008). Roussos et al. (2009) showed significant associations be-tween the haplotype comprising three PRODH SNPs (rs372055,rs450046, rs385440) and sensorimotor gating, memory, schizotypyand anxiety in healthy male subjects. Zinkstok et al. (2008) inves-tigated the association between three PRODH SNPs (different from

Please cite this article in press as: Carmel M, et al., Association of COMT anfunctions in 22q11.2DS subjects, Journal of Psychiatric Research (2014), h

ours) and brainmorphometry in young patients with schizophreniaand schizoaffective disorder. They found that two of the three SNPstested were associated with bilateral frontal white matter densityreductions, a finding frequently reported in 22q11.2DS andschizophrenia subjects. Raux et al. (2007) characterized the PRODHgenotype and the plasma proline level in 92 adult or adolescent22q11.2DS subjects. They found an inverse correlation between theplasma proline level and IQ, attesting that mild-to-moderatehyperprolinemia is involved in cognitive impairment in humans.Interestingly, 27 of 92 subjects had the risk allele PRODH Arg185Trpgenotype. Another haplotype of PRODH (rs385440-rs372055) wasassociated with impaired planning capacity in EF tasks (Li et al.,2008). A deficit in associative learning was detected in a mousemodel of PRODH deficiency that mimics the status in 22q11.2DS(Paterlini et al., 2005).

Several human studies failed to find an association between thevarious PRODH gene variants and schizophrenia (Glaser et al.,2006b; Abou Jamra et al., 2005; Ohtsuki et al., 2004; Williamset al., 2003a, 2003b; Fan et al., 2003). However, they did notassess the impact of the PRODH gene variants on EF and IQ. In ourstudy PRODH gene variant did not affect EF in 22q11.2DS subjects, apopulation prone to develop schizophrenia. Thus, it seems thatPRODH gene variants do not play a major role in EF performanceand IQ in 22q11.2DS.

5. Conclusions

Our findings show that the COMT genotype affects the perfor-mance of EF as assessed by the FF test. The beneficial effect of theCOMT Met allele on EF performance is manifested in both adoles-cents and adults, but not in children. The benefit of the COMT lowactivity allele may be achieved by reduced inactivation of mono-amines in the prefrontal cortex (Squarcione et al., 2013). In contrast,PRODH polymorphism did not affect EF performance or IQ score inour 22q11.2DS subjects.

The limitations of our study include: a relatively small samplesize, the cross-sectional nature of the study, the failure of correctingfor multiple testing and the phenotypic/diagnostic and age het-erogeneity of the sample. The strength of the study is the use of theappropriate cognitive tasks in three age groups that representdifferent neurodevelopmental stages, enabling the detection of theeffect of age on IQ and EF performance in 22q11.2DS.

We believe that our report contributes to a growing body ofliterature implicating genetic variation of the COMT locus in inef-ficient performance of cognitive functions (IQ and executive func-tion) that are relevant to the phenotype of schizophrenia and othermental disorders associated with cognitive deficits.

In conclusion, functional COMT, but not PRODH, variant affects IQand EF in 22q11.2DS subjects during neurodevelopment with amaximal effect at adulthood. Future longitudinal studies shouldmonitor the cognitive performance of the same 22q11.2DS in-dividuals from childhood to old age in an attempt to determine thecomplex interaction between gene variants and cognition in the lifecycle of this unique population.

Role of funding source

No role of funding source.

Author’s contributions

MC prepared the first draft of the manuscript. MC, AF, EM andMP managed the genotyping assays and analyses. DG, AW and AFdesigned the study and DG wrote the clinical protocol. TG partici-pated in the clinical evaluations. MC, EM and OZ performed the

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019

Page 7

M. Carmel et al. / Journal of Psychiatric Research xxx (2014) 1e8 7

statistical analysis. AW, EM, OZ and AF participated in designing thestudy, data analyses and participated in drafting the manuscript.DG recruited and followed up the patients, carried out the clinicalevaluations and participated in the study design.

All authors read and approved the final manuscript.

Conflict of interest

All authors declare that they have no conflict of interest.

Acknowledgment

No acknowledgment.

References

Abou Jamra R, Schumacher J, Becker T, Dahdouh F, Ohlraun S, Suliman H, et al. Noevidence for an association between variants at the proline dehydrogenaselocus and schizophrenia or bipolar affective disorder. Psychiatr Genet2005;15(3):195e8.

Antshel KM, Shprintzen R, Fremont W, Higgins AM, Faraone SV, Kates WR. Cognitiveand psychiatric predictors to psychosis in velocardiofacial syndrome: a 3-yearfollow-up study. J Am Acad Child Adolesc Psychiatry 2010;49(4):333e44.

Baker K, Baldeweg T, Sivagnanasundaram S, Scambler P, Skuse D. COMT Val108/158Met modifies mismatch negativity and cognitive function in 22q11 deletionsyndrome. Biol Psychiatry 2005;58(1):23e31.

Barnett JH, Heron J, Goldman D, Jones PB, Xu K. Effects of catechol-O-methyltransferase on normal variation in the cognitive function of children.Am J Psychiatry 2009;166(8):909e16.

Barnett JH, Heron J, Ring SM, Golding J, Goldman D, Xu K, et al. Gender-specificeffects of the catechol-O-methyltransferase Val108/158Met polymorphism oncognitive function in children. Am J Psychiatry 2007a;164(1):142e9.

Barnett JH, Jones PB, Robbins TW, Müller U. Effects of the catechol-O-methyltransferase Val158Met polymorphism on executive function: a meta-analysis of the Wisconsin Card Sort Test in schizophrenia and healthy con-trols. Mol Psychiatry 2007b;12(5):502e9.

Barnett JH, Scoriels L, Munafò MR. Meta-analysis of the cognitive effects of thecatechol-O-methyltransferase gene Val158/108Met polymorphism. Biol Psy-chiatry 2008;64(2):137e44.

Bearden CE, Jawad AF, Lynch DR, Sokol S, Kanes SJ, McDonald-McGinn DM, et al.Effects of a functional COMT polymorphism on prefrontal cognitive function inpatients with 22q11.2 deletion syndrome. Am J Psychiatry 2004;161(9):1700e2.

Bender HU, Almashanu S, Steel G, Hu CA, Lin WW, Willis A, et al. Functional con-sequences of PRODH missense mutations. Am J Hum Genet 2005;76(3):409e20.

Bender S, Rellum T, Freitag C, Resch F, Rietschel M, Treutlein J, et al. Dopamineinactivation efficacy related to functional DAT1 and COMT variants influencesmotor response evaluation. PLoS One 2012;7(5):e37814.

Bish JP, Ferrante SM, McDonald-McGinn D, Zackai E, Simon TJ. Maladaptive conflictmonitoring as evidence for executive dysfunction in children with chromosome22q11.2 deletion syndrome. Dev Sci 2005;8(1):36e43.

Blanchard MM, Chamberlain SR, Roiser J, Robbins TW, Müller U. Effects of twodopamine-modulating genes (DAT1 9/10 and COMT Val/Met) on n-backworking memory performance in healthy volunteers. Psychol Med 2011;41(3):611e8.

Caplan R, Arbelle S, Guthrie D, Komo S, Shields WD, Hansen R, et al. Formal thoughtdisorder and psychopathology in pediatric primary generalized and complexpartial epilepsy. J Am Acad Child Adolesc Psychiatry 1997;36(9):1286e94.

Daniels JK, Williams NM, Williams J, Jones LA, Cardno AG, Murphy KC, et al. Noevidence for allelic association between schizophrenia and a polymorphismdetermining high or low catechol O-methyltransferase activity. Am J Psychiatry1996;153(2):268e70.

Diamond A, Barnett WS, Thomas J, Munro S. Preschool program improves cognitivecontrol. Science 2007;318(5855):1387e8.

Diaz-Asper CM, Goldberg TE, Kolachana BS, Straub RE, Egan MF, Weinberger DR.Genetic variation in catechol-O-methyltransferase: effects on working memoryin schizophrenic patients, their siblings, and healthy controls. Biol Psychiatry2008;63(1):72e9.

Drew LJ, Crabtree GW, Markx S, Stark KL, Chaverneff F, Xu B, et al. The 22q11.2microdeletion: fifteen years of insights into the genetic and neural complexityof psychiatric disorders. Int J Dev Neurosci 2011;29(3):259e81.

Duijff SN, Klaassen PW, de Veye HF, Beemer FA, Sinnema G, Vorstman JA. Cognitivedevelopment in children with 22q11.2 deletion syndrome. Br J Psychiatry2012;200(6):462e8.

Dumontheil I, Roggeman C, Ziermans T, Peyrard-Janvid M, Matsson H, Kere J, et al.Influence of the COMTgenotype onworking memory and brain activity changesduring development. Biol Psychiatry 2011;70(3):222e9.

Fan JB, Ma J, Zhang CS, Tang JX, Gu NF, Feng GY, et al. A family-based associationstudy of T1945C polymorphism in the proline dehydrogenase gene andschizophrenia in the Chinese population. Neurosci Lett 2003;338(3):252e4.

Please cite this article in press as: Carmel M, et al., Association of COMT anfunctions in 22q11.2DS subjects, Journal of Psychiatric Research (2014), h

Farrell SM, Tunbridge EM, Braeutigam S, Harrison PJ. COMT Val(158)Met genotypedetermines the direction of cognitive effects produced by catechol-O-methyltransferase inhibition. Biol Psychiatry 2012;71(6):538e44.

Gaysina D, Xu MK, Barnett JH, Croudace TJ, Wong A, Richards M, et al. LHA geneticsgroup. The catechol-O-methyltransferase gene (COMT) and cognitive functionfrom childhood through adolescence. Biol Psychol 2013;92(2):359e64.

Glaser B, Debbane M, Hinard C, Morris MA, Dahoun SP, Antonarakis SE, et al. Noevidence for an effect of COMT Val158Met genotype on executive function inpatients with 22q11 deletion syndrome. Am J Psychiatry 2006a;163(3):537e9.

Glaser B, Moskvina V, Kirov G, Murphy KC, Williams H, Williams N, et al. Analysis ofProDH, COMT and ZDHHC8 risk variants does not support individual or inter-active effects on schizophrenia susceptibility. Schizophrenia Res 2006b;87(1e3):21e7.

Gothelf D, Eliez S, Thompson T, Hinard C, Penniman L, Feinstein C, et al. COMTgenotype predicts longitudinal cognitive decline and psychosis in 22q11.2deletion syndrome. Nat Neurosci 2005;8(11):1500e2.

Gothelf D, Schneider M, Green T, Debban M, Frisch A, Glaser B, et al. Risk factors andthe evolution of psychosis in 22q11.2 deletion syndrome: a longitudinal 2-sitestudy. J Am Acad Child Adolesc Psychiatry 2013;52(11):1192e203.

Karayiorgou M, Simon TJ, Gogos JA. 22q11.2 microdeletions: linking DNA structuralvariation to brain dysfunction and schizophrenia. Nat Rev Neurosci 2010;11(6):402e16. PMID: 20485365.

Kempf L, Nicodemus KK, Kolachana B, Vakkalanka R, Verchinski BA, Egan MF, et al.Functional polymorphisms in PRODH are associated with risk and protectionfor schizophrenia and fronto-striatal structure and function. PLoS Genet2008;4(11):e1000252. 1e9.

Kimoto S, Muraki K, Toritsuka M, Mugikura S, Kajiwara K, Kishimoto T, et al. Se-lective overexpression of Comt in prefrontal cortex rescues schizophrenia-likephenotypes in a mouse model of 22q11 deletion syndrome. Transl Psychiatry2012;2(8):e146. 1e16.

Knickmeyer RC, Wang J, Zhu H, Geng X, Woolson S, Hamer RM, et al. Commonvariants in psychiatric risk genes predict brain structure at birth. Cereb Cortex2014;24(5):1230e46.

Li T, Ma X, Hu X, Wang Y, Yan C, Meng H, et al. PRODH gene is associated withexecutive function in schizophrenic families. Am J Med Genet Part B (Neuro-psychiatr Genet) 2008;147B(5):654e7.

Niarchou M, Zammit S, van Goozen SH, Thapar A, Tierling HM, Owen MJ, et al.Psychopathology and cognition in children with 22q11.2 deletion syndrome. BrJ Psychiatry 2014;204(1):46e54.

Ohtsuki T, Tanaka S, Ishiguro H, Noguchi E, Arinami T, Tanabe E, et al. Failure to findassociation between PRODH deletion and schizophrenia. Schizophrenia Res2004;67(1):111e3.

Parasuraman R, Jiang Y. Individual differences in cognition, affect, and performance:behavioral, neuroimaging, and molecular genetic approaches. NeuroImage2012;59(1):70e82.

Paterlini M, Zakharenko SS, Lai WS, Qin J, Zhang H, Mukai J, et al. Transcriptionaland behavioral interaction between 22q11.2 orthologs modulatesschizophrenia-related phenotypes in mice. Nat Neurosci 2005;8(11):1586e94.

Philip N, Bassett A. Cognitive, behavioural and psychiatric phenotype in 22q11.2deletion syndrome. Behav Genet 2011;41(3):403e12.

Rasetti R, Weinberger DR. Intermediate phenotypes in psychiatric disorders. CurrOpin Genet Dev 2011;21(3):340e8.

Raux G, Bumsel E, Hecketsweiler B, van Amelsvoort T, Zinkstok J, Manouvrier-Hanu S, et al. Involvement of hyperprolinemia in cognitive and psychiatricfeatures of the 22q11 deletion syndrome. Hum Mol Genet 2007;16(1):83e91.

Roussos P, Giakoumaki SG, Bitsios P. A risk PRODH haplotype affects sensorimotorgating, memory, schizotypy, and anxiety in healthy male subjects. Biol Psy-chiatry 2009;65(12):1063e70.

Shapiro HM, Takarae Y, Harvey DJ, Cabaral MH, Simon TJ. A cross-sectional study ofthe development of volitional control of spatial attention in children withchromosome 22q11.2 deletion syndrome. J Neurodev Disord 2012;4(1):5. 1e12.

Shapiro HM, Wong LM, Simon TJ. A cross-sectional analysis of the development ofresponse inhibition in children with chromosome 22q11.2 deletion syndrome.Front Psychiatry 2013;4(81):1e10.

Shashi V, Francis A, Hooper SR, Kranz PG, Zapadka M, Schoch K, et al. Increasedcorpus callosum volume in children with chromosome 22q11.2 deletion syn-drome is associated with neurocognitive deficits and genetic polymorphisms.Eur J Hum Genet 2012;20(10):1051e7.

Shashi V, Keshavan MS, Howard TD, Berry MN, Basehore MJ, Lewandowski E, et al.Cognitive correlates of a functional COMT polymorphism in children with22q11.2 deletion syndrome. Clin Genet 2006;69(3):234e8.

Simon TJ, Bish JP, Bearden CE, Ding L, Ferrante S, Nguyen V, et al. A multilevelanalysis of cognitive dysfunction and psychopathology associated with chro-mosome 22q11.2 deletion syndrome in children. Dev Psychopathol 2005;17(3):753e84.

Sobin C, Kiley-Brabeck K, Daniels S, Blundell M, Anyane-Yeboa K, Karayiorgou M.Networks of attention in children with the 22q11 deletion syndrome. DevNeuropsychol 2004;26(2):611e26.

Squarcione C, Torti MC, Di Fabio F, iondi M. 22q11 deletion syndrome: a review ofthe neuropsychiatric features and their neurobiological basis. NeuropsychiatrDis Treat 2013;9:1873e84.

Stoddard J, Beckett L, Simon TJ. Atypical development of the executive attentionnetwork in children with chromosome 22q11.2 deletion syndrome. J NeurodevDisord 2011;3(1):76e85.

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019

Page 8

M. Carmel et al. / Journal of Psychiatric Research xxx (2014) 1e88

Takarae Y, Schmidt L, Tassone F, Simon TJ. Catechol-O-methyltransferase poly-morphism modulates cognitive control in children with chromosome 22q11.2deletion syndrome. Cognitive, Affect Behav Neurosci 2009;9(1):83e90.

Vorstman JA, Turetsky BI, Sijmens-Morcus ME, de Sain MG, Dorland B, Sprong M,et al. Proline affects brain function in 22q11DS children with the low activityCOMT 158 allele. Neuropsychopharmacology 2009;34(3):739e46.

Wechsler D. Wechsler Intelligence Scale for children. 3rd ed. San Antonio, TX:Psychological Corporation; 1991.

Williams HJ, Williams N, Spurlock G, Norton N, Ivanov D, McCreadie RG, et al. As-sociation between PRODH and schizophrenia is not confirmed. Mol Psychiatry2003a;8(7):644e5.

Williams HJ, Williams N, Spurlock G, Norton N, Zammit S, Kirov G, et al. Detailedanalysis of PRODH and PsPRODH reveals no association with schizophrenia. AmJ Med Genet Part B, Neuropsychiatric Genet 2003b;120B(1):42e6.

Please cite this article in press as: Carmel M, et al., Association of COMT anfunctions in 22q11.2DS subjects, Journal of Psychiatric Research (2014), h

Witte AV, Flöel A. Effects of COMT polymorphisms on brain function and behaviorin health and disease. Brain Res Bull 2012;88(5):418e28.

Zarchi O, Carmel M, Avni C, Attias J, Frisch A, Michaelovsky E, et al. Schizophrenia-like neurophysiological abnormalities in 22q11.2 deletion syndrome and theirassociation to COMT and PRODH genotypes. J Psychiatric Res 2013a;47(11):1623e9.

Zarchi O, Diamond A, Weinberger R, Abbott D, Carmel M, Frisch A, et al.A comparative study of the neuropsychiatric and neurocognitive phenotype intwo microdeletion syndromes: Velocardiofacial (22q11.2 deletion) and Wil-liams (7q11.23 deletion) syndromes. Eur Psychiatry; 2013. http://dx.doi.org/10.1016/j.eurpsy.2013.07.001. pii: S0924e9338(13)00097-7.

Zinkstok J, Schmitz N, van Amelsvoort T, Moeton M, Baas F, Linszen D. Geneticvariation in COMT and PRODH is associated with brain anatomy in patients withschizophrenia. Genes Brain, Behav 2008;7(1):61e9.

d PRODH gene variants with intelligence quotient (IQ) and executivettp://dx.doi.org/10.1016/j.jpsychires.2014.04.019