-
ORIGINAL PAPER
Effects of Lactobacillus rhamnosus on zebrafishoocyte
maturation: an FTIR imagingand biochemical analysis
Elisabetta Giorgini & Carla Conti & Paolo Ferraris
&Simona Sabbatini & Giorgio Tosi & Corrado Rubini
&Lisa Vaccari & Giorgia Gioacchini & Oliana
Carnevali
Received: 7 June 2010 /Revised: 16 September 2010 /Accepted: 21
September 2010 /Published online: 9 October 2010# Springer-Verlag
2010
Abstract The aim of this study was to verify the effects
ofprobiotic Lactobacillus rhamnosus on zebrafish oocytematuration
using FPA (focal plane array) FTIR imagingtogether with specific
biochemical assays (SDSPAGE,real-time PCR and enzymatic assay).
Oocyte growth isprevalently due to a vitellogenic process which
consists ofthe hepatic synthesis of vitellogenin and its selective
uptakeduring maturation. The administration of L. rhamnosusIMC 501
for 10 days induced chemical changes to oocytecomposition,
promoting the maturation process. Someinteresting biochemical
features, linked to protein secondarystructure (amide I band) and
to phospholipidic and glucidicpatterns, were detailed by
vibrational analysis. The spectro-scopic results were supported by
the early increase of thelysosomal enzyme involved in the final
oocyte maturation,the cathepsin L. This enzyme increases during
folliclematuration, with the highest levels in class IV oocytes.
In
treated females, class III oocytes showed higher cathepsinL gene
expression and enzymatic activity, with levelscomparable to class
IV oocytes isolated from controls; thiscan be related to the
proteolytic cleavage of the highermolecular mass yolk protein
components, as evidenced bySDSPAGE.
Keywords FPA FTIR imaging . Vibrational analysis . Fishoocytes .
Probiotic . Ovary .Danio rerio
Introduction
In recent years, probiotics have attracted considerableattention
not only as feed additives but also for theirpositive effects in a
great number of diseases [18]. Upuntil now, their role in
reproduction and mechanisms ofaction have been poorly studied.
However, it is noteworthyto evidence a recent study on the positive
role ofLactobacillus rhamnosus on zebrafish oocyte growth
andgametes quality [9]. The zebrafish and human genomeshave been
shown to share extensive conserved syntheticfragments and are
therefore increasingly seen as a powerfuland highly amenable model
system for many human andanimal diseases with complete genome
available. Inaddition, many zebrafish genes and their human
homologuedisplay structural and functional similarities [10]. For
thisreason, zebrafish have been considered a good model toelucidate
molecular mechanisms involved in several differ-ent physiological
processes, including reproduction.
Zebrafish oocytes, due to their number, size, relativeflatness
and distinctive maturation states, are ideal subjectsfor
vibrational microspectroscopy experiments. A zebrafishovary is
asynchronous, composed by oocytes at different
E. Giorgini (*) : C. Conti : P. Ferraris : S. Sabbatini :G.
TosiDipartimento di Idraulica, Strade, Ambiente e Chimica,Universit
Politecnica delle Marche,60121 Ancona, Italye-mail:
[email protected]
C. RubiniDipartimento di Neuroscienze,Universit Politecnica
delle Marche,60121 Ancona, Italy
L. VaccariBeamline SISSI, Sincrotrone Elettra,34102 Trieste,
Italy
G. Gioacchini :O. CarnevaliDipartimento di Scienze del
Mare,Universit Politecnica delle Marche,60121 Ancona, Italy
Anal Bioanal Chem (2010) 398:30633072DOI
10.1007/s00216-010-4234-2
-
size, whose maturation process causes relevant modifica-tions in
protein components [11]. In teleosts, vitellogenin(VTG), the yolk
precursor protein synthesized in the femaleliver, is incorporated
by the oocyte from the bloodstream byreceptor-mediated endocytosis;
once inside the oocyte,VTG is processed into smaller yolk proteins
consisting oflipovitellins, phosvitins, phosvettes and
-components,which are stored in the oocyte during the growth
periodand will be the source of nutrients and energy for
thedeveloping embryo [1214].
Fourier Transform Infrared (FTIR) microspectroscopy isa powerful
technique to study the composition and themacromolecular chemistry
of cells and tissues, providing abiochemical fingerprint of the
samples under investigation.Infrared mapping and imaging techniques
generate chemicalcartograms based on peak height, integrated areas
underspecific bands or band ratios, giving a
semi-quantitativeevaluation of sample biocomponents. The
identification andcorrelation of spectral groups (clusters),
directly evidencedon the images, can be achieved by means of
multivariateprocedures [1517].
A recent study analysed mice oocytes by using Synchro-tron
Radiation IR Microspectroscopy (SR-IRMS), providedthe overall
biochemical composition of samples duringmaturation: in fact,
differences between immature oocytes atthe germinal vesicle and
mature metaphase II stage werenicely evidenced [18].
Since 1990s, our group is involved in applying
infraredspectroscopy to study biological modifications [1922].
Aprevious study on zebrafish oocytes, carried out in
ourlaboratories, provided the characterization of specific
spectralmarkers ongoing from class III to IV oocytes, allowing
todefine a new method for classifying the different
maturationstates [23]. As a further extent, we decided to evaluate
at mol-ecular level the effects of probiotic L. rhamnosus on
zebrafishfollicle composition, by IR imaging using a
bidimensionalfocal plane array (FPA) detector, Q-polymerase chain
reaction(PCR), enzymatic assay and sodium dodecyl
sulphatepolyacrylamide gel electrophoresis (SDSPAGE).
Experimental
Sample preparation
Adult Danio rerio (zebrafish) females, purchased from
acommercial dealer (Acquario di Bologna, BO, Italy), were
kept in aquaria at 28 C and oxygenated water. Fishes werefed
twice daily with commercial food (Vipagran, Sera,Germany) and two
times with Artemia salina. Eggs laid byparental fish were kept and
grown. Six-month-old adultzebrafish were used for testing the
effects of probiotic onreproductive process. Two experimental
groups wereperformed: a control group (C), fed on commercial
dietonly, and a treated group (P), fed on commercial diet mixedwith
lyophilized probiotic for 10 days. The probiotic strainused was L.
rhamnosus IMC 501, provided by SynbiotecS.r.l. (Camerino, MC,
Italy) and supplied in the water tanksin a final concentration of
106 CFU ml1, as suggested bythe producer. The count of egg-spawned
output wasperformed every day at 9.00 a.m. within 1 h after
light.
At the end of the treatment, 30 ovaries were frozen inliquid
nitrogen, fixed on corky supports with OCT cryostatembedding medium
(Tissue-Tek) and cryosectioned at apredefined thickness of 57 m by
using a KRYOSTAT1720 DIGITAL instrument; adjacent slices were
deposedon silicon supports for vibrational analysis and on
conven-tional glass slides for morphological examination
(haema-toxylin and eosyn stained) [23]. These procedures
wereperformed in accordance with the Guidelines on the Handlingand
Training of Laboratory Animals by the UniversitiesFederation for
Animal Welfare and with the Italian animalwelfare legislation (D.L.
116/92).
FTIR measurements and data analysis
FTIR measurements were carried out at the FTIR beam-line SISSI,
ELETTRA synchrotron [24], by using aBruker VERTEX 70 interferometer
coupled with a Hyper-ion 3000 Vis-IR microscope and equipped with a
liquidnitrogen cooled FPA detector (detector area size 6464pixels).
For every ovary section, images were acquired intransmission mode
using a 15 condenser/objective (pixelresolution of about 2.6 m);
specific zones, correspondingto oocytes of classes III, III and IV,
were selected for IRmapping. Each IR image (OPUS 6.5, Bruker
softwarepackage), obtained by acquiring simultaneously groups
of4,096 spectra, was collected averaging 128 scans for eachdetector
pixel with a spectral resolution of 4 cm1,rationing the background
single-channel image againstthe sample single-channel one. Bigger
images were doneby defining a grid of images, until a maximum of
36,864spectra. All the samples were compared with
independenttrials.
Gene For primer Rev primer
CatL TGCAACAGAGGAAGGGTGGAG TCCAGCTTGTTTGGGACCTCA
-actin GGTACCCATCTCCTGCTCCAA GAGCGTGGCTACTCCTTCACC
Table 1 Primers list andsequences
3064 E. Giorgini et al.
-
By using OPUS 6.5, total absorbance cartograms,representing the
total intensity of the infrared absorption,were generated for each
sample by integrating areasbetween 1,800 and 1,000 cm1. For a
deeper analysis, thecorresponding spectral data were run with
CytoSpec 1.4.02to obtain chemical maps of the integrated areas
under CHstretching region (3,1002,800 cm1), amide I mode(1,7201,580
cm1) and phosphate and carbohydrate zones(1,300900 cm1).
Average spectra were extracted from IR images, select-ing an
area from the inner zone of each oocyte, in order toavoid the
influence of phospholipidic membrane (OPUS
6.5); depending on oocyte size, the number of selectedspectra
was in the range 1,36012,550. All the averagespectra were two
points baseline linear fitted in the spectralrange 4,000900 cm1 and
vector-normalized [25].
At the occurrence, second-derivative (nine-point smooth-ing) and
peak fitting (Gaussian algorithm) procedures wereadopted to
determine the right position and absorbanceintensity of bands. By
using GRAMS/AI 7.02 (GalacticIndustries, Inc., Salem, NH) software
package, peak fittingwas performed on average spectra (interpolated
in the range1,7201,580 cm1 and two points baseline linear fitted);
toidentify the underlying component bands, the number of
400 m 400 m
a bFig. 1 Photomicrograph of(a) C and (b) P zebrafish
ovarysections (haematoxylin-and-eosin-stained)
100 m
PO2 CH AI100 m
a b
c d e
Fig. 2 Total absorbance cartogram of IIIC oocyte, reconstructed
byintegrating the area between 1,800 and 1,000 cm1 (a), together
withthe corresponding photomicrograph (b); chemical maps of the
integrated areas under the CH2 and CH3 stretching regions
(3,1002,800 cm1) (c), the amide I band (1,7201,580 cm1) (d) and
thephosphate and carbohydrate zones (1,300900 cm1) (e)
Effects of Lactobacillus rhamnosus on zebrafish oocyte
maturation 3065
-
peaks together with their centre values was
carefullyindividuated according to second-derivative results
andfixed before running the iterative process, to obtain thebest
reconstructed curve (residual near to zero). Meanvalues of area and
wavelength were purchased for eachcomponent peak. Attribution of
the bands was doneaccording to literature [16, 2530].
Cathepsin L enzymatic assay
The cathepsin L (Cat L) enzymatic assays were optimizedand
performed from each experimental group (C and P) onthe three oocyte
stages: III, III and IV. The crude extractfor the enzymatic assays
was made by homogenizing thetissue with distilled water (1:2, w/v).
The homogenate wascentrifuged at 14,000g for 10 min at 4 C. The
supernatantwas carefully separated from the lipid layer. The
totalprotein level in the supernatant was determined by themethod
of Bradford [31] with bovine serum albumin(Sigma) as the standard.
Supernatants were used forenzymatic assays.
The Cat L enzymatic activity was routinely assayed againstthe
synthetic substrate Z-Phe-Arg-NNapOMe
(-N-benzy-loxycarbonyl-L-Phe-L-Arg-4-methoxy--naphthylamide)(5-mM
final concentration) by a selective colourimetric assay[32]. For
the quantitative analysis, we used a standard curvebased on
4-methoxy-2-naphtylamine (0.535 M), in orderto convert absorbance
in molar concentration. The colouri-metric assay was performed as
follows: 2.55 l of oocytes atIII, III and IV stages crude extract
were added to 376 l ofactivator buffer (0.1 M NaAc, 1.33 mM
ethylenediaminetetra-acetic acid, EDTA, 6.66 mM cysteine, 5.33 M
urea; pH 5).The mixture was incubated for 5 min at 40 C in order
toactivate the enzyme and then added to 6.25 l of substrate
Z-Phe-Arg-NNapOMe (6 mg/ml in DMSO) and water until afinal volume
of 500 l. After 20 min of incubation at 45 C,the reaction was
stopped with 500 l of colour reagent,containing Fast Garnet Salt (1
mg/ml) with pCMB (10 mM)and EDTA (50 mM), in a ratio of 1:1, pH
6.0. After additionof 1 ml of But-OH, the tube was centrifuged for
5 min at14,000g, in order to separate the reaction product
(4-Me-2-NA). The supernatant was read at 520 nm [32]. The assay
100 m
AI PO2 CH 100 m
a b
c d e
Fig. 3 Total absorbance cartogram of IIIP oocyte, reconstructed
byintegrating the area between 1,800 and 1,000 cm1 (a), together
withthe corresponding photomicrograph (b); chemical maps of the
integrated areas under the CH2 and CH3 stretching regions
(3,1002,800 cm1) (c), the amide I band (1,7201,580 cm1) (d) and
thephosphate and carbohydrate zones (1,300900 cm1) (e)
3066 E. Giorgini et al.
-
activity is expressed as micromole per minute per milli-gramme
per microlitre of 4-methoxy-2-naphthylamine re-leased. The crude
extract amount, temperature, pH and timeof incubations were
optimized and utilized for cathepsin Lassay in all classes of
isolated oocytes. The inhibition studieswere performed by using
both leupeptin and
N-(benzylox-ycarbonyl)-L-phenylalanyl-L-tyrosinal [3335].
SDSPAGE
Five oocytes from selected stage (III, III and IV) of
eachexperimental group (C and P) were homogenized in 10 lof lysis
buffer and then centrifugated at 14,000g for 15 minto separate the
dissolved yolk from the insoluble cellulardebris. The supernatant
was run on SDSPAGE underdenaturing conditions according to basic
procedures using10% acrylamide mini-gels (710 cm) [12].
Molecularweight standards were placed in wells and
electrophoresedat constant current (50 mA). Protein bands were
visualizedby fixing gels in 12% trichloroacetic acid for 1 h,
overnightstaining in 0.2% Coomassie Blue R-350 (Amersham-Pharmacia
Biotech Uppsala, SE-75184, Sweden) in 30%
methanol plus 10% acetic acid and final distaining in
25%methanol and 7% acetic acid.
Gene expression
Total RNA was extracted from samples using mini kitRNeasy
(Qiagen) extraction kit following the manufac-turers protocol.
Total RNA extracted was eluted in 25 l ofRNase-free water. Final
RNA concentrations were deter-mined by spectrophotometer, and the
RNA integrity wasverified by ethidium bromide staining of 28S and
18Sribosomal RNA bands on 1% agarose gel. RNA was storedat 80 C
until use. Total RNAwas treated with DNase (10UI at 37 C for 10
min, MBI Fermentas); a total amount of1 g of RNA was used for cDNA
synthesis, employingiScript cDNA Synthesis Kit (Bio-Rad).
Real-time PCR
PCRs were performed with SYBR green method in an iQ5iCycler
thermal cycler (Bio-Rad). For each sample, tripli-cate PCR
reactions were carried out. The reactions were set
100 m
PO2 AI CH 100 m
a b
c d e
Fig. 4 Total absorbance cartogram of IVC oocyte, reconstructed
byintegrating the area between 1,800 and 1,000 cm1 (a), together
withthe corresponding photomicrograph (b); chemical maps of the
integrated areas under the CH2 and CH3 stretching regions
(3,1002,800 cm1) (c), the amide I band (1,7201,580 cm1) (d) and
thephosphate and carbohydrate zones (1,300900 cm1) (e)
Effects of Lactobacillus rhamnosus on zebrafish oocyte
maturation 3067
-
on a 96-well plate by mixing, for each sample, 1 l ofdiluted
(1/20) cDNA, 5 l of 2 concentrated iQ SYBRGreen Supermix (Bio-Rad),
containing SYBR Green as afluorescent intercalating agent, 0.3 M
forward primer and
0.3 M of reverse primer. The thermal profile for allreactions
was 3 min at 95 C and then 45 cycles of 20 s at95 C, 20 s at 60 C
and 20 s at 72 C. Fluorescencemonitoring occurred at the end of
each cycle. Additional
100 m
PO2 AI CH
100 m
a b
c d e
Fig. 5 Total absorbance cartogram of IVP oocyte, reconstructed
byintegrating the area between 1,800 and 1,000 cm1 (a), together
withthe corresponding photomicrograph (b); chemical maps of the
integrated areas under the CH2 and CH3 stretching region
(3,1002,800 cm1) (c), the amide I band (1,7201,580 cm1) (d) and
thephosphate and carbohydrate zones (1,300900 cm1) (e)
3998,2 3600 3200 2800 2400 2000 1800 1600 1400 1200 1000
899,9
III
IV
I-II
Wavenumbers / cm-1
Abs
orba
nce
/ a.u
.
Fig. 6 Average spectra of clas-ses III, III and IV
oocytes(control C, red; probiotic-treatedP, blue) in the range
4,000900 cm1 (classes III and IVspectra were shifted along
they-axis). Grey rectanglesindicate the analysed
spectralwindows
3068 E. Giorgini et al.
-
dissociation curve analysis was performed and showed inall cases
one single peak. The -actin was used as referencegenes in each
sample in order to standardize the results byeliminating variation
in mRNA and cDNA quantity andquality. The primer sequences were
reported in Table 1. Noamplification product was observed in
negative control andno primerdimer formation was observed in the
controltemplates. The data obtained were analysed using the
iQ5optical system software version 2.0 (Bio-Rad). Modifica-tion of
gene expression is represented with respect to thecontrol sampled
at the same time of the treatment.
Wavenumber/ cm-1
Abs
orba
nce/
a.u
.
III C IV C
III P IV P
R
structures helical structures random coil structuresR
R
Fig. 7 Peak fitting in the region1,7201,580 cm1 of IIIC,
IVC,IIIP and IVP oocytes
1200 1180 1160 1140 1120
1169
1159
III
IV
Wavenumbers / cm-1
Abs
orba
nce
/ a.u
.
Fig. 9 Average spectra of classes III and IV oocytes (control C,
red;probiotic-treated P, blue) in the range 1,1851,130 cm1 (class
IVspectra were shifted along the y-axis)
Fig. 8 Representative SDSPAGE electrophoretic pattern from
classIIIC, IIIP, IIIC, IIIP, IVC and IVP oocytes. Positions of
MWstandards (in kilodalton) are indicated. This panel is a
composite ofthree gels
Effects of Lactobacillus rhamnosus on zebrafish oocyte
maturation 3069
-
Statistical analysis
Regarding the statistical analyses of enzymatic activity andgene
expression, the presented data are meanSD for thenumber of
experiments. Students t test was used forcomparison between the two
experimental groups. P
-
the same, while differences were found in classes III andIV,
between control (C) and probiotic-treated (P) oocytes,above all in
amide I band shape (protein secondarystructure), in CH lipid
stretching modes and in glucidicand phosphate moieties (1,300900
cm1).
Peak fitting procedure was performed on amide I band toevaluate
helical (-helix, 1,657 and 1,649 cm1, and three-turn helix, 1,665
cm1), random coil (1,641 cm1), -turn(1,693 cm1) and -sheet (1,682,
1,638 and 1,614 cm1)secondary structures (Fig. 7) [29]. The
following resultswere obtained: (1) on follicle maturation, the
value of helix/ structures absorbance ratio remained
approximatelyconstant in C, while an increase was observed in P;
(2)random coil structures were detectable only in C samples,with a
threefold increase from III to IVoocytes; (3) in bothgroups, a new
band at 1,665 cm1, attributable to three-turnhelix secondary
structure, was found in class IV oocytes,indicating a
differentiation of the proteic pattern onmaturation.
Changes in cytoplasmic proteins were also shown by theSDSPAGE
test (Fig. 8). The electrophoretic patternevidenced that
vitellogenin incorporation occurred in classIII oocytes, even if
class IIIP oocytes showed an amount ofcytoplasmic proteins similar
to that of class IVC. Aspreviously described, during oocyte
maturation, compo-nents at lower molecular mass appeared, too [34];
thesealterations could be due to proteolytic events, controlled
byCatL activity, occurring on yolk proteins [34, 38]: suchprocesses
generate small peptides and free amino acids thatproduce the
osmotic driving force for water uptake into theoocyte [3941]. To
evaluate oocyte hydration, the bands at1,159 cm1 (CO-H) and 1,169
cm
1 (CO-P) were investi-gated (Fig. 9) [19]: in group P, hydration
is already wellevident in class III oocytes, while in group C it is
observedonly in class IV. In addition, in class IVP oocytes, a
clearphosphorylation process is registered, as indicated by
theincrease of the band at 1,169 cm1.
The cleavage of proteins side chains is also confirmed bythe
increase of band ratios 2,959/2,926 cm1 (asym CH3/CH2) and
2,873/2,854 cm
1 (sym CH3/CH2), more evidentin class IIIP oocytes with respect
to IIIC [18, 23].
To confirm the spectral data, cathepsin L, the lysosomalenzyme
involved in yolk processing during the last phase offollicle
maturation, was analysed. In both class III and IVoocytes, a
significant increase of CatL gene expression(Fig. 10a) and
enzymatic activity (Fig. 10b) occurred afterthe probiotic treatment
(P
-
17. Tosi G, Burattini E, Malvezzi-Campeggi F, Chilosi M, Conti
C,Ferraris P, Monti F, Sabbatini S, Zam A (2007) J Mol
Struct834836:170175
18. Diem M, Wood BR, Chernenko T, Matthus C, Chong C, BernhardU,
Jene C, Brandli AA, McNaughton D, Tobin MJ, Trounson
A,Lacham-Kaplan O (2008) Anal Chem 80:90659072
19. Tosi G, Conti C, Ferraris P, Garavaglia M, Giorgini E,
Rubini C,Sabbatini S (2009) Microsc Res Tech 72:6775
20. Anastassopoulou J, Boukaki E, Conti C, Ferraris P, Giorgini
E,Rubini C, Sabbatini S, Theophanides T, Tosi G (2009) VibSpectrosc
51:270275
21. Tosi G, Balercia P, Conti C, Ferraris P, Garavaglia M,
Giorgini E,Lo Muzio L, Sabbatini S, Stramazzotti D, Rubini C (2010)
AnalQuant Cytol (in press)
22. Conti C, Ferraris P, Giorgini E, Pieramici T, Possati L,
RocchettiR, Rubini C, Sabbatini S, Tosi G, Mariggi A (2007) Lo
Muzio L.J Mol Struct 834836:8694
23. Carnevali O, Conti C, Ferraris P, Garavaglia MG, Gioacchini
G,Giorgini E, Rubini C, Sabbatini S, Tosi G (2009) J Mol
Struct938:207213
24. Lupi S, Nucara A, Perucchi A, Calvani P, Ortolani M, Quaroni
L,Kiskinova M (2007) J Opt Soc Am B 24:959964
25. Wood BR, Chiriboga L, Yee H, Quinn MA, Mc Naughton D,Diem M
(2004) Gynecol Oncol 93:5968
26. Jackson M, Mantsh HH (1993) Spectrochim Acta Rev 15:536927.
Gazi E, Dwyer J, Lockyer NP, Mijan J, Gardner P, Hart CA,
Brown MD, Clarke NW (2005) Vib Spectrosc 38:193201
28. Liu KZ, Shi MH, Mantsh HH (2005) Blood Cell Mol
Diseases35:404412
29. Stuart B (2004) Infrared spectroscopy. Wiley, Chichester30.
Pacifico A, Chiriboga LA, Lasch P, Diem M (2003) Vib Spectrosc
32:10711531. Bradford MM (1976) Anal Biochem 72:24825432. Kamboj
RC, Pal S, Raghav N, Singh H (1993) Biochimie 75:873
87833. Margiotta-Casaluci L, Carnevali O (2009) Chem Ecol
25:496034. Carnevali O, Cionna C, Tosti L, Lubzens E, Maradonna F
(2006)
Gen Comp Endocrinol 146(3):19520335. Carnevali O, Cionna C,
Tosti L, Cerd J, Gioacchini G (2008)
Mol Reprod Dev 75:9710436. Burattini E, Malvezzi-Campeggi F,
Chilosi M, Conti C, Ferraris P,
Monti F, Sabbatini S, Tosi G, Zam A (2007) J Mol Struct
834836:170175
37. Carr GL (2001) Rev Sci Instrum 72(3):1738. Carnevali O,
Carletta R, Cambi A, Vita A, Bromage N (1999)
Biol Reprod 60(1):14014639. Matsubara T, Ohkubo N, Andoh T,
Sullivan CV, Hara A (1999)
Dev Biol 213:183240. LaFleur GJ, Ralda D, Fabra M, Carnevali O,
Denslow N,
Wallace RA, Cerd J (2005) Biol Reprod 73:81582441. Fabra M,
Ralda D, Bozzo MG, Deen PMT, Lubzens E, Cerd J
(2006) Dev Biol 295:25026242. Lasch P, Boese M, Pacifico A, Diem
M (2002) Vib Spectrosc
28:147157
3072 E. Giorgini et al.
Effects of Lactobacillus rhamnosus on zebrafish oocyte
maturation: an FTIR imaging and biochemical
analysisAbstractIntroductionExperimentalSample preparationFTIR
measurements and data analysisCathepsin L enzymatic
assaySDSPAGEGene expressionReal-time PCRStatistical analysis
Results and discussionConclusionReferences
/ColorImageDict > /JPEG2000ColorACSImageDict >
/JPEG2000ColorImageDict > /AntiAliasGrayImages false
/CropGrayImages true /GrayImageMinResolution 150
/GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true
/GrayImageDownsampleType /Bicubic /GrayImageResolution 150
/GrayImageDepth -1 /GrayImageMinDownsampleDepth 2
/GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true
/GrayImageFilter /DCTEncode /AutoFilterGrayImages true
/GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict >
/GrayImageDict > /JPEG2000GrayACSImageDict >
/JPEG2000GrayImageDict > /AntiAliasMonoImages false
/CropMonoImages true /MonoImageMinResolution 600
/MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true
/MonoImageDownsampleType /Bicubic /MonoImageResolution 600
/MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000
/EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode
/MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None
] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false
/PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000
0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true
/PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ]
/PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier ()
/PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped
/False
/Description > /Namespace [ (Adobe) (Common) (1.0) ]
/OtherNamespaces [ > /FormElements false /GenerateStructure
false /IncludeBookmarks false /IncludeHyperlinks false
/IncludeInteractive false /IncludeLayers false /IncludeProfiles
true /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe)
(CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA
/PreserveEditing false /UntaggedCMYKHandling /UseDocumentProfile
/UntaggedRGBHandling /UseDocumentProfile /UseDocumentBleed false
>> ]>> setdistillerparams> setpagedevice