Supplementary Materials for CRISPR/Cas9-coupled recombineering for metabolic engineering of Corynebacterium glutamicum Jae Sung Cho a,b , Kyeong Rok Choi a,b , Cindy Pricilia Surya Prabowo a , Jae Ho Shin a , Dongsoo Yang a , Jaedong Jang a & Sang Yup Lee a,c a Metabolic and Biomolecular Engineering National Research Laboratory, Department of Chemical and Biomolecular Engineering (BK21 Plus Program), BioProcess Engineering Research Center, BioInformatics Research Center, and Institute for the BioCentury, Korea Advanced Institute of Science and Technology, 291, Daehak-ro, Yuseong-gu, Daejeon, 34141, Republic of Korea. b These authors contributed equally to this work. c Correspondence should be addressed to S.Y.L. ([email protected]) Contents Page Supplementary Notes 2 – 3 1
17
Embed
ars.els-cdn.com · Web viewDH5ɑ which also harbors the same gene in its chromosome. During the selection of transformants harboring successfully cloned plasmids, PCR analysis indicated
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Supplementary Materials forCRISPR/Cas9-coupled recombineering for metabolic engineering of Corynebacterium
glutamicum
Jae Sung Choa,b, Kyeong Rok Choia,b, Cindy Pricilia Surya Prabowoa, Jae Ho Shina, Dongsoo
Yanga, Jaedong Janga & Sang Yup Leea,c
aMetabolic and Biomolecular Engineering National Research Laboratory, Department of
Chemical and Biomolecular Engineering (BK21 Plus Program), BioProcess Engineering
Research Center, BioInformatics Research Center, and Institute for the BioCentury, Korea
Advanced Institute of Science and Technology, 291, Daehak-ro, Yuseong-gu, Daejeon,
Note S1. Cloning of endogenous recT gene in E. coli
Cloning of recT gene from E. coli K-12 MG1655 into pTacCC1 vector was first conducted in E. coli DH5ɑ which also harbors the same gene in its chromosome. During the selection of transformants harboring successfully cloned plasmids, PCR analysis indicated that most of the colonies formed carry the desired pTacCC1-recT plasmids. Interestingly, however, sequencing analysis on the plasmids prepared from the colonies read no recT gene cloned, indicating spontaneous loss of the gene while growing the colonies in liquid media. The loss of recT gene was further demonstrated by second round PCR analysis for the streaked colonies grown on master plates. It should be noted that the absence of lacI gene in pTacCC1 leads to uncontrolled expression of the recombinase RecT from its 0.8-kb gene. Ironically, the expressed RecT may have facilitated recombination of chromosomal and plasmid-borne recT genes, damaging the recT genes in the plasmids. As a response to this speculation, we changed the cloning host to E. coli XL1-Blue, which harbors chromosomal lacIQ (Table S1), to minimize the expression of RecT from the successfully cloned pTacCC1-recT. Additional supplementation of ~80 g/L glucose to prevent catabolite activator protein (CAP) from binding to Ptac in the plasmid and enhancing RecT expression enabled successful cloning and maintenance of pTacCC1-recT in XL1-Blue.
The same strategy, however, did not work for cloning the His:RecT vector pTacCC1-HrT. The loss of hexahistidine-tagged recT gene while growing the XL1-Blue transformants was consistently observed even with the supplementation of 80 g/L glucose. It has been repeatedly reported and also observed in our lab that N-terminal fusion of hexahistidine tag improves the expression of proteins (Shin et al., 2016), most likely due to increased translation efficiency. Accordingly, the leaky expression of RecT from XL1-Blue harboring pTacCC1-HrT with glucose supplemented might be high enough to induce recombination of the recT gene in the plasmid, facilitating the loss of the gene from the plasmid. With an observation that successfully cloned pTacCC1-HrT is detectable in most of the colonies formed immediately after transformation, we conceived a strategy of retrieving plasmids directly from the initial colonies formed. Our hypothesis was that successfully cloned pTacCC1-HrT would be among the heterogeneous plasmid population and direct introduction of the prepared plasmid to C. glutamicum will generate colonies with intact pTacCC1-HrT. Proving the hypothesis, C. glutamicum strains with intact pTacCC1-HrT was successfully selected upon introducing the heterogeneous population of plasmid isolated from the harvested colonies.
Note S2. Expression of Cas9 with different codon usage
In our initial efforts to construct plasmid pEKEx1-Cas9, a backbone vector harboring the S. pyogenes cas9 gene, we observed that the plasmid did not result in any transformant upon electroporation of C. glutamicum with pEKEx1-Cas9. It was only when we had cloned the cas9 gene originally codon-optimized for atinomycetal genomes(Tong et al., 2015) that we were able to obtain transformants expressing the Cas9 protein upon IPTG induction in RG media (Fig. S2b). It has been well reported and also observed in our group that the expression of Cas9 at high level retards bacterial cell growth most likely due to non-specific binding of the uncharged Cas9 to the chromosomal DNAs of host organisms. Moreover, a plasmid
2
constitutively expressing Cas9 in the cloning host has rarely been cloned. These reports and observations suggest the cas9 gene with native codon may results in a stronger expression than the codon-optimized cas9 gene in C. glutamicum, resulting in leaky expression of the native cas9 gene at significant levels upon the transformation and culture of the transformants in RG media.
Although direct demonstration of this hypothesis is difficult since viable C. glutamicum colonies harboring pEKEx1-Cas9 do not form, the hypothesis is further supported by another observation: a modified version of pEKEx1-Cas9 (pEKEx1-Cas9spacer) which has a long spacer (49 bp) between its ribosome binding site (RBS) and the first start codon – a feature that generally reduces translation initiation efficiency of a gene – can successfully be introduced to C. glutamicum, although the resulting transformants do not express Cas9 at a level observable on SDS-PAGE (data not shown). If the hypothesis is true, it is a good counterexample to a general notion that a gene with GC content similar to that of the host chromosome has higher translation efficiency – note that the GC content in the codon-optimized cas9 gene is 61.5% as opposed to 35.1% of the native S. pyogenes Cas9 gene while C. glutamicum genome has a GC content of 53.8%.
3
Fig. S1
Adapting electroporation conditions for C. glutamicum transformation for CRISPR/Cas9-coupled recombineering.
Electroporation protocol for C. glutamicum was adapted to improve transformation efficiency by exploiting different media for cell culture (a), distances between electrodes in electroporation cuvettes (b), resistance during electroporation (c), recovery time after electroporation (d) and presence or absence of pTacCC1-HrT (e). Default parameters are NCM media, 1-mm gap electroporation cuvettes and resistance of 200 Ω with two hours of recovery. n = 3, NS, not significant, **P < 0.01, determined by two-tailed Student t-test. Error bars represent standard deviations.
4
Fig. S2
Expression test for RecT and Cas9 in C. glutamicum.
(a) Expression of RecT (~30 kDa) and hexahistidine-tagged RecT (~31 kDa) from C. glutamicum ATCC 13032 harboring either pTacCC1-recT or pTacCC1-HrT. No IPTG was supplemented. Red arrows (►) indicate overexpressed protein bands. φ, control strain with pTacCC1. (b) Expression of hexahistidine-tagged Cas9 (~160 kDa) from C. glutamicum ATCC 13032 pEKEx1-Cas9opt in BHI and RG media. IPTG was supplemented at different concentrations (0 – 2 mM). Note that C. glutamicum strains applied for CRISPR/Cas9-coupled recombineering are recovered in BHI media after electroporation with no IPTG supplemented. Red arrows (◄) indicate overexpressed protein bands.
5
Fig. S3
Serial transformation protocol for CRISPR/Cas9-coupled recombineering.
(a) Schematic overview of the serial transformation protocol. Cas9-sgRNA vector (pCG9-argR1) and ssODN (ssODNargR_400) targeting 400-bp deletion of argR are introduced to the cells. The transformed cells are immediately used for the preparation of competent cells. The competent cells are re-transformed with the same Cas9-sgRNA vector and ssODN and the cycle is repeated indefinitely to enhance the mutant population until positive mutants are found.
6
Fig. S4
GABA production from the engineered C. glutamicum strains by 96-hour flask cultivation
Flask cultivation profiles over the course of 96 hours showing optical density (OD 600) and concentration for the products, L-glutamate and GABA. Samples at 96 hours were analyzed for the concentration of L-glutamate and GABA by HPLC n=3, error bars indicate standard deviation. Analysis data on additional set of samples at 24 hours are presented together.
gs_gabT gabT 457-480 TCGACAACGCGTACCACGGA Leading CGG 0 0 0
gs_gabP gabP 827-850 TGGCCATGTAATAGGCCACT Lagging GGG 0 0 0aPosition is measured from the beginning of the coding sequence.bNumber of promiscuous targets with 0-, 1-, or 2-bp mismatches of the sgRNA sequence.
13
References
Bachmann, B.J., 1996. Derivations and genotypes of some mutant derivatives of Escherichia coli K-12. In: Neidhardt, F. C., (Ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology vol. 2. ASM Press, Washington, DC, pp. 2460-2488.
Chang, A.C., Cohen, S.N., 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134, 1141-1156.
Eikmanns, B.J., Kleinertz, E., Liebl, W., Sahm, H., 1991. A family of Corynebacterium glutamicum/Escherichia coli shuttle vectors for cloning, controlled gene expression, and promoter probing. Gene. 102, 93-98.
Kinoshita, S., Nakayama, K., Akita, S., 1958. Taxonomical study of glutamic acid accumulating bacteria, Micrococcus glutamicus nov. sp. Bull. Agr. Chem. Soc. Japan. 22, 176-185.
Lee, S.Y., Lee, J.W., Song, H., Kim, J.M., Choi, S., Park, J.H., 2008. Recombinant microorganism having an ability of using sucrose as a carbon source. US patent 20110269183.
Na, D., Yoo, S.M., Chung, H., Park, H., Park, J.H., Lee, S.Y., 2013. Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs. Nat. Biotechnol. 31, 170-174.
Shin, J.H., Park, S.H., Oh, Y.H., Choi, J.W., Lee, M.H., Cho, J.S., Jeong, K.J., Joo, J.C., Yu, J., Park, S.J., Lee, S.Y., 2016. Metabolic engineering of Corynebacterium glutamicum for enhanced production of 5-aminovaleric acid. Microb. Cell Fact. 15, 174.
Studier, F.W., Moffatt, B.A., 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113-130.