Apoptosis induction and inhibition of hyperplasia formation by 2-[piperidinoethoxyphenyl]-3-[4-hydroxyphenyl]-2H-benzo(b)pyran in rat uterus

a

hoosm

Research www.AJOG.org

BASIC SCIENCE: GYNECOLOGY

Apoptosis induction and inhibition of hyperplasia formationby 2-[piperidinoethoxyphenyl]-3-[4-hydroxyphenyl]-2H-benzo(b)pyran in rat uterusVishal Chandra, MSc; Iram Fatima, MSc; Ruchi Saxena, MSc; Shakti Kitchlu, MSc; Sharad Sharma, MD;Mohammad Kamil Hussain, MSc; Kanchan Hajela, PhD; Preeti Bajpai, PhD; Anila Dwivedi, PhD

OBJECTIVE: The study was undertaken to explore the antiproliferativemechanism of action of 2-[piperidinoethoxyphenyl]-3-[4-hydroxyphenyl]-2H-benzo(b)pyran (K-1) in estradiol-induced rat uterine hyperplasia.

STUDY DESIGN: Adult ovariectomized rats received vehicle or estradiollone (20 �g/kg) or estradiol along with K-1 (100 or 200 �g/kg) for 14

days. Uterine histomorphometric analysis and immunoblotting wereperformed. Caspase-3 activity and terminal deoxynucleotidyl trans-ferase-mediated nick end-labeling staining were performed to analyzethe apoptotic potential of compound.

RESULTS: Compound inhibited estradiol-induced uterine weight andhistomorphometric changes pertaining to endometrial growth and

hydroxyphenyl]-2H-benzo(b)pyran in rat uterus. Am J Obstet Gynecol 2011;205:362.

rctr

0002-9378/$36.00 • © 2011 Mosby, Inc. All rights reserved. • doi: 10.1016

vator protein-1 regulated genes and transcription factors. The com-pound significantly induced apoptosis, interfered with Akt activation,decreased X-linked inhibitor of apoptosis protein expression leading toan increased cleavage of caspase-9, caspase-3, poly(adenosine diphos-phate–ribose) polymerase, increased Bax/Bcl2 ratio, and caspase-3activity.

CONCLUSION: K-1 inhibits endometrial proliferation via nonclassicalestrogen receptor signaling mechanisms. It interfered with Akt activa-tion and induced apoptosis via the intrinsic pathway and inhibited estra-diol-induced hyperplasia formation in rat uterus.

down-regulated the expression of estrogen response element and acti- Key words: apoptosis, endometrial hyperplasia, rat

Cite this article as: Chandra V, Fatima I, Saxena R, et al. Apoptosis induction and inhibition of hyperplasia formation by 2-[piperidinoethoxyphenyl]-3-[4-

sttsqtstshedp

2

Estrogen hormones induce prolifera-tive disorders and changes in the

structure of tissues in the uterus, result-ing in the formation of hyperplasia.1,2

The culmination of these estrogen-in-duced changes in proliferation and mor-phogenesis leads to atypical hyperplasiaand subsequently the formation of can-cer in the endometrium.3,4 Progestagens

ave been used widely in the treatmentf endometrial hyperplasias, especiallyf the simple forms, with satisfactory re-ults.5-7 Unfortunately, progestin treat-

ent leads to depletion of progesterone

From the Division of Endocrinology (Mr ChaDr Dwivedi), Division of Toxicology (Dr SharChemistry (Mr Hussain), Central Drug ReseaIndustrial Research (CSIR), Lucknow, India,Integral University, Lucknow, India.

Received Oct. 28, 2010; revised April 23, 2011;

This study was supported by Indian Council of MBMS (CDRI communication no. 8063) and the MGovernment of India.

Reprints: Anila Dwivedi, PhD, Division of Endocr173, Lucknow 226001, Uttar Pradesh, India. an

eceptor within the target tissue and thusausing response failure in adjuvant set-ings as is evident from the studies car-ied out in nude mice8 and humans.9

Estrogen has a variety of effects in theformation of endometrial hyperplasiaincluding stimulation of cell prolifera-tion and enhanced Akt activity, which isa survival factor with an antiapoptoticactivity, and it also affects cell cycle byregulating the stability of cyclins.10-12 Es-trogens have been found to act as mito-gens13; therefore, a logical approach tothe treatment of estrogen-related hyper-

a, Ms Fatima, Ms Saxena, Ms Kitchlu, and), Division of Medicinal and ProcessInstitute, Council of Scientific andDepartment of Biotechnology (Dr Bajpai),

epted May 5, 2011.

ical Research New Delhi Grant 58/23/2007-try of Health and Family Welfare, the

ogy, Central Drug Research Institute, P.O. [email protected].

r/j.ajog.2011.05.024

OCTOBER 2011 Americ

plasic endometrial growth is the use ofantiestrogens, which are thought to an-tagonize the action of estrogen by directcompetition to estrogen receptor (ER)sites.14,15

Different classes of synthetic com-pounds that are capable of antagonizingER action have been developed so far.Among these, benzopyrans are the classof potent antiestrogens and have highoral bioavailability.16 These compoundshow high affinity for ER in uterine cy-osol and have no estrogen agonistic ac-ivity in human breast cancer modelstudied in vitro and in vivo.17-19 In auest to design nonsteroidal pure anties-rogens, benzopyran derivatives synthe-ized at the Central Drug Research Insti-ute (CDRI) (Lucknow, India) displayignificant antiestrogenic activity and in-ibit uterine growth.20,21 However, theirffects and therapeutic potential on en-ometrial disorders have not been ex-lored yet.The potent antiestrogenic profile of

-[piperidinoethoxyphenyl]-3-[4-hyd-

ndrmarchand

acc

edinis

inolila.d

oxyphenyl]-2H- benzo(b)pyran (K-1)

an Journal of Obstetrics & Gynecology 362.e1

uprgcgbod2tV

rft

snctmwfa

psimhf

ta

tm

5tn1tgB1cdSoc

Research Basic Science: Gynecology www.AJOG.org

encouraged us to evaluate its antiprolif-erative effects on estrogen-induced hy-perplasia in rat uterus. The present studywas therefore undertaken to determinethe antiproliferative action of the com-pound in endometrial hyperplasia bystudying the modulation of genes thatare involved in cellular proliferation andsurvival.

MATERIALS AND METHODSCompoundK-1 (Figure 1) was synthesized accordingto the methods as described earlier.20,22,23

Animal preparation andtreatment scheduleYoung adult rats (Sprague Dawley strain)of body weight of 150 g of the institute col-ony were used in this study. Animals werehoused under uniform animal husbandryconditions (24 � 1°C) with free access topelleted food and water.

All animal procedures were carriedout as per the guidelines provided by theinstitute’s Animal Ethics, Use, and CareCommittee. Prior approval was obtainedfrom the Institutional Animal EthicsCommittee for animal experimentation.

Rats were ovariectomized24 bilaterallynder ether anesthesia and given a resteriod of 2 weeks. Following the rest pe-iod, rats were divided into variousroups (6-8 rats per group): group I re-eived olive oil and gum acacia as vehicle,roup II received estradiol (20 �g/kgody weight, in olive oil, subcutane-usly), groups III and IV received, in ad-ition to estradiol, K-1 at 100 �g and at00 �g/kg body weight doses, respec-ively (in gum acacia, orally), and groups

FIGURE 1Chemical structureof compound K-1

Chandra. Inhibition of hyperplasia formation in rat uterusby benzopyran derivative. Am J Obstet Gynecol 2011.

and VI received only K-1 at 100 �g/kg o

362.e2 American Journal of Obstetrics & Gynecolo

body weight and 200 �g /kg body weight,espectively. All treatments were givenor 14 days. Animals were killed 24 h af-er the last treatment.

Uteri were collected, weighed, andtored at – 80°C until analysis. For ribo-ucleic acid (RNA) isolation, tissue wasollected in RNA later at room tempera-ure for 24 h and then stored at – 80°C. A

idportion of a single horn of each uterias preserved in 4% paraformaldehyde

or histological and histomorphometricnalysis.

Histomorphometric analysisFormalin-fixed uterine tissues were sec-tioned, stained with hematoxylin/eosin,and examined under light microscope(Nikon 80i; Nikon, Tokyo, Japan). Imageswere captured with NIS-Elements F 3.0camera (Nikon) and analyzed using LeicaQWin software (Wetzlar, Germany).25,26

Endometrial area (EA), luminal area (LA),luminal epithelial cell height (LEH), glandnumber, glandular area (GA), stromalarea, and glandular/stromal area ratio(G/S) as an indicator for cellular hypertro-phy were calculated by averaging the mea-surements at 3 locations in 3 different he-matoxylin and eosin–stained uterine tissuesections for each individual animal.

Western blot analysisUterine tissue was homogenized in anice-cold phosphate buffer (50 mM) con-taining 10 mM sodium molybdate, 50mM sodium fluoride, 1 mM EDTA, 400mM sodium chloride, 12 mM mono-thioglycerol, 2 mM phenylmethylsulfo-nyl fluoride, leupeptin (2 �g/mL), and

rotease inhibitor cocktail (50 �g/g tis-ue) (Sigma Aldrich, St Louis, MO) us-ng ultraturrax homogenizer. The ho-

ogenate was incubated on ice for 1our with occasional shaking and centri-

uged at 16,000 � g for 15 minutes at4°C.

Protein concentration in supernatantwas determined by Bradford assay.27

Sample containing 35 �g protein wasboiled for 10 minutes in denaturing sam-ple buffer consisting of 10% glycerol, 1%sodium dodecyl sulfate, 1% �-mercap-oethanol, 10 mM Tris-HCl (pH 6.8),nd 0.01% bromophenol blue; separated

gy OCTOBER 2011

o Immuno-Blot polyvinyl difluorideembrane (Millipore, Bedford, MA).Nonspecific sites were blocked with

% skimmed milk for 2 hours at roomemperature and then incubated over-ight at 4°C with primary antibody at:5000 dilution ER, progesterone recep-or (PR), proliferating cell nuclear anti-en (PCNA), and cyclin D1 (Santa Cruziotechnology, Santa Cruz, CA) or at:1000 dilution for cleaved caspase-3,leaved caspase-9, cleaved poly(adenosineiphosphate–ribose) polymerase (PARP),437p-Akt, Akt, X-linked inhibitor of ap-ptosis protein (XIAP), c-Fos, c-Jun,-erbB2, c-myc, �-catenin, Bax, and Bcl-2

(Cell Signaling Technology, Beverly, MA).Subsequently the blots were washed 3times in 0.1% Tween 20 in Tris-bufferedsaline (TBS) and then incubated with1:10,000 dilution of secondary antibody(horseradish peroxidase conjugate) for 1hour at 25°C.

After extensive washing with 0.1%Tween 20 in TBS, substrate solution wasadded to the membrane, incubated for5-15 seconds, and exposed at room tem-perature. The membranes were devel-oped with an enhanced chemilumines-cence kit, following the manufacturer’sinstructions (GE Healthcare, Indianapo-lis, IN). For normalization, the mem-branes were stripped using buffer con-taining 62.5 mM Tris (pH 6.8), 2%sodium dodecyl sulfate, and 100 mM�-mercaptoethanol and then reprobedwith anti-�-actin antibody (Santa CruzBiotechnology). Quantitation of bandintensity was performed by using Quan-tity One software (version 4.5.1; Bio-RadLaboratories, Hercules, CA).

Terminal deoxynucleotidyltransferase-mediated nickend labeling (TUNEL)TUNEL staining was performed by usingan in situ cell death detection kit (Roche,Stockholm, Sweden) to demonstrate theapoptosis in uterine sections. The man-ufacturer’s protocol was followed forparaffin-embedded sections. The slideswere mounted in 3:1 Vectashield (Vec-tor Laboratories, Burlingame, CA): 4’,6-diamino-2-phenylindole (Invitrogen,Carlsbad, CA) and sealed. The sections

wp(we

v

e

www.AJOG.org Basic Science: Gynecology Research

(Nikon 80i), and images were capturedusing an NIS-Elements F 3.0 camera(Nikon).

Caspase-3 colorimetric assayOne of the major steps in apoptotic celldeath is the activation of caspases.Caspase-3 activity was measured usingcolorimetric caspase-3 assay kit (Sigma-Aldrich) according to the manufactur-

FIGURE 2Effect of K-1 compound on endome

Ovariectomized rats were treated with estradiol (iew of rat uteri showing histological changes at �

K-1 100 �g/kg (c and g)–, or E2 plus compoumbedded rat uterine sections of various groups

aP � .001; bP � .01; cP � .05; dP � .05 vs control and; eP �

Chandra. Inhibition of hyperplasia formation in rat uterus b

er’s instructions. Briefly, whole uterine

extract (approximately 50 �g protein)as incubated for 2 hours at 37°C in theresence of 1 mM caspase-3 substrateDEVD-pNA), and the optical densityas measured at 405 nm and activity was

xpressed as fold changes.

Statistical analysisResults are expressed as mean � SEM forthe number of experiments indicated.

al hyperplasia formation in rat uteru

(20 �g/ kg) or E2 plus compound K-1 at 100 �

(a-d) and �20 (e-h) magnification, obtained from-1 200 �g/kg (d and h)–treated rats. B, Histolues are expressed as mean � SEM (n � 6).

; fP � .01; gP � .05; hP � .05 vs estradiol.

zopyran derivative. Am J Obstet Gynecol 2011.

Statistical analysis was performed using

OCTOBER 2011 Americ

analysis of variance followed by New-man Keul’s test. Differences were con-sidered significant at P � .05.

RESULTSUterine histology andhistomorphometryThe haematoxylin-eosin–stained uterinesections and the histomorphometric an-

or 200 �g/kg, for 14 days. A, Cross-sectionalntrol (a and e), E2 (b and f)- or E2 plus compoundrphometric analysis of formalin-fixed, paraffin-

tri s

E2) g/kg4 co

nd K mo. Va.001

y ben

alysis are represented in Figure 2. The ef-

an Journal of Obstetrics & Gynecology 362.e3

r2wg

Attt(as(aPrswipaPa

e

Cb

Research Basic Science: Gynecology www.AJOG.org

362.e4 American Journal of Obstetrics & Gynecology OCTOBER 2011

fects of estradiol on uterine histologicparameters showed extensive proliferationof endometrial epithelium (Figure 2, A).As compared with control, in estradiol-treated rats, uterine sections showed an in-crease of nearly 5-fold in luminal epithelialcell height, 2.4-fold in endometrial area,2.9-fold in luminal area, 4.6-fold in glan-dular area, and 2.3-fold in the ratio of glan-dular vs stromal area (Figure 2, B). Allthese changes were statistically significant(P� .05 toP� .001)andwere indicativeofthe development of uterine hyperplasicconditions. But when compound K-1 wasgiven in rats receiving estradiol, a signifi-cant decrease in each of these parameterswas observed in comparison with the es-tradiol-treated group (P � .05 to P �.001). The effect was highly significant at200 �g/kg dose.

Uterine massThe wet uterine mass of ovariectomizedrats receiving estradiol showed signifi-cant increase (4.8 fold, P � .001) as com-pared with the control group. When K-1was administered in rats receiving estra-diol, a significant decrease in uterineweight was observed (P � .001). In ratseceiving the higher concentration (ie,00 �g/kg) of K-1, the uterine weightas comparable with that of the controlroup (P � .05) (Figure 3, A).

, Data represent the wet uterine weight of con-rol-, estradiol (E2)-, and E2 plus compound–reated groups. The results are represented ashe mean � SEM of 3 independent experiments6-8 rats per group in each experiment). B, PCNAnd cyclin D1 expression by Western blot analy-is. The protein lysates from control-, estradiolE2)-, and K-1–treated groups were preparednd subjected to Western blotting with anti-CNA and anti-cyclin D1, as described in Mate-ials and Methods. Equal amounts of protein ly-ate (35 �g) were analyzed in each lane. �-Actinas used as internal control to correct for load-

ng. Densitometric quantitation of protein ex-ression levels is shown as fold changes. Resultsre expressed as mean � SEM (n � 3).CNA, proliferating cell nuclear antigen.

P � .001; bP � .01; cP � .05; dP � .05 vs control and;P � .001; fP � .01 vs estradiol.

handra. Inhibition of hyperplasia formation in rat uterusy benzopyran derivative. Am J Obstet Gynecol 2011.

FIGURE 3Effect of K-1 treatment on uterine growthand proliferation marker proteins in rat

g(Dcg

wctF2

gg

ebia

www.AJOG.org Basic Science: Gynecology Research

Effect on expression of proliferationmarkers PCNA and cyclin D1For analysis of proliferation markers, im-munoblotting of PCNA and cyclin D1 wasperformed in uterine tissue. An increase ofgreater than 1.8-fold was observed in theestradiol-treated group in comparisonwith control, in both proteins (P � .01 toP � .001), whereas in the K-1-treatedroup, a significant reduction in PCNAapproximately 55%) as well as in cyclin1 (approximately 65%) was observed in

omparison with the estradiol-treatedroup (P � .001) (Figure 3, B).

Expression of estrogen responseelement (ERE)– and activator protein-1 (AP-1)–regulated proteinsand the protooncogenesTo study the effect of compound K-1 onERE- and AP-1–regulated genes, immu-noblotting of ER, PR, c-Jun, and c-Foswas performed in uterine tissue. Down-regulation of ER (P � .001), whereas up-regulation of PR, c-Fos, and c-Jun(P � .01) in the estradiol-treated group

as observed in comparison with theontrol group. In the K-1-treated group,he expression of ER, PR, c-Jun, and c-os was significantly down-regulated at00 �g/kg dose in comparison with the

estradiol-treated group (Figure 4, A).The quantitative messenger RNA

(mRNA) expression analysis clearly in-dicated the up-regulation of ER and PR(P � .001) genes in the estradiol-treatedroup in comparison with the controlroup and was down-regulated (P �

A, The expression level of ER, PR, c-Fos, andc-Jun. B, The expression level of �-catenin, c-rbB2, and c-myc as determined by Westernlotting. A representative immunoblot from 3

ndependent experiments is shown. Equalmounts of protein lysate (35 �g) were analyzed

in each lane. �-Actin was used as an internalcontrol to correct for loading. Densitometricquantitation of protein expression levels areshown as fold changes. Data are expressed asmean � SEM (n � 3).ER, estrogen receptor; PR, progesterone receptor.aP � .001; bP � .01; cP � .05; dP � .05 vs control and;eP � .001; fP � .01; gP � .05; hP � .05 vs estradiol.

Chandra. Inhibition of hyperplasia formation in rat uterusby benzopyran derivative. Am J Obstet Gynecol 2011.

FIGURE 4Expression of ERE- and AP-1–regulated proteinsand the protooncogenes in rat uterus

OCTOBER 2011 American Journal of Obstetrics & Gynecology 362.e5

D

Research Basic Science: Gynecology www.AJOG.org

FIGURE 5Detection of K-1–induced apoptosis in rat uteri

A, Figure represents the apoptotic cells of formalin-fixed, paraffin-embedded rat uterine sections, detected by TUNEL staining. TUNEL-positive cells werestained greenish yellow. The images were captured at �40. B, Caspase-3 proteolytic activity in uterine tissue measured by a colorimetric caspase-3 assaykit. Protein lysates were prepared from uterine tissue of control and treated groups. Proteolytic activity was measured by cleavage of the caspase-3substrate DEVD-pNA as described in Materials and Methods. C, D, and E, The expression level of phosphorylated Akt and XIAP proteins were determinedby Western blotting. A representative immunoblot from 3 independent experiments is shown. Equal amounts of protein lysate (35 �g) were analyzed ineach lane. �-Actin was used as an internal control to correct for loading. Densitometric quantitation of protein expression levels are shown as fold changes.

ata are expressed as mean � SEM (n � 3).aP � .001; bP � .01; cP � .05; dP � .05 vs control and; eP � .001; fP � .01; gP � .05 vs estradiol.

Chandra. Inhibition of hyperplasia formation in rat uterus by benzopyran derivative. Am J Obstet Gynecol 2011.

362.e6 American Journal of Obstetrics & Gynecology OCTOBER 2011

e

aedcm

www.AJOG.org Basic Science: Gynecology Research

.001) in the K-1-treated group in a dose-dependent manner (Supplementary Fig-ure 1).

Western blot analysis of the protoon-cogenes revealed that K-1 caused the sig-nificant inhibition of estradiol-inducedexpression of �-catenin (P � .001),rbB2 (P � .05), and c-myc (P � .001) as

compared with the uteri of estradiol-treated animals (Figure 4, B).

K-1 induces apoptosis inuterine hyperplasiaThe results of TUNEL staining per-formed on rat uterine sections of differ-ent groups are represented in Figure 5, A.The least number of positively stainedcells was observed in the control group,whereas the K-1-treated group showed asignificant number of TUNEL-positivecells in a dose-dependent manner. TheTUNEL-positive cells clearly indicatedthe apoptotic potential of K-1.

To further confirm apoptosis, caspase-3activity was measured using a colorimetricassay (Figure 5, B). Caspase-3 activity wassignificantly decreased in the estradiol-treated group, whereas the activity was sig-nificantly increased (P � .001) in com-pound K-1–treated rat uteri. In thepresence of caspase inhibitor, no signifi-cant activity of caspase-3 was observed.

K-1 interferes with Akt survivalpathway in uterine hyperplasiaCompound K-1 decreased the intracel-lular levels of pAkt, dose dependently in-dicating that compound K-1 interferedwith Akt phosphorylation in uterine hy-perplasia (Figure 5, C). The densitomet-ric analysis of immunoblots showed sig-nificant increase in pAkt (P � .01) as wells in XIAP expression (P � .001) in thestradiol-treated group, whereas itsown-regulation was observed withompound K-1 in a dose-dependentanner (P � .001 at 200 �g dose) (Fig-

ure 5, D and E).

K-1 induces cleavage of caspase-9,caspase-3, and PARP but notcaspase-8To analyze the role of different caspasesin K-1–induced cell death, processing ofimportant caspases like caspase- 9, -3,and -8 were analyzed by immunoblot-

FIGURE 6Effect of compound K-1 on cleaved caspase-9, caspase-3,and PARP and Bax and Bcl-2 proteins

Effect of compound K-1 on apoptotic markers cleaved caspase-9, caspase-3, and PARP. A-C, Baxand Bcl-2 protein expression as determined by Western blot analysis. A representative immunoblotfrom 3 independent experiments is shown. Equal amounts of protein (35 �g) were analyzed in eachlane. �-Actin was used as a control to correct for loading. Densitometric quantitation of proteinexpression levels are shown as fold changes. Results are expressed as mean � SEM (n � 3).PARP, poly(adenosine diphosphate–ribose) polymerase.aP � .001; bP � .01; cP � .05; dP � .05 vs control and; eP � .001; fP � .01; gP � .05 vs estradiol.

Chandra. Inhibition of hyperplasia formation in rat uterus by benzopyran derivative. Am J Obstet Gynecol 2011.

OCTOBER 2011 American Journal of Obstetrics & Gynecology 362.e7

to

ipld

2

c

a

Research Basic Science: Gynecology www.AJOG.org

the expression of the active form ofcaspase -9, caspase-3, and cleaved PARPby approximately 45%, approximately50%, and approximately 40%, respec-tively (P � .01), whereas compound K-1

FIGURE 7Effect of K-1 treatment on uterine wof proliferation markers in ovariect

Effect of K-1 treatment on uterine weight and expnd cleaved PARP in A, ovariectomized rat uteru

dent experiments is shown. Equal amounts of pwas used as an internal control to correct for loadlevels are shown as fold changes. Results are exER, estrogen receptor; PARP, poly(adenosine diphosphate–ribose)receptor.aP � .001; bP � .01; cP � .05; dP � .05 vs control and; eP �

Chandra. Inhibition of hyperplasia formation in rat uterus b

significantly increased the expression of t

362.e8 American Journal of Obstetrics & Gynecolo

cleaved caspase-9, caspase-3 and cleavedPARP by 3.6-fold, 3.4-fold, and 1.9-foldat 200 �g/kg (P � .001) after 14 days ofreatment (Figure 6, B). The expressionf cleaved caspase-8 could not be ob-

ight and expressionized rats

ion of proliferation markers viz. PCNA, ER�, PR,, A representative immunoblot from 3 indepen-in (35 �g) were analyzed in each lane. �-ActinDensitometric quantitation of protein expressionssed as mean � SEM (n � 3).erase; PCNA, proliferating cell nuclear antigen; PR, progesterone

; fP � .01; gP � .05 vs estradiol.

zopyran derivative. Am J Obstet Gynecol 2011.

ained (data not shown).These results c

gy OCTOBER 2011

ndicate that the apoptotic-signalingathway activated by compound K-1 is

ikely to be mediated via the mitochon-rial (intrinsic) pathway.

K-1 alters the Bax/Bcl-2 ratioWe next investigated the expression lev-els of proapoptotic Bax and antiapop-totic Bcl-2 proteins. The expression levelof Bax was found to be decreased by 50%in estradiol-treated rat uteri as comparedwith the control group (P � .001). How-ever, it was increased by 1.7- and 2.6-fold in K-1-treated groups at 100 �g and

00 �g/kg dose, respectively, in compar-ison with the estradiol-treated group(P � .001) (Figure 6, C). The expressionlevel of Bcl-2 protein was increased by1.6-fold in uteri of the estradiol-treatedgroup, which was found to be decreasedby 40% and 60% at 100 �g and 200�g/kg doses, respectively, in K-1–treatedrats (P � .01 to P � .001) (Figure 6, C).

At the mRNA level, the ratio of Bax/Bcl-2 was found to be increased by 2.6-and 5.3-fold in K-1–treated rats at 100�g and 200 �g/kg doses, respectively(Supplementary Figure 2 and Supple-mentary Table).

Effect of K-1 treatment inovariectomized rat uterusResults revealed that in ovariecto-mized rats, K-1 did not induce uterinegrowth (Figure 7, A) and the expres-sion of proliferation marker proteins(ie, ER�, PR, and PCNA), as comparedwith that of control rats, at both thedoses studied (P � .05) (Figure 7, B).The expression of cleaved PARP, amarker for apoptosis, also did notchange (P � .05) under the influence ofK-1. These results indicated the lack ofinherent estrogenicity in K-1.

COMMENTEndometrial hyperplasia is an over-growth or thickening of the endome-trium, which may involve part or all ofthe endometrium. Hyperplasia usuallydevelops in the presence of continuousestrogen stimulation unopposed by pro-gesterone28 and is characterized by in-reased G/S ratio. Severe hyperplasia is

eom

resss. Broteing.pre

polym

.001

y ben

alled carcinoma in situ and is the earli-

atct

h

ccasdg

appohifs

dfetwciopuf

ipg

alpipwt

afaehrut

www.AJOG.org Basic Science: Gynecology Research

est detectable stage of the endometrialcancer.29-31

Our studies in rat uteri demonstratedthat a physiological dose of estradiolgiven for 2 weeks causes a rapid prolifer-ation of the endometrium akin to hyper-plasia, whereas benzopyran compoundK-1 antagonized the proliferative andhyperplasic effects of estradiol. In estra-diol-treated groups, uterine hematoxy-lin-eosin staining clearly showed the his-tological changes (eg, increased EA, LA,LEH, GA, and G/S ratio) in comparisonwith the control group. Interestingly, allthese changes were reversed when K-1was administered along with estradiol.These estradiol-antagonizing effects ap-pear to be mediated via inhibition ofER�-ERE/AP-1–mediated transcriptionalactivation,21 thereby leading to the sup-pression of estradiol-induced prolifera-tion marker genes (eg, PR, PCNA, andcyclin D1). In addition, the estradiol-induced expression of protooncogenes32-34

was suppressed under the influence ofK-1, thereby suppressing the hyperplasicgrowth of uterus.

In the classical pathway, ER binds totheir specific ligands, dimerizes, andthen interacts with the ERE located inthe promoter region of the estrogen-responsive gene.35,36 The present studys well as our earlier study has shownhat benzopyran compound K-1 effi-iently antagonizes ERE-mediated es-rogen action.21

Apart from this, ERs also act throughan alternative pathway in which recep-tors interact with deoxyribonucleic acidindirectly through protein-protein con-tact via AP-1 transcription factors.37

AP-1 is an important transcription fac-tor that governs the expression of genesinvolved in intercellular communica-tion, amplification, and primary patho-genic signals spreading as well as initia-tion and acceleration of tumorigenesis.38

We found that treatment with K-1 de-creased the expression of AP-1 transcrip-tion factors viz. c-fos and c-jun in estradi-ol- induced conditions. The compounddecreased the expression of AP-1 targetgenes, such as cyclin D1, PCNA, andc-myc, which are associated with cell cycle

Estrogen also has rapid, nongenomic ef-fects in the endometrium. It activates sev-eral membranous or cytoplasmic kinasecascades, including the phosphatidylinosi-tol 3-phosphate (Akt) cascade, a signalingpathway that plays a key role in cell survivaland apoptosis.12,39,40 We demonstratedthat benzopyran compound K-1 reducedthe expression of phosphorylated Akt,which may be the upstream event respon-sible for subsequent reduction of AP-1–mediated transactivation.

Akt phosphorylates XIAP, leading tothe inhibition of ubiquitination/degra-dation of XIAP, which is considered apotent inhibitor of caspases and apopto-sis.41 XIAP suppresses cell death by in-

ibiting caspase-3 and caspase-742,43 andmodulates the Bax/cytochrome c path-way by inhibiting caspase-9.44,45 In thisregard, a decrease of XIAP levels as shownby our compounds could induce the apo-ptotic process, at least in part, through ac-tivation of procaspases.46 The activatedaspase signaling and the presence ofleaved fragments of caspase-9, caspase-3,nd cleaved PARP in treated cells demon-trated the involvement of the mitochon-rial (intrinsic) pathway of apoptosis trig-ered by compound K-1.

Akt has been shown to phosphorylatend activate the cyclic adenosine mono-hosphate response element–bindingrotein, which increases the transcriptionf antiapoptotic genes, such as Bcl-2.47 Itas also inhibits the activation of Bax dur-

ng apoptosis.48,49 Translocation of Baxrom the cytosol to the mitochondria re-ults in the release of cytochrome c.

Our results demonstrated that the re-uced Akt activity may be responsible

or significant down-regulation of thexpression of antiapoptotic Bcl-2 andhe up-regulation of proapoptotic Bax,hich indicates that the Bax, Bcl-2, and

aspase proteases are involved in regulat-ng K-1-induced apoptosis. Collectively,ur results suggest that benzopyran com-ound is a potent apoptosis inducer in theterus and can be used as therapeutic agent

or endometrial hyperplasia.In conclusion, we have characterized the

nhibitory effects of benzopyran com-ound K-1 on estradiol- induced uterinerowth in hyperplasic condition in rat

OCTOBER 2011 Americ

ctivity, reduced ERE- and AP-1–regu-ated gene expression, and induced apo-tosis through the caspase-9–mediated

ntrinsic pathway. Interestingly, the com-ound also lacked inherent estrogenicity asas evident from the uterine weight and

he proliferation markers data.Results indicate that benzopyran deriv-

tive K-1 can serve as a candidate moleculeor use as preventive as well as therapeuticgent for endometrial hyperplasia. How-ver, further studies in primary cells fromuman endometrial hyperplasia would beequired with a view to explore the molec-lar and cellular mechanism of action of

his benzopyran derivative in humans. f

ACKNOWLEDGMENTWe wish to thank Dr Mandira Sharma (patholo-gist) for her help in histological evaluation ofuterine sections. V.C. is the recipient of SeniorResearch Fellowship of Indian Council of Med-ical Research, New Delhi.

REFERENCES1. Martin L, Finn CA, Trinder G. Hypertrophyand hyperplasia in the mouse uterus after oes-trogen treatment: an autoradiographic study. JEndocrinol 1973;56:133-44.2. Guinn AG, Mashin IN, Zahkarov DA. Prolifer-ation, mitosis orientation and morphogeneticchanges in the uterus of mice following chronictreatment with both estrogen and glucocorti-coid hormones. J Endocrinol 2001;169:23-31.3. Emons G, Fleckenstein G, Hinney B,Huschmand A, Heyl W. Hormonal interactionsin endometrial cancer. Endocr Relat Cancer2000;7: 227-42.4. Akhmedkhanov A, Zeleniuch-Jacquotte A,Toniolo P. Role of exogenous and endogenoushormones in endometrial cancer: review of theevidence and research perspectives. Ann N YAcad Sci 2001;943:296-315.5. Affinito P, Carlo CD, Mauro PD. Endometrialhyperplasia: efficacy of a new treatment with avaginal cream containing natural micronizedprogesterone. Maturitas 1994;20:191-8.6. Saarikoski S, Yliskoski M, Penttila I. Sequen-tial use of norethisterone and natural progester-one in premenopausal bleeding disorders. Ma-turitas 1990;12:89-97.7. Figueroa-Casas PR, Ettinger B, Delgado E,Javkin A, Vieder C. Reversal by medical treat-ment of endometrial hyperplasia caused by es-trogen replacement therapy. Menopause 2001;8:420-3.8. Satyaswaroop PG, Clarke CL, Zaino RJ,Mortel R. Apparent resistance in human endo-metrial carcinoma during combination treat-ment with tamoxifen and progestin may result

an Journal of Obstetrics & Gynecology 362.e9

4[r8n41Bagg1H2SEaC2H

2ya2Nd12liieB2Yen12avoS2ttG2fpb2HemE2HccwC3n3saM3pE3Vs-au3Eh

3a23egg3Rge3c3vhd4Gsmd14po24sc4nac24ta24nM4Dsh64Asp4npO4DcbA

Research Basic Science: Gynecology www.AJOG.org

of tumor progesterone receptor. Cancer Lett1992;62:107-14.9. Janne O, Kauppila A, Kontula K, Syrjala P, Vi-hko R. Female sex steroid receptors in normal,hyperplastic and carcinomatous endometrium.The relationship to serum steroid hormones andgonadotropins and changes during medroxy-progesterone acetate administration. Int J Cancer1979;24:545-54.10. Simoncini T, Hafezi-Moghadam A, BrazilDP, Ley K, Chin WW, Liao JK. Interaction ofoestrogen receptor with the regulatory subunitof phosphatidylinositol-3-OH kinase. Nature2000;407:538-41.11. Bouskine A, Nebout M, Mograbi B,Brucker-Davis F, Roger C, Fenichel P. Estro-gens promote human testicular germ cell can-cer through a membrane-mediated activationof extracellular regulated kinase and protein ki-nase A. Endocrinology 2008;149:565-73.12. Zhang L, Li X, Zhao L, et al. Nongenomiceffect of estrogen on the MAPK signaling path-way and calcium influx in endometrial carci-noma cells. J Cell Biochem 2009;106:553-62.13. Taylor AH, al-Azzawi F, Pringle JH, Bell SC.Inhibition of endometrial carcinoma cell growthusing antisense estrogen receptor oligode-oxyribonucleotides. Anticancer Res 2002;22:3993-4003.14. Rochefort H, Borgna JL, Evans E. Cellularand molecular mechanism of action of anties-trogens. J Steroid Biochem 1983;19:69-74.15. MacGregor JI, Jordan VC. Basic guide tothe mechanisms of antiestrogen action. Phar-macol Rev 1998;50:151-96.16. Dhar JD, Setty BS, Durani S, Kapil RS. Bi-logical profile of 2-[4-(2-N piperidinoethoxyphe-nyl) -3-phenyl (2H) benzo(B) pyran—a potentanti-implantation agent in rat. Contraception1991;44:461-72.17. Gauthier S, Caron B, Cloutier J, et al. (S)-(�)--[7-(2,2-dimethyl-1 oxopropoxy)-4-methyl-2-[4-

2-(1-piperidinyl)-ethoxy]phenyl]-2H-1-benzopy-an-3-yl]-phenyl 2,2 dimethylpropanoate (EM-00): a highly potent, specific, and orally activeonsteroidal antiestrogen. J Med Chem 1997;0:2117-22.8. Couillard S, Labrie C, Belanger A, Candas, Pouliot F, Labrie F. Effect of dehydroepi-ndrosterone and the antiestrogen EM-800 onrowth of human ZR-75-1 breast cancer xeno-rafts. J Natl Cancer Inst 1998;90:772-8.9. Carlos H, Antonio C. Pure antiestrogens.um Reprod Update 2000;6:237-43.0. Sharma AP, Saeed A, Durani S, Kapil RS.tructure-activity relationship of antiestrogens.ffect of the side chain and its position on thectivity of 2,3-diaryl-2H-1-benzopyrans. J Medhem 1990;33:3216-22.1. Kharkwal G, Fatima I, Kitchlu S, Singh B,

362.e10 American Journal of Obstetrics & Gyneco

-[piperidinoethoxyphenyl]-3-[4-hydroxyphen-l]-2H-benzo(b)pyran, a potent antiestrogenicgent in rats. Fertil Steril 2011;95:1322-7.2. Kapil RS, Durani S, Dhar JD, Setty BS.ovel benzopyrans and process for their pro-uction. European patent no. 90308787/2;990.3. Hajela K, Pandey J, Dwivedi A, et al. Reso-

ution, molecular structure and biological activ-ties of the D- and L-enantiomers of potent anti-mplantation agent DL-2-[4-(2-piperidino-thoxy)phenyl]-3-phenyl-2H-1-benzopyran.ioorg Med Chem 1999;7:2083-90.4. Bauman HR. The estrogens. In: Zarrow MX,ochim JM, McCarthy JL, eds. Experimentalndocrinology: a source book of basic tech-iques. New York, London: Academic Press;964:18-60.5. Innocente F, Mandracchia D, Pektok P, etl. Paclitaxel-eluting biodegradable syntheticascular prostheses. A step towards reductionf neointima formation? Circulation 2009;15:37-45.6. Lortlar N, Kilic S, Peker T, et al. The long-erm effects of progesterone-only contracep-ives on endometrium and ovary in rats. Archynecol Obstet 2010;281:1051-9.7. Bradford MM. A rapid and sensitive method

or the quantitation of microgram quantities ofrotein utilizing the principle of protein-dyeinding. Anal Biochem 1976;72:248-54.8. Epplein M, Reed SD, Voigt LF, Newton KM,olt VL, Weiss NS. Risk of complex and atypicalndometrial hyperplasia in relation to anthropo-etric measures and reproductive history. Am Jpidemiol 2008;168:563-70.9. Horn LC, Schnurrbusch U, Bilek K,entschel B, Einenkel J. Risk of progression inomplex and atypical endometrial hyperplasia:linicopathologic analysis in cases with andithout progestogen treatment. Int J Gynecolancer 2004;14:348-53.0. Sorosky JI. Endometrial cancer. Obstet Gy-ecol 2008;111:436-47.1. Chen X, Zhang Z, Feng Y, et al. Aberranturvivin expression in endometrial hyperplasia:nother mechanism of progestin resistance.od Pathol 2009;22:699-708.2. Weisz A, Bresciani F. Estrogen induces ex-ression of c-fos and c-myc in rat uterus. Molndocrinol 1988;2:816-24.3. Gunin AG, Bitter AD, Demakov AB,asilieva EN, Suslonova NV. Effects of peroxi-ome proliferator activated receptors-alpha andgamma agonists on estradiol-induced prolifer-tion and hyperplasia formation in the mouseterus. J Endocrinol 2004;182:229-39.4. Maia H, Maltej AJ, Athayde C, CoutinhoM. C-erbB2 over-expression in endometrialyperplasia induced by estrogens. Maturitas

logy OCTOBER 2011

5. Nilsson S, Makela S, Treuter E, et al. Mech-nisms of estrogen action. Physiol Rev001;81:1535-65.6. Bjornstrom L, Sjoberg M. Mechanisms ofstrogen receptor signaling: convergence ofenomic and nongenomic actions on targetenes. Mol Endocrinol 2005;19:833-42.7. Kushner PJ, Webb P, Uht R, Liu MM, PriceH Jr. Estrogen receptor action through targetenes with classical and alternative responselements. Pure Appl Chem 2003;75:1757-69.8. Shaulian E, Karin M. AP-1 as a regulator ofell life and death. Nat Cell Biol 2002;4:E131-6.9. Kayisli OG, Kayisli UA, Luleci G, Arici A. Inivo and in vitro regulation of akt activation inuman endometrial cells is estrogen depen-ent. Biol Reprod 2004;71:714-21.0. Gielen SC, Santegoets LA, Kuhne LC, et al.enomic and nongenomic effects of estrogenignaling in human endometrial cells: involve-ent of the growth factor receptor signalingownstream AKT pathway. Reprod Sci 2007;4:646-54.1. Dan HC, Sun M, Kaneko S, et al. Akt phos-horylation and stabilization of X-linked inhibitorf apoptosis protein (XIAP). J Biol Chem004;279:5405-12.2. Takahashi R, Deveraux Q, Tamm I, et al. Aingle BIR domain of XIAP sufficient for inhibitingaspases. J Biol Chem 1998;273:7787-90.3. Scott FL, Denault JB, Riedl SJ, Shin H, Re-atus M, Salvesen GS. XIAP inhibit caspase-3nd -7 using two binding sites: evolutionarilyonserved mechanism of IAPs. EMBO J 2005;4:645-55.4. Nicholson DW. ICE/CED3-like proteases asherapeutic targets for the control of inappropri-te apoptosis. Nat Biotechnol 1996;14:97-301.5. Shiozaki EN, Chai J, Rigotti DJ, et al. Mecha-ism of XIAP-mediated inhibition of caspase-9.ol Cell 2003;11:519-27.6. Sasaki H, Sheng YL, Kotsuji F, Tsang BK.own-regulation of X-linked inhibitor of apopto-is protein induces apoptosis in chemoresistantuman ovarian cancer cells. Cancer Res 2000;0:5659-66.7. Pugazhenthi S, Nesterova A, Sable C, et al.kt/protein kinase B up-regulates Bcl-2 expres-ion through cAMP-response element-bindingrotein. J Biol Chem 2000;275:10761-6.8. Yamaguchi H, Wang HG. The protein ki-ase PKB/Akt regulates cell survival and apo-tosis by inhibiting Bax conformational change.ncogene 2001;20:7779-86.9. Yuan Z, Feldman RI, Sussman GE, Coppola, Nicosia SV, Cheng JQ. AKT2 inhibition ofisplatin induced JNK/p38 and Bax activationy phosphorylation of ASK1: implication ofKT2 in chemoresistance. J Biol Chem

.

Chandra. Inhibition of hyperplasia formation in rat uterus by benzopyran derivative. Am J Obstet Gynecol 2011.

www.AJOG.org Basic Science: Gynecology Research

OCTOBER 2011 American

SUPPLEMENTARY FIGURE 1Changes in the expressionof ER and PR mRNA

Changes in the expression of ER and PR mRNAin control-, estradiol-, and compound-treatedgroups determined by real-time polymerasechain reaction analysis. Results are expressed asmean � SEM (n � 3).ER, estrogen receptor; PR, progesterone receptor.aP � .01; bP � .05 vs control and; cP � .001; dP � .05 vsestradiol.

Chandra. Inhibition of hyperplasia formation in rat uterusby benzopyran derivative. Am J Obstet Gynecol 2011.

SUPPLEMENTARY FIGURE 2Changes in the ratioof Bax/Bcl-2 mRNA

Changes in the ratio of bax/Bcl-2 mRNA in con-trol-, estradiol-, and compound-treated groupsdetermined by real-time polymerase chain reac-tion analysis. Results are expressed as mean �SEM (n � 3).aP � .001; bP � .01; vs control and; cP � .05; dP � .05; eP �001; fP � .01 vs estradiol.

Chandra. Inhibition of hyperplasia formation in rat uterusby benzopyran derivative. Am J Obstet Gynecol 2011.

SUPPLEMENTARY TABLESense and antisense primers for amplification of targeted messages with real-time PCR

mRNA target Sense (5=) primers Antisense (3=) primers

ER 5= CAACCAGTGGCTGGGAGT 3= 5= CATGGGACTCAGATGTAATGACTG 3=................................................................................................................................................................................................................................................................................................................................................................................

PR 5= GGCAGCTGCTTTCAGTAGTCA 3= 5= TGGTCATCGATGTGTAAGTTCC 3=................................................................................................................................................................................................................................................................................................................................................................................

Bax 5= GTGAGCGGCTGCTTGTCT 3= 5= GTGGGGGTCCCGAAGTAG 3=................................................................................................................................................................................................................................................................................................................................................................................

Bcl-2 5= GTACCTGAACCGGCATCTG 3= 5= GGGGCCATATAGTTCCACAA 3=................................................................................................................................................................................................................................................................................................................................................................................

�-actin 5= CCCGCGAGTACAACCTTCT 3= 5= CGTCATCCATGGCGAACT 3=................................................................................................................................................................................................................................................................................................................................................................................

ER, estrogen receptor; PCR, polymerase chain reaction; PR, progesterone receptor.

Journal of Obstetrics & Gynecology 362.e11