-
CLINICAL CANCER RESEARCH | TRANSLATIONAL CANCER MECHANISMS AND
THERAPY
Anti–PD-1 Induces M1 Polarization in the GliomaMicroenvironment
and Exerts Therapeutic Efficacy in theAbsence of CD8 Cytotoxic T
Cells A CGanesh Rao1, Khatri Latha1, Martina Ott1, Aria Sabbagh1,
Anantha Marisetty1, Xiaoyang Ling1,Daniel Zamler2, Tiffany A.
Doucette1, Yuhui Yang1, Ling-Yuan Kong1, Jun Wei1, Gregory N.
Fuller3,Fernando Benavides4, Adam M. Sonabend5, James Long6, Shulin
Li7, Michael Curran8, andAmy B. Heimberger1
ABSTRACT◥
Purpose: Anti-programmed cell death protein 1 (PD-1) therapyhas
demonstrated inconsistent therapeutic results in patients
withglioblastoma (GBM) including those with profound impairments
inCD8 T-cell effector responses.
Experimental Design: We ablated the CD8a gene in BL6 miceand
intercrossed them with Ntv-a mice to determine how CD8 Tcells
affect malignant progression in forming endogenous
gliomas.Tumor-bearing mice were treated with PD-1 to determine
theefficacy of this treatment in the absence of T cells. The
tumormicroenvironment of treated and controlmice was analyzed by
IHCand FACS.
Results: We observed a survival benefit in immunocompetentmice
with endogenously arising intracranial glioblastomas
afterintravenous administration of anti–PD-1. The therapeutic
effectof PD-1 administration persisted inmice even after genetic
ablation
of the CD8 gene (CD8�/�). CD11bþ and Iba1þ monocytes
andmacrophages were enriched in the gliomamicroenvironment of
theCD8�/� mice. The macrophages and microglia assumed a
proin-flammatory M1 response signature in the setting of
anti–PD-1blockade through the elimination of
PD-1–expressingmacrophagesand microglia in the tumor
microenvironment. Anti–PD-1 caninhibit the proliferation of and
induce apoptosis of microgliathrough antibody-dependent cellular
cytotoxicity, as fluorescentlylabeled anti–PD-1 was shown to gain
direct access to the gliomamicroenvironment.
Conclusions:Our results show that the therapeutic effect of
anti–PD-1 blockade in GBM may be mediated by the innate
immunesystem, rather than by CD8 T cells. Anti–PD-1
immunologicallymodulates innate immunity in the glioma
microenvironment—likely a key mode of activity.
IntroductionImmunotherapy has revolutionized the treatment of
cancer. This
has generated interest in harnessing the immune system as a
treatmentfor glioma, the most common primary brain tumor in humans
(1–5).However, the effectiveness of immunotherapy against glioma is
atten-uated by the immunosuppressive tumor microenvironment (6). In
thecontext of metastatic cancer to the brain, immunotherapy has
dem-onstrated significant efficacy, suggesting that this treatment
is not
impeded by the blood–brain tumor barrier (7). Treatment of
patientswith glioblastoma (GBM) with immune checkpoint inhibitors
maybenefit a select patient subset (8, 9). However, these patients
are knownto be profoundly immunosuppressed (10) and, in particular,
lympho-penic (11). The number of cytotoxic CD8þ T cells, thought to
becritically important to mediate the effects of immunotherapy, is
verylow in subsets of patients with GBM (12), in part, related to
theirsequestration in the bone marrow (13). In patients with GBM
whodemonstrate a response to anti–PD-1 antibody (Ab), it is unclear
whatimmune cell ismediating the antitumor effect because the CD8T
cell ispresumed to be completely refractory to immune modulation
(10).
The role of the T cell in the process of gliomagenesis is also
unclear.GBMs frequently arise de novo butmay also originate froma
low-gradeglioma precursor. Despite an initially indolent course,
during whichsurvival time may be many years, low-grade gliomas
almost inevitablyprogress to GBM (14–16). After this malignant
transformation, sur-vival rates drop precipitously to 12–15 months.
We have previouslyshown a direct correlation between an
immune-suppressive micro-environment and malignant progression
(17). As the immune systemrecognizes and eradicates tumor cells,
some tumor cells evade theimmune system by avoiding detection or by
becoming immunesuppressive to diminish the tumoricidal effects of
CD8 T cells (18–20).Thus, by the time of diagnosis, GBM has already
been subject toimmunoediting by T cells andmight not be susceptible
to this immunecell population, even in the presence of
immunotherapies that enhanceT-cell activity.
Here, we show that PD-1 Ab delivered intravenously
significantlyincreases survival in immunocompetent mice with
endogenouslyforming tumors (21, 22). To model the lack of CD8
T-cell effectorsobserved in human patients, we genetically
modifiedmice to eliminate
1Department of Neurosurgery, Baylor College of Medicine, The
University ofTexas MD Anderson Cancer Center, Houston, Texas.
2Department of GenomicMedicine and Cancer Biology, The University
of Texas MD Anderson CancerCenter, Houston, Texas. 3Department of
Pathology, The University of Texas MDAnderson Cancer Center,
Houston, Texas. 4Department of Epigenetics andMolecular
Carcinogenesis, The University of Texas MD Anderson Cancer
Center,Houston, Texas. 5Department of Neurosurgery, Feinberg School
of Medicine,Robert H Lurie Comprehensive Cancer Center,
Northwestern University,Chicago, Illinois. 6Department of
Biostatistics, The University of Texas MDAnderson Cancer Center,
Houston, Texas. 7Department of Pediatrics, TheUniversity of Texas
MD Anderson Cancer Center, Houston, Texas. 8Departmentof
Immunology, The University of Texas MD Anderson Cancer Center,
Houston,Texas.
Corresponding Authors: Amy B. Heimberger, The University of
Texas MDAnderson Cancer Center, 1515 Holcombe Blvd., Houston, TX
77030. Phone:713-792-2400; Fax: 713-794-4950; E-mail:
[email protected]; andGanesh Rao, Department of Neurosurgery,
Baylor College of Medicine, 7200Cambridge, Houston, TX 77030.
E-mail: [email protected]
Clin Cancer Res 2020;26:4699–712
doi: 10.1158/1078-0432.CCR-19-4110
�2020 American Association for Cancer Research.
AACRJournals.org | 4699
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-19-4110&domain=pdf&date_stamp=2020-8-14http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-19-4110&domain=pdf&date_stamp=2020-8-14http://clincancerres.aacrjournals.org/
-
the CD8 T cells. We hypothesized that the absence of the CD8
effectorresponse might promote malignant progression.
Alternatively, selec-tive pressure of the immune effector response
might induce the tumorto become more malignant and
immunosuppressive through geneticalterations and instability of the
tumor. We show that the CD8 T-cellpopulation does not influence
glioma formation rates, tumor-freesurvival times, or malignant
progression and that the innate immunesystem compensates for CD8
T-cell loss primarily through theinflux of immune-reactive
macrophages and microglia. Even in theabsence of CD8 T cells, we
observed a significant therapeutic effectfrom the administration of
intravenous anti–PD-1 antibodies. Com-mensurate with this effect
was a significant decrease in immune-suppressive PD-1þ macrophages
within the tumor microenviron-ment, possibly allowing for greater
tumor clearance by the proin-flammatory M1 macrophage
population.
Materials and MethodsStudy designSample size and rules for
stopping data collection
For the binary comparison, we set the control rate at 95%, for
ax2 test with two-sided 5% alpha and 80% power, with 30 mice
pergroup, we could detect a proportion in the experimental group of
67%as being significantly different from the control rate. Because
apredefined interim analysis demonstrated marked differences in
sur-vival after we used 10 animals per group, further data
collection wasnot needed.
Data inclusion/exclusion criteriaProspectively, mice were
replaced who died within three weeks after
injection of the RCAS vector or that did not receive at least
three dosesof either anti–PD-1 Ab or IgG.
OutliersNo outliers were excluded from analysis.
Selection of endpointsThe primary prospective endpoint of the
study was survival.
ReplicatesExperimental replicates are designated in each
legend.
RandomizationMice were randomly sorted into treatment arms
starting on day 21
after the initiation of gliomagenesis when thymic output is at
amaximum (23) and after maturation of the immune system (24,
25).
BlindingThe investigatorswho assessed,measured, andquantified
the results
were blinded to the experimental conditions and outcomes.
Theprimary endpoint was death, which was recorded by the
animalcaretakers and then associated with the treatment group.
Cell linesThe murine microglia cell line EOC-20 was purchased
from the
ATCC and was cultured in DMEM (Corning Inc), supplemented
with10% FBS and 1% penicillin/streptomycin at 37�C in a
humidifiedatmosphere of 5% CO2 and 95% air. These cells were
maintained bytrypsin passage every 2–3 days. The cell line was
confirmed to be free ofMycoplasma.
AnimalsAll mice were housed in the MD Anderson Isolation
facility in
accordance with Laboratory Animal Resources Commission
stan-dards, and all work was supervised by the Institutional Animal
Careand Use Committee at MD Anderson Cancer Center (Houston,
TX;Protocol 00000900-RN01).
Generation of a C57BL/6J congenic strain carrying a null
alleleof CD8 and the Ntv-a transgene
The Ntv-a transgene [avian cell surface receptor (TVA) for
sub-group A avian leukosis virus under the control of a glial
progenitor-specific promoter derived from the human nestin (NES)
gene] and theCD8a-targeted allele were moved from their respective
genetic back-grounds onto the C57BL/6 background by marker-assisted
backcross-ing (26) to yield Ntv-a/CD8�/� and Ntv-a/CD8þ/þ mice.
Vector constructsThe RCAS/Ntv-amodel was described previously
(21). Both RCAS-
PDGFB (27) and RCAS-STAT3 (17) vectors have been described.
Thevector constructs are propagated in DF-1 chicken fibroblasts.
Livevirus was produced by transfecting plasmid versions of RCAS
vectorsinto DF-1 cells using FuGene6 (Roche). DF-1 cells senesce
1–2 daysafter injection. In mice injected with DF-1 cells with
nontumor-inducing vectors, no long-term inflammatory response is
observedin the brain or the brains appear histologically normal
consistent withprior reports using this model (28, 29).
In vivo somatic cell transfer in transgenic miceTo transfer
genes via RCAS vectors, 5 � 104 DF-1 producer cells
transfected with the RCAS vectors in 1–2 mL of PBS were injected
intothe frontal lobes of mice using a 10-mL gastight Hamilton
syringe (30).Micewere injectedwithin 24–48 hours after birth.
Themicewere killed90 days after injection or sooner if they
demonstrated morbidity. TheRCAS-PDGFB and RCAS-STAT3 model has been
found to recapit-ulate many of the key immune features of human
gliomas includingmacrophage infiltration and have been used to
study antitumorimmunity for a variety of immune therapeutic
strategies (31, 32).
Quantitative real time-PCRIn addition to IHC methods for
detecting expression of CD8a in
tumor-bearing tissue, we also performed RT-PCR assay on the
brainsof mice (n ¼ 3). After the mice were killed, their forebrains
were
Translational Relevance
Immune checkpoint inhibition (ICI) has largely been
ineffectiveagainst glioblastoma (GBM), likely due to the uniquely
immuno-suppressed microenvironment of this primary brain tumor.
Thepaucity of CD8þ T cells in GBM has long been considered
thereason for the failure of ICI. However, the population of
anti-programmed cell death protein 1 (PD-1þ) macrophages is
veryrobust in GBM and may be targeted by ICI. We show that
ICItargeting PD-1 results in significant survival gains in
glioma-bearing immunocompetentmice evenwhenCD8T cells are
absent.Treatment with anti–PD-1 antibody shifts the polarization
ofremaining macrophages to the inflammatory (and antitumor)M1
phenotype. In humans, this strategy may not have directantitumor
effect, but may be useful to reverse immunosuppressionby the
resident macrophage population. Thus, combinatorialimmune
strategies which include ICI, may be a rational next stepin the
treatment of GBM.
Rao et al.
Clin Cancer Res; 26(17) September 1, 2020 CLINICAL CANCER
RESEARCH4700
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
removed and frozen in liquid nitrogen. Tissue specimens were
homog-enized and RNAwas extracted using Qiagen RNeasyMini Kit.
Reversetranscription was performed using Bio-Rad iScript cDNA
SynthesisKit. Quantitative RT-PCR was performed using FastStart
SYBR GreenMaster reagent (Roche) with the following primers: CD8a
forward (F):CAAGCCCAGACCTTCAGAGA; CD8a reverse (R):
TCCCCATCA-CACCCCTACTA. Data were normalized to internal GAPDH and
b2-microglobulin.
Phenotypic characterization of tumorWe dichotomized tumors as
either low-grade or high-grade on
hematoxylin and eosin (H&E)–stained tumor sections,
depending onthe presence of histologic features including
neovascularization andnecrosis. Tumor gradingwas performed by the
study neuropathologist(G.N. Fuller).
Syngeneic clonotypic intracranial glioma modelTo induce
intracerebral tumors in C57BL/6J mice, GL261 cells were
injected at a dose of 5 � 104 cells/mL as described previously
(33).
Flow cytometry analysisPeripheral blood (50 mL) was collected
and placed in 4mL ofmouse
RBC lysis buffer (eBioscience). Splenic single-cell suspensions
wereprepared by mechanical dissociation of the spleen, followed by
filtra-tion, and lysis of the RBCs. Cells were stained with
anti-mouse CD4,CD8a, CD19, CD3e, NK1.1, ls-T, FoxP3, and granzyme B
antibodies(eBioscience). For granzyme B measurements, T-cell
activation wasperformed before antibody staining. Splenic
single-cell suspensionswere prepared and cultured in RPMI1640
(containing 10% FBS) plusIL2. T cells were activated for 7 days
using a Dynabead Mouse TActivator CD3/CD28 Kit. Antibodies used for
flow cytometry in thisstudy (anti-CD11c, anti-CD11b, anti-CD19,
anti-NK1.1, anti-CD3,and anti-MHCII) were from eBioscience, and
anti-TNF-a was fromBecton Dickinson. Single-cell suspensions were
prepared with aNeural Tissue Dissociation Kit from Miltenyi Biotec.
For CD11b andTNF-a analysis, cells were treatedwith Cell
Stimulation Cocktail and aprotein transport inhibitor (eBioscience)
overnight, stained for surfaceCD11b, and fixed and permeabilized
for TNF-a detection (using flowcytometry). TMEM 119 was used to
stain microglia via ex vivo flowcytometry and by IHC (34).
IHC and immunofluorescence analysesMouse brains were fixed in
10% buffered formalin and were
paraffin-embedded, with 4-mm sections being used for IHC
analysis.To detect Iba1 (1:1,000), the anti-Iba1 antibody fromWako
was used.To quantify Iba1-positive cells, we counted the total
number of cellsand the number of positively stained cells in the
areas of highest tumor-cell density in 10 nonoverlapping
microscopic fields (400X magnifi-cation) in tumor-bearing brains
taken from mice in each group. Todetect CD8þ T cells in brain
sections, we performed immunofluo-rescence using Fluor-conjugated
antibodies from eBioscience (1:50).PD-1 for immunofluorescence was
detected using antibodies fromAbcam (ab214421) or from R&D
Systems (AF1021) and TMEM119using Abcam (ab209064). Alexa
Fluor–conjugated secondary antibo-dies were used from Invitrogen
Thermo Scientific. ProLong GoldAntifade Mountant with
40-diamidino-2-phenylindole (DAPI;Thermo Fisher Scientific) was
used as the mounting medium. Slideswere further processed for
imaging and confocal analysis using anOlympus Fluoview
FV1000microscope.We quantified the percentageof positive cells by
counting the number of cells that stained for both
Iba1 and TMEM119 and PD-1 in at least five nonoverlapping
micro-scopic fields (magnification, 400� and/or 600�) from each
genotype.The number of positive cells was divided by the total
number ofDAPIþ
cells.
Ex vivo flow cytometry of intracerebral gliomasWhen themice
started to show signs of neurologic deficit, they were
euthanized and the brains were collected after cardiac perfusion
withPBS. To isolate immune cells from the brains, the
brainsweremanuallydissected, filtered through a 70-mm cell strainer
(BD Biosciences) andthe myelin was depleted from the single-cell
suspension with Percollgradient centrifugation or magnetic bead
separation (MACS MiltenyiBiotec) according to the manufacturer
instructions. Next, cells wereincubated with Protein Transport
Inhibitor Cocktail 500x (ThermoFisher Scientific) for 4 to 5 hours
at 37�C. To prevent nonspecificbinding, cells were incubated with
Fc-Block (CD16/32, Biolegend) andthen stained with fixable
viability dye eFluor 780 to exclude dead cells(Thermo Fisher
Scientific). To determine the different immune cellsubsets, the
following antibodies were used: anti-mouse CD45 BV510,anti-mouse
CD11b PerCP/Cy5.5, anti-mouse PD-1 BV421, anti-mouse CD3
PerCP/Cy5.5, anti-mouse CD4 FITC, anti-mouse IFNgPE/Cy7, anti-mouse
CD49b – PE/Cy7, anti-mouse CD4 – BV510, (allBioLegend), anti-mouse
CD25 BV510 (BD Biosciences), anti-mouseFoxp3 PE (Thermo Fisher
Scientific), anti-mouse TMEM119(Abcam), goat anti-rabbit AlexaFluor
488 (highly cross-absorbed; LifeTechnologies). For fixation and
permeabilization of the cells, theeBioscience Foxp3/Transcription
factor Fixation/Permeabilization Kit(Thermo Fisher Scientific) was
used according to the manufacturer’sinstructions. The cells were
measured using FACS Celesta (BDBiosciences) and the data analysis
was done with FlowJo software.
NanoString assayRNA (200 ng) at a concentration of 40 ng/mL in a
total volume of
5 mL was prepared for NanoString assay analysis with the
immune-specific gene array kit (NanoString Technologies, Inc).
Sample prep-aration and hybridization were performed for the assay
according tothe manufacturer’s instructions. Briefly, RNA samples
were preparedby ligating a specific DNA tag (mRNA-tag) onto the 30
end of eachmature mRNA, and excess tags were removed via
restriction enzymedigestion at 37�C. After processing with the mRNA
sample prepara-tion kit, the entire 10-mL reaction volume
containing mRNA andtaggedmRNAswas hybridizedwith a 10-mL reporter
CodeSet, 10mL ofhybridization buffer, and a 5-mL capture ProbeSet
(for a total reactionvolume of 35mL) at 65�C for 16–20 hours.
Excess probeswere removedusing two-step magnetic bead-based
purification with an nCounterPrep Station. The specific target
molecules were quantified using annCounter Digital Analyzer by
counting the individual fluorescent barcodes and assessing
targetmolecules. The data were collected using thenCounter Digital
Analyzer after obtaining images of the immobilizedfluorescent
reporters in the sample cartridge using a charge-coupleddevice
camera. These data were then normalized to mRNA geneexpression data
for the GSE5099 Classical M1 VS Alternative M2macrophage gene panel
(35). The cluster analyses were used todetermine deregulated genes
between the anti–PD-1 and the IgGisotype control group by
multigroup comparison using Qlucoresoftware. Gene counts were
loaded into GSEA 4.0.1 as a tab-delimited text expression matrix,
with each row representing a geneand its expression across the
samples. Analyses were run with thedefault settings and 100
permutations. Dataset labels were created togroup the columns that
were either anti–PD-1 antibody or IgG treated.
Immunologic Modulation of Gliomagenesis
AACRJournals.org Clin Cancer Res; 26(17) September 1, 2020
4701
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
Microglia assaysCell viability was assessed using the
Presto-blue assay according to
the manufacturer’s recommendations (Invitrogen, A13261).
Briefly,3,000 cells were seeded overnight into a 96-well plate
containing100 mL/well of cell culture medium. Cells were treated
with variousconcentrations of IgG (BioXcell; BE0089) and the
anti–PD-1 antibody(BioXcell; BE0146) for 24, 48, 72, 96, and 120
hours. Next, 10 mL of cellviability reagent was added at the end of
the incubation periods andincubated for 10 minutes in the dark
(protected from light). Fluores-cencewasmeasured at 560 nm.Cell
proliferationwasmeasured using aBrdU incorporation assay according
to the manufacturer’s recom-mendations (Cell Signaling Technology;
catalog No. 6813). Briefly,3,000 cells were seeded overnight and
treated with various concentra-tions of IgG or the anti–PD-1 Ab for
24 and 48 hours. Twenty-fourhours before the proliferation
measurement, the 10� BrdU solutionwas added at a concentration of
1� and the cells were incubated at37�C in an atmosphere of 95%air
and 5%CO2. The cells werefixed andincubated with the detection
antibody for an hour followed byincubation with HRP secondary
antibody and the TMB substrate.Absorbance was measured at 450 nm.
For assessment of the effects oncell cycle, the EOC-20 cells were
harvested, fixed, stained with a PIantibody, and analyzed by flow
cytometry after incubating with125 mg/mL of either the anti–PD-1
antibody or IgG.
Antibody-dependent cell cytotoxicity assayIn a typical
antibody-dependent cell cytotoxicity (ADCC) assay, an
antibody binds on the surface of target cells, the effector cell
FCreceptor recognizes cell-bound antibodies, and the
cross-linkingresults in apoptosis of target cells. To investigate
whether PD-1signaling was mechanistically required, we used two
different blockingantibodies [RPM1-14 (BioXcell, BE0146) and
29F.1A12 (BioXcell,BE0273)] and a nonblocking antibody [RPM1-30
(eBioscience, 14-9981-82)]. RPM1-14 (anti–PD-1) is produced in rats
and as such, theFc gamma R IV receptor of the mouse does not
recognize/react withthe rat IgG2a (36). Repeat administration of
rat anti-mouse antibodieswill trigger in vivo generation of mouse
anti-rat responses. To reca-pitulate the in vivo vaccination
response to RPM1-14, mouse anti-ratIgG antibodies were added to
experimental arms. TheADCCassaywasperformed using standardmurine
FcgRIIIADCCeffector cells accord-ing to manufacturer’s
recommendations (Promega, G7015). Briefly, aday before the assay,
target cells (EOC20) were plated in freshmediumin a 96-well plate
and incubated in a CO2 incubator at 37�C. On thefollowing day,
either IgG or anti–PD-1 or secondary antibodies werediluted in
medium and added to the target cells, followed by theaddition of
effector cells. The ratio of Effector:Target cells is main-tained
at 20:1 in triplicate for 24 hours. The Bio-Glo luciferase
reagentwas added and the luminescence (in relative light units,
RLUs) wasdetermined using a SynergyHTX multimode plate reader.
Treatment with anti–PD-1 monoclonal Ab and in vivo depletionsWe
used RMP1-14, a murine mAb against PD-1 (BioXCell). Mice
were injected with RCAS-PDGFBþ RCAS-STAT3 to induce
primarilyhigh-grade tumors, consistent with glioblastoma. Mice were
random-ized between the two treatment arms beginning 3 weeks after
genetransfer in the perinatal period (approximates adolescence in
humans)and were treated with either RPM1-14 (200 mg) or an IgG
isotypecontrol (BioXCell) intravenously (via tail vein injection)
three timesweekly for up to 5 weeks. At three weeks, thymic output
is at its maxi-mum (23) and the immune system is fully mature (24,
25). Animalsthat died from tumor progression prior to the
initiation of at least threedoses of anti–PD-1 antibody were
replaced. Mice were monitored as
described previously and killed when they exhibited
neurologicmorbidity. Their brains were removed and fixed in 4%
formalin.
Anti–PD-1 fluorescent tagging and in vivo
biodistributionanalysis
The PD-1 antibody was fluorescently tagged with Alexa Fluor
647using the SAIVI Rapid Ab Labeling Kit according to the
manufac-turer’s recommendations (S30044, Invitrogen). Briefly, 1 mg
of theantibody at a concentration of 2 mg/mL was incubated with the
Alexa647 dye for 1 hour at room temperature with gentle stirring. A
3-cmcolumn was prepared by using the resin in the kit and washed
twicewith elution buffer before loading the sample. The labeled
antibodywas loaded onto the column, and all the eluted fractions
were collected.The first-eluted colored bands contained the labeled
antibody. Absor-bance of the purified conjugated antibody was
measured at both A280and 650 nm and protein concentration was
calculated using a Nano-drop 1000 spectrophotometer (Thermo Fisher
Scientific). To evaluatewhether the anti–PD-1 antibody was able to
infiltrate brain tumors,C57BL/6micewith intracerebral GL261 tumors
established for 20 daysor mice injected with RCAS-PDGFBþRCAS-STAT3
in the Ntv-aþwild-type or in the homozygous CD8�/� background that
wereneurologically symptomatic were injected intravenously with 200
mgof Alexa Fluor 647–conjugated anti–PD-1 antibody. The mice
werekilled and their organs were harvested after 3 hours and imaged
usingan IVIS 200 fluorescence imager.
Statistical analysisTheCochran–Mantel–Haenszel test was used to
compare the tumor
incidence between different injection sets. Student two-sample t
testwas applied to compare immune cell compositions between
differentgroups. Kaplan–Meier survival curves were used to estimate
unad-justed tumor latency. To compare the time-to-event variables
betweengroups, the log-rank test was used to compare distributions.
All testswere two-sided, and P < 0.05 was considered
statistically significant.Statistical analysis was carried out
using R version 3.1.2 software(R Core Team) and Graphpad Prism
version 6.01 software (GraphpadSoftware, Inc).
ResultsEnhancement of innate immunity in the
gliomamicroenvironment in the absence of CD8 T cells
To analyze the immune gliomamicroenvironment in the absence
ofCD8 T cells, Ntv-a mice were backcrossed into a BL6 background
andintercrossed with CD8�/� mice to create Ntv-a/CD8�/� mice.
Toascertain the CD8 T-cell composition in the CD8�/,
heterozygous(CD8�/þ), and wild-type mice (CD8þ/þ), their peripheral
blood, bonemarrow, and spleens were analyzed. No CD8þ cells were
detected inthese tissues of CD8�/�mice (Supplementary Fig. S1A).
HeterozygousCD8 mice (Supplementary Fig. S1B) displayed a level of
CD8 T cellssimilar to that in wild-type mice (Supplementary Fig.
S1C and S1D;P > 0.05). The flow cytometry data were consistent
with the geneticanalysis of CD8 T-cell loss achieved in the CD8 KO
background. Weidentified intratumoral infiltration of CD8þ T cells
in the CD8þ/þ
mice, but as expected, these cells were absent in the CD8�/�
mice(Supplementary Fig. S1E). To test the hypothesis that the CD8
effectorresponse facilitates evasion of immune detection, thereby
decreasinganimal survival and promoting malignant progression,
gliomas wereinducedwithRCAS-PDGFBþRCAS-STAT3 inNtv-amice in either
theCD8þ/þ or CD8�/� background. CD8þ/þ wild-type mice
survivedlonger (49.5 days, 95%CI: 27–69) than the CD8�/�mice (27
days, 95%
Rao et al.
Clin Cancer Res; 26(17) September 1, 2020 CLINICAL CANCER
RESEARCH4702
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
CI: 21–46) although this was not statistically significant (Fig.
1A,P ¼ 0.2281, H.R.1.354). In addition, there was no difference in
theincidence of high-grade gliomas, regardless of CD8 status (Fig.
1B).
CD11b is a marker of myeloid cells of the innate immune
systemincluding macrophages. In the tumor-bearing mice we found
anincrease in the CD11bþ cells in the CD8�/� mice relative to
CD8þ/þ
mice in both the spleen and blood (Fig. 1C; P ¼ 0.02 for blood
andP < 0.0001 for spleen). There was also a significant
difference in themacrophage and microglia marker Iba1þ in tumors
induced inCD8�/� mice compared with CD8þ/þ mice (Student t
test,
P ¼ 0.0009; Fig. 1D). MHCþCD11bþ cells demonstrated a
>2-foldincrease in the gliomas of CD8�/� mice relative to CD8þ/þ
mice(Fig. 1E). This expansion was not an intrinsic property of the
CD8�/�
mice, as shown by the lack of an increase in the percentage of
CD11bþ
cells in the brains of nontumor-bearing control mice. These
macro-phages possess features that reflect a proinflammatory immune
pro-pensity based on TNF-a expression (Fig. 1F; P ¼ 0.001).
Increases ininnate immunity in the gliomamicroenvironment were also
found in asecond glioma model in which retrovirus induced
PGFRþPten�/�murine gliomas were depleted of CD8 T cells (37).
Cumulatively, these
Figure 1.
CD8 knockout (CD8�/�) does not have an impact on survival in a
genetically engineered murine model of glioma and demonstrate a
compensatory increase inmacrophages in the glioma microenvironment.
A, As shown by the Kaplan–Meier curves, survival was not affected
when 5 � 104 DF-1 cells/mouse containing theRCAS-PDGFBþRCAS-STAT3
geneswere injected bilaterally into the frontal brain lobes of
CD8�/�mice.B,At the time of death or when the animal wasmoribund,
anautopsywas performed, andmicroscope slides containing sections of
the central nervous system (CNS)were stainedwith H&E for tumor
grading. TheCD8 status didnot influence the glioma
grade.C,CD11bþmonocytes andmacrophageswere found to occurmore
frequently in the blood and spleens of tumor-bearing CD8�/�micethan
in those of CD8þ/þmice (� , P¼ 0.0202 for blood; ���� , P <
0.0001 for spleen). The analysis was conducted using ex vivo flow
cytometry and the percentage ofCD11bþ cells was calculated on the
basis of the total alive cells with 30,000 total events
analyzed.D,CD11bþMHC IIþ cells were found by ex vivo flow cytometry
to beenriched in the CD8�/� group relative to the wild-type CD8þ/þ
group (���� , P¼ 0.0001). The percentage of dual expressing
CD11bþMHC IIþ cells was calculated onthe basis of the total alive
cells with 30,000 total events analyzed. E, Dot plot summarizing a
significantly higher percentage of Iba1þ cells in gliomas in the
CD8�/�
mice than in CD8þ/þ mice. P ¼ 0.001. F, Functional analysis by
detecting intracellular TNF-a expression with flow cytometry
demonstrated increased numbers ofTNF-aþ-expressing CD11bþ cells in
glioma-bearing CD8�/�mice (��� , P¼ 0.0001). The analysis was
conducted using ex vivo flow cytometry and the percentage ofCD11bþ
cells that had intracellular expression of TNF-awas calculated on
the basis of the total alive cells with 30,000 total events
analyzed. G, CD8 knockout micedemonstrate a compensatory increase
in the peripheral CD4 compartment. The CD4þ T-cell percentage in
spleens was increased in CD8�/�mice (���P¼ 0.0002).H, Because there
was an increase in the frequency of CD4þ T cells in the CD8�/�
mice, the fraction of Tregs within the CD4 compartment was
assessed, butno differences were observed in this in either the
blood or spleen compartments, regardless of CD8 status. I, The
percentage of CD4þ T cells producing granzymeB was found to be
increased only in CD8�/� mice harboring intracranial tumors (���� ,
P < 0.0001).
Immunologic Modulation of Gliomagenesis
AACRJournals.org Clin Cancer Res; 26(17) September 1, 2020
4703
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
data indicate an association of the innate immune system
withgliomagenesis and antitumor immune reactivity.
To ascertain whether there was a compensatory increase in CD4T
cells in the absence of CD8T cells in thesemodels, we analyzed
bloodand spleens for the percentage of CD4 T cells in the CD8�/�
and wild-type mice. The frequency of CD4 T cells was elevated in
the spleens ofCD8�/� mice relative to that in the CD8þ/þ mice (P ¼
0.0002).However, there was no difference in the frequency of the
CD4 T cellsin the blood of the CD8�/� mice relative to the
wild-type mice
(Fig. 1G). Previously, an increased regulatory T-cell fraction
wasshown to be present within the CD4 compartment in patients
withhigh-grade gliomas (11). To determine whether there was an
alterationof glioma-induced immune suppression between the CD8�/�
andCD8þ/þ mice, both their blood and spleens were analyzed for
thefraction of CD4þ and FoxP3þ T cells. We found no difference in
thefraction of CD4þ FoxP3þT cells between glioma-bearing CD8�/�
andCD8þ/þ mice (Fig. 1H), indicating that Tregs are not
differentiallymodulated. Because some CD4 T cells are cytotoxic
cells (38, 39),
Figure 2.
CD8 knockout mice (CD8�/�) demonstrate a compensatory increase
inmultiple peripheral immune compartments.A,CD4þ T cells were not
detected in the gliomasof either CD8�/�mice or wild-type mice
(CD8þ/þ) by IHC staining. CD19þ cells (B) and NK1.1þ (C)
populations in the blood and spleen of glioma-bearing mice
werefound to be significantly higher in the CD8�/� group relative
to the CD8þ/þ group (��� , P ¼ 0.0004 and ����, P < 0.0001,
respectively). However, these cellpopulations were not detected
within the brain tumors. Spleen staining is the positive control.
Representative IHC-stained images at 200�magnification for A andB
(left, bar¼ 100 mm); A and Bmiddle and right at 400�magnification,
scale bar, 50 mm. D, Kaplan–Meier estimates of tumor-free survival
in glioblastoma-bearingNtv-amice in thewild type (CD8þ/þ) or CD8�/�
background treatedwith anti–PD-1 or IgG isotype control (n¼ 11–13
per group). Themedian overall survival timewas68 days in the
anti–PD-1 antibody-treated wild-type mice and 40 days in the
control group (log-rank test, P ¼ 0.0002; left). The median overall
survival time was61 days in the anti–PD-1 antibody-treated CD8�/�
mice and 39 days in the control group (log-rank test, P <
0.0001).
Rao et al.
Clin Cancer Res; 26(17) September 1, 2020 CLINICAL CANCER
RESEARCH4704
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
including those directed against malignancies (refs. 40, 41; a
per-forin- and granzyme B-mediated process; ref. 42), we
exploredwhether the increase in CD4 frequency was tied to these
specificfunctional activities. In mice harboring gliomas, there was
a 2.4-foldincrease of granzyme bþ CD4 T cells in the spleens of
CD8�/� micerelative to that in CD8þ/þ mice (Fig. 1I). However, this
expansionwas not an intrinsic property of the CD8�/� background, as
shownby the absence of an increase in the percentage of granzyme
bþCD4 T cells in nontumor-bearing control mice (not injected
withDF-1 cells) possibly related to the immunologic recognition of
theintracranial tumor. Further analysis of the CD8�/� mice
harboringgliomas demonstrated no expansion of this population in
theglioma microenvironment (Fig. 2A), indicating that the
CD4cytotoxic T cell does not have a dominant role in the
immunologiccontrol of gliomagenesis.
Compensatory immune cell expansionoccurs peripherally in
theabsence of CD8 T cells
Because we observed expansion of the CD4 T-cell population inthe
spleens of mice with the CD8�/� background (Fig. 2A),
weinvestigated whether this occurred with other immune cell
popula-tions such as CD19þ B cells (Fig. 2B) and NK1.1þ cells (Fig.
2C). Inthe CD8�/� glioma-bearing mice, there was a
compensatoryincrease in both B cells and NK cells, in the blood and
spleen.However, we saw no CD19þ B cells in gliomas arising in
either theCD8�/� (n ¼ 8) or CD8þ/þ wild-type mice (n ¼ 9). Similar
findingswere obtained for the NK1.1 population in the CD8�/� (n ¼
8) andwild-type backgrounds (n ¼ 9), again indicating that although
theremay be expansion of these populations in the periphery as a
reactionto the tumor but there was no evidence of their involvement
intrafficking to and exerting an effector response in the
tumormicroenvironment.
Anti–PD-1 exerts a therapeutic effect in the absence of CD8T
cells
To investigate the role of anti–PD-1 in the absence of CD8 T
cells,we induced high-grade gliomas in Ntvaþ/BL6 mice of the
CD8þ/þ
background by coinjecting RCAS-PDGFBþRCAS-STAT3, as has
beendescribed previously (17). Mice were observed for 3 weeks and
treatedwith anti–PD-1 intravenously through tail-vein injection.
Animalswere treated with 200 mg of either rat IgG (control) or
anti–PD-1administered intravenously every week for up to 5 weeks.
Mice areweaned at 3 weeks after birth and they reach maturity
(adulthood) by8–10 weeks (43). On the basis of this report, the
mice used in theseexperiments started treatment as teenagers with
the vast majority oftreatments occurring in adulthood. The median
survival time for theanti–PD-1–treated group was 68 days, and in
the IgG control group itwas 40 days; (log-rank test, P ¼ 0.0002;
Fig. 2D), demonstratingtherapeutic activity of anti–PD-1 in this
model and similar to theGL261 model (44–46). To investigate whether
anti–PD-1 would exerta therapeutic effect in the CD8�/� mice, we
treated a cohort of thesemice. Compared with the anti–PD-1–treated
groups, median survivaltimes for the IgG-treated controls were 40
days (relative to the PD-1Ab–treated group of 68 days; log-rank
test, P ¼ 0.0002) and 39 days(relative to the PD-1Ab-treated
control group of 61 days; log-rank test,P < 0.0001) in the
CD8þ/þ and the CD8�/� mice, respectively(Fig. 2D). The difference
in the survival of the CD8þ/þ mice and theCD8�/� mice treated with
anti–PD-1 (Fig. 2D) was not statisticallysignificantly different
(68 vs 61 days, respectively, log-rank test P ¼0.0727). These
results demonstrate that a similar therapeutic effect wasobtained
for anti–PD-1 regardless of the presence of CD8 T cells.
CD11bþ myeloid cells are the predominant immune cellspopulation
in the brains of tumor-bearing Ntv-a/CD8�/�
and Ntv-a/CD8þ/þ miceTo investigate which immune cells subsets
could mediate the anti–
PD-1–mediated survival benefit in the absence of CD8 T cells,
weisolated immune cells from the whole brains of tumor-bearing
Ntv-a/CD8�/� and Ntv-a/CD8þ/þ mice treated with PD-1 antibody or
IgGcontrol for multicolor flow cytometry (Supplementary Fig. S2).
First,we quantified the percentage of myeloid cells (defined as
CD11bþ
cells), CD4T cells (defined asCD3þCD4þ cells), andNK cells
(definedas CD3� CD49þ cells) because those immune cells have
already beenreported to express PD-1 (Fig. 3A). With an average of
around 70%,CD11bþ myeloid cells (Fig. 3A, left) represented the
majority ofimmune cells in all groups, whereas the contribution of
CD4 T cells(middle), was less than 5%, and NK cells (right), were
less than 1%.There was no statistical significant difference in the
percentage of thedifferent immune cells subsets between any of
treatment groups withintheir genotype. Next, we determined the PD-1
expression levels oneach of these cell subsets. The CD11bþ myeloid
cell subset showed anaverage PD-1 expression between 10% and 20%
(Fig. 3B, left) with nosignificant differences between the
treatment groups. CD11bþmyeloidcells, but not CD4 T cells, are
present throughout the brain paren-chyma. Notably, myeloid cells
only showed PD-1 expression in thepresence of glioma (Supplementary
Fig. S3). Thus, the flow cytometryanalysis, which analyzed the
whole brain including the glioma, under-estimates themodulation of
this population in the setting of anti–PD-1treatment within the
glioma microenvironment. In the CD4 T-cellsubset (Fig. 3B, middle),
there was much more variability in thepercentage of PD-1 expression
within the different groups (Fig. 3B,middle) with expression levels
ranging from11.5% to 89.4%. Therewasa statistically significant
difference detected between the anti-IgG andthe anti–PD-1 in the
Ntv-a CD8þ/þ mice (P ¼ 0.0425) but not inthe Ntv-a/CD8�/� mice. In
the NK-cell subset, only 2% to 4%showed PD-1 expression and there
was no difference between thedifferent groups (Fig. 3B, right).
Because the CD4 T cells showed quitehigh PD-1 expression, even
though they are not very frequent andcontribute only to very small
extent to the immune cell composi-tion, we examined whether the
anti–PD-1 treatment influencestheir functional status. Therefore,
we stained the CD4 T cells forIFN-g (Fig. 3C, left), TNF-a (Fig.
3C, middle), and for regulatoryT cells (Fig. 3C, right), but we
could not detect any significantchanges, indicating the CD4 T cells
are not the main contributors ofour observed effects.
Anti–PD-1 recalibrates the glioma-infiltrating
macrophages/microglia to an M1 phenotype
Because PD-1 expression has been previously described for
tumor-associated macrophages (47), we evaluated whether PD-1
expressionwas present within gliomas and coexpressed with
macrophages withinthe CNS. Using dual immunofluorescence, clusters
of PD-1- and Iba1-positive cells were detected in both the CD8þ/þ
and CD8�/� mice(Supplementary Fig. S4 and S5). Throughout the
glioma microenvi-ronment, there was heterogeneous expression of
Iba1þPD-1�,Iba1�PD-1þ, and Iba1þPD-1þ cells. Given that the
tumor-associated macrophages express PD-1, and that there are scant
CD8T cells in gliomas at diagnosis, we hypothesized that PD1
blockademight act independently of CD8 T-cell–based immune
responses. Toassess whether PD-1 blockade has any role in the
regulation ofmacrophages/microglia in the tumor microenvironment we
per-formed multi-immunofluorescent staining for the
microglia-specificmarker TMEM119, Iba1, and PD-1 (Fig. 4A). We
noticed that in the
Immunologic Modulation of Gliomagenesis
AACRJournals.org Clin Cancer Res; 26(17) September 1, 2020
4705
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
anti–PD-1–treated group relative to the IgG control during
thetherapeutic window, the microglia/macrophage expression
wasdecreased in both the CD8þ/þ and the CD8�/� backgrounds.Notably,
relative to the IgG control group, we detected a markeddecrease in
the populations expressing Iba1þ TMEM119þ
PD1þcells within the tumor in both CD8þ/þ and CD8�/� mice(P <
0.0001; Fig. 4B). The decreased expression of macrophage/microglia
markers Iba1 and TMEM119 (Supplementary Fig. S6)suggest that the
innate immune system may be mediating the effectsof the anti–PD-1
antibody.
Given that the PD-1–expressingmacrophage/microglial
populationwas reduced in the setting of anti–PD-1 therapy, we
evaluated whetherthe remainingmacrophage/microglia populationwas
exerting a proin-flammatory or M1 classical skewed phenotype, as
these cells can existeither in a nonpolarized state or along a
continuum that is eitherpro- or anti-inflammatory (48). Gliomas in
either the CD8þ/þ or theCD8�/� backgrounds treated with anti–PD-1
demonstrated a signi-ficant skewing in genes associated with the
proinflammatory M1phenotype relative to the IgG isotype
control–treated mice based onNanoString profiling (Fig. 4C). The
upregulated genes were related to
Figure 3.
Flow cytometric analysis of immune cell subsets isolated from
the whole brain of glioblastoma-bearing Ntv-amice in the wild type
(CD8þ/þ) or CD8�/� backgroundtreated with PD-1 antibody or IgG
isotype control.A, Percentage of CD11bþmyeloid (left; CD8þ/þ IgG vs
anti–PD-1 P¼ 0.7933; CD8�/� IgG vs anti–PD-1 P¼ 0.6872),CD3þ CD4þ T
cells (middle; CD8þ/þ IgG vs anti–PD-1 P¼ 0.9975; CD8�/� IgG vs
anti–PD-1 P¼ 0.5572), and cells NK cells (right; CD8þ/þ IgG vs
anti–PD-1 P¼ 0.7146;CD8�/� IgG vs anti–PD-1 P¼0.3732) of all immune
cells isolated from thewhole brains of tumor-bearingNtv-amice.B,
PD-1 expression onCD11bþmyeloid cells (left;CD8þ/þ IgG vs anti–PD-1
P¼0.1551; CD8�/� IgG vs anti–PD-1 P¼0.8539), CD3þCD4þ T cells
(middle; CD8þ/þ IgG vs anti–PD-1 P¼0.0425; CD8�/� IgG vs
anti–PD-1,P¼0.2647), andNK cells (right; CD8þ/þ IgG vs anti–PD-1
P¼0.2294; CD8�/� IgG vs anti–PD-1 P¼0.5275). C,Quantification of
functional CD3þCD4þ T-cell subsetsin the brains of
tumor-bearingmice, percentage of IFNg (left; CD8þ/þ IgG vs
anti–PD-1, P¼0.9441; CD8�/� IgG vs anti–PD-1, P¼0.5492) and TNF-a
(middle; CD8þ/þIgG vs anti–PD-1, P¼0.8415; CD8�/� IgG vs anti–PD-1
P¼0.2869) expressing cytotoxic CD3þCD4þ T cells, and percentage of
regulatory T cells (Treg; right; CD8þ/þIgG vs anti–PD-1 P¼0.5431;
CD8�/� IgG vs anti–PD-1 P¼0.2994). Two-sided unpaired t test was
performed to compare the treatment groupswithin the genotypes,only
the statistical significant values (P ≤ 0.05) are indicated in the
figure.
Rao et al.
Clin Cancer Res; 26(17) September 1, 2020 CLINICAL CANCER
RESEARCH4706
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
class I MHC–mediated antigen processing and presentation(eg,
TRIM69), skewing to or maintaining the M1 phenotype(eg, LP1N1,
EPST1 ZNF229, HDAC3), macrophage differentiation(eg, ERMAP),
toll-like receptor transcription (eg, HCFC2), phagocy-tosis (eg,
ATP10A), and survival (eg, E4F1; Supplementary Fig. S7).Together,
these results indicate that anti–PD-1 enriches for a classicalM1
skewed macrophage phenotype in the glioma microenvironment.
Anti–PD-1 has direct effects on PD-1–expressing
macrophage/microglia expressing cells, but also triggers ADCC
To define the direct effects of the anti–PD-1 antibody on
macro-phages/microglia, we used EOC-20, a murine microglia cell
line thatexpresses PD-1 (Fig. 5A) to a similar extent as
tumor-infiltratingmyeloid cells (defined as CD45þ CD11bþ cells;
Fig. 5B), to assay cellviability, proliferation, and cell cycle. At
a concentration of 125 mg/mLof anti–PD-1, there was direct loss of
cell viability after one day ofcoincubation that was further
enhanced by extended exposure
(Fig. 5C). The effect of the anti–PD-1 antibody was partially
mediatedby direct inhibition of cellular proliferation (Fig. 5D).
After treatmentwith the anti–PD-1 antibody for 48 hours, EOC20
cells were analyzedfor cell-cycle distribution with flow cytometry,
and there was no dif-ference upon exposure to anti–PD-1 (Fig. 5E).
Given that the max-imum circulating concentration of anti–PD-1 was
approximately3mg/mL (200-mg infusion in a 60-mLbloodvolume),we
testedwhetherthe anti–PD-1 antibody could be further potentiated
secondary to theinvolvement of ADCC. There was no substantial
increase in cytotox-icity as detected by luminescence released from
the microglia targetcells in the presence of the isotype IgG
control and effector cells, but thepresence of anti–PD-1 increased
this by 113% (Fig. 5F). Becauserepeated administration of the
anti–PD-1 rat anti-mouse antibodyin vivo would trigger an anti-rat
humoral response, a secondaryantibody (anti-rat IgG) was added to
the ADCC assay, which furtherenhanced luminescence release by 233%.
To further investigate wheth-er PD-1 signaling ismechanistically
required, both blocking antibodies
Figure 4.
Anti–PD-1 recalibrates the glioma-infiltrating
macrophages/microglia to an M1 phenotype. A, Representative
immunofluorescent images of Iba1þTMEM119þPD-1þ
microglia infiltration in a glioblastoma-bearing mouse (CD8þ/þ
background, with similar staining in the CD8�/� background) after
IgG or anti–PD-1 Ab treatment,400� magnification, scale bar ¼ 50
mm. B, Scatter plot demonstrating difference in PD-1–expressing
Iba1þTMEM119þ expression in the wild-type CD8þ/þ and
KOCD8�/�backgroundmice demonstrating a significant reduction in the
number of Iba1þTMEM119þmicroglia after anti–PD-1 antibody treatment
(P
-
(RMP1-14 and 29F.1A12) and a nonblocking antibody (RMP1-30)were
evaluated in the ADCC assay. All three antibodies triggeredADCC
elimination of PD-1–expressing microglia, indicating thatanti–PD-1
triggers the elimination of PD-1–expressing immune-suppressive
innate immune cells in the CNS through an ADCC-mediated mechanism
independent of PD-1 blockade.
Anti–PD-1 antibodies can be detected in CNS gliomasTo ascertain
whether anti–PD-1 was able to penetrate CNS gliomas,
the anti–PD-1 antibody was fluorescently labeled and
subsequentlyinjected intravenously into mice. Nonglioma–bearing,
untreatedC57BL/6 mice showed no baseline fluorescence, but mice
treated withthe labeled anti–PD-1 antibody demonstrated
fluorescence in thebrain and systemic organs (Fig. 6A). In
tumor-bearing mice treatedwith labeled anti–PD-1 antibody, ex vivo
analysis of the entire braindemonstrated elevated fluorescence in
the right frontal lobe where the
GL261 glioma cells were implanted, but no focal fluorescence
wasdetected in nontumor-bearing mice (Fig. 6B). Increased
fluorescencewas detected in the cerebellum (ie, posterior fossa)
including innonglioma-bearingmice. Subsequent sequential coronal
sections fromanterior to posterior directly confirmed the presence
of tumor in theright frontal lobe that correlated with this
increased fluorescence(Fig. 6C). Because GL261 is surgically
implanted and grows in a focalmanner, this increased fluorescence
could be an artifact of the model.As such, we evaluated the
penetration of fluorescently labeled anti–PD-1 in the Ntv-a model
in which gliomagenesis is triggered in theneonatal period. In
addition, gliomas generated in the Ntv-a model arediffusely
infiltrative and can be multifocal, more closely
recapitulatinghuman gliomas. In the Ntv-a CD8�/� mice bearing
gliomas treatedwith labeled anti–PD-1, increased fluorescence was
detected in mul-tiple areas of the CNS relative tomicewithout
gliomas (Fig. 6D). Theseareas were confirmed to histologically
contain glioma (Fig. 6E).
Figure 5.
Direct and ADCC activity of anti–PD-1 Ab on PD-1–expressing
macrophage/microglia. A, PD-1 expression of EOC-20 cells, gated on
CD45þ CD11bþ cells. B, PD-1expression on myeloid cells (CD45þ,
CD11bþ) isolated from tumor-bearing Ntv-a mice. C, Coincubation of
only the anti–PD-1 antibody at the designatedconcentrations with
PD-1 expressing EOC-20 microglia resulted in diminished cellular
viability starting 1 day after exposure, which was further enhanced
withincreased exposure time. D, Coincubation of BrdU-labeled EOC-20
microglia with increasing concentrations of anti–PD-1 relative to
the IgG control demonstrateddecreased proliferative capacity. E,
Cell-cycle analysis of EOC-20 cells exposed to IgG control or
anti–PD-1 demonstrating that these antibodies do not affect
cellularproliferation. F,ADCC assay detecting lactic dehydrogenase
leakage [luminescence; relative light units (RLU)] from target
EOC-20microglia cells upon exposure toanti–PD-1 and in the presence
of effector cells capable of mediating ADCC. Mouse microglial
target cells, EOC20, were incubated with control antibody or
anti–PD-1antibody at a concentration of 125 mg/mL or 12.5 mg/mL,
followed by the addition of effector cells. The E:T ratio was 20:1.
After 8 hours of induction at 37�C, Bio-Gloluciferase reagentwas
added, and luminescence (RLU)was determined. TheADCCwas further
potentiatedby the presence of a secondary antibody (mouse
anti-rat)that could be generated by repeat administration of a rat
anti-mouse antibody (anti–PD-1) in vivo. M, media; T, target; E,
effector cell. When the anti–PD-1 antibodywas decreased to 12.5
mg/mL, similar results were obtained.
Rao et al.
Clin Cancer Res; 26(17) September 1, 2020 CLINICAL CANCER
RESEARCH4708
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
Cumulatively, these data indicate that the anti–PD-1 can pass
into theCNS, especially within gliomas in which there is breakdown
of theblood–brain barrier (BBB; such as GL261) and in gliomas that
haveevolved intrinsically within the CNS that are more diffusely
infiltrat-ing, such as those induced in Ntv-a mice.
DiscussionIn our previous clinical trial of patients with
recurrent glioblastoma
that were treated with anti–PD-1 prior to surgery, immune
profiling ofthe tumor microenvironment revealed a marked paucity of
effectorT cells but a profound predominance of macrophages
displayingheterogeneous immune-stimulatory and immune-suppressive
pheno-types. In our clinical trial (49) and in another (8),
patients withglioblastoma treated in an adjuvant setting had better
than expectedoutcomes. Thus, there arises the paradox of an
anti–PD-1 agent havingtherapeutic activity in an oncologic setting
that is notable for T cells
that are sequestered in the bone marrow and completely
refractory tobeing reinvigorated with immune checkpoint inhibitors
(10). It islikely that anti–PD-1 can switch its therapeutic effect
between variousimmune populations given their relative frequencies.
In malignanciesenriched in T-cell infiltration, anti–PD-1 likely
exerts most of itstherapeutic activity through direct T-cell–ligand
interactions. In con-trast, in malignancies such as glioblastoma
that are devoid of T cells,anti–PD-1 activity may exert a
therapeutic effect through alternativeimmune populations such
asmacrophages andmicroglia. In this latterscenario, the therapeutic
activity is mediated through the eliminationof an
immune-suppressive, tumor-supportive PD-1þ macrophage/microglia
population by myeloid-to-myeloid ADCC-mediated fratri-cide
mechanisms and/or to M1 macrophage polarization. PD-1 haspreviously
been shown to be expressed by macrophages, which limitstheir
phagocytic capacity (47) and as such, treatment with anti–PD-1may
be enhancing this activity in vivo. Proinflammatory M1 macro-phages
mediate direct tumor killing through secreted products like
Figure 6.
Anti–PD-1 in vivo biodistribution analysis. A, C57BL/6 mice were
either untreated (control) or injected with 200 mg of fluorescently
labeled anti–PD-1. After 3 hours,their organswere harvested, rinsed
in PBS, positioned on a petri dish, and then imaged using the IVIS
200 Fluorescence Imager. The organswere then photographed.B,
Thebrain fromanontumor-bearingC57BL/6mouse treatedwithfluorescently
labeled anti–PD-1 (top) or bearing intracerebral GL261 (bottom).
The arrowdenotesthe location of the GL261 implantation. C, The
brains from Bwere then sequentially coronally sectioned, with the
non-tumor–bearing brain on the left and the GL261-implanted brain
on the right. The sections were positioned anterior to posterior on
the petri dish and imaged. The horizontal arrow denotes the
location of theimplanted GL261 cells in the right frontal lobe.
Increased fluorescent intensity is detected in the posterior
cerebellum. All brain sections were imaged for the sameexposure
time. D, Nonglioma–bearing (control) or glioma-bearing Ntv-a mice
in the knockout (CD8�/�) background were treated with 200 mg of
fluorescentlylabeled anti–PD-1. After 3 hours, their brains were
harvested, rinsed in PBS, coronally sectioned, positioned on a
petri dish, and then imaged using the IVIS 200Fluorescence Imager.
The brains were then photographed. Increasing fluorescence
intensity is seen to correlate with increasing concentration of
anti–PD-1. E, H&E-stained coronal sections of GL261 (top) and
Ntv-a CD8�/� (bottom) from C and D. Magnification 20�; scale bar,
100 mm. Arrows indicate the region of the tumor.
Immunologic Modulation of Gliomagenesis
AACRJournals.org Clin Cancer Res; 26(17) September 1, 2020
4709
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
nitric oxide or tumor necrosis factor (50). This alternative
mechanismof anti–PD-1 activity also provides an explanation for the
failure ofbiomarkers to predict clinical responses in cancers such
as glioblas-toma, as these markers are focused on the immune
functional featuresof the adaptive immune system such as the
abundance of antigens(ie, mutational burden) and the presence of
T-cell infiltration andligand frequency (ie, PD-1þ TILs, PD-L1),
which are unlikely to be thedominant mechanism of therapeutic
activity of anti–PD-1 in thesetting of myeloid-enriched
malignancies. Because PD-1 is notexpressed in gliomas, it is
unlikely that the anti–PD-1 is exerting adirect effect on the tumor
cell. We are unable to exclude the possibilitythat other immune
populations are also contributing to the therapeuticeffect of the
anti–PD-1 and it is likely that a combination of immunepopulations
play a role in activity. Cumulatively, this is the first studyto
demonstrate that the anti–PD-1 antibody may promote a
proin-flammatory M1 signature within the glioma
microenvironment.
The purpose of this study was not to suggest that
monotherapywith anti–PD-1 in glioblastoma is effective for all
patients withGBM (49). Rather, the purpose of our study was to more
fullyunderstand the mechanisms of action of this agent in GBM so
thatwemightmore appropriately select rational combinations and
identifypotential response biomarkers. To date, immune checkpoint
inhibitorresponse biomarkers are surrogates for antitumor T-cell
responseswhich include T-cell counts in the tumor microenvironment;
tumormutational burden, microsatellite instability, and POLE
mutationsas T-cell targets; IFN signatures; and the inhibitory
ligand forPD-1–PD-L1. We are also not attempting to refute the
contributionof CD4 cytotoxic T cells to these responses (51–53),
but are ratherexpanding consideration to PD-1–expressing
macrophages andmicroglia as also being involved in the antitumor
immune responseswith these agents. As such, future clinical trials
using ICIs shouldalso consider including the immune phenotype and
function ofmacrophages which may be all the more relevant in
glioblastomagiven the predominance of this immune population.
Combinatorialstrategies, such as macrophage polarization
therapeutics, are beingactively considered with anti–PD-1. However,
our data indicatesthis may not be necessary because anti–PD-1 is
already eliminatingPD-1–expressing microglia and driving M1
polarization and assuch should be deprioritized.
Because CNS macrophages arise from peripherally derived
mono-cytes, the anti–PD-1 antibody need not have penetrated into
the CNSto eliminate PD-1þ immune-suppressive macrophages in the
gliomamicroenvironment. Most immune cells, including the
monocyte-derived macrophages in the tumor microenvironment, arise
from theperiphery where they can interact with the anti–PD-1
antibody.However, the elimination of PD-1–expressing microglia,
which orig-inate in the CNS during embryogenesis, implies that the
anti–PD-1antibody is capable of some degree of CNS penetration,
especially intumor regions in which there is breakdown of the BBB.
Fluorescently-tagged anti–PD-1 accumulated in the glioma relative
to the surround-ing brain, confirming that the anti–PD-1 antibody
can gain access tothe glioma microenvironment. Future studies will
be directed atassessing the concentrations of the anti–PD-1
antibody in infiltratingnoncontrast-enhancing regions of the brain
that do not have appreci-able breakdown of the BBB.
Eliminating the CD8 T cell from the microenvironment of
anevolving glioblastoma enabled us to isolate the macrophage as
thecell mediating the therapeutic effect of checkpoint
inhibition.We werealso able to study how the absence of CD8þ T
cells affects gliomadevelopment, malignancy, and survival. A
previous study showed thatthe CD8þ T cell is defective and
nonoperational in murine models of
spontaneously-arising astrocytomas, even at early stages of
tumordevelopment (54). However, this contrasts with recent reports
thatlevels of CD8þ tumor-infiltrating lymphocytes are inversely
correlatedwith glioma grade and are associated with long-term
survival (55).Alternatively, the CD8þT-cell populationmay only have
a role duringthe early stages of tumor development (56, 57). Our
primary hypoth-esis was that the elimination of the CD8 immune
effector populationwould produce an increased incidence of
high-grade gliomas resultingfrom the lack of immunologic
recognition and control. Because thepresumptive antitumor immune
effector population is not present inthe CD8�/� genetic background
relative to wild-type mice, the tumor-bearing CD8�/� mice should
have had an environment favoringgrowth of tumor cells.
Alternatively, without the selective pressure ofCD8 T cells culling
tumor cells sensitive to elimination, the moreresistant cells
escaping immune surveillance might not proliferate,resulting in
some degree of quiescence. If this hypothesis were correct,then
there would be increased survival in mice with the CD8�/�
genetic background associated with less malignant
progression.Surprisingly, we found that there was no difference in
survivaltime and no difference in the incidence of glioma grade
between thetwo genotypes. These results show that CD8 T cells do
not influencesurvival of mice that undergo de novo glioma
formation. Yet, Kaneand colleagues report that while CD8 T cells do
not influencesurvival similar to our glioma model, the presence of
CD8 T cellsdo influence the tumor genome, phenotype
(oncogenes/tumorsuppressors, MAPK activation), and composition of
the immuno-logic microenvironment (37).
Another observation from our study was that there was
elevatedMHC-II and Iba1 expression associated with the
monocyte/macrophage population present in the glioma in the absence
of CD8T cells. These cells demonstrated a proinflammatory activated
profile.Activated macrophages have been shown to be capable of
tumoricidalactivity (58). Similar compensatory findings have been
reported in aGL261 glioblastoma model treated with a tumor lysate
vaccine withOX40L-Fc stimulant in which the vaccine efficacy was
independent ofthe CD8þ T-cell population, but dependent on CD4þ T
cells, NK cells,and B cells (59); however, this study did not
specifically delve into therole of the proinflammatory macrophage.
The macrophages alsodemonstrated immune-suppressive features,
including PD-1 expres-sion and elaboration of arginase. Consistent
with our findings fromhuman GBM specimens (48), the
glioma-infiltrating macrophages inour models demonstrated marked
immunologic heterogeneity ofphenotype and function.
A confounder of our study is the possibility that the CD19þ
andNK1.1þ populations play a role in the earlier stages of
gliomagenesisand the CD8 KO model may have an impact on the
development ofother immune cells. However, given the sustained
survival in thismodel and the fact that gliomagenesis is induced in
the postnatalperiod, it is not technically feasible to perform in
vivo depletions inneonatal mice. This study also underscores the
importance of genet-ically engineered mouse models in which gliomas
are formed de novoin the brain for the study of the immune system,
as there was asignificant difference in the infiltration of T cells
and macrophagesbetween endogenously forming tumors and orthotopic
xenografts.These results and the studies by others (37) indicate
that CD8 T cellsmight influence features of glioma development such
as genotype,phenotype, immunogenicity, and the microenvironment
throughimmunoediting, and that these effector cells might not be
responsiblefor responses to anti–PD-1 blockade. This may be related
to anunappreciated role of the innate immune system in
modulatingmalignant degeneration, as has been previously suggested
(60).
Rao et al.
Clin Cancer Res; 26(17) September 1, 2020 CLINICAL CANCER
RESEARCH4710
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
Disclosure of Potential Conflicts of InterestA.M. Sonabend
reports personal fees from Abbvie (consulting fees) outside the
submitted work; in addition, A.M. Sonabend is listed as a
coinventor of a patentregarding predicting response to
immunotherapy in gliomas that is owned byColumbia University. J.P.
Long reports grants from Brockman Foundation duringthe conduct of
the study. S. Li reports grants from NIH during the conduct of
thestudy. M.A. Curran reports personal fees from ImmunoGenesis,
ImmunOS, Agenus,Alligator, Aptevo,Mabimmune,Oncoresponse, Pieris,
Xencor, andMerck outside thesubmitted work; in addition, M.A.
Curran is listed as a co-inventor on four patentslicensed to
ImmunoGenesis Inc and owned by MD Anderson Cancer Center relatedto
PD-L1 antibodies, PD-L2 antibodies, PD-L1/PD-L2 dual specific
antibodies, andPD-L1/PD-L2 bispecific antibodies. No potential
conflicts of interest were disclosedby the other authors.
Authors’ ContributionsG. Rao: Conceptualization, resources, data
curation, formal analysis, supervision,
funding acquisition, writing-original draft, project
administration, writing-reviewand editing. K. Latha: Data curation,
writing-review and editing. M. Ott: Datacuration, writing-review
and editing. A. Sabbagh: Data curation, writing-review andediting.
A. Marisetty: Data curation, writing-review and editing. X. Ling:
Datacuration, formal analysis, writing-review and editing. D.
Zamler: Data curation,writing-review and editing. T.A. Doucette:
Data curation, writing-review andediting. Y. Yang: Data curation,
writing-review and editing. L.-Y. Kong: Datacuration,
writing-review and editing. J. Wei: Data curation, writing-review
and
editing. G.N. Fuller: Data curation, writing-review and editing.
F. Benavides:Data curation, writing-review and editing. A.M.
Sonabend: Data curation,writing-review and editing. J. Long: Formal
analysis, writing-review and editing.S. Li: Writing-review and
editing. M. Curran: Data curation, writing-review andediting. A.B.
Heimberger: Conceptualization, resources, data curation,
supervision,funding acquisition, writing-original draft,
writing-review and editing.
AcknowledgmentsWe thank David M. Wildrick, Ph.D., for scientific
editing of the manuscript
and Audria Patrick for administrative support. This work was
supported by grantsfrom the Brockman Foundation, the Dr. Marnie
Rose Foundation, the Ben andCatherine Ivy Foundation, The
University of Texas MD Anderson Cancer CenterGBM Moonshot program,
and the NIH CA120813, P50 CA127001, and NS094615.This study made
use of the Research Animal Support Facility-Smithville
(LaboratoryAnimal Genetic Services), which is supported by P30
CA016672 DHHS/NCI CancerCenter Support grant toTheUniversity of
TexasMDAndersonCancerCenter and theTLC Foundation.
The costs of publication of this article were defrayed in part
by the payment of pagecharges. This article must therefore be
hereby marked advertisement in accordancewith 18 U.S.C. Section
1734 solely to indicate this fact.
Received December 19, 2019; revised April 16, 2020; accepted
June 11, 2020;published first June 18, 2020.
References1. Liau LM, Prins RM, Kiertscher SM, Odesa SK, Kremen
TJ, Giovannone AJ, et al.
Dendritic cell vaccination in glioblastoma patients induces
systemic and intra-cranial T-cell responses modulated by the local
central nervous system tumormicroenvironment. Clin Cancer Res
2005;11:5515–25.
2. Prins RM, Soto H, Konkankit V, Odesa SK, Eskin A, Yong WH, et
al. Geneexpression profile correlates with T-cell infiltration and
relative survival inglioblastoma patients vaccinated with dendritic
cell immunotherapy.Clin Cancer Res 2011;17:1603–15.
3. Sampson JH, Aldape KD, Archer GE, Coan A, Desjardins A,
Friedman AH, et al.Greater chemotherapy-induced lymphopenia
enhances tumor-specific immuneresponses that eliminate
EGFRvIII-expressing tumor cells in patients withglioblastoma. Neuro
Oncol 2011;13:324–33.
4. Sampson JH, Heimberger AB, Archer GE, Aldape KD, Friedman AH,
FriedmanHS, et al. Immunologic escape after prolonged
progression-free survival withepidermal growth factor receptor
variant III peptide vaccination in patients withnewly diagnosed
glioblastoma. J Clin Oncol 2010;28:4722–9.
5. Yu J, Liu G, Ying H, Yong W, Black K, Wheeler CJ. Vaccination
with tumorlysate-pulsed dendritic cells elicits antigen-specific,
cytotoxic T-cells in patientswith malignant glioma. Cancer Res
2004;64:4973–9.
6. Nduom EK, Weller M, Heimberger AB. Immunosuppressive
mechanisms inglioblastoma. Neuro-oncol 2015;17:vii9–vii14.
7. Tawbi HA, Forsyth PA, Algazi A, Hamid O, Hodi FS, Moschos SJ,
et al.Combined nivolumab and ipilimumab in melanoma metastatic to
the brain.N Engl J Med 2018;379:722–30.
8. Cloughesy TF, Mochizuki AY, Orpilla JR, HugoW, Lee AH,
Davidson TB, et al.Neoadjuvant anti-PD-1 immunotherapy promotes a
survival benefit withintratumoral and systemic immune responses in
recurrent glioblastoma.Nat Med 2019;25:477–86.
9. Zhao J, Chen AX, Gartrell RD, Silverman AM, Aparicio L, Chu
T, et al. Immuneand genomic correlates of response to anti-PD-1
immunotherapy in glioblas-toma. Nat Med 2019;25:462–9.
10. Woroniecka K, Chongsathidkiet P, Rhodin K, KemenyH,Dechant
C, Farber SH,et al. T-cell exhaustion signatures vary with tumor
type and are severe inglioblastoma. Clin Cancer Res
2018;24:4175–86.
11. Fecci PE, Mitchell DA, Whitesides JF, Xie W, Friedman AH,
Archer GE, et al.Increased regulatory T-cell fraction amidst a
diminished CD4 compartmentexplains cellular immune defects in
patients with malignant glioma. Cancer Res2006;66:3294–302.
12. Hussain SF, Yang D, Suki D, Aldape K, Grimm E, Heimberger
AB. The role ofhuman glioma-infiltrating microglia/macrophages in
mediating antitumorimmune responses. Neuro-oncol 2006;8:261–79.
13. Chongsathidkiet P, Jackson C, Koyama S, Loebel F, Cui X,
Farber SH, et al.Sequestration of T cells in bone marrow in the
setting of glioblastoma and otherintracranial tumors. Nat Med
2018;24:1459–68.
14. Kreth FW, Faist M, Grau S, Ostertag CB. Interstitial 125I
radiosurgeryof supratentorial de novo WHO Grade 2 astrocytoma and
oligoastrocy-toma in adults: long-term results and prognostic
factors. Cancer 2006;106:1372–81.
15. JaeckleKA,Decker PA, BallmanKV, FlynnPJ, Giannini C,
Scheithauer BW, et al.Transformation of low grade glioma and
correlation with outcome: an NCCTGdatabase analysis. J Neurooncol
2011;104:253–9.
16. Jakola AS, Myrmel KS, Kloster R, Torp SH, Lindal S, Unsgard
G, et al.Comparison of a strategy favoring early surgical resection
vs a strategy favoringwatchful waiting in low-grade gliomas. JAMA
2012;308:1881–8.
17. Doucette TA, Kong LY, Yang Y, Ferguson SD, Yang J, Wei J, et
al. Signaltransducer and activator of transcription 3 promotes
angiogenesis and drivesmalignant progression in glioma. Neuro Oncol
2012;14:1136–45.
18. Lohr J, Ratliff T, Huppertz A, Ge Y, Dictus C, Ahmadi R, et
al. Effector T-cellinfiltration positively impacts survival of
glioblastoma patients and is impairedby tumor-derived TGF-beta.
Clin Cancer Res 2011;17:4296–308.
19. Arrieta VA, Cacho-Diaz B, Zhao J, Rabadan R, Chen L,
Sonabend AM. Thepossibility of cancer immune editing in gliomas. A
critical review. Oncoimmu-nology 2018;7:e1445458.
20. Dunn GP, Fecci PE, Curry WT. Cancer immunoediting in
malignant glioma.Neurosurgery 2012;71:201–22.
21. Holland EC, Varmus HE. Basic fibroblast growth factor
induces cell migrationand proliferation after glia-specific gene
transfer in mice. Proc Natl Acad SciU S A 1998;95:1218–23.
22. Kong LY, Wu AS, Doucette T, Wei J, Priebe W, Fuller GN, et
al. Intratumoralmediated immunosuppression is prognostic in
genetically engineered murinemodels of glioma and correlates to
immunotherapeutic responses. Clin CancerRes 2010;16:5722–33.
23. Hale JS, Boursalian TE, TurkGL, Fink PJ. Thymic output in
agedmice. Proc NatlAcad Sci U S A 2006;103:8447–52.
24. Simon AK, Hollander GA, McMichael A. Evolution of the immune
system inhumans from infancy to old age. Proc Biol Sci
2015;282:20143085.
25. Zlotoff DA, Schwarz BA, Bhandoola A. The long road to the
thymus: thegeneration, mobilization, and circulation of T-cell
progenitors in mouse andman. Semin Immunopathol 2008;30:371–82.
26. Wakeland E, Morel L, Achey K, Yui M, Longmate J. Speed
congenics: aclassic technique in the fast lane (relatively
speaking). Immunol Today1997;18:472–7.
Immunologic Modulation of Gliomagenesis
AACRJournals.org Clin Cancer Res; 26(17) September 1, 2020
4711
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
27. Dai C, Celestino JC, Okada Y, Louis DN, Fuller GN, Holland
EC. PDGFautocrine stimulation dedifferentiates cultured astrocytes
and induces oligoden-drogliomas and oligoastrocytomas from neural
progenitors and astrocytesin vivo. Genes Dev 2001;15:1913–25.
28. Holland EC, Hively WP, DePinho RA, Varmus HE. A
constitutively activeepidermal growth factor receptor cooperates
with disruption of G1 cell-cyclearrest pathways to induce
glioma-like lesions in mice. Genes Dev 1998;12:3675–85.
29. Fults D, Pedone C, Dai C, Holland EC. MYC expression
promotes the prolif-eration of neural progenitor cells in culture
and in vivo. Neoplasia 2002;4:32–9.
30. Shih AH, Dai C, Hu X, Rosenblum MK, Koutcher JA, Holland EC.
Dose-dependent effects of platelet-derived growth factor-B on glial
tumorigenesis.Cancer Res 2004;64:4783–9.
31. Wei J, Wang F, Kong LY, Xu S, Doucette T, Ferguson SD, et
al. miR-124 inhibitsSTAT3 signaling to enhance T cell-mediated
immune clearance of glioma.Cancer Res 2013;73:3913–26.
32. Xu S,Wei J,Wang F, Kong L-Y, Ling X-Y, Doucette TA, et al.
Effect of miR-142–3p on theM2macrophage and therapeutic efficacy
against murine glioblastoma.J Natl Cancer Inst 2014;106:dju162.
33. Heimberger AB, Crotty LE, Archer GE, Hess KR, Wikstrand CJ,
Friedman AH,et al. Epidermal growth factor receptor VIII peptide
vaccination is efficaciousagainst established intracerebral tumors.
Clin Cancer Res 2003;9:4247–54.
34. BennettML, Bennett FC, Liddelow SA, Ajami B, Zamanian JL,
Fernhoff NB, et al.New tools for studying microglia in the mouse
and human CNS. Proc Natl AcadSci U S A 2016;113:E1738–46.
35. Martinez FO, Gordon S, Locati M,Mantovani A. Transcriptional
profiling of thehuman monocyte-to-macrophage differentiation and
polarization: new mole-cules and patterns of gene expression. J
Immunol 2006;177:7303–11.
36. Dahan R, Sega E, Engelhardt J, Selby M, Korman AJ, Ravetch
JV. FcgammaRsmodulate the anti-tumor activity of antibodies
targeting the PD-1/PD-L1 Axis.Cancer Cell 2015;28:285–95.
37. Kane JR, Zhao J, Tsujiuchi T, Laffleur B, Mahajan A, Rao G,
et al. CD8þ T-cell-mediated immunoediting influences genomic
evolution and immune evasion inmurine gliomas. Clin Cancer Res
2020. doi: 10.1158/1078-0432.CCR-19-3104.
38. Fleischer B. Acquisition of specific cytotoxic activity by
human T4þ T lym-phocytes in culture. Nature 1984;308:365–7.
39. Appay V. The physiological role of cytotoxic CD4(þ) T-cells:
the holy grail?Clin Exp Immunol 2004;138:10–3.
40. Porakishvili N, Kardava L, Jewell AP, Yong K, Glennie MJ,
Akbar A, et al.Cytotoxic CD4þT cells in patients with B cell
chronic lymphocytic leukemia killvia a perforin-mediated pathway.
Haematologica 2004;89:435–43.
41. Echchakir H, Bagot M, Dorothee G, Martinvalet D, Le Gouvello
S, Boumsell L,et al. Cutaneous T cell lymphoma reactive CD4þ
cytotoxic T lymphocyte clonesdisplay a Th1 cytokine profile and use
a fas-independent pathway for specifictumor cell lysis. J Invest
Dermatol 2000;115:74–80.
42. Yasukawa M, Ohminami H, Arai J, Kasahara Y, Ishida Y, Fujita
S. Granuleexocytosis, and not the fas/fas ligand system, is the
main pathway of cytotoxicitymediated by alloantigen-specific CD4(þ)
as well as CD8(þ) cytotoxicT lymphocytes in humans. Blood
2000;95:2352–5.
43. Dutta S, Sengupta P. Men and mice: relating their ages. Life
Sci 2016;152:244–8.44. Hung AL,Maxwell R, Theodros D, Belcaid Z,
Mathios D, Luksik AS, et al. TIGIT
and PD-1 dual checkpoint blockade enhances antitumor immunity
and survivalin GBM. Oncoimmunology 2018;7:e1466769.
45. Kim JE, Patel MA, Mangraviti A, Kim ES, Theodros D, Velarde
E, et al.Combination therapy with anti-PD-1, anti-TIM-3, and focal
radiation resultsin regression of murine gliomas. Clin Cancer Res
2017;23:124–36.
46. Zeng J, See AP, Phallen J, Jackson CM, Belcaid Z, Ruzevick
J, et al. Anti-PD-1blockade and stereotactic radiation produce
long-term survival in mice withintracranial gliomas. Int J Radiat
Oncol Biol Phys 2013;86:343–9.
47. Gordon SR,Maute RL, DulkenBW,Hutter G, George
BM,McCrackenMN, et al.PD-1 expression by tumour-associated
macrophages inhibits phagocytosis andtumour immunity. Nature
2017;545:495–9.
48. Gabrusiewicz K, Rodriguez B, Wei J, Hashimoto Y, Healy LM,
Maiti SN, et al.Glioblastoma-infiltrated innate immune cells
resemble M0 macrophage phe-notype. JCI Insight 2016;1:e85841.
49. de Groot J, Penas-PradoM, Alfaro-Munoz K, Hunter K, Pei B-L,
O’Brien B, et al.Window-of-opportunity clinical trial of
pembrolizumab in patients with recur-rent glioblastoma reveals a
predominance of immune suppressive macrophages.Neuro Oncol
2020;22:539–49.
50. Carswell EA, Old LJ, Kassel RL, Green S, Fiore N, Williamson
B. An endotoxin-induced serum factor that causes necrosis of
tumors. Proc Natl Acad Sci U S A1975;72:3666–70.
51. Yan H, Hou X, Li T, Zhao L, Yuan X, Fu H, et al. CD4þ T
cell-mediatedcytotoxicity eliminates primary tumor cells in
metastatic melanoma throughhigh MHC class II expression and can be
enhanced by inhibitory receptorblockade. Tumour Biol
2016;37:15949–58.
52. Binnewies M, Mujal AM, Pollack JL, Combes AJ, Hardison EA,
Barry KC, et al.Unleashing type-2 dendritic cells to drive
protective antitumor CD4(þ) T cellimmunity. Cell
2019;177:556–71.
53. AhrendsT, SpanjaardA, Pilzecker B, BabalaN, BovensA, XiaoY,
et al. CD4(þ) Tcell help confers a cytotoxic T cell effector
program including coinhibitoryreceptor downregulation and increased
tissue invasiveness. Immunity 2017;47:848–61.
54. Tran ThangNN, Derouazi M, Philippin G, Arcidiaco S, Di
Berardino-BessonW,Masson F, et al. Immune infiltration of
spontaneous mouse astrocytomas isdominated by immunosuppressive
cells from early stages of tumor development.Cancer Res
2010;70:4829–39.
55. Kmiecik J, Poli A, Brons NH,Waha A, Eide GE, Enger PO, et
al. Elevated CD3þand CD8þ tumor-infiltrating immune cells correlate
with prolonged survival inglioblastoma patients despite integrated
immunosuppressive mechanisms in thetumor microenvironment and at
the systemic level. J Neuroimmunol 2013;264:71–83.
56. Marijt KA, Blijleven L, Verdegaal EME, KesterMG, Kowalewski
DJ, RammenseeHG, et al. Identification of non-mutated neoantigens
presented by TAP-deficienttumors. J Exp Med 2018;215:2325–37.
57. Marijt KA, Doorduijn EM, van Hall T. TEIPP antigens for
T-cell basedimmunotherapy of immune-edited HLA class I(low)
cancers. Mol Immunol2019;113:43–9.
58. Beatty GL, Chiorean EG, Fishman MP, Saboury B, Teitelbaum
UR, SunW, et al.CD40 agonists alter tumor stroma and show efficacy
against pancreatic carci-noma in mice and humans. Science
2011;331:1612–6.
59. Murphy KA, Erickson JR, Johnson CS, Seiler CE, Bedi J, Hu P,
et al. CD8þT cell-independent tumor regression induced by Fc-OX40L
and therapeutic vaccina-tion in a mouse model of glioma. J Immunol
2014;192:224–33.
60. Gajewski TF, Schreiber H, Fu YX. Innate and adaptive immune
cells in the tumormicroenvironment. Nat Immunol
2013;14:1014–22.
Clin Cancer Res; 26(17) September 1, 2020 CLINICAL CANCER
RESEARCH4712
Rao et al.
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/
-
2020;26:4699-4712. Published OnlineFirst June 18, 2020.Clin
Cancer Res Ganesh Rao, Khatri Latha, Martina Ott, et al. Cellsand
Exerts Therapeutic Efficacy in the Absence of CD8 Cytotoxic T
PD-1 Induces M1 Polarization in the Glioma
Microenvironment−Anti
Updated version
10.1158/1078-0432.CCR-19-4110doi:
Access the most recent version of this article at:
Material
Supplementary
http://clincancerres.aacrjournals.org/content/suppl/2021/01/09/1078-0432.CCR-19-4110.DC1
Access the most recent supplemental material at:
Cited articles
http://clincancerres.aacrjournals.org/content/26/17/4699.full#ref-list-1
This article cites 59 articles, 25 of which you can access for
free at:
E-mail alerts related to this article or journal.Sign up to
receive free email-alerts
Subscriptions
Reprints and
[email protected]
To order reprints of this article or to subscribe to the
journal, contact the AACR Publications Department at
Permissions
Rightslink site. Click on "Request Permissions" which will take
you to the Copyright Clearance Center's (CCC)
.http://clincancerres.aacrjournals.org/content/26/17/4699To
request permission to re-use all or part of this article, use this
link
on June 24, 2021. © 2020 American Association for Cancer
Research. clincancerres.aacrjournals.org Downloaded from
Published OnlineFirst June 18, 2020; DOI:
10.1158/1078-0432.CCR-19-4110
http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-19-4110http://clincancerres.aacrjournals.org/content/suppl/2021/01/09/1078-0432.CCR-19-4110.DC1http://clincancerres.aacrjournals.org/content/26/17/4699.full#ref-list-1http://clincancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://clincancerres.aacrjournals.org/content/26/17/4699http://clincancerres.aacrjournals.org/
/ColorImageDict > /JPEG2000ColorACSImageDict >
/JPEG2000ColorImageDict > /AntiAliasGrayImages false
/CropGrayImages false /GrayImageMinResolution 200
/GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true
/GrayImageDownsampleType /Bicubic /GrayImageResolution 300
/GrayImageDepth -1 /GrayImageMinDownsampleDepth 2
/GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true
/GrayImageFilter /DCTEncode /AutoFilterGrayImages true
/GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict >
/GrayImageDict > /JPEG2000GrayACSImageDict >
/JPEG2000GrayImageDict > /AntiAliasMonoImages false
/CropMonoImages false /MonoImageMinResolution 600
/MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true
/MonoImageDownsampleType /Bicubic /MonoImageResolution 900
/MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000
/EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode
/MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None
] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false
/PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000
0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true
/PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ]
/PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier ()
/PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped
/False
/CreateJDFFile false /Description > /Namespace [ (Adobe)
(Common) (1.0) ] /OtherNamespaces [ > /FormElements false
/GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks
false /IncludeInteractive false /IncludeLayers false
/IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000
/MultimediaHandling /UseObjectSettings /Namespace [ (Adobe)
(CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA
/PageMarksFile /RomanDefault /PreserveEditing true
/UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling
/LeaveUntagged /UseDocumentBleed false >> > ]>>
setdistillerparams> setpagedevice