Annual Report of IVRI 2011-12.

1

EDITORIAL BOARD

Dr. J.M. Kataria, Joint Director (Research) Chairman

Dr. D.N. Kamra, Head, Animal Nutrition Division Member

Dr. S.K. Agarwal, Head, AR Division Member

Dr. R.K. Agarwal, Head, B&M Division Member

Dr. P.S. Banerjee, Head, Parasitology Division Member

Dr. K.N. Bhilegaonkar, Principal Scientist, VPH Division Member

Dr. Rupasi Tewari, Senior Scientist & In-charge, ATIC Member

Dr. C. Madhan Mohan, Scientist (Sr. Scale), Vety. Biotechnology Member

Dr. M. Sankar, Scientist, TAH Division Member

Shri Kundan Singh, In-Charge, Communication Centre Member

Dr. H.P. Aithal, Senior Scientist, Surgery Division Member Secretary

Assistance:

Ashutosh Soni, T-7/8, Joint Directorate of Research

S.S. Bisht, T-5, Communication Centre

Published by : Prof. (Dr). M.C. Sharma, Director & Vice-Chancellor, Indian Veterinary Research Institute,

Izatnagar - 243 122 (U.P.), India, FAX: 0091-581 2303284, Gram: VETEX, website:

www.ivri.nic.in

Printed by : M/s Anoopam Press, Bareilly

2

Chapter Page No.

1. Executive Summary 1

2. Introduction 6

3. Research Achievements 15

4. Technologies Assessed and Transferred 99

5. Education and Training 102

6. Awards and Recognition 107

7. Linkage and Collaboration in India and Abroad including Funded Projects 110

8. List of Publications 118

9. List of Research Projects 136

10. Consultancy, Patents, Commercialization of Technologies 146

11. Meetings of Management Committee, Academic Council, RAC, IRC, etc. with significant decisions 149

12. Participation of Scientists in Conferences, Workshops, Symposia and Trainings in India and Abroad 154

13. Workshops, Seminars, Summer Institutes, Short Courses and Trainings convened at the Institute 158

14. Distinguished Visitors 160

15. IVRI Personnel 161

16. Any Other Relevant Information such as Infrastructure Development 170

17. Empowerment of Women and Mainstreaming the Gender issues 178

CONTENTS

1

A. ANIMAL HEALTH

* Live attenuated sheep pox vaccine was found

to be protective against challenge with virulent

virus even after 2 years of vaccination in

sheep.

* Thermo-stability studies of live attenuated orf

vaccine revealed it to be intrinsically stable

for 12 and 5 days when exposed at 37ºC and

42ºC, respectively.

* Developed aroA deletion mutant of P.

multocida.

* Four novel chicken miRNAs were identified

from the high throughput sequencing data of

MicroRNAs differentially expressed in chicken

lungs during H5N1 infection target immune

response genes.

* The siRNA cocktail was found to be a better

BVDV-inhibitor than the earlier reported

individual siRNAs.

* A small interfering RNA (siRNA) targeting

rabies virus (RABV) nucleoprotein (N) gene

delivered using replication-defective

adenoviruses and lentiviruses was found to be

effective in inhibiting RABV multiplication in

vitro in BHK-21 cells and in vivo in mice.

* Monoclonal antibodies were developed and

characterized against matrix and nucleoprotein

antigen of AIV.

* Molecular Beacon based real-time PCR assay

for detection of crimean-congo hemorrhagic

fever virus was developed.

* A micro plaque reduction neutralization test

was optimized for detection of West Nile fever

virus neutralizing antibodies in wild birds.

* A loop-mediated isothermal amplification

(LAMP) test for detection of IBR virus in bovine

semen was developed. The test could detect

as little as 0.2 TCID50 or 0.4 infective virus

particles per reaction.

* A highly sensitive multiplex real-time PCR

assay based on SYBR Green I dye was

developed for detection of IBR virus in bovine

semen. The assay could detect as low as

0.002 TCID50 of infective virus particle per

reaction.

* LAMP assay based on conserved region of 'N'

gene of PPR virus was standardized for rapid

and specific detection of PPR virus from

clinical samples.

* A TaqMan hydrolysis probe based real time

PCR assay targeting the ankyrin repeat protein

(C18L) gene sequences was developed for the

detection and quantitation of camelpox virus.

* A sandwich ELISA (s-ELISA) was developed

for detection of BTV antigen in blood, tissue

materials and culture fluid.

* Recombinant nucleoprotein based single serum

dilution ELISA kit for serological profiling of

Newcastle disease virus has been developed.

The kit has a shelf life of 6 months when stored

at 40C. The kit has been validated and is ready

for commercialization.

* Recombinant VP2 sub-viral particles as a

subunit vaccine candidate against Infectious

bursal disease virus (IBD) has been developed.

* Real Time RT-PCR was able to detect IBV

nucleic acids in tracheal and lung tissues from

24 h post infection.

* Standardized a loop mediated isothermal

amplification test for specific detection of

Salmonella enterica subsp. enterica serovar

Typhimurium. LAMP test was found to be

specific and successfully detected S.

Typhimurium in spiked meat samples.

* Multiplex PCR based on SCAR markers and

ITS-1 based nested PCR for species level

identification of Eimeria oocysts of poultry has

been standardized.

* Standardized PCRs for detection of extraneous

agents like BVDV-I, BVDV-II, PCV-1, PCV-2,

and parvovirus in vaccine and cell culture.

Three duplex PCRs, namely. pestivirus and

Mycoplasma; Mycoplasma and parvovirus, and

Mycoplasma and porcine circovirus-2 (PCV-

1)) were also standardized.

* A lateral flow strip based assay was developed

for detection of ciprofloxacin, the assay was

able to detect ciprofloxacin in spiked samples.

* Multi locus sequence typing of Indian isolates

of Pasteurella multocida (Type B) of buffalo

origin revealed that all isolates belonged to

Type ST-122.

* Cloning and sequencing of 5UTR, E2, NS5B

and 3UTR genes of CSFV isolates revealed

close homology between recent Indian isolates

of genotype 2.2 with Chinese and Taiwanese.

New diagnostics i.e. real-time RT-PCR and

fluorescent in situ hybridization were developed

for detection of (SFV).

* HPAIV-H5N1 was recorded in crows

(Jharkhand, Maharashtra, Odisha, Bihar, Uttar

Pradesh and Tripura) in addition to chicken and

ducks. A total of 86 H5N1 viruses from nine

States, six H9N2 from three States and one

each of H11N6 and H4N6 viruses were

isolated.

1. EXECUTIVE SUMMARY

2

* Acute BVDV-1 infection in lambs was found

to change CD4+ and CD8+ T-cell subset

counts, up-regulation of pro-inflammatory (IL-

1 and TNF-α) and regulatory (IL-10 and TGF-β) cytokines in lymphoid organs.

* Malignant catarrhal fever was diagnosed in a

wild bison from zoo at Bangaluru and cattle

from State Veterinary Hospital at Bengaluru.

* Crimean-Congo hemorrhagic fever virus was

detected in ticks collected from a cattle calf

from Vadnagar Taluq, Mehsana District of

Gujarat.

* The phylogenetic analysis of HA genes

indicated that the 2011-2012 H5N1 viruses

belonged to clade 2.3.2.1 and the 2008 viruses

belonged to clade 2.2.

* The PB1 gene of some of the clade 2.3.2

viruses isolated from chickens in Meghalaya

grouped with the unknown lineage of H9N2

viruses isolated from Tripura in 2008 and

Haryana in 2005 indicating reassortment

between the two subtypes of avian influenza

viruses.

* Phylogenetic analysis of 'S' segment sequence

of CCHFV revealed that the Indian isolate is

closest to Tajakistan virus (AY049083/TAJ/

HU8966) falling in Asia 2 group of the CCHFV.

* Genotyping of rotaviral isolates revealed that

G1 and G2 were most predominant G types

and P[6], P[4] and P[8] were most predominant

P types in human. In bovines, G6 was the

most prevalent G type and P[11] was the most

common P type.

* In vivo use of 2- nitropropanol (2-NPOH) in its

MIC dosage in chick exhibits its growth

inhibitory effect on shigatoxic E. coli and S.

Gallinarum.

* National (Indian) Reference Preparations of

Clostridium perfringens ε toxin and anti ε toxin,experimental preparations were produced and

standardized.

* Presence of Picobirnavirus was confirmed in

several diarrhoeal samples from calves from

cattle and buffaloes.

* The test extract Sd 2 has showed pronounced

hypoglycaemic, insulin releaseing and hypo

cholesterolaemic effect in clinical diabetic

dogs.

* Plant materials HNAP-11 in combination with

animal origin material HNAB-2 revealed potent

hepatoprotective property in clinical cases of

HBD in dogs as compared to conventional

standard hepatoprotectant (silymarin).

* Entada pursaetha extract (EPE) had effectively

reduced pro-inflammatory cytokines TNFα andIL1b production from RAW 264.7 cell line after

LPS stimulation and also reduced NO

production by these cells.

* The herbal formulations (EO-S1 and EO-S2)

showed marked efficacy against clinical

infection of Haemonchus contortus in sheep.

Formulation EO-F1 exhibited highly significant

efficacy against Fasciola gigantica in

experimentally infected sheep.

* Two herbal acaricides were developed, which

imparted up to 70% protection to cattle against

natural tick infestation in clinical trials in farms.

The active compounds of the acaricides were

identified as Rutin and Precocene I.

* Point mutation of cytocine ( C ) to adenine (A)

nucleotide substitution (CTC to ATC) at

position 190 in domain II S4-5 linker region of

Na channel gene was identified in acaricide

resistant field isolate of cattle tick,

Rhipicephalus (Boophilus) microplus.

* Resistance status of R.(B.) microplus to

synthetic pyrethroids (SP) was 66.6%. Level

II and Level III resistance was recorded in the

ticks collected from northern sub-temperate

trans-gangetic plains and from tropical middle-

gangetic plains, respectively.

* Beta-tubulin isotype-1 gene of Bunostomum

trigonocephalum and Mecistocirrus digitatus

cloned, sequenced and characterized. The

point mutation at 200th position, where phenyl

alanine converted into tyrosine was predicted

as main reason for benzimidazole resistance.

* Standardized allele specific PCR for

benzimidazole resistance diagnosis in

Bunostomum trigonocephalum and

Mecistocirrus digitatus. Further, allele specific

PCR for diagnosis of benzimidazole resistance

was applied in field samples and 13.1% of

Haemonchus contortus showed resistance.

* Interlocking nail systems for long bones-tibia

and femur/humerus were developed and

evaluated for internal fixation of fractures in

large ruminants.

* Standardized technique of intravenous infusion

of dexmedetomidine/ midazolam, pentazocine/

butorphanol, thiopental/propofol with isoflurane

for maintenance of general anaesthesia in

buffaloes.

* Venereal tumour in street dogs was

successfully shown to be regressed with use

of recombinant VP3 gene construct of chicken

infectious anaemia virus.

* Four unique horn cancer specific ligand

sequences were identified using Phage display

methods for developing horn cancer specific

peptide nano-delivery vehicle.

* Six brain cell homing peptides having more

than 80% homing ability were identified using

phage display technique.

3

* A total of 1,59,000 doses of RD 'F' strain

vaccine; 3,200 doses of R2B vaccine; 4,200

doses of fowl pox vaccine; 3,52,565 doses of

lapinized swine fever vaccine; 9,66,000 doses

of tissue culture sheep pox vaccine; 79,86,100

doses of PPR vaccine; 59,983 doses of

Brucella abortus strain-19 (live) vaccine; 1,000

doses of enterotoxaemia vaccine; 6,000 ml HS

adjuvant vaccine; 79,290 doses of tuberculin

PPD; 27,500 doses of Johnin PPD; 44,120

doses of mallein PPD; 98,000 ml of Brucella

agglutination test antigen; 67,240 ml of Brucella

abortus Bang ring antigen; 27,500 ml of rose

Bengal plate test antigen; 86 ml of Brucella

abortus positive serum; 4,560 ml of S. Pullorum

coloured antigen; 3,000 ml of S. Pullorum plain

antigen; 7 ml S. Pullorum positive serum and

2,000 ml of S. Abortus equi 'H' antigen were

produced, quality tested and supplied to

various organizations viz., Defense

Establishments, ICAR Institutes, Medical

Institutes, Diagnostic Laboratories, State

Governments and farmers.

* A total of 6.87 million monovalent doses of

FMD vaccine comprising of 1.44 million doses

of type O, 3.43 million doses of type A and 2.0

million doses of type Asia-1 were produced.

* PPR c-ELISA (43) and PPR s-ELISA (4) kits

were produced and supplied.

B. LIVESTOCK IMPROVEMENT

* In-house poly-herbal formulation and

supplementation of methionine was found to

ameliorate arsenic induced hematopoetic,

hepatotoxic and oxidative injuries in poultry

model and was also found to reduce arsenic

deposition in vital organs like liver and kidney.

* Aegle marmelos and Murraya koenigii leaves

and area specific mineral mixture demonstrated

potential effect on induction of estrus and

cyclicity in delayed pubertal heifers. Herbal

plants have beneficial effect on follicular

development & CL formation.

* Supplementation of Zn, Se and Vit E

significantly (P<0.05) reduced the Cd

concentration in the vital organs.

* Supplementation of Cu and Zn through

inorganic (sulphate) or organic (methionine)

sources showed significant (P<0.05)

improvement in cell mediated and humoral

immune response.

* Supplementation of 10% DMSC in the

concentrate mixture of crossbred calves and

lambs was effective for reducing the severity

of trickle infection of F. gigantica.

* Detoxified cake, after removal of karanjin,

pongamol and trypsin inhibitors, can safely

replace soyabean meal protein moiety up to

50% without any adverse effect on DM intake,

nutrient utilization, growth rate, FCR, metabolic

profile, immune response, carcass

characteristics and meat quality in kids.

* Inclusion of DMSC and guar meal @ 5% in

CCFB showed improvement in performance of

crossbred calves vis-a-vis reduced (L/kg DMI)

methane production (13.75 to 17.57%).

* Condensed tannins (CT) based TM rations

(1.5%) significantly improved the intake,

nutrient metabolism and growth performance

of growing lambs with reduction in GI parasites.

* Methanobrevibacter spp. was the most

abundant methanogen In buffaloes.

* An investigation on physical treatments, i.e.

chopping and sun drying revealed that although

both were effective in reducing hydrolysable

tannins, were not effective in reducing

condensed tannin contents, of F. roxburghii

leaves.

* For bio-prospecting sea buckthorn leaves, the

methanol, water and 50% methanol extracts

were analyzed for antioxidant activity using

DPPH, FRAP and ABTS assays, which

revealed high level of antioxidant activity.

* The micro mineral profile of most of the forage

grasses and of anestrous heifers at temperate

hills showed deficiency in Cu, Zn and I.

* Caprine mesenchymal stem cells after tagging

with tracking dye, were transplanted in

myocardial infarction in rabbit, it was observed

that these cells stayed in the rabbit heart and

helped in regeneration.

* Transgenic mesenchymal stem cells

expressing green fluorescence protein were

generated, which could be further propagated

through passaging.

* Higher expression of heat shock protein genes

in caprine PBMCs during thermal stress

suggest it's possible involvement to ameliorate

deleterious effect of thermal stress so as to

maintain cellular integrity and homeostasis in

goats.

C. ANIMAL GENETIC RESOURCES

* PCR SSCP and logistic regression analysis

of lactoferrin and DRB3.2 genes revealed

genotypes having highly significant correlation

with mastitis incidence in cattle.

* The CREB binding site at the 5' region of TLR4

gene was characterized by using Chromatin

Immunoprecipitation (ChIP) assay.

* Foetal myoblast cell line was established.

Three siRNA construct successfully down-

regulated MSTN among which siRNA-3

resulted in maximum knockdown. Three

shRNA were individually transduced using

lentiviral particles and stably transfected

myoblast cells successfully established.

4

* Based on 16 SSCP patterns of four polymorphic

regions of CatSper gene, three haplotypes were

identified and haplotye II and III showed

significance with three motility parameters viz.,

high mass motility, high initial progressive

motility and high post thaw motility in

crossbred cattles.

* Genotyping of FecG locus in five sheep breeds

i.e. Garole, Kuzi, Shahabadi, Balangir and

Bonpala showed presence of only one

genotype i.e. FecGHH, suggesting fixing of

FecG gene in these breeds.

* About 20% indigenous cattle population of

Ramganga Katri were found to suffer by

polydactyl genetic defects in surveyed 21

village of Bareilly district located on the bank

of Ramganga river.

* A new garbage processing indigenous

earthworm strain Perionyx ceylenesis

designated as "Jai Gopal" was developed

having high fecundity, heat tolerance and

inhabiting ability on animal and farm waste.

* Vermibiomanure sieving machine was

designed and fabricated.

D. LIVESTOCK PRODUCTS TECHNOLOGY

* Incorporation of 1% tamarind seed powder or

flaxseed flour was found effective for binding

of dietary fibre rich extended restructured

mutton chops as well as overall improvement

in sensory acceptability.

* Processing conditions and formulations were

standardized for preparation of shelf stable

products from meat of spent animals, namely

microwable meat chips, meat papad, ready to

reconstitute meat cubes and ready to cook

meat rings.

* Fortification of restructured buffalo meat steaks

with 0.5% mousambi peel powder imbibed

functional value and enhanced the shelf life

with reduction in the production cost of the

product.

E. EXTENSION ACTIVITIES

* Annual Kisan Mela Avam Pashu Vigyan

Pradarshini-2011 was organized during 18-20th

October, 2011 at Institute and approximately

13046 farmers, students NGO's personnel's,

government personnel's, industrialists visited

this Kisan Mela.

* All India Dog show was organized on 10th

January, 2012, wherein 108 dogs of 23 breeds

participated in dog show.

* A total of 105 exhibitions were put up at

different places in country viz., CSWRI

Avikanagar, GBPUA&T Pantnagar, NDRI

Karnal, Dehradun, CIRB Hisar, IARI, Pusa,

Gorakhpur, Allahabad and in Bareilly,

Moradabad and Badaun district of Uttar

Pradesh.

* Forty five animal health camps were organized,

wherein a total of 1,435 animals were treated.

* Fifty one kisan gosthies, 86 demonstrations

of technologies (viz., olinall, crystoscope and

area specific mineral mixture, fractured bone

fixator, UMMB, complete feed block, herbal

ointment, herbal anti-diarrhoea, herbal

acaricide, herbal medicament, vermiculture/

vermi-compost) were organized at different

place such as Anand district in Gujarat,

Dehradun and Haridwar districts of Uttrakhand,

Bareilly, Badaun, Moradabad, Gorakhpur and

Allahabad districts of Uttar Pradesh.

* A total of 14 training programmes were

organized on different subjects for 35 field

veterinarians, 18 pharmacists, and 202

progressive farmers.

* A total of 20,263 visitors' viz., livestock

owners/ farmers, students, and entrepreneurs,

distinguished visitors visited the Institute during

the year.

* A total of 463 questions related to various

aspect of livestock production, health and

management were replied through Kisan Call

Centre and further, a total of 489 calls were

attended at the Institute Help Line.

* Two issues of half yearly magazine entitled

"Pashu Chiktsa Vigyan" were published from

ATIC for dissemination of scientific information

to livestock owners, farmers and rural youth.

* Four interfaces meet with AI inseminators,

veterinary officers of Uttar Pradesh and

Uttarakhand States were conducted

* An interaction meet with the ATIC kisan club

members was organized, wherein a total of 41

ATIC Kisan Club members and the officials

from banking and insurance sectors

participated.

* Media Meet and showcasing of technologies

was organized at IVRI Izatnagar, wherein a total

of 50 media personnel of print and electronic

media and 50 progressive farmers of Bareilly

district participated.

* A total of 312 visits of ATIC mobile van in 95

different villages, were undertaken for

popularization of IVRI technologies.

* IVRI, ERS, Kolkata organized five (5) animal

health camps, two (2) training programmes for

tribal farmers and two (2) short term training

programmes for veterinary officers from various

states. Further, one farmers' interface meeting

was conducted at Domkal village of Sunderbans

area in collaboration with KVK, Sri Ramkrishna

Ashram, Nimpith, South 24 Parganas, West

Bengal.

5

* A total of 144 skill oriented trainings benefiting

2999 participants were organized on-campus,

off-campus, in-service and sponsored for

farmers, rural youths, rural women and

extension functionaries for disseminating the

latest and advance technical know how in their

area of work.

* Five hundred and seventy rural women have

been empowered technically in home science,

animal husbandry and crop science areas.

* A total of 58 demonstrations were conducted

under FLD on oilseed and pulses; 145

demonstrations were organized on Paddy SRI,

Napier grass, Berseem + Oat, nutritional kitchen

garden, wheat, chilly, fodder sorghum,

vegetables, bio control of fruit fly, floriculture

etc and 16 demonstrations units were

established on backyard poultry and 4 on

goatry in different villages.

* Seventeen animal health camps were

organized/ participated wherein 2110 animals

were treated, 38 Kisan goshties were organized

covering 18 different villages by KVK and

participated in 04 exhibitions/mela at national

level by putting institute stall to display the

technologies.

* KVK published 21 folders, 4 leaflets and one

CD on scientific paddy cultivation for farmers

and extension personnel's.

* One day kisan mela was organized in village

Pitamberpur wherein farmer goshti, technology

exhibition, animal health camp, animal

competitions were organized. About 265

farmers/ women were benefited.

* Three exposure visits to CIRG, Makhdoom,

GBPUA&T, Pantnagar and IVRI, Izatnagar were

organized for 60 rural women to make them

aware about the improved technologies of

livestock farming.

* Six OFT were conducted on mineral deficiency

in goats reared under semi intensive system,

problem of high mortality and low productivity

in backyard poultry, problem of bacterial blight

in Pusa basmati-1 variety of rice, low

productivity of late sown wheat crops, problem

of wilt disease in green chilies, problem of

nutritional insecurity among rural families.

* A total of 45 film shows were organized during

various training programs and about 1037

farmers, students, dignitaries', extension

personnel and visitors visited the KVK, KVK

farms etc.

* One women health camp was organized in

village Ganghora Ghangori, wherein more than

three hundred women/rural girls were checked

by the doctors of IVRI human hospital and free

medicines were distributed.

* Under distance education program, 29 radio

talks and 25 TV talks have been delivered

through AIR, Rampur and AIR, Bareilly and

Doordarshan Bareilly.

F. EDUCATION

* On the basis of All India Entrance

Examination, 240 students (136 MVSc and 104

PhD) were admitted to post-graduate

programmes during the academic year.

* A total of 6 veterinary officers from various

states were enrolled to national diploma

courses in one discipline.

* An International Training Course on 'Gene

based techniques for research in

biotechnology' sponsored by TCS Columbo

Plan, India Millennium Fund was conducted

from February 20 to March 11, 2012. Ten

participants from Asia Pacific region were

trained.

* Fifteen highly specialized short-term training

courses were conducted in different disciplines

to provide the recent advances and hands-on

training to students and in-service candidates.

G. PUBLICATIONS & PRESENTATIONS

* A total of 405 research papers were published

in Indian (213) and foreign (192) journals of

repute.

* The other major publications of the institute

include Books (24), Book Chapters (199),

Annual Reports (1), Popular/Technical Articles

(309), Bulletins (54), Research Abstracts (520),

GenBank submissions (169), Training Manual/

Compendia (30), Monographs (9), News Letter

(2), and extension bulletins (37).

* The scientific and mass media presentations

made during the year include Radio/TV Talks

(28), Press Releases/Newspaper

Presentations (120).

H. OTHER ACHIEVEMENTS

* The Institute generated Rs.8.95 crores from

sale of various livestock products, biologicals,

technologies, animal health diagnostic services

and other sources.

* Many ICAR National Awards and an

International recognition conferred on IVRI

including Rajrshi Tandon Rajbhasha Puraskar-

2010; Ganesh Shankar Vidyarthi Puraskar-

2010; Best KVK Award of Zone-IV for the year

2005-10; Best National Agribusiness Incubator

Award-2011; Best National Agribusiness

Incubatee Award-2011 and OIE certification for

notable contribution in achieving 'Zero

Rinderpest status' for India.

* The Institute has filed 12 new patents 3

copyright applications and 4 design registration

and 4 technologies were commercialized during

the year.

6

2. INTRODUCTION

BRIEF HISTORY

The Indian Veterinary Research Institute,

Izatnagar is one of the premier national institutions

in veterinary and animal sciences in the world.

Founded in 1889, the Institute is the oldest among

the institutions governed by Indian Council of

Agricultural Research. The major historical landmarks

in the genesis, growth and development of this

national Institute are detailed below:

1889 Foundation of Imperial Bacteriological

Laboratory (IBL) at Pune, Maharashtra

1890 Appointment of Dr. Alfred Lingard, a noted

medical scientist as the founder Director

1893 Shifting of the IBL to Mukteswar, Kumaon

Hills of Uttar Pradesh (now in Uttarakhand)

1897 Historical visit of renowned bacteriologists,

Dr. Robert Koch, Dr. R. Pfeiffer and Dr. G.

Gaffky

1899 Production of first batch of anti-rinderpest

serum

1913 Birth of Izatnagar campus

1925 Renaming as Imperial Institute of Veterinary

Research

1930 Renaming as Imperial Veterinary Serum

Institute

1936 Renaming as Imperial Veterinary Research

Institute (IVRI)

1940 Development of vaccine against Ranikhet

disease of poultry

1947 Shifting of headquarters of the Institute from

Mukteswar to Izatnagar and renaming as

Indian Veterinary Research Institute (IVRI)

under Govt. of India

1958 Establishment of a Postgraduate College of

Animal Sciences at Mukteswar, affiliated to

Agra University

1966 Transfer of administrative control to Indian

Council of Agricultural Research and

recognition as a National Institute

1967 Establishment of Regional Station at

Palampur (Himachal Pradesh)

1970 Establishment of a Regional Station at

Kolkata (formerly Calcutta)

1971 Establishment of IVRI Campus at Bangalore

1973 Development of irradiated lung worm vaccine

and establishment of Vaccine Production

Centre at Srinagar

1982 Establishment of Germplasm Centre at

Izatnagar

1983 Conferment of Deemed University status by

University Grants Commission to IVRI,

Izatnagar

1986 Establishment of National Biotechnology

Centre (NBC) at Izatnagar

1986 Establishment of a Centre for Animal Disease

Research and Diagnosis (CADRAD) at

Izatnagar

1998 Establishment of High Security Animal

Disease Laboratory at Bhopal

2000 Dedication of High Security Animal Disease

Laboratory to the Nation

2001 Development of competitive-ELISA

diagnostic kit for Rinderpest, approved by

OIE and validated by IAH, Pirbright, UK.

2001 P2 facility for FMD vaccine quality control

created at Animal Experimental Station,

Yelahanka, IVRI, Bangalore

2001 Conferment of Sardar Patel Outstanding

ICAR Institution Award

2002 Development of live modified PPR vaccine

2004 Establishment of Kisan Call Centre at

Izatnagar

2004 Inauguration of University-cum-

Administrative Block

2005 Award of ISO 9001: 2000 Certificate by

International Certificate Services Asia to

CADRAD

2007 Kisan Help Line at Mukteswar campus

2009 Recognition of HSADL as OIE approved

Referral Lab for HPAI diagnosis; the third

such lab in Asia and seventh in the world

2009 Establishment of SPF Animal Facility at

HSADL, Bhopal

2009 Establishment of Zonal Technology

Management - Business Planing and

Development Unit (North Zone)

2010 Conferment of Sardar Patel Outstanding

ICAR Institution Award for the year 2009

The Institute with its long heritage and glorious

scientific achievements has always enjoyed a certain

prestige and tradition of its own. The Institute at its

headquarters functions through more than 20

research divisions, 400 acres livestock and fodder

production farms, feed technology unit, a modern

computerised library, engineering section, medical

hospital, etc. Besides the main campus, three

regional stations at Kolkata, Palampur and Srinagar

and two full-fledged campuses at Mukteswar in

Uttarakhand and Bangalore in Karnataka are the other

functional units of the Institute dedicated to livestock

research and development. Further, the Institute is

the seat of two Centres of Advanced Studies in Animal

Nutrition, and Veterinary Physiology, many Network,

National Agricultural Innovation Projects and All India

Co-ordinated Research Projects.

7

MANDATE

1. To conduct research, provide postgraduate

education and transfer of the technology in all

areas of animal sciences with emphasis on

animal health and production.

2. To act as national referral centre for veterinary

type cultures, disease diagnosis, biologicals,

immunodiagnostics etc.

PAST ACHIEVEMENTS

The Institute, the largest of its kind in whole

of South-east Asia, is widely known for its impressive

contributions to all aspects of livestock and poultry

health, production technology and postgraduate

education. The Institute is a pioneer not only in

mission-oriented research, but also a foremost centre

for postgraduate training and education. For many in

the profession it is their Alma Mater.

The Institute takes a legitimate pride in its

contributions and distinguished services pro rata in

achieving the national goals. With the richest animal

resource in the world today, India is the largest milk

producer and ranks fourth in egg production and eighth

in broiler production in the world. These notable

achievements became a reality due to direct impact

on account of control of major diseases, particularly

rinderpest and CBPP in cattle, African horse sickness

in horses and Newcastle disease in poultry as a result

of potent vaccines developed by IVRI. Some of the

salient achievements are summarised below:

A. ANIMAL HEALTH

Early Interventions - Pre-independence Phase

* Development of anti-rinderpest serum (1899),

anti-anthrax serum for cattle (1902),

haemorrhagic septicaemia (HS) serum (1905)

* Development of black quarter vaccine (1906-

08)

* Treatment of surra (T. evansi infection) in

horses and camels (1908-11)

* Production of polyvalent HS vaccine (1908)

* Eradication of dourine in horses (1920-21)

* Development of goat tissue vaccine (GTV)

against rinderpest (1927)

* Development of R2B vaccine against Ranikhet

disease of poultry (1940)

Sustained R&D Activities - Post-independence

Phase

* Development and updating FMD vaccines

including crystal violet tongue epithelium

(1946-52), goat kidney cell culture (1964-65),

saponin and oil adjuvant (1968-70) and BHK-

21 monolayer and cell suspension (1971-78)

vaccines

* Development of anthrax spore vaccine (1951)

* Control and eradication of African horse

sickness through appropriate diagnostics,

vaccine and control strategies (1960 - 65)

* Development of an irradiated sheep lung worm

vaccine (1973)

* Standardization of fermenter technology for

large scale production of FMD vaccine in BHK-

21 (clone 13) cells in suspension (1976-79)

* Development of Theileria schizont vaccine for

bovine theileriosis (1979)

* Development of inactivated goat pox vaccine

(1986-87)

* Successful use of horn plates in the

management of long bone fractures in animals

(1986-90)

* Development of drugs/formulations from

indigenous medicinal plants for skin infections,

ecto-and endoparasites and wounds (1990-96)

* Molecular characterization and differentiation

of P. multocida strains, Salmonella serovars

of veterinary and zoonotic significance using

ribotyping, PCR and DNA fingerprinting

techniques (1992-2000)

* Development of ELISA technology for

diagnosis of salmonellosis, brucellosis,

listeriosis, theileriosis, babesiosis,

trypanosomosis, fasciolosis and

echinococcosis (1995-99) and inclusion body

hepatitis-hydropericardium syndrome (IBH-

HPS) in chicks (2000)

* Development and release of a COFAL test kit

for detection of ALC infection in poultry (1997)

* Olinall®, a formula for treatment of chronic skin

ailments commercialized (1997)

* Development of a panel of monoclonal

antibodies against rinderpest virus and a MAb

based competitive ELISA to distinguish

rinderpest and PPR viruses (1997-99)

* Development and release of a kit for diagnosis

of bluetongue (1998), FMD (1998), rinderpest

(2001)

* Demonstration of 'lead' as an inducer of

oxidative stress in bovines for the first time

(1998-99)

* Development of PCR assay and a non-isotopic

gene probe for detection of Trypanosoma

evansi (1998-2000)

* Development of IBD vaccine (1999) and a

thermostable IBD vaccine (2001) for Gumboro

disease of poultry (1999)

* Standardization of ELISA and PCR for the

diagnosis of Mycoides clusters of Mycoplasma

viz., Mycoides mycoides subsp. capri, M.

mycoides subsp. mycoides Type LC, M.

capricolum subsp. capricolumn, M.

capricolum, Subsp. capripneumoniae and

Mycoplasma sp. bovine group 7 (1999)

* Designing and fabrication of an external skeletal

fixation device for stable fixation of metatarsal

and radial fractures in large animals (1999)

8

* Development of CCPP vaccine for goats and

sheep (2000)

* Development of Rose Bengal coloured antigen

for serum agglutination test (1999-2000) and

kit for diagnosis of caprine pleuropneumonia

* Occurrence of chicken infectious anaemia

(CIA) in India by PCR assay and isolation of

virus (2000)

* Development of an inactivated oil emulsified

vaccine against IBH-HPS (2000)

* Targeted PCR assays for detection of

haemoprotozoan infections caused by Theileria

annulata and Babesia bigemina infected carrier

animals were standardized (2001)

* PCR based diagnostic technology developed

for the detection and differentiation of important

avian diseases viz., infectious bursal disease,

CIA, Newcastle disease, EDS-76 virus

syndrome, Avian Reovirus infection and duck

plague (2001)

* Development of an effective indigenous

treatment for endometritis in buffaloes (2002)

* Development of ELISA technology for

diagnosis of BVD and PPR (2003)

* Development of PCR based diagnostic

technology for fowl adeno virus-4 (2003)

* PCR based diagnostic assays standardized

for BPV, BVD virus, canine parvovirus,

Campylobacter (2003), Brucella and

Haemonchus contortus (2006)

* Development of area-specific mineral mixtures

to improve animal health and production (2003)

* Conferment of 100 per cent protection in

challenged calves by a low volume (2 ml)

saponified haemorrhagic septicaemia vaccine,

up to 12 months post immunization (2004)

* Conferment of 100 per cent protection in mares

challenged with a virulent S. Abortus equi strain

by defined deletion double mutant vaccine for

Salmonella Abortus equi (2004)

* Successful fixation of fractures in dogs with

osteopenic bones by modified technique of

interlocking nailing (2004)

* Commercialization of area specific mineral

mixture with industrial concerns (2005)

* Development of multiplex PCR for listeriosis

and nested PCR for BDV, BVDV (type 1 & 2)

and T. evansi (2006)

* Detection of H5N1 subtype of influenza virus

in poultry for the first time in the country. Four

H9N2 and one H9N1 viruses were isolated

(2006)

* Development of Real-time PCR based

diagnostic assays for important exotic

diseases namely, avian influenza virus and

pseudorabies (2006)

* A status of freedom from contagious bovine

pleuropneumonia infection in cattle and buffalo

was obtained from OIE (2007)

* Dot-ELISA was developed for serodignosis of

Fasciola gigantica infection (2007)

* Development of cell culture vaccine for

classical swine fever (2007).

* Development of recombinant antigen based

ELISA kit for serodiagnosis of IBD and NDV

(2007)

* Epoxy-pin external skeletal fixation technique

has been developed for a variety of compound

fractures of long bones in small animals (2007)

* A novel design of bilateral external fixator has

been developed for the management of long

bone fractures in large animals (2007)

* A Taqman based one-step Real-time RT-PCR

was developed for simultaneous detection and

genetic typing of ruminant pestiviruses,

namely, BVDV-1, BVDV-2 and BDV (2008)

* A diagnostic Real-time PCR based on DNA

polymerase gene has been developed and

validated using suspected clinical samples of

Capri poxviruses obtained from sheep and

goats (2008)

* A post-milking herbal teat dip for prevention of

bovine mastitis was developed (2008)

* A cart for rehabilitation of dogs suffering from

posterior paresis has been designed and

developed (2008)

* Porcine circovirus 2, the causative agent of

PMWS, an emerging disease of pig was first

identified in the Indian swine population (2009)

* Porcine parvovirus causing reproductive failure

in pigs was detected in Indian swine population

(2009)

* Real time PCR assays for specific diagnosis

of pox viruses (Orf, buffalo pox) and rotavirus

were developed (2010)

* A ELISA diagnostic kit for diagnosis of

Haemonchus contortus infection was

developed (2010)

* Phylogenetically new strain of H5N1 (clade

2.3.2) was identified from outbreak in ducks of

Tripura (2011)

* Allele specific PCR for benzimidazole

resistance diagnosis in Bunostomum

trigonocephalum and Mecistocirrus digitatus

(2011)

B. LIVESTOCK IMPROVEMENT/MANAGEMENT

* Introduction of Japanese quail (Coturnix

coturnix japonica) as an alternate to poultry

for the first time (1974) in India

* Development and release of a high yielding

broiler (B77) of poultry (1977)

* Development of urea-molasses liquid feed and

urea-molasses mineral liquid supplement for

efficient utilization of low grade straws by

ruminants (1980-85)

9

* Evolution of new strains of high yielding cattle

(3000-3500 kg of milk / 300 days of lactation)

(1986-97)

* Utilization of agro-industrial by-products like

mahua cake, neem seed cake, sal seed meal,

tomato pumace, etc. and unconventional feed

stuffs as livestock feed (1990-95)

* Development of a promising diet for growing

pigs and feeding standards for buffaloes,

rabbits and guinea fowls (1990-95)

* The feeding of lactics (lactic acid bacteria) to

pre-ruminant calves and yeast to adult

ruminants was found to improve animal

productivity (1995-2000)

* Designing and fabrication of a simple field

diagnostic tool 'Crystoscope' indigenously for

assessing the optimum insemination time and

categorization of bulls based on crystallization

patterns of cervical mucous and neat semen

(1999)

* A combined PCR-SSCP, PCR-RFLP,

microsatellite and heteroduplex analysis and

DNA sequencing were successfully used for

genotyping of animals (2001)

* Regression of thyroid gland activity with

decreased levels of thyroid hormones, T3 and

T4 was observed in goats infected with PPR

and liverfluke infection caused by F. gigantica

(2001)

* A pregnancy-specific marker protein of

placental origin in serum of pregnant goats was

characterized (2001)

* Technology development for utilization of

karanj cake, urea-ammoniated sugar cane

bagasse and kitchen waste as livestock feed

(2003)

* Genotyping of various genes namely, IGF BP-

3, IL-2, IL-10, NRAMP-1, DRB-3 and ITGB-2

genes that affect growth/ production

performance and/or disease resistance was

done in buffaloes and goats (2003)

* Eupatorium sesquiterpene (ODA, 9-oxo-10,11-

dehydroageropherone) identified as a potent

inhibitory agent in ruminant methane formation

(2003)

* Development of a lifting device for sick and

convalescent large animals (2003)

* Restoration of fertility in endometric cows by

autologous plasma and ketocytes (2004)

* Development of a tractor operated animal

carrier (2004)

* Development of cross-bred cattle strain

'Vrindavani' (2006)

* Feeding practices were devised for in vivo

reduction of methane production in buffaloes

(2010)

* Generated transgenic mesenchymal stem

cells expressing green fluorescence protein

(2011)

C. LIVESTOCK PRODUCTS TECHNOLOGY

* Development of technologies for value aided

recipes such as meat pickles (1982), buffalo

meat sausage (1982), meat patties (1986),

meat tikkas (1986), meat kofta (1987), rabbit

meat products (1992), chicken nuggets (1997),

milk sausages (1986), egg loaf (1997), meat

based snacks, chicken meat chips, curls

(2001), functional mutton nuggets (2007)

* Development of diet nuggets from broilers and

culled broiler hens (2002)

* Development of technologies for buffalo meat

based idli and meat samosa (2003)

* Development of technique for successful

incorporation of pork skin/rind in emulsion

based products (2003)

* Development of a novel device 'tandoor hook'

hanger for meat specialities (2003)

* Development of low salt, low fat, medium fibre

pork meat balls (2004)

* Development of meat products of nutritional

merit incorporating capsicum, carrot, radish,

red chilli, linseed and soya (2006)

D. HUMAN RESOURCE DEVELOPMENT

* Prior to conferment of Deemed University

status to IVRI in 1983, a total of 851 scholars

earned their postgraduate degrees from the

institute (M.V.Sc.-570, Ph.D.-273, D.Sc.-8)

including 103 scholars from 22 countries

* The Deemed University, IVRI awarded 105

M.Sc., 1808 M.V.Sc., 853 Ph.D. degrees to

P.G. scholars enrolled at this institute (1984-

2012)

* A total of 1559 field veterinary officers were

awarded National Diploma certificates by IVRI

before conferment of Deemed University status

* The Deemed University IVRI awarded 565

National Diploma certificates to field Veterinary

Officers (1984-2012)

10

11

STATEMENT SHOWING THE TOTAL NUMBER OF EMPLOYEES AT IVRI AND ITS CAMPUSES/

STATIONS AND NUMBER OF S.C. AND S.T. CATEGORY EMPLOYEES (AS ON 31.03.2012)

Class of No. of No. of No. of S.C. No. of S.T. No. of O.B.C. No. of

posts sanctioned employees category category category PHs in

posts in position employees employees employees position

Scientific

Scientists 202 175 16 01 11 02

Sr. Scientists 82 45 09 01 06 -

Principal Scientists 39 22 02 - - -

R.M.Ps 08 06 - - - -

Technical

Category-I 351 282 49 07 07 04

Category-II 82 60 15 10 11 -

Category-II (T-5) 15 12 (excluding 03 04 06 01

those promoted

by way of FYA)

Category - III 91 41 03 03 02 01

(T-6 to T-9)

Administrative

JD (Admn. & Registrar) 01 01 01 - - -

C.A.O 01 02 01 - 01 -

SF&AO 01 01 - - - -

S.A.O. 02 02 01 - 01 -

A.O. 05 03 - - - -

A.A.O 30 18 02 - - -

F&AO 02 02 01 - - -

AF&AO 04 02 - - - -

Asstt. Director (OL) 02 01 - - - -

Security Officer 02 01 - - - -

P.S. 11 10 - - 01 -

M.O. 06 04 01 - - -

Assistant 143 91 11 01 03 02

U D C 55 101 19 02 04 09

LDC 40 45 05 - 05 -

P.A. 15 09 - - 01 01

Steno Grade III 05 02 - - - -

Jr. A/cs Officer 01 01 01 - - -

Asst. Manager (Canteen)01 01 - - - -

Manager (Canteen) 01 01 - - - -

Cook 01 01 - - - -

Skilled Support Staff 1285 1003 330 24 52 23

12

REVENUE GENERATION DURING 2011-12

(Rupees in lakhs)

(A) Revenue Generation Izantnagar Mukteswar Bangalore Bhopal Total

1. Sale of dairy products 129.42 9.70 0.00 0.00 139.12

2. Sale of vaccines 198.13 5.10 134.03 0.00 337.26

3. Income from services rendered 0.00 0.00 0.00 0.00 0.0

4. Income from publications 3.15 0.00048 0.00 0.00 3.15048

5. Sale of animals 53.87 0.00 0.00 0.00 53.87

6. Other misc. receipts 239.11 30.58 33.52 58.45 361.66

Total 623.68 45.38 167.55 58.45 895.06

SUMMARY OF EXPENDITURE 2011-12

(Rupees in lakhs)

(B) Summary of Expenditure:

Non plan:

1. Estt. Charges including LSPC 7011.21 901.69 551.93 310.69 8775.52

2. T.A. 27.97 2.00 2.00 2.99 34.96

3. Assets acquired :

a) Equipment 38.88 3.52 2.19 0.86 45.45

b) Books & journals 0.00 0.00 0.00 0.00 0.0

c) Others 61.21 0.33 5.29 4.05 70.88

4. Feed & upkeep of animals 160.58 19.71 3.21 1.14 184.64

5. Chemicals & glassware 434.33 29.11 5.13 54.27 522.84

6. Scholarship/fellowship 301.57 18.45 2.29 0.00 322.31

7. Other misc. contingent expenditure 1089.71 122.10 80.21 325.98 1618

8. Works - repair & maintenance 192.05 36.62 26.99 18.10 273.76

Total 9317.51 1133.53 679.24 718.08 11848.36

Plan:

1. Estt. charges including LSPC

2. T.A. 21.98 3.94 4.00 4.00 33.92

3. H.R.D. 9.20 0.66 0.00 0.59 10.45

4. Assets acquired 0.00 0.00 0.00 0.00 0.00

5. Equipment 75.73 15.72 0.00 0.93 92.38

6. Books & journals 100.00 24.02 20.00 9.33 153.35

7. Livestock 1.80 0.92 0.00 0.00 2.72

8. Others 0.00 0.00 0.00 0.00 0.00

9. Feed & upkeep of animals 107.64 0.00 0.00 0.00 107.64

10. Chemicals & glassware 53.79 10.60 17.09 70.83 152.31

11. Scholarship/fellowship 0.00 0.00 0.00 0.00 0.00

12. Other misc. contingent expenditure 17.35 36.61 44.90 89.45 188.31

13. Major works 294.08 85.00 11.58 32.99 423.65

14. Repairs & maintenance 0.00 3.74 0.00 0.00 3.74

Total 681.57 181.21 97.57 208.12 1168.47

13

SCHEME-WISE EXPENDITURE DURING 2011-12

(Rupees in lakh)

S N.Summary of Expenditure Izantnagar Mukteswar Bangalore Bhopal Total

1 Non Plan 9317.51 1133.53 679.24 718.08 11848.36

2 Plan 676.57 181.21 97.57 208.12 1163.47

3 Schemes financed from Non Plan:

a ICAR Fellowship 274.75

b SUMMER INSTITUTES 2.97

(ICAR Summer/ Winter School)

4 Schemes financed from Plan Budget of Council:

a Niche Area Project 42.17 18.52

b Dr. Bhaskar Sharma (National Prof.) 46.89

c ZTMC/ITMU Project 9.57

d Environmental Pollutant 208.37

e Zoonotic Disease 167.50

f Ethno Veterinary Medicine 230.34

AICRPs:

g AICRP on Pigs 10.31

h AICRP on Feed Resources 10.54

All India Network Project:

i AINP on GIP 109.85

j AINP on HS 103.76

k AINP on BTD 94.91 7.65

l Enhancing Livelihood of Rural 4.68

Woment through Livestock

Production

Education Division Schemes:

m P.G.Education Programme 32.33

n Centre for Advance Studies (A N) 11.56

o Centre for Advance Studies (A. Phy) 9.38

p Advance Centre on P.G. Education -

5 KVK 62.12

6 Externally funded Projects:

NAIP 805.90 25.21 2.16

CDDL

'R' Deposit Schemes

Scheme Financed from other

Deptt. 336.93 26.48

DBT SFV

NPRE Project

AD-hoc project

7 A.P.Cess funded Schemes 1.79

}

14

3. RESEARCH ACHIEVEMENTS

Sl.No. Theme Page No.

1. Development and improvement of vaccines and vaccine delivery 15

2. Development and improvement of diagnosis 20

3. Production and standardization of veterinary biologicals 28

4. Molecular characterization of pathogens and host-pathogen interaction 30

5. Disease monitoring and surveillance 37

6. Exotic and emerging diseases 45

7. Development of alternate systems of therapy 49

8. Molecular mechanism of drugs and their monitoring in animal system 54

9. Environmental pollutants/xenobiotics and their impact on animal health and production 54

10 Clinical and surgical interventions 56

11. Clinical and diagnostic services 60

12. Genetic studies related to disease resistance, production and reproduction in livestock 63

13. Livestock production and management 68

14. Reproductive management and augmentation of fertility 73

15. Nutrition for health and welfare of livestock, pets and wildlife 77

16. Expending feed resources and improving nutrient extraction from biomass 81

17. Strategic supplementation of macro- and micro-nutrients for improving livestock production 83

18. Feeding practices for optimizing animal productivity and reducing environmental pollution 84

19. Impact of environmental stress on health and production in livestock 86

20. Database on livestock related statistics and development of statistical models 88

21. Economic evaluation of livestock diseases and marketing of livestock products 89

22. Extension interventions in livestock production systems 91

23. Value addition of livestock products 96

1 5

1. DEVELOPMENT AND IMPROVEMENT

OF VACCINES AND VACCINE

DELIVERY

(1) VIRAL VCCCINES

(a) Foot and mouth disease

(i) Evaluation of inactivated Foot-and-mouth

disease vaccine formulated with VacciMax, a

liposome based novel delivery system: Two

different formulations of high payload trivalent

VacciMax-FMD vaccine were evaluated in

comparison to the conventional oil adjuvanted

vaccine. Cattle immunized with these vaccines were

assessed for duration of immunity at monthly interval

up to 9 months post-vaccination and screened by

VNT for type specific FMDV antibodies. At 6 months,

animals were given booster vaccination. The VNT

data were analysed for duration of protective immune

response. Cattle vaccinated with two VacciMax-

FMDV preparation had shown titre of 64 up to 6

months similar to conventional vaccine. The mean

titre of >64 was observed in 70% of animals for type

O, 75% for type A and 87% for Type Asia1. The titre

(>64) was maintained till 7 months in conventional

vaccine while it started declining in VacciMax

formulations after 6 months. However, a booster dose

of VacciMax formulation on completion of 6 months

post-vaccination showed rise in VN titre of 64 and

above in 100% animals for all three serotypes.

(ii)Recombinant adenovirus vectored FMD

vaccine: Recombinant adenoviruses containing

capsid genes of three Indian Vaccine strains (O R2/

75, A 40/2000 and Asia-1 63/1972) and two field

strains (A 195/2007 and A 281/2003) were

constructed.

(iii) Baculovirus expressed FMD vaccine:

Baculovirus expressed P1-2A-3C of FMDV type O

was prepared in bulk for purification by sucrose

density gradient. The expressed proteins were tested

in sandwich ELISA format and found to be type

specific and showed reactivity to anti- FMDV antibody

raised in rabbit. The purified proteins were screened

in Transmission Electron Microscopy for empty

capsids.

Infectious genome length cDNA of FMDV type

O has been constructed. BHK-21 cells transfected

with plasmid containing full genomic cDNA of the

virus flanked by murine RNAPI promoter and

terminator sequences lead to recovery of infectious

FMDV particles as evidenced by cytopathic effects

(CPE) in the cultured cells (Fig.1). Recombinant virus

was characterized by virus neutralization test (VNT),

antigen ELISA, plaque assay.

B A

Fig. 1: CPE in BHK-21 cells infected with rescued virus

from infectious clone.

(A) Normal monolayer of BHK-21 cells transfected with

lipofectamine alone containing no cDNA construct. Cells

do not show any changes 72 hours post-transfection.

(B) BHK-21 cells transfected with 2 µg of pFMDV-O-IND-

R2/75 clone with lipofectamine after 24-48 h of

transfection show CPE characterized by cell aggregates

and cell degeneration that is characteristic of FMDV in-

fected BHK-21 culture.

(iv) Modulation of immune responses to FMDV :

A DNA vaccine was made by cloning VP1 of FMDV

serotype O either alone or fusing with HSP60 in pVAC

vector. The vaccine constuct, when studied for its in

vitro functionality in BHK21 cells and in vivo

immunogenicity in guinea pigs, showed that it

induced high level of IgG1, IgG2 and nitric oxides. A

protection of 50% in guinea pigs upon virulent FMDV

challenge was observed as compared to 30%

protection in VP1 alone.

A DNA vaccine construct carrying VP1 gene

of FMD virus serotype O fused to Omp A gene of

Salmonella Typhimurium (pVAC VP1- OmpA) was

constructed and evaluated for immunogenicity and

protection. This construct conferred 70% protection

against homologous virulent challenge, in immunized

guinea pigs.

Chitosan nanoparticles containing FMD whole

virus (146S) induced strong mucosal immunity (IgA)

when administered intranasally and withstood

intranasal FMD virus type O challenge in cattle.

(v) Bovine GM CSF: Molecular subcloning,

expression in Pichia pestoris and evaluation of

it's biological activity: Bovine GMCSF recombinant

peptide 16-20 kDa was expressed in Pichia pastoris

GS115 cells and purified. The biological activity of

purified recombinant bGMCSF was evaluated on

bovine bone marrow cells. It showed the highest

proliferation of bone marrow cells at 2-4 ng/ml of

culture in dose dependent manner.

3. RESEARCH ACHIEVEMENTS

1 6

(vi) Application of revere genetics: A novelapproach for studying the molecular basis of immune

response in Indian cattle breed: A chimeric virus with

structural protein genes of type 'O' and back bone of

Asia 1 was produced and studied as vaccine

candidate for eliciting specific immune response in

guinea pigs as well as in cattle. As per the survey a

few indigenous cattle breeds of Karnataka were

selected and vaccinated with the Chimeric 'O' vaccine

and the humoral and cell mediated immune responses

were studied. Of the four breeds selected, viz.,

Hallikar, Malnadugidda, Deoni and Amrutmahal,

Malnadugidda showed high antibody and gamma

interferon responses even after 6 months post

vaccination. A positive marker vaccine was

developed though the incorporation of 9 amino acids

of GFP in the structural protein gene of Asia 1.

(b) Enzootic bovine haematuria/Bovinepapillomatoses

A preliminary vaccine trial was conducted in

hill cows to evaluate the therapeutic potential of

binary ethylenimine (BEI) inactivated and saponized

bovine papillomavirus-2 (BPV-2) for enzootic bovine

haematuria (EBH). Although the vaccine failed to

show favourable clinical results in treatment of EBH

affected cows at 120 days post vaccination,

immunopathological responses were encouraging. A

significant difference was observed in humoral

(against Brucella abortus strain 19S) and cell-

mediated (in vivo phytohaemagglutination delayed

type hypersensitivity (PHA DTH) test and CD4+/

CD8+ T-cells ratio by FACS analysis) immune

responses following vaccination (Fig.2). The

vaccinated animals grossly failed to show regression

of bladder tumours but microscopically engorgement

and marked perivascular infiltration of mononuclear

cells was observed, which are indicative of the

induction of initial stages of tumor regression. Overall

results indicated that the therapeutic vaccine

developed can have potentials for treating EBH in

cows, for which further modifications in vaccine dose

and field trial is required.

Fig. 2: Analysis of CD4+/CD8+cells by FACS

Bar diagram showing CD4+/CD8+ by FACS in cows of

Control, EBH and EBHV groups.

(c) Pox vaccine

i. Long term immunitiy trial of sheep pox vaccine:The live attenuated sheep pox vaccine was found

protective after 1 year of vaccination in sheep. The

immunity of the vaccinated sheep after 2 years of

vaccination was assessed by challenge study using

virulent sheep pox virus. At 2 years post vaccination,

a total of 4 vaccinated and 2 control animals were

used for challenge with virulent strain (106.0 TCID50

/ml, SPPV Srinagar at passage level 6). All the

vaccinated animals were protected on challenge,

whereas, all unvaccinated controls developed

infections (Fig.3). The same has been reflected in

sero-monitoring of collected sera by using SNT. The

developed live attenuated sheeppox vaccine was

found potent even at 2 years of immunization of

sheep pox vaccine.

A B C

Fig. 3: No signs of infection in vaccinated animals (A)

and typical clinical lesion at the site of inoculation of

challenge virus in control animals (B and C) at 10 days

post challenge.

(ii) Intrinsic thermo-stability of live attenuated orfvaccine: The live attenuated orf vaccine wasevaluated for its safety, efficacy and potency by

laboratory trials and found to be satisfactory. The

intrinsic thermo-stability of developed orf vaccine was

evaluated at two different temperatures, 37ºC and

42ºC, without adding any stabilizer to the vaccine

during freeze-drying process. Sufficient number of

vaccines without any stabilizer was lyophilized and

initial titer of the vaccine was identified by end point

dilution method in cell culture and found to have 100

doses of vaccine virus. After exposure of the vaccine

at 37ºC and 42ºC for 10 days, the stability of vaccine

was checked in cell culture based end point dilution

method. It is found that the vaccine was stable for

12 and 5 days when exposed at 37ºC and 42ºC,

respectively.

(iii) Field trial of sheep pox, orf and combinedvaccine (goatpox and PPR): A total of 500 doseseach of sheep pox and Orf vaccines were tested in

sheep and goats as field trials in villages namely

Ayyampalayam, Sithankuttai and Uyilampalayam in

Erode district of the state Tamil Nadu during April-

May, 2011. Similarly, a total of 200 doses of

combined vaccine containing PPR and goat pox

vaccine strains were evaluated for safety in goats in

villages namely Sithankuttai and Uyilampalayam and

vaccines were found safe and not caused any

untoward reactions in vaccinated goats.

1 7

(d) Rabies

(i) Evaluation of anti-rabies effect of smallinterfering RNA (siRNA) delivered through viralvector: Two small interfering RNAs (siRNAs)targeting rabies virus (RABV) nucleoprotein (N) and

polymerase (L) genes were designed and evaluated

in vitro in BHK-21 cells and in vivo in mice. When

BHK-21 cells were treated with replication-defective

adenoviruses or lentiviruses expressing siRNAs and

challenged with RABV, there was significant reduction

in RABV gene transcripts analysed using quantitative

real-time PCR (Fig.4A and 5A). When mice were

treated intracerebrally with adenoviruses or

lentiviruses expressing siRNAs and challenged

peripherally with virulent RABV by the intramuscular

route in masseter muscle, there was significant

protection (62-65%) with adenoviruses and

lentiviruses expressing siRNAs against RABV-N

(Fig.4B and 5B). This supported the hypothesis that

RNAi, based on siRNA targeting RABV-N gene can

prevent RABV infection and holds the potential of

RNAi as an approach to prevent infection.

A

B

Fig.4: Effect of different adenoviruses expressing

siRNAs on inhibition of RABV multiplication in vitro in

BHK-21 cells (A) and in vivo in mice (B).

A. Reduction in RABV titers in BHK-21 cells treated with

different adenoviruses expressing siRNAs and then

infected with RABV-PV-11 strain.

B. Protection of mice treated intracerebrally with different

adenoviruses and challenged by intramuscular route in

masseter muscle with 20 LD50 of lethal RABV-CVS-11

strain.

A

B

Fig.5: Effect of different lentiviruses expressing siRNAs

on inhibition of RABV multiplication in vitro in BHK-21

cells (A) and in vivo in mice (B).

A. Reduction in RABV titers in BHK-21 cells expressing

siRNAs and then infected with RABV-PV-11 strain.

B. Protection of mice treated intracerebrally with different

lentiviruses and challenged by intramuscular route in

masseter muscle with 20 LD50 of lethal RABV-CVS-11

strain.

(e) Newcastle disease

Bulk propagation of ND virus (Indian isolate)

was made in the 10-day old embryonated chicken

eggs. After the end of 6th passage level, the virus

infected allantoic fluid showed the HA titre of 211.

The virus was inactivated with BPL, precipitated with

PEG, dialyzed and freeze dried.

(i) Preparation and characterization of PLG

nanoparticles: The nanoparticles made up ofpolylactide-co-glycolide (PLG) were prepared by

double emulsion solvent evaporation technique.

Characterization of nanoparticles by particle sizeanalyzer (zeta-sizer) revealed the mean diameter of

PLG nanoparticles as 201 nm with negative charge/

zeta potential of -6.0 mV. The scanning electron

microscopy (SEM) revealed a heterogenous

population of spherical shaped nanoparticles.

(ii) Preparation and characterization of chitosannanoparticles: Chitosan nanoparticles were prepared

1 8

by the method of ionotropic gelation of chitosan (CS)

with sodium tripolyphosphate (TPP) anions. Chitosan

nanoparticles exhibited mean size of 189 nm with a

positive charge of 47.3 mV as determined by Malvern

particle size analyzer.

(f) Infectious bursal disease:

The vvIBDV strain SD 1/10 was originally

isolated from a poultry farming Namakkal, Tamil Nadu

was utilized as the candidate viral isolate for cloning

and expression of VP2 gene. The full length VP2

gene was cloned and expressed in yeast

(Saccharomyces cerevisiae) expression system.

Expression of IBDV-VP2 (rVP2) in yeast resulted in

the formation of sub-viral particles (SVPs) with a

diameter of approximately 20 nm. The rVP2 SVPs

were further produced in bulk and purified. The

concentration of the recombinant VP2 protein was

found to be 14 mg/ml. The reactivity of the

recombinant protein was determined by Western blot

using polyclonal anti IBD sera. Electron microscopy

detected an approximately 20 nm particles that

contained only VP2 and the wild type yeast culture

under electron microscopy showed an approximately

40 nm sized particles. The recombinant VP2 SVPs

has been utilized to immunize the specific pathogen

free chickens following dose standardization and

safety test. It was found that 100 µg of rVP2 protein

was enough to induce cell mediated and humoral

immune response. There was no abnormal local or

systemic reaction observed in the immunized

chicken. This recombinant VP2 protein developed

as a vaccine candidate was safe for the birds.

(g) Chicken infectious anemia virus (CIA)

For the development of CIAV-DNA vaccine,

VP1 and VP2 genes of CIAV were cloned in

bicistronic pIRES eukaryotic expression vector.

Recombinant clones were characterized by colony

PCR, RE and sequencing. The in vitro expression

was studied, pIRES-VP1 -VP2 were expressed in

vero cells, which was demonstrated by employing

RT-PCR and immunoperoxidase test. Experimental

evaluation of the induction of immune response by

CIAV-DNA vaccine in 2 week old specific pathogen

free (SPF) chicks indicated protective humoral

immune response with ELISA antibody titres of 4784

to 4936 with primary DNA vaccination and 6183 to

6048 with booster DNA vaccination (booster

vaccination given at 2 weeks interval). IFN-γ and IL-4 titer values assessed also indicated an effective

cell-mediated immune response in booster DNA

vaccinated group. In another effort, for the

improvement in DNA vaccine, CIAV VP1 and VP2

genes cloned separately in pTARGET vector were

used as a DNA vaccine after incorporating novel

adjuvants (r-IL-2 and HMGB1). Recombinant chicken

high mobility group box protein one (HMGB1) was

amplified, sequenced and expressed in prokaryotic

system. Chicken interleukin-2 (IL-2) was cloned in

eukaryotic expression system. CIAV VP1 and VP2

genes cloned in pTARGET vector were bulk purifiedfor use as DNA vaccine.

(2) BACTERIAL VACCINES

(a) Haemorrhagic septicaemia

In an attempt to develop a live attenuatedvaccine strain for the protection against haemorrhagicsepticaemia, Pasteurella multocida P52 has beenused for targeted mutagenesis. The developed mutantwas highly attenuated. Mice inoculated with 1 X107

cells of P. multocida mutant strain, ∆aro-P52IVRI,by i/p route, survived. Rabbits immunized with liveP. multocida P52 aroA mutant strain showed highlevel of protection against virulent challenge. Cattlecalves were immunized with mutant strain of P.multocida P52. There was rise in rectal temperatureby about 2oC which subsided in 12 h.

(b) Combined vaccine against M. mycoidessubsp. capri and P. multocida serotype A: 1

A combined vaccine using M. mycoidessubsp. capri and P. multocida serotype A: 1 antigens,an seppic adjuvant was prepared. After sterility andsafety test the vaccine was inoculated in 40experimental goats @ 1 ml; subcutaneously at neckregion. The control group of goats were inoculatedwith seppic adjuvant alone. The individual animalswere periodically bled at fortnightly interval up to 4months; followed by monthly bleeding up to 10 monthperiod. Indirect ELISA and IHA were performed forthe pooled serum samples collected. The mean O.D.value in ELISA for M. mycoides subsp. capriantibodies in vaccinated goats was observed as 1.64on day 15th PI. It reached its peak of 1.85 at 3 and3.5 months PI. The mean O.D. value of 1.67 wasobserved at 10 month PI (Fig.6). The mean O.D. valuefor P. multocida A:1 antibodies in vaccinated goatswas observed as 1.13 on day 15th PI. It reached itspeak of 1.72 at 4 month PI. The mean O.D. value of1.43 was observed at 10 month PI (Fig.7).

Highest antibody titre (160) for M. mycoidessubsp. capri was found highest at 2.5 months, whichcame down at 40 by 5th month. At 10 m PI, the titrerecorded was 80. For P. multocida A:1; the titrereached up to 40 by 3.5 month PI. It reduced to 20

at 8th month PI and exhibited same up to 10 months

PI.

The potency testing of vaccine was conducted

by direct challenge test performed at 9 month PI, onvaccinated and control goats. The challenge culture

dose by intra-tracheal route was 1 ml 1012 cfu, for M.

mycoides subsp. capri and 8 ml of 5 x108 cfu for P.

multocida A:1 was performed. The challenged animals

were observed for a period of 7 days. The vaccinated

animals exhibited 62.5% protection for M. mycoidessubsp. capri challenge and 75% protection for P.

multocida A:1 challenge.

1 9

Fig.6: ELISA antibody titre for M. mycoides subsp capri

in goats vaccinated with combined vaccine

anatolicum

Fig.7. ELISA antibody titre for P. multocida A:1 in goats

vaccinated with combined vaccine

(c) Black leg

In an attempt to identify the potential vaccine

candidate antigens, Clostridium chauvoie was

characterized by PCR using the primers specific to

16-23s rRNA spacer gene that yielded a specific

product with size of 522 bp and flagellin gene which

yielded specific product of 535 bp (Fig.8).

Fig. 8: Characterization of Clostridium chauvoei by PCR.

A. 16-23s rRNA spacer gene specific 522 bp product. B.

Flagellin gene specific 535 bp product. M. 1 Kb DNA

ladder.

(3) PARASITIC VACCINES

(a) Anti tick vaccine

The efficacy of the BM-86 vaccine was

evaluated against Rhipicephalus (Boophilus)

microplus and Hyalomma anatolicum anatolicum.

Twenty cross bred calves of 3 month age were

randomly divided into four equal groups and animals

of groups 1 and 2 were immunized with 2 ml of rBm86

(100 µg) vaccine thrice at 30 days interval. Animals

of groups 3 and 4 were kept as negative control and

inoculated with PBS only. Each animal of group 1

and 3 was challenged with 7 day old 50 unfed adults

of H. a. anatolicum (1:1, male and female) and each

animal of groups 2 and 4 was challenged with 6-8

day old R. (B.) microplus larvae obtained from 50 mg

of eggs, on 17th day of last immunization. The efficacy

of rBm86 against tick infestation was determined as

percentage reduction in number of adults dropped

(DT%), engorged body weight (DR%), egg masses

(DO%) and immunogen efficacy (E%) (Fig.9). The

results indicated partial effectiveness of Bm86

antigen in imparting protection against homologous

and heterologous challenge infestations of Indian

ticks.

6.4

11.24

40.7

44.5

11.8 10.8

15

25.1

DT% DR% DO% E%

R. (B.) microplus H. a. anatolicum

Fig.9: Comparative efficacy of Bm86 based vaccine

a g a i n s t c h a l l e n g e i n f e s t a t i o n o f R. (B.) microplus and H.

a. anatolicum

(4) IMPROVEMENT OF VACCINES DELIVERY

AND ADJUVANT

(a) Modified LPS as an adjuvant

The study was designed to explore the

adjuvant potential of bacterial endotoxin after reducing

its toxic effect. LPS was extracted from Pasteurella

multocida strain 52, purified, characterized and

modified after treatment with alkaline phosphatase

to reduce its toxicity. The modified LPS were used

for in-vitro and in-vivo studies. It was found that

modified LPS were lower inducer of nitiric oxide

production from immune cells of mice as compared

to their native counterpart. Similarly enzyme treated

dephosphorylated LPS exhibited lower proliferative

response towards mouse splenocytes and ovine

PBMCs than native LPS. In repeated trial, it was

observed that modified LPS never exhibited toxic

2 0

effect at higher concentration on in vitro cell culture

system of mice and chicken origin, which is

considered as a most desired attribute of any adjuvant.

In vivo effect of modified LPS was studied as

an adjuvant for HELas soluble antigen. The group

received modified LPS with HEL elicited higher

antibody response against HEL as compared to

groups received HEL alone or in combination with

native LPS. Modified LPS did not influence IL-10

production which is antinflamatory cytokine that

protects the host from exaggerated effect of TNF,

where as TNFα secretion was found to be at lowerlevel in comparison to native LPS receiving groups.

In experimental protocol using variable dose of LPS,

none of the mice produced anti LPS antibody that is

more desirable. Histopathological changes in the liver

indicated normal architectural details in modified LPS

received group compared to native LPS received

group indicating reduced toxicity of modified LPS

which is in conformity with mice survivability test.

Collectively, the study indicates that the modification

process employed significantly attenuates the LPS

toxicity for its use as an adjuvant.

Foot and mouth disease

(b) Efficacy of different oil adjuvants for FMD

vaccine

Conventional inactivated whole virus vaccine

was prepared with different oil adjuvants viz.,

Montanide ISA 201, 206VG and Indigenous Oil

adjuvant. The three adjuvants were evaluated for

cytokine response, other correlates such as Th1/Th2

bias and protection against FMD challenge in cattle.

2. DEVELOPMENT AND IMPROVEMENT

OF DIAGNOSTICS

(1) VIRAL DISEASES

(a) Foot and mouth disease

Recombinant 3ABC antigen based indirect

ELISA (FMD-3ABC-iELISA) was developed for

detection of FMD non-structural protein antibodies in

sera. The assay which employs insect cell expressedantigen using baculovirus system is highly sensitive,

specific for FMD diagnosis with DIVA application.

The performance of the assay is comparable with

commercial kit (94.2% agreement). The test is highly

cost effective.

(b) Infectious bovine rhinotracheitis (IBR):

(i) LAMP PCR: Loop-mediated isothermalamplification (LAMP) test for the rapid detection of

IBR virus in bovine semen was developed. The testhad the sensitivity of 10 fg viral DNA or 0.2 TCID50/

0.4 infective virus particles per reaction. The whole

assay, including DNA isolation, isothermal

amplification and visualization of results can be

completed within 90 minutes and the results can be

visualized with naked eye by differentiating positive

and negative visual colour development.

(ii) Multiplex real time PCR: A highly sensitive SYBRGreen I dye based multiplex real-time PCR wasdeveloped for detection of IBR virus in bovine semen.

The assay employed two sets of primers, combined

in single tube multiplex format, targeting a highly

conserved region of the IBR virus and bovine growth

hormone gene (internal control) (Fig.10). The assay

had analytical sensitivity of 0.002 TCID50 of infectivevirus particle per reaction using extended bovine

semen spiked with IBR viral genome.

Fig.10: SYBR Green-based multiplex real-time PCR for

detection of IBR virus in bovine semen.

A. two peaks with positive sample (one IBR virus specific

and the other bGH specific internal control).

B. one peak with negative sample (bGH specific as

internal control).

(iii) Development of user friendly diagnostic kit:

Glycoprotein E (gE) was selected for development

of diagnostic ELISA. The B cell epitopic region of gE

was identified and amplified using PCR and cloned

in T/A cloning vector and recombinant plasmid

characterized. The gene fragment was subcloned into

a prokaryotic expression vector (pProEX HTc) and

transformed in E. coli DH5α strain for the expressionof recombinant protein.

Development and standardization of PCR for

the detection and differentiation of BHV 1 and BHV

5: PCR was standardized employing custom

synthesized primers to amplify gC gene of BHV 1

and BHV 5 in the clinical, morbid, semen and tissue

culture samples. In the positive cases 354 and 159

bp amplicons were visualized for BHV1 and BHV 5,

respectively, in agarose gel under UV translluminator.

(iv) Development of monoclonal antibodies

against IBR: For development of monoclonal

antibodies against Bovine Herpesvirus 1, fresh lot of

virus was produced in MDBK cell line, purified and

were used for mice immunization. For development

of ELISA, gB (partial), gC (complete) and gD (partial)

genes were sequenced and PCR standardized.

2 1

(c) Enzootic bovine haematuria/bovinepapillomatoses

Etiopathological characterization of upper

gastrointestinal tract (GIT) tumours of cattle andbuffaloes was undertaken. A total of 27 GIT wart-like

lesions in rumen, reticulum, mouth and oesophagus

of cattle and buffaloes revealed the presence of small

nodular growth to larger spherical or slender growths

with a thin base present on mucosa and ruminal pillar.

Ruminal warts of cattle and buffaloes revealed thepresence of BPV-5, -1 and -2, which is the first report

of presence of these BPVs in the ruminal warts from

India. Quantitative real time PCR revealed that DNA

samples of different GIT wart-like lesions contained

varying amount of BPV DNA copy numbers.

Immunohistochemistry revealed that the PCNA andKi67 immunopositivity was present in the basal and

spinosum layers of the fibropapilloma/papilloma

indicating these as the cellular proliferation sites. In

conclusion, that BPV-5, -1 and -2 are associated with

GIT wart-like lesions/growths in cattle and buffaloes

and the basal and spinosum layers of the ruminalfibropapilloma/papilloma were cellular proliferation

sites (Fig.11).

Fig.11: A-B. Buffalo ruminal lesion/wart: Varying shape

and size, small nodular or slender, elevated growth on

the mucosa of rumen.

C. Buffalo ruminal wart: Acanthosis, elongated rete pegs

and hyperplastic dermal fibrous tissue along with marked

MNCs infiltration. Fibropapilloma.

D. Buffalo reticulum wart: Hyperkeratosis, parakeratosis

and acanthosis with hyperplastic fibrous connective

tissue Fibropapilloma.

E. Buffalo ruminal wart: Ki67 immunopositivity in the

keratinocytes of staratum spinosum and basal layer.

Fibropapilloma, Ki67 IHC×AEC.

F. Buffalo ruminal wart: PCNA immunopositivity in the

keratinocytes of staratum spinosum and basal layer.

Fibropapilloma, PCNA IHC×AEC.

Animal pox viruses

(i) Detection and quantification of camelpox virus

using TaqMan probe real time PCR assay:

A TaqMan hydrolysis probe based real time

PCR (rt-PCR) assay targeting the ankyrin repeat

protein (C18L) gene sequences was developed for

the detection and quantitation of camelpox virus

(CMLV) nucleic acid and compared with established

conventional and SYBR green rt-PCR assays. The

assay was specific with an efficiency of 99.4%. The

analytical sensitivity was 4×101 and 0.35 in terms of

copy number and picogram of virus genomic DNA,

respectively. The assay was linear (Fig.12) with an

acceptable intra (0.9-2.83% and 0.9-2.3%) and inter-

assay (0.46-2.3% and 0.9-3.3%) variations, when

standard plasmid DNA and genomic DNA from

purified CMLV, respectively were tested. The assay

was rapid, specific and sensitive as that of SYBR

green and 1000 times more sensitive than the

conventional PCR. It is suitable for the detection of

CMLV nucleic acid directly from clinical samples.

The virus titre in terms of copy number for clinical

samples screened by this QPCR technique ranges

from 2.21x106 to 3.82x107 copies µl of extracted viral

genomic DNA. This is an improved technique over

the conventional and SYBR green rt-PCR methods

for the detection and quantitation of CMLV from skin

scabs.

Fig.12: C18L gene based TaqMan real time PCR for

camelpox. Linear regression curve of the rt-PCR assay

based on 10-fold serial dilutions of standard plasmid

DNA over 109 dilution range. The square of correlation

coefficient (R2) and the slope value (b) is also shown.

(e) Peste des petits ruminants virus (PPR)

(i) LAMP assay: LAMP assay for rapid detection ofPPR virus from clinical samples was standardized.

The assay is based on conserved region of 'N'gene

of PPR viruses with their specific amplification.

Hydroxy naphthaol blue (HNB) dye was used for a

colorimetric assay of the LAMP reaction, which inpositive reaction, turned sky blue. The primer of LAMP

was specific for PPR and not cross reactive with

rinderpest.

(f) Bluetongue

A sandwich ELISA (s-ELISA) was developed

for detection of BTV antigen in blood, tissue materials

2 2

and culture fluid. The assay was applied to test 2000

samples from sheep, goat, cattle, buffaloes and cell

culture supernatant.

(g) Classical swine fever

A total of 21 suspected CSF outbreaks in the

State of Uttar Pradesh were investigated,

epidemiological data and appropriate samples (136

tissues and 139 serum) were collected. Outbreaks

were recorded in small holdings (30-40 animals). The

mortality rate varied from 25 to 75% and the case

fatality rate was highest in young weaners. Alternate

primers were used to generate the complete E2 gene

sequence and based on the obtained sequence data,

the established primers were modified to increase

the sensitivity of the RT-PCR assay. From CSFV

confirmed cases, 5UTR, Erns, E2, NS5B and 3UTR

genes were amplified from samples collected from

16 different outbreaks and 20 clones were

sequenced. The E2 protein of recent CSFV isolates

of India (genotype 2.2) were analyzed along with 6

Chinese isolates (genotype 2 viruses) to assess

amino acid substitutions. The B-cell epitopes

including those that induce neutralizing antibodies,

T-cell epitopes and potential glycosilation sites that

may affect the conformation of the protein revealed

significant amino acid substitutions, which may

compromise the efficacy of the lapinized vaccine

strain used in India.

A total of 50 samples, including two positive

and 2 negative controls were tested with conventional

RT-PCR based on Pan-Pestivirus primers (V324 and

V326) and CSFV primers (UP-1 and UP-2). The 46

samples tested consisted of specimens from lymph

nodes showing CSF suspected lesions. The 5UTR-

L1R1 assay resulted in 43 CSFV positive samples,

5 negative and 2 doubtful reactions, whereas the

NS5B rtRT-PCR assay resulted in 25 positive, 21

negative and 4 doubtful reactions. Comparison of the

results obtained by the two in house developed rtRT-

PCRs revealed that 17 samples found negative by

NS5B rt-RT-PCR assay were positive in the 5'UTR-

L1R1 assay. Among the two in house developed rt-

RT-PCR assays, the 5'UTR-L1R1 assay was found

more sensitive than the NS5B rt-RT-PCR assay. A

real-time PCR assay using a probe specific for the

lapinized vaccine strain used in India was also

designed.

As an alternative to FAT, Fluorescent In Situ

Hybridization (FISH) assay was developed by

designing two oligoprobes specific for CSFV E2 and

CSFV NS5B genes. A total of 16 samples were tested

with FISH and 12 were found positive with both

probes. The results of FISH assay corroborated with

those obtained by RT-PCR (Fig.13). Further

confirmation of positive signals owing to probe

hybridization with CSFV genome was done by

confocal microscopy (Fig.14).

Fig.13: 63/A/11, DNANS5B, Ileum, 400X: Mononuclear

cells showing fluorescent signals in the intercryptic area.

Alexa -568 and DAPI broad band filter overlay.

Fig. 14: Confocal microscopy: NKP-4/11, DNAE2, Lymph

node, 1000X (2OPZ): (A) Cells stained for Cytoskeleton

with FITC labelled anti β-actin mouse MAbs showing

green fluorescence. (B) FISH with Alexa-568 to

demonstrate virus in the cytoplasm of mononuclear cells,

red fluorescence. (C) 2D image FITC, Alexa-568 and

DIC image. (D) 2D image FITC, Alexa-568. (Courtesy;

AIRF, Confocal Microscopy Unit, JNU, New Delhi).

(h) Canine parvovirus infection

(i) Development and standardization of PCR:Amplification of part of VP 2 gene of both CPV 2a

and CPV 2b variants (3025 -3706 nucleotide position

of CPV genomic DNA) was carried out to yield a

product size of 681 bp using pCPV 2ab primers.

The PCR positive samples were further analysed

using pCPV 2b primers for specific amplification of

VP2 gene unique to CPV-2b variants only (4043 to

4470 nucleotide position of CPV genomic DNA) to

yield a product size of 427 bp and rest of the samples

were considered as CPV 2a and thereby

differentiating CPV 2a and CPV 2b variants (Fig.15).

Another set of primer pCPV RT was used to yield an

2 3

amplicon of 160 bp (3176-3295 nucleotide position

of CPV genomic DNA) of all the variants of CPV-2

(2a/2b/2c). This set of primer can also be used in

SYBR Green based Real Time PCR technology for

sensitive, specific and accurate diagnosis of CPV-

2 variants and its quantitation.

Fig. 15: PCR amplifying 427 bp amplicons of CPV-2b

(ii) Development and standardization of nested

PCR : Nested PCR was developed and standardized

employing the in house designed and custom

synthesized primers (pCPV 2 N) after the first round

of PCR (681 bp) to yield an amplicon of 442 bp. It

can be used to detect all the variants of CPV-2 and

to further substantiate the result of PCR. It was found

100 times more sensitive than conventional PCR.

(iii) Development and standardization of PCR for

amplification of whole genomic DNA: PCR was

also developed and standardized employing the in

house designed and custom synthesized primers

to amplify entire VP1/VP2 gene (2.2 kbp) coding for

the structural proteins of CPV-2. The eluted PCR

product was cloned into a TOPO TA vector. The 2.2

kbp products were further characterized by digesting

the inserts with Pst I, Bgl II, Bam HI, Sal I,

respectively, to obtain the desirable product sizes.

(iv) Molecular characterization of CPV-2 isolates:

PCR was developed and standardized to amplify

the C terminal of VP2 gene of CPV-2 to obtain a

DNA product of 765 bp. The product was cloned and

nucleotide sequences and deduced amino acid

sequences were analysed. The amino acid residue

at position 426 of the VP2 protein of all the isolates

were carefully analysed, which formed the basis of

classification of the CPV-2 into 3 antigenic types-

CPV-2a, CPV-2b or CPV-2c. Out of 7, 4 isolates were

designated as CPV-2b types and 3 isolates were

designated as CPV-2a types. Three isolates PALAM-

5, PALAM-8 and PALAM-10 were found to match

with isolates from USA, Brazil and New CPV-2a isolate

from USA, respectively. Feline Panleucopenia virus

(FPV/USA/M38246) formed a separate clade distinct

from the CPV isolates.

(i) Canine distemper: PCR was standardized

employing in house designed and custom

synthesized primers for specific and sensitive

amplification of N gene coding for the nucleocapsid

protein of canine distemper virus. In positive cases

an amplicon of 184 bp was revealed. The same primer

can also be used in SYBR green based real time

PCR with a high degree of sensitivity and specificity

and added advantage of quantification of copy

number.

(j) Canine adenovirus: Multiplex PCR for the

detection and differentiation of CAV 1 and CAV 2.

Multiplex PCR using custom synthesized primers

standardized to amplify the genomic DNA of CAV-1

and CAV-2 in order to diagnose and differentiate

pathogens causing ICH and ICTB in the clinical

samples and vaccines. A total of 19 clinical samples

and 7 commercially available vaccines were tested,

of which 3 and 9 samples were found positive for

CAV-1 and CAV-2, whereas 4 vaccines were found

positive only for CAV-2 (Fig.16).

Fig.16: Amplification of 1030 bp DNA product of E 3

gene of CAV 2 and 508 bp DNA product of CAV 1

(k) Avian reovirus

To develop a diagnostic kit for ARV infection,

sigma C gene was used. The gene was amplified by

PCR and cloned in pTZ57R T/A cloning vector.

(l) Newcastle disease

To develop a diagnostic kit to detect and

differentiate NDV vaccine strain from the virulent

strain, the work on development of monoclonal

antibodies (Mabs) against the virulent strain of NDV

was initiated. Hybrid clones were generated using

spleenocytes from mice immunized with either E.

coli expressed recombinant protein/whole NDV

virulent strain UP1/97/peptide.

2 4

(m) Egg drop syndrome 76

One immunogenic gene (1.3 kb) of EDS76 was

successfully expressed in prokaryotic expression

system and confirmed by SDS-PAGE and Western

blot analysis. The expressed protein has been purified

in bulk concentration estimated (140 µg/ml).

(n) Infectious bronchitis

The circulation of different genotypes of avian

IBV viz. Massachusetts (M41) and 4/91(793B) UK

type in the poultry flocks of India was found and all

the field isolates were found virulent for young chicks

in their pathogenicity study. Real Time PCR was used

for early detection and quantitation of IB virus in

infected materials. The technique was able to detect

IBV nucleic acids in tracheal and lung tissues from

24 hrs post infection up to 30 dpi. The presence of

IBV was detected in kidneys at 3 dpi and caecal

tonsils from 7 dpi.

(2) BACTERIAL PATHOGENS

(a) Haemarrhagic septicaemia

(i) Analysis of outer membrane protein profilesof P. multocida isolates: A comparative OMPs/IROMPs profile revealed the presence of protein

bands in the range of ~18 kDa to ~130 kDa (Fig.17).

OmpH and OmpA proteins were observed between

34 kDa and 42 kDa. Omp16 (16 kDa) was commonly

observed among all the isolates. Higher order

molecular weight proteins (~72-130 kDa) were

observed more prominently in IROMPs grown under

iron deplete conditions. Iron regulated proteins such

as transferring binding protein (TbpA ~103 kDa),

haemin binding protein (HemR ~102 kDa) and

haemoglobin binding protein (HgbA ~126 kDa) were

noticed prominently in most of the isolates. The

results also indicated the variable protein pattern

among animal and avian isolates, which reflected

variation in their pathogenesis of various disease

manifestations. Currently, further identification and

characterization of individual OMPs and genes

encoding them are underway.

Fig.17. A comparative outer membrane protein profile

of different avian isolates of P. multocida following growth

in iron deplete and replete in vitro conditions

(ii) Cloning, expression and purification of fimbrial

subunit and transferrin binding proteins: Based

on the bioinformatics analysis of available complete

genome sequence of P. multocida strain Pm70,

putative genes encoding of different outer membrane

proteins (OMPs) were identified. The specific primers

targeting the candidate genes (ptfA and tbpA) were

designed and respective fragments were amplified

by PCR (Fig.18 Panel A). Following confirmation of

gene insertion in pET32a vector, transformation was

done in to E. coli expression host (BL21-DE3 codon

cells).

Fig.18. ptfA gene amplification (panel A); expression of

recombinant fimbrial protein (panel B); Immunoblot of

purified recombinant fimbrial subunit protein (panel C).

The purified proteins were analysed qualitatively and

quantitatively; and confirmed by Westernblotting using

hyperimmune sera raised against P. multocida

serogroup B:2 (Fig.18. panel C).

(iii) A homology model of fimbrial subunit protein

of P. multocida serogroup B:2: A homology model

for fimbrial subunit protein of P. multocida serogroup

B:2 (strain p52), an Indian HS vaccine strain has

been predicted using SWISS-MODEL (Fig.19) and

its characteristics were analysed in comparison to

fimbrial proteins of other bacteria.

Fig.19: A homology model of fimbrial subunit protein

of P. multocida serogroup B:2 (strain p52).

The model and secondary structure predictions

revealed the presence of N-terminus long stretch of

hydrophobic α-helix region (α1) followed by four β-

strand regions (β1, β2, β3 and β4) at carboxyl

terminus. The three-dimensional model revealed N-

terminal α-helix wrapped by anti-parallel β-strands in

2 5

a characteristic topology of β1β2β3β4, indicating its

belonging to the type IVa subclass of fimbriae. The

disulfide bond between second pair of cysteine

residues (131 and143 aa) links the last strand β- sheet

to a peripheral C-terminal region to form a receptor

binding loop. The predicted homology model of

fimbriae from P. multocida serogroup B2 (strain p52)

support the conserved architecture of type IV pilins.

(b) Salmonellosis

A loop mediated isothermal amplification

(LAMP) test was standardized for specific detection

of Salmonella enterica subsp. enterica serovar

Typhimurium. A set of LAMP primers were designed.

The LAMP test was optimized by testing at different

time and temperature ranging from 20 to 70 min and

60 ºC to 70ºC. The LAMP performed at different DNA

concentrations (100 ng/µl to 1 fg/µl) revealed that

the test detected 1 pg/µl of target DNA. LAMP test

was found 10 times more sensitive than PCR. The

test was found to specific on testing with 8 different

isolates of non-Salmonella and 20 serovars of non-

Typhimurium Salmonella. Moreover, 35 isolates of

Salmonella Typhimurium collected from different

sources gave positive reaction indicating test to be

specific for the detection of Salmonella serovar.

(c) Johne's disease

For development of more sensitive and specific

ELISA basd test for detection of antibodies from

paratuberculosis infected animals, epitopic regions

from M. a. paratuberculosis (Map) coding sequences

were selected and expressed in E. coli as single as

well as multiantigenic polyproteins. Chekerboard

titration of proteins in indirect ELISA revealed that

40 ng of the recombinant polyproteins detectewd the

antibody consistently. Further the indirect ELISA was

standardized using recombinant single, polyproteins

as well as MAP culture filtrate (CF) as coating

antigens. The result indicated using sera from Map

infected cattles that multiantigenic proteins were

sensitive than the single protein.

Sera from 42 Johnin PPD positive cattle were

screened with ELISA, 18 were found positive for the

presence of Map specific antibodies using

recombinant polyproteins. However, only 8 were found

positive with the single protein. Sera samples from

175 goats were collected from slaughter houses and

32 samples were found positive for paratuberculosis

using polyproteins.

(d) Listeriosis

The study was carried out to develop and

evaluate internalin C (InlC)-based serological assay,

for diagnosis of Listeria monocytogenes (LM) infection

in goats. Nine peptides representing major antigenic

domains of InlC, a novel protein thought to be linked

to the virulence of LM, were identified, analyzed,

synthesized and employed in indirect ELISA in order

to evaluate their diagnostic potential by testing

against goat sera from experimental animals

inoculated with live and killed strain of LM as well as

the apparently healthy goats. The standardized ELISA

revealed titers of antibodies against InlC (AInlC) as

well as listeriolysin O (ALLO), even after adsorption

of sera with streptolysin O (SLO). In general, the

overall AInlC titres were found to be lower than ALLO

titres. A fair correlation was observed between the

titres of AInlC and ALLO in experimentally infected

as well as apparently healthy goats.

(e) Leptospirosis

The recombinant M15 cells of E coli containing

the N terminal conserved region of LigA and Lig B

gene in pQE expression vector were confirmed by

colony PCR and RE digestion of the pQE vector using

SacI and HindIII enzymes. On SDS-PAGE analysis,

LigB protein appeared as a thick band at the expected

size of 46 KDa.

The protein was purified (Fig.20) and rLigB

protein was tagged with sensitised latex beads. Latex

agglutination test was standardized for diagnosis of

leptospirosis.

Fig.20: SDS PAGE of LigB protein

Dot Blot and Western blot analysis using known

positive and negative bovine and canine sera samples

confirmed that rLigB protein is an immunodominant

protein against which antibodies are produced in host

during active infection and anti LigB antibodies are

present in sera of infected animals in sufficient

quantity.

2 6

(3) PARASITIC DISEASES

(a) Haemonchosis

Dot ELISA kit developed for diagnosis of H.

contortus infection was tested with experimental and

naturally infected sera. Out of 250 sera samples of

naturally infected sheep and goats, 175 sera samples

were found positive for H. contortus infection. The

kit was also validated by the collaborating centres

viz. Pantnagar, Chennai, Gangtok, Kolkata with high

sensitivity and specificity.

(b) Toxocariosis

Somatic soluble antigen of adult T. canis (Tc

SA) and excretory-secretory antigens of T. canis (Tc

ES) were separated and fractionated in reducing

condition using sodium dodecyl sulphate

electrophoresis. Tc SA antigen revealed 14

polypeptide bands of molecular moieties ranging from

44 to 300 kDa, while Tc ES antigen revealed 9

prominent bands ranging from 30 to 384 kDa.

The specific immuno-reactivity of the T. canis

somatic and excretory-secretory antigens with

naturally infected dog sera as well as hyperimmune

sera raised in rabbits was tested by Western blotting.

The immuno-dominant polypeptides of TcSA reactive

to T.canis infected dog serum were observed at

approximately 26 to 198 kDa regions, showing 12

prominent immuno-reactive bands of distinct sizes

at 23.8, 28.61, 32.60, 38.10, 43.04, 49.99, 73.22,

101.77, 144.74, 161.11, 177.84 and 196.31 kDa, while

those of TcES showed 5 bands of 43, 57,105,139,175

kDa.

The immuno-dominant polypeptides reactive

to anti-sera raised in rabbits against TcSA were

observed at approximately 11 to 250 kDa regions,

showing 8 prominent bands of distinct sizes at 34.83,

43.46, 52.47, 55.89, 61.80, 70, 74.60 and 107.06 kDa,

while those for TcES showed 10 bands of 21, 25, 30,

37, 45, 50, 57, 69. 77, 105 kDa.

(c) Oesophagostomum and Bunostomum

infection

Gene encoding a 31 kDa protein was identified

using primers (F-5'-ATGTCTCGTTTACTCAACGTG-

3',R-5'-TGAGGTGCTGAGAAGATAGTC -3') and

about 90% of the whole protein coding sequence of

the gene (720 bp) was successfully amplified from

cDNA of Oesophagostomum spp. parasite (O.

dentatum and O aspersum) of sheep and goat origin.

Analysis of sequences revealed that 8.33%,

7.77% and 6.94% variability was found between O.

dentatum/ O. columbianum, O. dentatum/O.

aspersum and O. columbianum/O. aspersum,

respectively. Transition and transversion ratio

between Oesophagostomum parasite of pig (O.

dentatum) and sheep and goat (O. coulmbianum and

O. aspersumi) was found to be 4.26. Phylogenetic

analysis revealed that oesophagostomum parasite

of sheep and goat was distinctly related with the

same parasite of pig origin.

(d) Toxoplasmosis

(i) Evaluation of serodiagnostic potential of

recombinant surface antigen 1 (SAG1) based

ELISA : A total number of 447 serum samples were

collected from sheep from Ranchi and Chatra districts

of Jharkhand for studies on seroprevalence of

toxoplasmosis using a laboratory standardized

recombinant SAG1 protein based ELISA. The sheep

sera samples collected from Chatra (n= 187) included

two breeds Muzaffarnagari (78 samples) and

Shahabadi (109 samples). A total of 148 samples

were collected from RVC farm, Ranchi maintaining

Chhotanagpuri breed and 112 samples from village

conditions from the same breed of sheep. The

performance of rSAG1 ELISA was compared with

that of native tachyzoite lysate antigen based ELISA.

Out of 447 samples 42.34% were positive by rSAG1

antigen based ELISA and 29.5% were positive with

native tachyzoites lysate antigen ELISA. A positive

correlation in the prevalence of toxoplasmosis was

established with the age of the sheep studied as

infection was higher in sheep aged more than 24

months.

Further, a total number of 411 goat sera

samples were collected from the Kumaon region. The

rSAG1 based ELISA could detect Toxoplasma

specific IgGs in 17.27% of sera samples.

(4) BIOSENSORS FOR PATHOGENS AND

DRUG RESIDUES

(a) Characterization and application of gold

nanoparticles for detection

Gold nanoparticles were synthesized from

aqueous auric chloride (HAuCl4) in presence of citrate

reducing agent under controlled conditions.

The synthesized gold NPs were characterized

for size by TEM, zeta potential and particle sizing by

Dynamic light scattering. Particles of size 17-20 nm

were observed on TEM and potential of particles were

found in the range of 35- 40 mv, which is suitable for

its stability and in-vivo applications.

(b) Lateral flow strip development for

ciprofloxacin

2 7

Ciprofloxacin-BSA protein conjugate and

ciprofloxacin-KLH conjugate were prepared to put a

test line of heptane's molecule for detection of

ciprofloxacin, a small molecule under inhibition assay

format. Conjugate of Ciprofloxacin with protein BSA

and KLH were done using EDC-NHS crosslinking

chemistries under optimum condition and optimized

for good yield of conjugates. Goat antimouse IgG

was used as control line of nitrocellulose membrane

strip. After formation of conjugate, it is preserved in

solution made of BSA, PEG, NAN3, NaCl and Tris-

HCl. The ciprofloxacin was detected on lateral flow

strip under competitive inhibition assay format.

Appearance of single line was confirmation of

presence of ciprofloxacin in sample. Detection limit

as low as 10 ng/ml was found.

(c) Characterization of magnetic nanoparticles

(MNPs) and its applications

The MNPs were conjugated to FITC through

strong covalent carboxydiimide chemistry taking into

account their in-vivo biomedical applications as

delivery vehicles and carrier of therapeutic agent.

(d) Development of surface plasmon resonance

biosensor surfaces for PPR monoclonal

antibodies

PPR 4G6 monoclonal antibody was covalently

coupled to 6-Ethylene glycol carboxy hexadecane

thiol self assembled monolayer through amine

coupling procedure over surface plasmon sensor

system. Chip showed a strong immobilization of 4G6

with 1000 RU, which is considered sufficient for

development of assay as shown in Fig.21.

Subsequently, this surface was checked for

sensitivity against 4H4 PPR monoclonal. This surface

is suitable to detect PPR antigen directly.

Fig.21: SPR sensorgram showing the amine coupling

procedure for immobilization of 4G6 PPR antibody over

6-Ethylene glycol carboxy hexadecane thiol surface.

(5) CANCER BIOMARKERS

(a) Matrix metalloproteases as biomarkers for

canine mammary tumour: Matrix metalloproteases

(MMP) were screened as biomarker, which is

essential for screening, diagnosis and prognosis of

dog mammary cancer. Stromelysin (MMP-11) was

chosen for cloning and expression to study its role

as antigen for immunotherapy of cancer. RNA was

collected from dog mammary tumour tissue and cDNA

was synthesized from it. MMP11 gene was amplified

using this cDNA as template and it was cloned in

eukaryotic expression vector PVAX-1. Transfection

of MDCK cell was done and expression of cloned

gene in MDCK cells was confirmed by Western blot

using human MMP-11 antibody.

(6) BOVINE MASTITIS

Attempts were made to develop molecular

diagnostics for pathogen detection and detection of

pro-inflammatory cytokines. For pathogen detection

three bacterial species at genus level

(Staphylococcus spp, Sreptococcus spp and E.coli)

were targeted. DNA isolation method directly from

milk and developed multiplex PCR to detect the

pathogen using internal control. For developing

diagnostic test based on host response to the

pathogen invasion. Specific biomarkers were targeted

and developed liquid phase blocking ELISA. The

method was further studied to make a pen-side test

using latex beads. To develop biochip based

detection of pathogen in mastitic milk, primers and

probes corresponding to genus-specific sequences

of S. aureus, Streptococcus spp., and E. coli and

virulence genes of the respective pathogens were

designed and used for immobilization on solid

surface. Four-tube multiplex PCR was carried out

using biotinylated reverse primers. The amplified

products were subjected for hybridization with the

dot-blotted probes on nylon membrane and detected

using avidin-alkaline phosphatase system. The

positive reactions correlated with the gel-based

detection of amplified products.

(7) MARKERS FOR SEX IDENTIFICATION OF

GYPS VULTURES

Chromohelicase DNA binding gene specific

test based on W-specific and ZW-common primer

combinations was assessed and was found to be an

accurate and reliable method for sexing Gyps indicus

and Gyps bengalensis vultures at VCBC, Pinjore,

greatly aiding future work and breeding programme

with these species (Working Manual on Conservation

Breeding of vultures, www.cza.nic.in).

2 8

3. PRODUCTION AND STANDARDIZA-

TION OF VETERINARY BIOLOGICALS

(1) PRODUCTION OF VACCINES,

DIAGNOSTICS AND KITS

The immunobiologicals produced and supplied

are given in Table 1.

Table 1: Immunobiologicals produced and

supplied by institute

Sl. Product Production

No. (Quantity)

A. VIRAL VACCINES

1. Cell culture sheep pox 9,66,000 doses

vaccine

2. RD vaccine (R2B strain) 3,200 doses

3. RD vaccine 'F' strain 1,59,000 doses

4. Fowl pox vaccine 4,200 doses

5. Lapinized swine fever vaccine 3,52,565 doses

6. PPR vaccine 79,86,100 doses

B. BACTERIAL VACCINES

7. HS oil adjuvant vaccine 6,000 ml

8. Enterotoxaemia vaccine 1,000 doses

9. Brucella abortus strain-19 59,983 doses

vaccine 59,983 doses

C. DIAGNOSTICS

10.Tuberculin PPD 79,290 doses

11. Mallein PPD 27,500 doses

12. Johnin PPD 44,120 doses

13. Brucella abortus plain (SAT) 98,000 ml

antigen

14. Brucella abortus Bang ring 6,7240 ml

antigen

15. Rose Bengal plate test antigen22,620 ml

16. Brucella abortus positive 86 ml

serum

17. Salmonella Pullorum plain 3,000 ml

antigen

18. Salmonella Pullorum coloured 4,560 ml

antigen

19. Salmonella Pullorum positive 7 ml

serum

20. Salmonella Abortus equi 'H' 2,000 ml

antigen

(b) Production and supply of FMD vaccine

A total of 6.87 million monovalent doses of

FMD vaccine comprising of 1.44 million doses of type

O, 3.43 million doses of type A and 2.0 million doses

of type Asia-1 were produced.

(c) Pox vaccines

A total of 500 doses each of orf and sheeppox

and 200 doses of goatpox with PPR combined

vaccines, respectively, have been field evaluated in

Tamil Nadu and Karnataka states and no adverse

reactions were reported. Further, a total of 800 doses

of goatpox vaccine have been supplied to field

conditions on cost basis.

(d) PPR vaccine and diagnostics

i) A total of 2.0 lakh doses of PPR vaccine were

produced.

ii) 43 PPR c-ELISA and 04 PPR s-ELISA kits were

produced and supplied.

(e) Bluetongue diagnostics

About 2.7 g recombinant VP7 protein was

prepared, from which 180 vials were made each

containing 15 µg of freeze-dried rVP7. Indirect ELISA

kit was supplied to two centres.

(2) QUALITY CONTROL AND QUALITY

ASSURANCE

(a) Foot and mouth disease vaccine

Four FMD vaccine (trivalent) referred samples

from DADF were evaluated for their quality testing

which included sterility, safety and estimation of

FMDV antibodies.

(b) Standardization and quality control of

veterinary immunodiagnostic antigens and

antisera

Standardization and quality control of the

immunodiagnostic antigens and antisera were done

for a total of 34 batches (Table 2), which included

mostly the B. P. Division - IVRI products and two

experimental batches of VBRI - Hyderabad products.

All the products passed were of satisfactory in quality.

Further, development of suitable SOPs for testing

veterinary immunodiagnostic antigens and antisera

in Indian Pharmacopoeia are under progress.

Table - 2: Details of immunodiagnostics tested during 2011-12

Sl. No. Name of antigens/antisera Production unit No. of batches tested

1. B. abortus RBPT antigen BP. Div. - IVRI 11

2. B. abortus RBPT antigen VBRI - Hyd. 1

3. B. abortus Plain antigen BP. Div. - IVRI 7

4. B. abortus ABR antigen -do- 7

5. B. abortus positive serum -do- 1

6. S. Pullorum plain antigen -do- 1

2 9

7. S. Pullorum coloured antigen -do- 2

8. S Pullorum coloured antigen VBRI - Hyd. 1

9. Mallein PPD -do- 1

10. Johnin PPD -do- 1

11. Bovine Tuberculin PPD -do- 1

Total = 34

(c) Standardization and quality control of veterinary vaccines

As a part of quality assurance programme, standardization and quality control of veterinary vaccines were

carried out for a total of 68 batches. These included 26 bacterial vaccines and 42 viral vaccines, from different

production units as detailed in Table 3.

Table 3: Bacterial and Viral vaccines tested during 2011-12

Sl. Name of vaccine Bacterial/ Production No. of

No. Viral unit batches

1 HS vaccine Bacterial BP Div., IVRI 1

2 Brucella abortus vaccine (Living) strain 19 Bacterial BP Div., IVRI 5

3 ET vaccine Bacterial BP Div., IVRI 1

4 HS BQ combined vaccine Bacterial Animal Husbandry 15

Dept, Bihar

5 HS vaccine (Alum ppt) Bacterial Punjab Vet. Vaccine 1

Inst., Ludhiana

6 Brucella abortus vaccine (Living) strain 19 Bacterial Drug Cont.Gen (India) 3

Indian Immunologicals

7 NDV live vaccine Viral Globion India Pvt. Ltd.,1

Lentogenic Lasota strain Hyderabad

8 NDV live vaccine Viral Ventri Biologcals, 2

(B-1 strain and Lasota strain) Pune

9 Sheep pox vaccine Viral Regional Vet. 1

Biological Unit, Jamdoli,

Jaipur

10 PPR cell culture vaccine Viral BP Division, IVRI 25

11 Rabies vaccine (experimental batches) Viral BP Division, IVRI 2

12 Rabies vaccine Viral Brilliant Bio Pharma 2

Ltd. Medak, (AP)

13 Lapinized swine fever vaccine Viral BP Division, IVRI 9

Total 68

(d) Veterinary type cultures

A total of 76 bacteria and 11 viral cultures were supplied on demand to various stakeholders.

Table 4: Cultures supplied during 2011-12

Sl. Culture No. of ampoules/vials/slant

No. supplied

1 Bacillus anthracis 4

2 Brucella abortus strain 19 2

3 Brucella abortus strain 99 2

4 Brucella abortus strain 544 2

5 Brucella melitensis 4

6 Brucella suis 1

7 Clostridium chouvoei-49 15

8 Clostridium septicum-51 11

9 Clostridium perfringenes type B 1

10 Clostridium perfringenes type C 1

11 Clostridium perfringenes type D 3

3 0

12 Pasteurella multocida p-52 25

13 Pasteurella multocida Fowl 3

cholera vaccine strain

14 Anti Brucella abortus serum 2

15 Rabies virus CVS 1

16 Fowl pox virulent 3

17 Fowl pox virus vaccine 2

18 Ranikhet disease vaccine strain F 3

19 Ranikhet disease vaccine strain R2B 2

(e) Standard reagents for use in standardizationof enterotoxaemia vaccines

Clostridium perfringens type D was revived and

cultured. ε protoxin produced was trypsinized and itstoxic activity was detected to be 1500 mld/ml in mice.

The crude culture filtrate toxin was validated as

epsilon toxin by neutralization test with WHO standard

epsilon antitoxin. It was found that 300 MLD of epsilon

toxin was neutralized by 2 IU of epsilon antitoxin.

Epsilon toxin was freeze dried so that each ampoule

contains 900 MLD of toxin. It was reconstituted in

desired volume of 3 ml to get 300 MLD/ml and then

checked for toxic activity and neutralizing activity.

The freeze dried toxin after reconstitution retained

the toxic activity (30 MLD: death within 30-45 min I/

V and 1.5-2 hrs I/P) and neutralization activity with

antitoxin. Keeping quality of the reconstituted toxin

at different temperature was also determined and it

was found that the keeping quality of reconstituted

toxin at -20°C and 4°C is less than one month. Toxoid

was prepared and was used for repeated immunization

of goat at 14 days interval to raise ε antitoxin. Theseveral collects of sera were pooled and anti epsilon

titer of the pooled serum was determined in terms of

IU/ml, in comparison with the WHO Standard (1 IU =

quantity of antitoxin capable of neutralizing 150 MLD

of toxin) and was found to be 52 IU/ml. Anti-epsilon

toxin was lyophilized in vials in 1 ml amount containing

52 IU antitoxin titer and stored at -20ºC. In house

validation of finished lots were done by reconstituting

the freeze dried preparation in desired volume of

normal saline and subjecting to mice neutralization

test in comparison to WHO standard. It was found

that 2 IU of WHO and test standards of antitoxin

results in 100% neutralization of toxin. For quality

control, one batch of Enterotoxaemia vaccine was

prepared in laboratory and was tested for potency

using both WHO and the laboratory developed

standard preparations. The ET vaccine batch was

found to be potent having anti epsilon titer > 2 IU/ml.

1. One batch of standard freeze dried preparation

of Cl. perfringens epsilon toxin. One ampoule

contains 900 MLD, which is sufficient to test one

batch of ET vaccine.

a. 300 MLD for standard antitoxin control

b. 300 MLD for test vaccinated serum and

c. 300 MLD as toxin control

2. One batch of standard freeze dried preparation

of Cl. perfringens epsilon antitoxin containing 52

IU, which is sufficient to test 26 batches of

Enterotoxaemia vaccine.

These standards are required for the quality

control of Enterotoxaemia vaccines and were not

available in India.

(f) Standardization of PCRs for detection of

extraneous agents

The PCR was standardized for nucleic acid

detection of extraneous agents like BVDV-I, BVDV-

II, PCV-1, PCV-2, and Parvovirus in viral vaccines.

Duplex PCR was standardized for detection of

Pestivirus and Mycoplasma in a single reaction.

Similarly duplex PCR was also standardized for

detection of Mycoplasma and Porcine circovirus-1

(PCV-1) and Mycoplasma and Parvovirus genome.

All the PCRs can be used for screening of animal

derived products used for production of live viral

vaccine.

4. MOLECULAR CHARACTERIZATION

OF PATHOGENS AND HOST-

PATHOGEN INTERACTION

(1) VIRAL PATHOGENS

(a) Animal pox viruses

i) Genetic characterization of Indian orf virusisolates based on A32L gene: The comparative

sequence analysis of Indian field isolates of ORFV

(n=13) based on full length A32L gene sequences

was carried out along with those of parapoxviruses

available in the GenBank database. Multiple

sequence analysis has revealed high nt and aa

identity among Indian isolates of ORFV from sheep

and goat belonging to different regions. They shared

97.7-99.9% and 97.8-99.6% sequence identity among

themselves at the nt and aa level, respectively.

Sequence analysis of the nt and deduced aa of the

Indian ORFV isolates shared relationship with other

ORFV isolates from different regions (93.8-99.6% and

95.5-96.6%), and shared the highest homology with

ORFV-SA00 and ORFV-Nan from USA and Taiwan

(98.4-99.6% and 98.2-99.6%). However, ORFV-Pal

isolate showed identity with other Indian ORFV of

97.7-99.3% and 98.2-98.9% at nt and aa level,

3 1

respectively. The results of phylogenetic analysis

based nucleotide sequences revealed two major

clusters, which included all 13 Indian orf isolates along

with two foreign isolates (ORFV-SA00 and ORFV-

Nan) forming a Cluster-1, and rest of foreign isolates

were grouped into a Cluster-2. The study indicated

that Indian orf viruses obtained from small ruminants

were phylogenetically closely related to other orf

viruses reported globally, however, carboxyl terminal

heterogeneity could be potentially used for strain

differentiation.

ii) Comparative multiple sequence alignment

analysis of animal pox viral ATPase motifs: Multiple

alignments of ATPase sequences from different

animal poxviruses including Indian animal poxviruses

available in the GenBank database were done using

MegAlign (DNASTAR). Poxviral ATPase motifs

alignment (Fig. 22) indicated the presence of highly

conserved four conventional functional motifs (motifs

I-IV) and which included Walker A, Walker B and two

motifs (III and IV) belonging to A32L specific regions,

respectively (Fig. 22). Another AYDG motif-V was

also found to be conserved among all the pox viruses

(Fig. 22). By sequence comparison, certain amino

acid substitutions in various motifs without affecting

the critical functional residues were observed. These

variations were similar in most of respective members

of genus. Furthermore, it was observed that all the

poxvirus ATPases bore a highly conserved arginine

(R) at the beginning of motif-III, equivalent to

identically positioned arginine fingers in HerA/FtsK

ATPases and sensor-1 residue (Q) at the C-terminus

of motif-III.

Fig. 22: Multiple sequence alignment of animal

poxviruses ATPase proteins functional motifs.

On the basis of conserved ATPase functional

motifs among poxviruses, it is presumed that all the

poxvirus ATPases form a similar structure of the core

ATPase domain as described, involving a common

mechanism of viral DNA packaging and probably had

evolved from a common ancestor. The best

conserved ATPase domain followed by A32L specific

motif among poxviruses could potentially be used

as signature region of the family for diagnostic

purpose.

iii) A homology model of Indian orf viral A32L gene

encoded ATPase domain/motifs: A consensus A32L

gene region of Indian ORFV was analysed using

various protein prediction programs such as ExPASy,

JpredV3, Phyre and PSIPRED for secondary structure

as well as characterization. An automated homology

model of A32L was done using SWISS-MODEL and

the functional motifs of ATPase were identified. The

consensus ATPase protein sequence of Indian ORFV

with distinct functional motifs as well as predicted

homology model using SWISS-MODEL is depicted in

Fig. 23. The secondary structure predictions revealed

the presence of four β-strands (β1, β2 with substrandβ2.1, β3 and β4) and three α-helices (α1, α2 and α3)in A32L encoded ATPase especially in the N-terminus

(aa16-aa141). The first conserved block in A32L

ATPase include the Walker A (motif-I), which

encompasses the first β-strand, the P-loop and thefollowing helix (α1). The Walker B (motif-II) definedthe second conserved block with third β-strand (β3).The third conserved motif-III, a part of A32L specific

region includes a run of bulky hydrophobic amino acids,

forming a beta-strand (β4) followed by a highlyconserved polar amino acid (Q) at the C-terminus and

the distinct helix (α3) with a highly conserved argininethat precedes this strand (Fig. 23). Another motif-V is

mapped between second strand (β2) and its shortsubstrand (β2.1). In the three-dimensional (3D)homology structure of A32L, β-strand 4 (β4), ispositioned in between the Walker A and Walker B

strands (Fig. 23). The predicted structure indicate the

expected strand (β1)-helix (α1, α2)-strand (β3)structure, which makes a P-loop and Mg2+ binding

pocket. The conserved core of the HerA/FtsK

superfamily is a seven-stranded β-sheet with a7615423 topology. The current homology model also

confirmed the presence of requisite DNA binding motifs

in A32L gene encoded ATPases of orf viruses.

Fig. 23: A homology model of Indian orf viral ATPase

protein with functional motifs.

3 2

b) Rotavirus

i) Sequence analysis of NSP4 gene: A total of 15NSP4 genes of bovine RVA from different regions of

India were sequenced and showed most common

genotype E2, except two isolates, P9 and P-BC, from

Pantnagar (UKD), which showed E1 genotype, which

is more common in humans. Phylogenetic tree

constructed within isolates of present study,

distributed all the isolates in a single E2 cluster, while

P-BC and P9 isolates of E1 genotypes formed a

separate E1 cluster (Fig. 24). With bovine isolates,

these two isolates showed a low identity both at

nucleotide level (<80%) as well as amino acid level

(<86%), while the human isolates showed a very high

identity both at nucleotide level (>99% with the isolate

R1949 from France) as well as at amino acid level

(>99% with the isolate R1949 from France).

Fig. 24: Phylogram indicating the genetic relationship

of the NSP4 gene of different isolates from different

regions of the country. Significant Bootstrap values (1000

replicates) above 70 are indicated at each branch nodes.

The length of the horizontal bar indicates the number of

nucleotide substations per site.

ii) Sequence analysis of VP7 gene: Phylogeneticanalysis of VP7 gene sequences from the 15 bovine

RVA isolates (Fig. 25) showed that G3 isolates formed

a single cluster, while G6 isolates formed another

single cluster. Three isolates with G1, G8 and G9

genotypes formed individual clusters. Phylograms

constructed for the 15 isolates of this study with other

Indian and world isolates depicted that G1 (BR-91)

and G9 (WB-H2) isolates were clustering with human

G1 and G9 isolates, respectively, while all other

isolates with common bovine type G types clustered

within the respective clusters i.e. G3 with bovine G3,

G6 with bovine G6 and G8 with bovine G8,

respectively. The G1 and G9 bovine RVA isolates (BR-

91 and WB-H2) showed an identity of 95% at nucleotide

and amino acid level with corresponding human G1

and G9 isolates, respectively. These showed lower

identity of <85% both at nucleotide level and amino

acid level with the bovine isolates. One isolate, BE-

3 with G6 genotype formed a different sub-cluster

within the G6 cluster, in the phylogenetic tree

constructed for these isolates. This BE-3 also formed

a totally different sub-cluster within the G6 cluster in

the phylogenetic tree constructed with the world

isolates. Analysis of this isolate (BE-3) at amino acid

level with other two G6 isolates of this study, BR-

111 and WB-H6, revealed amino acid variations at

17 positions.

Fig. 25: Phylogram indicating the genetic relationship

of the VP7 gene of different isolates from different regions

of the country. Significant Bootstrap values (1000

replicates) above 70 are indicated at each branch nodes.

The length of the horizontal bar indicates the number of

nucleotide substations per site.

The results confirmed a changing pattern of

circulation of bovine RVA in India. The sequence

analysis of bovine RVA isolates indicates possible

inter-species re-assortment events. These findings

suggest that interspecies transmission and

reassortment events between RVs can occur in

nature.

(iii) G and P typing of human and animal isolates:Molecular characterization of the 86 human rotavirus

isolates showed only 47 and 55 isolates typable by

VP7 (G) and VP4 (P) gene based typing, respectively.

G1 and G2 (18 each) were the most prominent G

type in children from North India, followed by G9 (5),

G4 (4) and G12 (2). P typing revealed P[6] to be the

most prominent type (37), with P[4] (12) and P[8] (6)

also being detected.

VP7 gene based typing of the bovine rotavirus

isolates revealed G6 (64.7%) to be the most prevalent

followed by G3 (17.6%), G8 (11.8%) and G10 (5.89%).

Among the P genotypes, P[11] was the most

common, accounting for 92.3% of the 13 typable

bovine rotavirus isolates, with rest of the isolates

being P[3] (7.7%). G6P[11] was the most prevalent

3 3

genotype combination encountered, with G8P[11],

G10P[11], G3P[11] and G3P[3] being the others.

Molecular characterization of the goat kid isolates

revealed G8 and P[14] genotype. Nearly 17 human

and bovine rotavirus sequences for VP7, VP4, NSP1,

NSP2, NSP3, NSP4 and NSP5 genes have been

submitted to the NCBI gene bank.

d) Bluetongue virus:

i) Sequence analysis of segment-2 (VP2 gene):The ORF (VP2 gene) length in all the isolates was

found to be 2874 bp and 5'-GTTAAA and ACTTAC-3'

sequences were seen in the 5' and 3' termini

respectively beyond the ORF region. BLAST analysis

of full length segment-2 of each isolate showed 96%

identity at nucleotide level with other BTV 23 segment-

2 sequences available in GenBank. This indicates

that all BTV isolates studied in this work belong to

BTV 23 serotype and earlier designated BTV 18

namely, Parbhani and Srinagar isolates are now

confirmed as BTV 23.

e) Classical swine fever virus (CSFV)

Characterization of CSFV adapted to

heterologous cell lines viz. Madin-Darby Canine

Kidney (MDCK) and Rabbit Kidney (RK-13) was

carried out. Investigations included, serial passaging

of virus in respective cell lines, type of cytopathic

effect (CPE) produced, titre of the virus, antigenic

reactivity against monoclonal antibody (MAb), cloning,

sequencing and analysis of sequence data. Findings

indicated that the virus adapted in MDCK cell lines

exhibited cytopathic effect but not in RK-13). The

virus identity was confirmed in both the cell lines by

amplification of 5'UTR, E2 and NS5B genes in PCR

and positive signal of immunoperoxidase test (IPT)

using MAb against E2 gene. In case of MDCK

passaged virus, 5'UTR and E2 were detected in all

the passages with no or minor change; whereas,

NS5B gene could be detected up to passage 12 only

with 30% divergence between passages (Fig.26).

Fig. 26: Gene-wise characterization of RK-13 and MDCK

adapted CSFV.

a & d: CSFV 5' UTR (151 bp) based amplification in all

representative passages.

b & e: CSFV E2 (173 bp) based amplification in all

representative passages.

c & f : CSFV NS5B (449 bp) based amplification in all

representative passages.

M: 100 bp DNA ladder plus Marker MBI, Fermentas)

NTC: Non template control.

Phylogenetic analysis based on 5UTR, E2 and

NS5B genes of recent CSFV isolates revealed that

genotype 2.2 viruses are circulating in Madhya

Pradesh, Uttar Pradesh, West Bengal, Haryana,

Assam, Meghalaya, Mizoram and Kerala. Two Indian

isolates from the northeast detected during 2002 and

2006, belonged to genotype 2.1. The CSF 40-02 was

the first Indian isolate of genotype 2.2 detected in a

northeastern state during 2002. Subsequently, from

2006 onwards, genotype 2.2 viruses were detected

in other states in the north, central and southern India.

The new emerging genotype 2 has been detected in

wild hogs of Assam and West Bengal also and they

were closely related to viruses circulating in China

(GXW02) and Taiwan (0406/CH/01/TWN). Map

showing distribution of genotype 2 viruses in different

states of the country are depicted in Fig. 27.

Fig. 27: Map depicting distribution CSFV genotype 2

viruses in India.

Molecular characterization of classical swine

fever challenge virus by partial sequencing of E2, 5

NTR and NS5B genes and its comparison with other

reference strains revealed that the challenge virus

belongs to group 1.1. Phylogenetic studies also

revealed that the challenge virus is very similar to

one of the world reference virulent strain, i.e., Brescia

strain, which is also used as challenge virus for

potency resting of swine fever vaccines.

f) Canine parvovirus

Primer sets were designed to amplify the part

of the VP2 gene of CPV to yield a product of N

terminal part of the VP2 gene to yield a product of

990 bp and C terminal part of the VP2 gene of CPV

3 4

to yield a product of 765 bp. The C terminal part of

the VP2 gene of CPV-2 of 7 isolates were amplified

(765 bp), sequenced and the nucleotide and amino

acid sequences were analysed. Four isolates

(PALAM-1, PALAM-5, PALAM-8 and PALAM-10)

having Aspartate at the 426 position were

designated as CPV-2b types, which were again

confirmed by BLAST analysis and also on

phylogenetic analysis. Three isolates (PALAM-2,

PALAM-4 and PALAM-7), which had Asparagine at

426 position were designated as CPV-2a types, which

were confirmed in a similar manner. Three isolates

PALAM-5, PALAM-8 and PALAM-10 were found to

match with isolates from USA, Brazil and New CPV-

2a isolate from USA, respectively.

(2) BACTERIAL PATHOGENS

(a) Pasteurella multocida

Multi-locus sequence typing (MLST) was

carried out for 17 isolates of capsular type B of buffalo

origin belonging to different parts of the country. The

genomic DNA of all the isolates was isolated. PCR

amplification of 7 house keeping genes selected for

the MLST analysis (adk (adenylate kinase), est

(esterase), pmi (mannose-6-phosphate Isomerase,

mdh (malate dehydrogenase), gdh (glutamate

dehydrogenase), pgi (phospho glucose isomerase)

and Zwf (glucose-6-phosphate dehydrogenase) was

carried out, which yielded amplicons of expected size.

The PCR products were purified from gels and

subjected to nucleotide sequencing in both directions.

The nucleotide sequences were aligned and

compared by using Laser Gene software. The allelic

profiles obtained for the isolates at the seven loci

were 23, 37, 21, 17, 4, 2, 17 for adk, est, pmi, zwf,

mdh, gdh and pgi genes, respectively, based on the

data in RIRDC MLST data base for P. multocida.

These isolates were grouped into a single sequence

type (ST122) indicating that the isolates prevalent in

the buffalo population were closely related and had

the same allelic profile for all the 7 house keeping

genes

(b) Campylobacter spp.

Genotyping of 61 thermophilic Campylobacter

spp. isolates from diverse origin was carried out by

PCR-based RFLP and RAPD techniques in order to

deduce their molecular heterogeneity. The typeability

for RFLP in the present study was 100%. The overall

discriminatory power and typeability of the PCR-RFLP

method was satisfactory.

RAPD technique was applied with the view to

compare typeability and discriminatory efficacy of

two universal primers, OPA-11 and HLWL85, and the

overall comparison of this method with fla-typing.

The molecular heterogeneity studies and

comparison of the two genotyping methods revealed

that both the techniques are suitable for the diversity

studies. The D value index of > 0.9 is desirable for

typing schemes and the results are to be interpreted

with confidence. Among the two methods, RAPD was

found more discriminatory on comparing the D values.

However, disadvantages such as minor differences

in band patterns and weak band patterns in RAPD

make its discriminatory capacity somewhat poor,

which may lead to subjective interpretation of results.

Further, it was observed that the RAPD technique

sometimes required a second PCR assay as it gave

negative results in the first trial or yielded weak bands.

Taking into consideration the latter facts, fla-typing

seems to be a better suited method for genotyping

Campylobacter isolates as evident by its ability to

type all the isolates under study and also to give

acceptable level of discriminatory index. The isolates

studied reveal the existence of wide DNA diversity.

(c) Brucella spp.

In order to work out the molecular epidemiology

of the Brucella, PCR targeting the OMP 31 gene of

Brucella was run using DNA from the field isolates of

B. melitensis (n=19) with the primers designed. The

PCR product from each isolate was sequenced. The

sequences of the OMP 31 were aligned using the

software. The sequences of OMP 31 gene of each

field isolate were compared with each other and with

those available in the NCBI database to find out any

similarity or differences. It was found that the

sequences of the different field isolates of the B.

melitensis from India did not differ from each other.

When the same were compared with those available

in the database, again no difference was observed.

This showed the highly conserved nature of the gene

of the Brucella.

(d) Shiga toxin producing E. coli

A total of 17 human and 41 cattle STEC

isolates were screened for the presence of cardinal

genes i.e., stx1, stx2 and both stx1 and stx2 . Among

the 17 human isolates stx1 gene was detected in 9

isolates, stx2 in 5 isolates and both stx1 & stx2 in 3

isolates. Among the 41 cattle isolates, stx1 gene

was found in 12 isolates, stx2 in 16 isolates and both

stx1 and stx2 were in 13 isolates.

Five genes namely Ler, orf1----(L0053, L0052,

L0051, L0050), EscRSTU---(escR, escS, escT,

escU), orf2----(L0054, L0044, L0043) and cesD

belonged to LEE pathogenicity island were screened,

where Ler, EscRSTU and orf-2 were not found in

human isolates; however, orf-1 and cesD were

detected in 1 and 8 isolates, respectively. Among

the cattle isolates (n=41), ler, orf-1, EscRSTU, orf-2

and cesD were present in 19.5%, 9.8%, 12.2%, 9.8%

and 48.8% isolates, respectively.

(e) Staphylococcus aureus

An attempt was made to investigate the

molecular interactions between two ECM proteins,

vitronectin and fibronectin, and S. aureus. Heparin

binding site in vitronectin was altered by site directed

3 5

mutagenesis to understand its role. Mutation caused

no alteration in the multimerization of the protein thus

indicating that the primary heparin-binding site hasno role in this process.

(3) PARASITIC PATHOGENS

(a) Haemonchus contortus

(i) Complement C3 binding protein ofHaemonchus contortus and its significance inhost-parasite interactions: C3 binding protein in H.contortus was characterized as glyceraldehyde 3

phosphate dehydrogenase (GAPDH) by mass

spectrometry and by generating the recombinant formof H. contortus. The rGAPDH bound to C3

complement and inhibited sensitized sheep

erythrocyte lysis by complement. Furthermore, the

presence of rGAPDH inhibited C3b and membrane

attack complex formation. Identification of GAPDH

as complement C3 binding protein is a novelobservation.

(ii) Drug resistance: Beta-tubulin isotype-1 gene ofBunostomum trigonocephalum and Mecistocirrus

digitatus cloned, sequenced and characterized. The

point mutations were predicted for benzimidazole

resistance diagnosis. The deduced amino acidsequence showed point mutation (phenyle alanine to

tyrosine) at 200th position on beta-tubulin protein may

be responsible for benzimidazole resistance. Based

on the mutation at 200th position (599th position at

nucleotide level), standardised allele specific PCR

(AS-PCR) for benzimidazole resistance diagnosis in

Bunostomum trigonocephalum and Mecistocirrusdigitatus. For anthelmintic resistance study in field

level, AS-PCR was applied and 13.1% of

Haemonchus contortus were showing resistance

against benzimidazole group of drugs.

(b) Taenia solium cysticerci

Total RNA was extracted from cysticerci of

Taenia solium collected from muscles of pigs(measly pork, Fig. 28) using trizol reagent following

standard protocol and cDNA was synthesized using

oligo (dT)18 primer. The 201 bp coding sequence of

Ag1V1 protein of T. solium cysticerci was PCR

amplified using specific primers and cloned in INSTA

cloning vector. The presence of insert in therecombinant clone was confirmed by restriction

digestion with Nco I and Hind III as well as by colony

PCR.

A B

Fig. 28: A. Mesly pork; B. Scolex of Cysticercus cellulosae

(c) Cryptosporidium spp.

A 834 bp nested PCR product (Fig. 29) of 18S

rRNA gene of Cryptosporidium spp. (from faecal

samples of cattle, buffalo and kid) were subjected

to PCR-RFLP using three restriction enzymes (SspI,

VspI and MboII). The specific RFLP patterns (Fig.30)

confirmed the presence of Cryptosporidium parvum

in all the cattle and buffalo isolates. However, RFLP

pattern of the kid isolate was different from C. parvum.

For further confirmation of species, the 834 bp nested

product of one isolate each from Pantnagar and Bihar

and two isolates of Izatnagar (one cattle and one

buffalo) was cloned in pTZ57R/T cloning vector and

custom sequenced. The sequence homology with

known sequences available in GeneBank further

confirmed these species as C. parvum.

For further subtyping of C. parvum, one sample

each from IVRI cattle, IVRI buffalo, Pantnagar cattle

and Bihar buffalo was subjected to nested PCR based

amplification of Gp60 gene. These nested PCR

products of 340 bp (Fig. 31) of GP60 gene were directly

sequenced. The sequences obtained were aligned

with already published sequences of C. parvum sub-

genotypes IIa, IIb, IIc, IId and IIe. The alignment

studies showed maximum homology of all the four

isolates with published sequence of IId sub-genotype.

Further analysis of sequences revealed that all the

sub-types had 15 copies of the TCA repeat and 1

copy of the TCG repeat and one ACATCA sequence

was present immediately after the trinucleotide

repeats (TCA or TCG). Thus, all the 4 subtypes of C.

parvum were further classified as IIdA15G1R1, which

is known to be zoonotic.

Fig. 29: 834bp Nested Fig. 30: PCR-RFLP pattern of

amplicons of 18S rRNA 834bp nested amplicons

of Cryptosporidium spp. of 18S rRNA gene of C.

Lane A,B,C: cattle isolates parvum, Lane A,C: Vspl

Lane D,E,F: buffalo isolates (628bp & 115bp); Lane D,

Lane M:100bp DNA ladder E: Sspl (450bp, 267bp &

108bp); Lane B,F: Mboll

(771bp & 76bp) Lane M:

100bp DNA ladder

3 6

Fig. 31: Nested PCR amplification of GP-60 gene of C.

parvum

Lane A: IVRI Cattle isolate

Lane B: IVRI Buffalo isolate

Lane C: Pantnagar Cattle isolate

Lane D: Bihar Buffalo isolate

Lane M: 100bp DNA ladder

(d) Ticks

The larvae of laboratory maintained acaricide

susceptible reference IVRI-I strain of Rhipicephalus

(Boophilus) microplus and those emanated from

deltamethrin-resistant adult female ticks collected

from ten locations spread over three agroclimatic

regions of India were used to amplify three point

mutation sites (kdr like mutation in domain IIS6,

T2134A in domain IIIS6 and C190A in domain IIS4-

5) of sodium channel gene known to be associated

with resistance to pyrethroids. The double stranded

sequence analysis of at least two clones from each

of the deltamethrin-resistant isolates failed to detect

any nucleotide substitution, which is linked to

resistance (mutation) in either domain IIS6 or domain

IIIS6 region when compared with the sequence from

susceptible IVRI-I strain.

The double stranded sequence analysis from

susceptible strain and field isolates of ticks led to

the identification of a cytocine (C) to adenine (A)

nucleotide substitution (CTC to ATC) at position 190

in domain II S4-5 linker region in three field isolates

having highest resistant factors (7.6 to 34.9) and

elevated esterase levels. In silico translation of this

nucleotide substitution causes a leucine to isoleucine

(L64I) change within domain II S4-5 of the sodium

channel gene. The occurrence of mutation in the tick

isolates having high resistance factor suggested that

target site insensitivity is a mechanism of resistance

to deltamethrin in the Indian isolates of R.(B.)

microplus. These results concluded that the mutation

site is similar in Indian and Australian tick isolates

while it is different in isolates of ticks from Mexico

and Brazil.

(4) HOST-PATHOGEN INTERACTION/

ONCOLYSIS

(a) Elucidation of molecular mechanism involved

in Newcastle disease virus induced oncolysis

Infection of HeLa cells with 0.1 moi of HeLa

adapted Newcastle disease virus induced apoptosis,

which was evident from the translocation of

phosphatidyl serine translocation from inner leaflet

to outer leaflet. The percent Annexin V positive cells

at 48 h p.i in mock-, parental NDV- and HeLa adapted

NDV at passage-5 infected and staurosporin treated

cells were 19.14%, 39.64%, 69.86% and 51.42%,

respectively. Analysis of propidium iodide stain cells

in flow cytometer indicated significant increase in

hypodiploid cell count (sub-G1 peak). Around 64.79%

cells were PI positive in NDV infected HeLa cells as

against 66.78% staurosporin treated control cells

Our results indicated that NDV infection of

HeLa cells causes disruption of mitochondrial

membrane potential at 24 h p.i. which increased till

48 h p.i. suggesting that mitochondria plays role in

NDV induced apoptosis of HeLa cells. Further study

revealed that TRAIL acts as one of the effector

molecules which was up-regulated in NDV-infected

HeLa cells confirming involvement of death receptor

mediated pathway.

(b) Identification of oncolytic viral genes anddevelopment of tumour targeted nano-delivery vehicle for cancer therapy in bovines

The NS1 gene of CPV-2 and VP3 of chickeninfectious anaemia virus (CAV) amplified and clonedin eukaryotic expression vector pcDNA3.1(+) in order

to develop viral gene therapeutics were found toinduce apoptosis in HeLa cells (Fig. 32). Detailed

study of molecular mechanism of cell death confirmedthat NS1 induces apoptosis only through endoplasmicreticulum stress mediated pathway and there was

no involvement of p53, bax and bcl2, whereas VP3induced cell killing is only through mitochondria and

cleavage of poly (ADP-ribose) polymerase (PARP).

In order to develop horn cancer specific nano-

delivery system, four unique horn cancer specificligand sequences were identified using phage displaymethods. These horn cancer specific ligands were

chemically synthesized by solid phase peptidechemistry and labeled by FITC labeled at their N-

terminal ends to detect their preferentially homing tohorn cancer cells.

In-vivo tumour models for evaluating theoncolytic potential of the gene constructs were

developed in male Wistar rats using 1% DMBA (7,12 -Dimethylbenz (a) anthracene) (2.5 mg DMBA in0.25 ml of acetone to each rat) tissues. Similarly

mammary tumour models were developed) in female

3 7

Sprague Dawley rats using N-methyl-N-Nitroso Urea(Sigma Aldrich, USA) for evaluation and validation

of oncolytic gene therapeutics. Tumours werecharacterized by histopathology, AgNOR and PCNA

count.

Fig. 32: Detection of nuclear fragmentation by Hoescht

staining in transfected HeLa cells

5. DISEASE MONITORING AND

SURVEILLANCE

(1) VIRAL DISEASES

(a) Rotavirus infection:

A total of 885 diarrhoeal (784) and non-

diarrhoeal (101) faecal samples of human beings and

animals (calves, goats kids and lambs) from five

states of north India viz, Punjab, Rajasthan, Himachal

Pradesh, Uttar Pradesh and Jammu & Kashmir were

screened for rotavirus. SDS-PAGE, ELISA and RT-

PCR were able to detect viral load in 28.29%, 41.46%

and 41.95% of the 205 human samples with an overall

prevalence of 48.29%. The highest prevalence (70%)

was observed during the months of November to

February and in children aged 3-6 months (74.28%).

In case of bovine calves a prevalence of

15.41% was observed, with 4.29%, 10.15% and

15.41% positivity shown by SDS-PAGE, ELISA and

RT-PCR, respectively. Of the 202 goat kid and 212

lamb samples screened, a prevalence of 9 (4.46%)

and 7 (3.3%), respectively was observed by RT-PCR.

Real time PCR was also standardized for the

VP7 gene and found more sensitive than conventional

RT-PCR.

(b) Japanese encephalitis

Of the 309 pig sera samples from various

regions of Uttar Pradesh screened for presence of

antibodies to JE virus by indirect IgM ELISA, 159

(51.45 %) were found to be positive.

A total of 140 pig blood samples were collected

from various regions of Uttar Pradesh, out of which

22 (15.71%) samples were found positive by RT-

PCR.

(2) PRION DISEASES

(a) Bovine spongiform encephalopathy

A total of 42 brain samples from adult cattle

and buffaloes of different age groups belonging to

clinical suspect/downers/fallen cases/slaughter

house were collected/ received from the postmortem

room of the institute. Brain sections were stained

with haematoxylin and eosin as well as with special

stain. The brain sections were examined and none

showed spongiform lesions of BSE. A total of 3179.2

surveillance points were gathered. The other

microscopic lesions identified as: congestion/

hemorrhages, gliosis and neurons degeneration. The

clinical suspect cases were also tested for Rabies

by dFAT and 3/7 found positive for rabies. Veterinary

Officers (120) from Rajasthan, Punjab, Himachal

Pradesh, Uttar Pradesh, Bihar, Maharashtra, Goa and

SSB were trained on BSE surveillance, collection

and preservation of brain for various tests for

confirmation of BSE.

(3) BACTERIAL DISEASES

(a) Pasteurellosis

Twenty eight of 33 cultures and samples

received from different parts of the country for isolation

and confirmation of Pasteurella multocida, were

identified as Pasteurella multocida on the basis of

morphological, cultural and biochemical tests. The

isolates were from different animal species viz., cattle,

buffalo, sheep, goat, rabbit, duck, chicken and emu.

The capsular typing of all isolates was done by

multiplex PCR using capsular types A, B, D and F

specific primers. Among 28 isolates, 16 were found

to be serotype A, 8 isolates serotype B, while 4

isolates belong to type F.

(b) Leptospirosis

A total of 590 sera samples of different animal

species and human beings were examined for

leptospirosis by latex agglitunation test and MAT, of

which 436 were found positive for the presence of

Leptospira antibodies. The results of both tests were

comparable. Of the 432 cattle sera from Mathura,

West Bengal and Odisha, 298 were found positive.

Serovars identified were Icterohaemorrhagiae,

followed by Grippotyphosa, Hebdomadis, Hardjobovis

and Australis. This high seroprevalence (65%)

recorded may be attributed to the endemicity in this

region. Screening of 18 caprine sera revealed 11 to

be positive. Fourteen of 15 canine sera samples

suspected for leptospirosis tested positive when

screened using both MAT and rLigB based LAT.

Icterohaemorrhagiae and Grippotyphosa were the

serovars prevalent in canines in Bareilly region.

As many as 34 human sera of 35 tested were

positive for leptospirosis. Icterohaemorrhagiae was

the predominant serovar, followed by Javanica and

Grippotyphosa.

3 8

Majority (69) of the 80 sera samples of wild

animals (tiger, lion, jaguar, leopard, cheethal, black

buck, panther etc.) referred from different zoos were

tested positive for leptospiral antibodies. Serovars

identified were Icterohaemorrhagiae, Pomona and

Grippotyphosa. Buffalo carcasses without removing

offals fed to wild animals were suspected to be

responsible for infection.

(c) Vero-toxic E. coli infection

The study was aimed for the detection of

virulence genes, viz VT1 and VT2 in Escherichia coli

isolates, from samples received from postmortem/

diseased domestic and wild animals. A total of 106

samples yielded 30 E. coli isolates, which were

maintained in Dorset egg medium (modified) at 40C.

E. coli specific polymerase chain reaction (PCR) was

carried out. E. coli specific PCR of isolates resulted

in a single amplification product of 231bp. However,

E. coli VT1 gene and VT2 gene specific PCR of the

isolates revealed the absence of 130 bp VT1 and

346 bp VT2 genes.

(d) Arcobacteriosis

A total of 174 samples (poultry faeces - 55,

chicken meat - 70, pig faeces - 49) screened for

Arcobacter spp. by genus specific PCR by targeting

16S rRNA. Out of which 28 (16.09%) samples were

found positive for Arcobacter spp. All genus specific

positive samples were subjected to multiplex-PCR

for species confirmation. Out of which 8 (14.54%)

poultry faecal samples were found positive for

Arcobacter butzleri (401 bp), 13 (18.57%) chicken

meat samples found positive for Arcobacter butzleri,

out of 13 samples one found positive for both A.

butzleri and A. cryaerophilus (257 bp), 7 (14.28%)

pig faecal samples found positive for Arcobacter spp.

out of which 5 samples were positive for A. butzleri

and 2 samples found positive for A. skirrowii (641

bp).

(e) Campylobacteriosis

A total of 123 samples were screened for the

presence of thermophilic Campylobacter spp.

comprising of human stools (35), pig faeces (50),

vegetables (24) and dog faecal samples (14). Out of

these, 9 samples were found positive giving an overall

prevalence of 7.3%, with highest isolation rate from

vegetables (12.5%), followed by dog faeces (7%),

pig faeces (6%) and human stools (5.7%).

(f) Q fever

A total of 202 samples (bovine milk-172,

poultry eggs-12, cattle blood-05 and human blood-

13) were collected and screened for detection of the

pathogen by standardized Trans-PCR and/or Real

Time-PCR. Among them only 20 bovine milk samples

were found positive for Coxiella burnetii DNA. 12 out

of 20 PCR-positive milk samples were further

processed for isolation studies, by egg inoculation

method, however, none of the samples did yield live

Coxiella burnetii.

(g) Streptococcus suis infection

A total of 81 clinical/morbid materials from pigs

suspected to have Streptococcus suis infection were

collected from Nekpur slaughter house (40),

Premnagar slaughter house (5), swine production

farm, IVRI (14) and postmortem room, Division of

Pathology, IVRI (16) and outside Bareilly (6). Out of

81 samples collected, 67 lungs, brain and tonsils

showed gross lesions. Ten nasal swabs from

apparently healthy animals, 2 joint fluids and 2

abscesses were also collected. All the samples were

subjected to microbiological investigation for the

presence of S. suis. Out of which, 30 isolates were

suspected to be S. suis based on the haemolysis

pattern of bacterial colonies on blood agar. On Gram's

staining, they were arranged in pairs or in short chains.

All these isolates were subjected to various

biochemical tests. Out of 30 suspected isolates, 6

isolates showed no growth in 6.5% NaCl, positive

bile esculin test, negative MRVP test and positive

starch hydrolysis test. On various sugar fermentation

tests, 3 isolates showed positive result for raffinose,

lactose, salicin, inulin and negative for sorbitol and

mannitol.

4. MYCOTIC INFECTIONS

A total of 236 samples suspected for the

presence of fungal element from different animal

species and human beings were aseptically collected

and screened. Out of 111 samples from dogs, 11

were found positive for Malassezia spp., 12 for

Candida spp., 9 for Alternaria spp., 5 for Trichophyton

spp., 3 for Mucor spp., 3 for Aspergillus flavus, 2 for

Aspergillus niger, and 1 each for Cladosporium spp.

and Penicillium spp. Out of 28 samples from

buffaloes, 8 were positive for Alternaria spp, 2 each

for Candida spp., Cladosporium spp., Aspergillus

flavus and dermatophytes, 1 each for Cephalosporium

spp. and Mucor spp. Among 29 samples from goats,

4 were found positive for Alternaria spp,, three for

Penicillium spp., 2 for Cladosporium spp., and 1 each

for Candida spp., Cladosporium spp., Curvularia spp.

and for Cephalosporium spp. Out of 13 samples of

cattle, 3 were positive for Candida spp., 1 for

Fusarium spp., and 1 for Microsporum gypseum.

Twenty nine samples from calves were also collected,

5 were positive for dermatophytes and 3 for each

Alternaria spp. and Aspergillus flavus. Among 11

samples from sheep, 5 were positive for Alternaria

spp., 2 for Cladosporium spp. and 1 for Trichophyton

spp. Out of 7 samples from horses, 3 were positive

one each for Aspergillus flavus, Aspergillus spp. and

Alternaria spp. Three of 8 samples from human beings

were positive for Candida spp. and 1 each for

Fusarium spp., Alternaria spp. and Aspergillus niger.

3 9

In addition, 2 impression slides of female Bengal tiger

were found negative for any of the fungal agents.

5. PARASITIC DISEASES

(a) Canine toxocarosis

A total of 558 faecal samples of dogs (278

stray dogs and 280 pet dogs) in and around Bareilly

were screened for T. canis infection. An overall

prevalence of 24.3% (31.29% stray and 17.5% pet)

was recorded in dogs. Among the 86 stray pups

screened, 54 (62.79%) were found positive for T.

canis eggs in their faeces. On the contrary, only 7.8%

adult stray dogs were positive (7/89). Infection rates

in male and female stray pups were 61.22% and

64.86%, respectively; whereas in adult stray dogs,

5.88% males and 10.52% females were infected.

Among the 103 pet pups screened, 43 (41.74%) were

found positive for T. canis eggs, whereas out of 177

adult pet dogs screened, only 6 (3.38%) were found

positive. In the young pet dog population, 43.86%

males and 39.13% females were positive. In dogs

where the age and sex could not be determined

25.24% (26/103) were positive.

Out of the 327 soil samples collected in and

around Bareilly, 42 (12.84%) were found to contain

the eggs of Toxocara species. Out of 94 samples

examined from public parks, 16 (17.02%) samples

were positive for Toxocara species eggs. A

prevalence of 13.33% was recorded in door mat dusts,

11.71% in the samples of road sides/ sidewalks and

8.33% in samples from playgrounds.

(b) Animal cryptosporidiosis

Faecal samples of 502 domestic animals

(cattle, buffalo, sheep and goat), collected from 8

different states, were examined microscopically for

the presence of Cryptosporidium spp. oocysts. State

wise prevalence is presented in Table 5. Age wise

prevalence revealed higher infection rate (33.72%)

in calves below 1 month of age. The infection was

higher in diarrhoeic (25.56%) than in non-diarrhoeic

(3.33%) calves. Highest prevalence was noticed in

monsoon (23.3%), followed by premonsoon (9.91%)

and post-monsoon seasons (6.85%)

Table 5: Prevalence of Cryptosporidium spp. in

domestic animals and man

State No. of No. %

Samples Positive Prevalence

Uttar Pradesh 203 49 24.13

Uttarakhand 76 18 23.68

Haryana 25 0 0

Bihar 32 4 12.50

West Bengal 53 6 11.32

Gujarat 12 2 16.60

Karnataka 96 4 5.20

Kerala 05 0 0

Total 502 83 16.53

(c) Poultry coccidiosis

Poultry droppings were collected from 35

broiler (27-U.P. and 8-Uttarakhand) and 14 layer farms

(9-U.P. and 5-Uttarakhand). Besides these, 9

samples (6-U.P. and 3-Uttarakhand) were also

collected from backyard poultry. 88.6% broiler farms,

71.4% layer farms and 77.8% backyard poultry were

positive for Eimeria spp. oocysts.

The oocysts were harvested from the poultry

droppings of individual farms separately and genomic

DNA were extracted using genomic DNA isolation

kit. Multiplex PCR based on SCAR markers and ITS-

1 based nested PCR for species level identification

of Eimeria oocysts of poultry were standardized.

Based on the results, E. tenella, E. acervulina, E.

maxima, E. necatrix and E. mitis were the

predominant species in poultry farms of U.P., while

E. acervulina, E. maxima, E. tenella, E. praecox and

E. mitis were predominant species in Uttarakhand.

(d) Gastrointestinal parasites

District wise map of gastrointestinal parasites

in Rohilkhand region was developed. In different

zones, Haemonchus, Oesophagostomum and

Trichostrongylus spp. were recorded. Haemonchus

infection was predominant throughout the year

whereas Oesophagostomum and Trichostrongylus

infection found prevalent during rainy and winter

seasons, respectively. Bioclimatograph for

Haemonchus infection has been prepared for

Rohilkhand region. Favourable months for pasture

infection to livestock recorded during August to

November based on pasture larval burden (L3 /kg

DH)

A total of 1433 and 43 faecal samples of goats

and calves, respectively were screened by

qualitatively and quantitatively faecal analysis method

to study the endoparasites prevalence in different

seasons over the year. The results indicated that

the endoparasite particularly strongyles infection was

present throughout the year and the mean egg per

gram (EPG) between 900-4200. The highest EPG

was observed from April to November. However, the

infection was also noticed in winter months (December

to February) though the intensity of infection was less.

The faecal samples were cultured for L3 larvae and

the predominant strongyle parasites found in this area

were: Haemonchus contortus (throughout year),

Teladorsagia circumcincta (November to March),

Oesophagostomum columbianum (throughout the

year with medium level of infection), Bunostomum

trigonocephalum (sporadic) and Trichostrongylus spp

(All seasons except severe winter) (Fig. 33). In sub-

population structure study on H. contortus revealed

knobbed (60%) form was predominant in Mukteswar

region though linguiform (20%) and smooth form

(15%) also observed.

4 0

Total of 53 gastrointestinal tracts of goats were

screened for GI parasites and it also revealed

strongyle as observed in faecal culture analysis.

Along with strongyles, adult and immature

amphistomes were also observed from GI tracts;

however, the rate of infection was very low. For

molecular identification of different strongyles

composition in field population, beta-tubulin PCR-

RFLP, PCR for ITS-1 and 2 on Haemonchus

contortus, Trichostrongylus colubriformis were

standardised and also ITS-2 of Paramphistomum

epiclitum were cloned, sequenced (JF834888) and

characterised.

Fig. 33: Various parasites isolated from Mukteswar

(e) Canine parasitic diseases

Faecal samples were collected from 413 dogs

with digestive system ailments, brought for treatment

in the Referral Veterinary Polyclinic. Blood samples

of these animals were tested for haematological and

haematobiochemical parameters. A total of 10.89%

dogs were found positive for gastrointestinal parasites

which included 6.055% cases of Ancylostoma

caninum and 4.84% had mixed infection of

Ancylostoma caninum and Toxocara canis. The

positivity percentage of males and females affected

were 14.4 and 6.21, repectively.

(f) Fishborne parasites

A total of 123 economically important

freshwater fish of 10 different species such as Catla

catla (n=10), Oreochromis niloticus (n=24), Puntius

gonionotus (n=19), Labeo rohita (n=12), L. bata

(n=14), Notopterus chitala (n=7), Cirrhinus mrigala

(n=9), Arius tenuispinus (n=17), Cyprinus carpio

(n=11) and Nematolosa nasus (n=9) were

metacercarial stage of digenean trematodes. Out of

161 samples (tissue muscles and head), prevalence

of metacercarial stage of digenean trematodes was

found in 18.35% samples. On species-wise

comparison, encysted metacercariae of digenean

trematodes were highest in O. niloticus (35.48 %)

followed by in P. gonionotus (30.43 %), A. tenuispinus

(29.41%), L. bata (16.66%), C. carpio (15.38%) and

N. nasus (11.1%), whereas rest of the fish species

examined did not harbour the trematodes.

6. OTHER DISEASES

(a) Calf diarrhoea

A total 72 faecal samples were collected from

diarrhoeic calves from C&B farm, IVRI. Out of which,

61 samples were found to be positive for E. coli on

cultural examination. The E. coli bacteria were further

confirmed by PCR and were subjected to antibacterial

sensitivity test against common antibiotics. Among

the other pathogens, 11, 8, 13 samples were found

to be positive for rota virus, corona virus and

Cryptosporidium spp., respectively. Few samples

were of mixed infections.

(b) Abortion in dairy animals

Twenty three (20 IVRI, 3 Bareilly local) cases

of abortions were investigated, post-mortem was

carried out and gross lesions were recorded. The

morbid samples were collected for histopathological

and microbiological diagnosis of the abortions. The

vaginal swab and blood serum samples were also

collected from the aborted dam. Among these 23

cases, 19 cases were of cattle and 4 of buffaloes.

Sixteen abortions occurred in the 3rd trimester (7-9

months) while 7 in 2nd trimester (4-6 months). In some

cases foetus carcasses revealed vascular

congestion in lungs, liver, kidneys, brain and serosal

haemorrhages over the stomach. The stomach

contents were reddish brown in colour in few cases,

while gruel like in others. Four aborted cattle serum

samples were found positive for Brucella antibodies.

E. coli was isolated from stomach contents of 2 cattle

aborted foetuses as well as vaginal swabs. Two

aborted cattle had shown the history of repeat

breeding and inseminated twice.

7. INVESTIGATIONS BY CADRAD

A total of 1276 samples including 407 serum

and other clinical (646), morbid (131) samples were

collected/received for bacteriological analyses from

the states of UP (836 ), UA (201), JK (84), Punjab

(25), West Bangal (5), Odisha (16) and Rajasthan (9)

of these 407 were serum, 646 clinical and 131 morbid

samples. These samples belonged to different animal

species viz. cattle, buffalo, caprine, canine, ovine

and swine. After bacteriological processing of

samples isolates of 92 different bacterial spp. were

4 1

isolated. The isolates were characterized by colony

characteristics, morphology, biochemical reactions

and sugar fermentation tests. From the serum

samples, 374 were tested for brucella antibodies and

14 were found positive. A total of 70 animals were

screened for TB and JD belong to UP and UA. The

observation of skin reaction as made after 72 h, no

animal showed positive reaction for tuberculin and

Johnin testing. Apart from this 26 serum samples

were tested for mucoplasma and two were found

positive from Jammu and Kashmir. Seven sera

samples were tested for Leptospiral antibodies. Total

836 biological samples (sputum, milk, dung and urine)

from 246 animals from different military farms across

the country were examined for presence of acid fast

bacterium. Only three were found positive in ZN

smear microscopy.

A total of 1105 clinical and morbid samples

including 813 serum samples, 139 semen samples,

90 tissue blood samples/swabs and 63 faecal

samples from different states were analyzed for IBR,

PPR, FMD, classical swine fever, canine parvovirus,

swine pox, sheep pox, JE and ICH. 105/280 serum

samples from U.P., U.K., Odisha, Punjab, Nagaland,

and 32/76 semen samples from, UK and U.P. were

found positive for IBR. 3/26 tissue, 8/13 serum

samples from Punjab, Haryana and U.P. were found

positive for classical swine fever, 3/6 serum samples

and 28/62 faecal samples found positive for CPV

(U.P. and Odisha), 1/1 tissue as tested positive for

CPV (UP). 116/174 samples (serum, stool, nasal

swab, ocular swab, rectal swab, tissue) were tested

positive for PPR (UK, Bihar, J&K and U.P). 30/31

samples (semen, serum and tissue) were tested

positive for FMD (U.P., U.K. and J & K), 9/43 samples

(serum, tissue) were tested for sheep pox from H.P.,

1/1 sample was tested for ICH (U.P.) and 1/1 tissue

sample tested positive for CAV-2.

A total of 594 biological specimens, including

369 morbid tissues, 204 clinical (blood/serum) and

21 carcasses of 9 species including wildlife received

from UP, UA, Rajasthan, Haryana, MP, Jharkhand,

Chhattisgarh, HP, Tripura, Kerala, Bihar, Odisha and

West Bengal were processed for pathomorphological,

hematobiochemical, special staining, immuno-

histochemistry (FAT) and PCR methods. The results

revealed rabies (UP), pasteurellosis (UP), Fasciolosis

(UP), suppurative bronchopneumonia (UP), fatty liver,

toxemia, FMD (UP and UK) in buffaloes;

granulomatous pneumonia (TB) (UP), gangrenous

myositis (BQ) (Odisha), Theileria sp. infection

(Chhattisgarh), FMD (UP, UK), anemia (UP,

Chhattisgarh) in cattle; PPR (UP), sheep pox (HP),

intestinal schistosomosis (Raj.), plant toxicity (UK)

in sheep; verminous pneumonia (UK), nephrosis,

hemocidrosis (UK), anemia (UP) in goats;

hemangiosarcoma, anemia, nephrosis (UP),

septicemia (UK) in horses; rabies (UP, UK), anemia,

urinary calculi (UP), suppurative bronchopneumonia,

metastatic calcification in vessels, chronic interstitial

nephritis, hepatoses, CPV, (MP), leptospirosis (Bihar)

in dog; swine fever (Haryana), pasteurellosis (UA),

aflatoxicosis, necrotic hepatitis, splenitis (UP),

granulomatous hepatitis (Schistosomosis) (WB) in

pig; chronic hepatitis, debility and heptoses (Lion),

pulmonary congestion (Tiger), toxicity (Peacock),

chronic necrotic hepatitis and enteritis (Spectacled

languor), bronchitis, fatty liver, necrotic hepatitis

(Civet cat), congestion and lung edema (Shock) in

Bison, leptospira in Panther (Raj.), ICH (Sloth bear)

(Bihar), verminous pneumonia (Leopard) (UK), bird-

flu (Crow in Jamshedpur) in wild life; hepatic

coccidiosis in the rabbit (Chhattisgarh).

For toxicological analysis,150 samples

including feeds, fodder and biological materials were

analysed for the presence of various toxicological

agents. Out of 44 samples of compounded livestock

feed (cattle & buffalo-17, poultry-12, pig-06, horse-

03, rabbit-06 and feed ingredients-06) analyzed for

aflatoxin-B1, a major feed contaminant, 16 feed

samples (C&B-06, Pig- 04, Poultry- 04, Rabbit- 02)

were found positive. The concentration of AFB1

ranged from 0. 1 to 2.0 ppm, which is higher than the

permissible levels in cattle/poultry feed. Out of 06

feed ingredients analyzed for presence of aflatoxin-

B1, one sample (Maize) was found positive. These

samples were also analyzed for other mycotoxins.

Four feed samples were found to contain Ochratoxin-

A and two feed samples were positive for T-2 toxin.

A total of 07 fodder samples, suspected for cause of

mortality in animals, were analyzed for the presence

of various toxicants and one sample was found to

contain hydrocyanic acid. Toxicological analysis of

various morbid samples i.e. liver (35), kidney (20),

rumen contents (10), intestinal contents (13) stomach

contents (07) and gizzard contents (08) from various

species was carried out for toxicants like alkaloids,

heavy metals, nitrate/nitrite, pesticides, phosphine

etc. One sample of poultry liver was found to contain

aflatoxin B1 (0.2 ppm). A total of 18 samples (liver-

06, kidney -03, rumen content -02 and gizzard content-

07) were found to contain an organochlorine group of

insecticide (probably BHC/ Lindane). These samples

were associated with mortality in deer and peacocks.

A blood smears/blood samples of different

animals were examined and 25 were found positive

for blood protozoan infection, names babesiosis and

trypanosomosis in horses and theileriosis in cattle;

out of 285 faecal samples from different animals, 98

were positive for different gastro-intestinal parasites;

11 skin scrapings of different animals were examined

and all were found negative for mange mites; two

specimens received were identified as Tabanus and

Haematopinus spp.; 410 preputial washings from

4 2

cattle and buffalo bulls received were cultured and

were found negative for Trichomonas foetus infection.

A total of 397 sera samples of 5 species of

animals (bovine, caprine, swine, canine and equine)

collected and/or received from 12 sources (Tekanpur,

Jharkhand, Gurgaon, Odhisa, Mukteshwar,

Chatishgarh, Rishikesh, Meerut, Bareilly, Mathura,

and Kerala) were tested for brucellosis. Altogether

40 samples (10.08%) of bovine were found positive.

Screening of bovine herd for Tuberculosis and

Paratuberculosis was also carried out. A total of 506

cattle which belonged to Military Dairy Farm, Bareilly

and IVRI, Mukteswar were screened for tuberculosis,

out of which 67 animals of military dairy farm, Bareilly

were found positive to tuberculin test while none of

the animals of IVRI, Mukteswar were found positive.

Ninety nine animals of IVRI, Mukteshwar were also

screened for paratuberculosis but none of them were

found positive.

Outbreak investigations

i. At Sardhana, Meerut (18.4.11) 13 animals

(buffalo-07, cattle-06) were confirmed for rabies

in these animals.

ii. At Chinbauli, Uttarkashi (UK) (18.4.2011) 60 out

of 300 goats died due to PPR were investigated.

iii. General health checkup of horses of Dr. B.R.

Ambedkar, PTC Moradabad was carried out (6-

5-2011).

iv. Disease investigation in GADVASU dairy farm

carried out on 28.5.11. Total 35 buffalo calves

reported dead within 5-6 d time after showing the

symptoms of respiratory distress and swelling

around the neck. The mortality was attributed to

Pasteurellosis.

v. General health check up of cattle at Chak Gajaria,

Lucknow was carried out on 29-8-2011.

vi. General health check up of horses of Dr. B.R.

Ambedkar, PTC Moradabad was carried out on

7.9.11. Total 12 animals were found to be affected

with different affections of bone, hoof ailments

and dermatitis.

vii. Testing of breeding bulls at ULDP Shyampur,

Rishikesh was carried out on 12-9-2011.

viii. Disease investigation in animals of village

Mohammadpur Devmal, block Mandavar District

Bijnor was carried out on 25.9.11. The animal

population was 2000 (Cattle-500, buffalo-1500).

Total 21 animals (He buffalo-2, she buffalo-10,

cow-05, bullock-03, horse-01) were reported to

be dead in about 1 month time after showing the

nervous symptoms. The disease was diagnosed

as rabies.

i. Disease investigation in pigs at French Farm,

Gurgaon, Haryana was carried out on 21-22

October, 2011. Total 207 out of 375 pigs reported

dead in last 2 months. The disease was

diagnosed as swine fever.

ii. Disease investigation in pigs at Govt. Livestock

and Agricultural Farm, Sitapur, U.P carried out

on 4.11.11. Thirtyfive young pigs (3 to 6 month

age) out of total 170 pigs (26 male, 9 female)

were reported died in 1 month time with the

symptoms of high fever, respiratory distress,

staggering. The disease was diagnosed as

aflatoxicosis.

iii. The flood affected areas of district Jagatsinghpur,

Jajpur, Puri and Khurda of Odisha were visited

during 14-19 November, 2011 to assess the

animal losses as a result of flood.

iv. Mortality in crows at Jamshedpur was

investigated on 18-19 November, 2011. More

than 1000 crows reported died. The samples sent

to HSADL from Project Directorate on Cattle,

Meerut were found positive for H5N1.

v. Serum and semen samples were for IBR and

Blue tongue testing. (20 and 21 December 2011).

vi. Disease investigation in horses at Allahabad was

carried out on 29-12-2011 and was found to be

Glanders.

vii. Outbreak in poultry birds at Tripura was

investigated on 30-12-2011 and the mortality was

found to be because of R.D.

viii. Disease investigation in village Shiv Nagar,

Champatpur, Block Majhwagan, Bareilly was

carried out on 21-01-2012. 13 blood, serum and

fecal samples were analyzed, some of the animals

showed decreased hoemogram values indicating

anaemia.

ix. Disease outbreak in goats at Purnia, Bihar was

attended on 24-01-2012. 95 goats out of 351 died

due to PPR.

x. Disease investigation in Durgapur and Maghra

Karik Nagal Village, Block Kanalganj/

Mohammadabad,Distt. Farukhabad was carried

out on 14.03.2012. Blood, serum and faecal

samples were collected for investigation. The

disease was diagnosed as FMD.

xi. Disease investigation in Nagla Madhi Village,

Block Sheetalpur, Etah was carried out on

16.03.2012. Blood, serum, oral swab and morbid

samples were collected for Foot and Mouth

disease. The disease was diagnosed as FMD.

xii. Disease investigation in Kursena Village,

Jaswantnagar, Distt Etawa was carried out on

21.03.2012. Blood, serum and faecal samples

were collected for bacterial infection,

gastrointestinal parasitism and foot and mouth

disease. The disease was diagnosed as FMD.

8. MORTALITY PATTERN AND CAUSES OFDEATH AMONG LIVESTOCK, POULTRY ANDWILDLIFE

Bovines: A total of 60 bovine carcasses (25 belowsix months and 35 above six months of age) were

necropsied. Among the calf carcasses, 13 were

4 3

males and 12 females. Gastro-enteritis was the major

pathological condition (3/25) causing mortality among

calves. Pneumonia, hepatitis, septicemia, arthritis,

premature births were the other important causes of

death. Out of 35 cattle carcasses (above six months

of age), 17 were cattle received from LPM (C&B)

and remaining were from other divisions/ sections of

Institute. Tuberculosis (02), endometritis (02),

mastitis, gastroenteritis, anemia, singly and in

combination were recorded.

Buffalo: A total of 17 buffalo (8 calves + 9 adults)carcasses were received for disease diagnosis.

Among young animals, 6 were males and 2 females,

while in adults 7 were females and 2 males. Major

causes of deaths in young animals were- enteritis

(3, 17.65%), septicemia (2, 11.76 %), pneumonia (1,

5.88 %), suppurative arthritis (1, 5.88 %), pneumonia

(1, 5.88%) and pneumo-enteritis (1, 5.88%). The major

causes of mortality in adult buffaloes were pneumonia

(2, 11.76 %), chronic pericarditis (1, 5.88 %),

septicemia (1, 5.88 %), trauma (1, 5.88 %),

haemorrhagic gastro-enteritis (1, 5.88 %), rumen

impaction (1, 5.88 %), hepatitis (1, 5.88%) and no

abnormal detected (1, 5.88 %).

Goats: One hundred seventy five goat carcasses(99-male and 76-female) were received from various

Divisions/ Sections of the Institute for necropsy 10

animals were of less than 1 month of age, 56 were 1-

6 month and 45 were of 7-12 month and 64 were

above 1 year. Major causes of mortality among

included haemonchosis (16.00%) followed by

pneumonia (15.42%), debility (12.00%), enteritis

(11.4%), gastroenteritis (6.85%), cold shock (2.85%),

metritis (1.71%), tympany/ruminal impaction (1.71%),

traumatic injury (1.14%), coccidiosis (0.571%),

hepatic rupture (0.571%), exp. pasteurellosis

(0.571%), expt. mycoplasmosis (0.571%) and

experimental listeriosis (0.571%). Forty nine (28%)

cases couldnot be diagnosed due to advanced stages

of putrefaction/autolysis.

Sheep: Forty one sheep carcasses (19-male and22-female) were received from various Divisions/

Sections of the Institute for necropsy 3 animals were

in less than 1 month old, 1 in 1 - 6 month and 5 were

in 7-12 month and 31 were above 1 year. Major

causes of mortality were pneumonia (19.5%) followed

by enteritis (14.63%), gastroenteritis (12.19%),

haemonchosis (12.19%), septicemia (7.31%), exp.

Trypanosomiasis (4.87%) and debility (4.87%). Ten

cases (24.39%) couldnot be diagnosed due to

advanced stages of putrefaction/autolysis.

Swine: In total, 74 pigs from the Swine ProductionFarm of the institute were received for necropsy

examination. The proportional mortality rate (PMR)

was highest (37.8%) in piglets below one week of

age and the causes of mortality were trauma,

pneumonia and enteritis. In piglets below one month

of age, the PMR was 16.2% and the causes of

mortality were pneumonia and enteritis. In piglets

aged 1-3 months, the PMR was 36.5% and the causes

of mortality were enteritis and pneumonia, which was

found together in many cases. Some of the

pneumonic cases revealed fibrinous pleuritis and

histopathologically most lesions were characterized

as interstitial pneumonia with varying degrees of

secondary bacterial infections. In a proportion of the

enteritis cases, fibrinonecrotic lesions were seen in

the large intestines. Polyserositis, peritonitis and

ascites were the other causes of death in this age

group. In growers (4-9 months old) the PMR was 8.1%

and the major causes of mortality were pneumo-

enteritis and CSF. The single mortality in an adult

pig was due to septicaemia. A total of 21 suspected

CSF outbreaks in Uttar Pradesh were investigated.

Generally, CSF outbreaks were recorded in small

holdings (30-40 animals), where vaccination had not

been done. The mortality rate varied between 25 to

75% and the case fatality rate was highest in young

weaners.

Canines: A total of nine necropsy of dogs wereconducted and important conditions diagnosed were

rabies (03), parasitic enteritis due to Diplidium

canninum (02), parasitic nodules in oesophagial wall

(Spirocerca lupi- 01) and pneumonia (02).

Equines: Two equine carcasses were necropsied.Parasitic gastritis and debility was diagnosed in one

case. The other animal died due to severe traumatic

injuries as result of severe colic due to enterolith.

Wildlife: A total of 109 carcasses of different speciesof wild animals (tiger-1, leopard-2, spotted deer-1,

black buck-5, neelgai-2, ghariyal-3, turtle-76, pangolin-

1, monkey-2 and langur- 1) were necropsied. The

important diseases/ conditions diagnosed included

trauma and shock ( due to in fighting and automobile

accidents) in majority of carnivores and cervids,

dystokia due fetal mis-presentation and gangrenous

pneumonia in chital and hepatitis in black buck. In

turtles disarticulation of cervical vertebrae leading to

severing of spinal cord and instantaneous death were

main findings. Formalin fixed tissues from 69 different

species of wild animals were processed and examined

microscopically. Important pathological conditions

diagnosed were interstitial nephritis with severe

tubular nephrosis in white tiger, interstitial pneumonitis

in serow and bonet monkeys, cholangiocellular

adenocarcinoma replacing most of liver parenchyma

with intrahepatic cholestasis in sloth bear, necrotic

hepatitis in deer and acute fibrino-purulent

bronchopneumonia in deer.

During the year, histopathological (304 tissues

from 69 animals), 102 microbiological (304 tissues

from 69 animals), toxicological (43) and

parasitological (8) and haemato-biochemical (5)

examinations were conducted on tissues/samples

4 4

collected/received from different places and the

reports were sent to the stake holders. In addition,

post-mortem examinations were conducted on 109

animals comprising 2 leopards, 9 blackbuck, 4

spotted deer, 2 nilgai, 3 gharials, 2 crocodile, 80

turtles, 6 peacock, 2 Sarus crane, 2, monkey, 2

vulture, one each of pangolin, tiger, langur, sambhar

and owl. Systemic aspergillosis was found to be the

cause of mortality in one vulture (Gyps himalayensis).

Leptospirosis in both carnivorous as well as

herbivorous species such as tiger, lion, leopard,

panther, spotted deer, buffalo was diagnosed. Even

human staff in one of the zoo was also found positive

for leptospira.

Poultry and other captive birds: A total of 5927

birds comprising 5295 chickens, 240 Guinea fowls

and 392 turkeys received from CARI poultry farms

were necropsied. The significant disease conditions

diagnosed upon necropsy were Marek's Disease,

lymphoid leucosis, ranikhet disease, air sacculitis,

colibacillosis, coccidiosis, fatty liver kidney

syndrome, ascaridiasis, visceral gout, enteritis, heat

stroke and egg peritonitis. Among Guinea fowls, RD,

egg-peritonitis, E. coli infection, parasitic enteritis and

deficiency disorders were the main causes of deaths.

In turkeys, significant diseases encountered were E.

coli infection, hepatitis, egg peritonitis and debility.

A total of 108 ailing or dead birds of different species,

age groups and breeds/strains were received from

various Govt. and Private Poultry Farms (42) of 5

states viz. UP, Uttrakhand, Rajasthan, J&K state

and Jharkhand. The main disease conditions

diagnosed on the basis of laboratory tests including

histopathology, serology and isolation of causal

agents in these farms were mixed infection of E. coli,

mycoplasma and IBD, MD, coccidiosis, ascites, egg

peritonitis and fatty liver. Diagnosis was also given

on formalin fixed tissue specimens referred by various

State Poultry Farms, Disease Diagnostic Laboratories

and National Zoological Parks. Histopathological

diagnosis on referred specimens revealed acute toxic

hepatosis in peacock, visceral gout in steppe eagle,

pox in pigeon and collangiocellular carcinoma in green

pheasant. Etiological investigations included 38

samples either freshly collected or preserved in 50%

glycerine saline for virus isolation, 17 for fungal

isolation and 18 for coccidia. Various etiological

agents isolated/ demonstrated were RDV, IBDV, IBV,

E. coli, Coccidia and Aspergillus fungi. Serological

investigations on 105 sera samples, 21 bursa of

Fabricius and 28 feather follicles revealed presence

of antibodies to IBV, IBDV and RDV. IBD antigens

in bursa of Fabricius and MD antigens in feather

follicles were also detected by immunodiffusion test.

Disease investigation was also carried out on dead/

morbid materials of various wild birds/zoo birds,

captive and migratory birds viz. peacocks, pigeons,

ducks, owl, pheasants, Himalayan Griffon vulture,

Steppe eagle, and Siberian crane.

9. MAINTENANCE OF REGISTRY OFPATHOLOGY AND ONCOLOGY

A total of 977 specimens of important

pathological conditions were maintained in the registry

museum. System wise catalogued specimens

included gastrointestinal-238, reproductive-184,

respiratory-159, urinary system-89, cardiovascular-

89, lymphatic-72, haemic-25, muscles and bones-

23, nervous-13, and miscellaneous-90. Two new rare

specimens were incorporated which included

'disseminated intravascular coagulation' in cattle

where all the internal organs- like liver, kidneys and

lymph nodes showed marked haemorrhages. Cut

surface of liver showed multiple circumscribed lesions

of haemorrhages throughout the parenchyma.

Another case was 'diprosopus condition' in a newborn

piglet which had 2 faces with a single head on a single

trunk. It is one of the rarest craniofacial malformations

and a rare form of conjoined twinning.

10. INVESTIGATION ON DISEASES, SERO-PREVALENCE AND ANIMAL HUSBANDRYPRACTICES IN NWHR

Investigations were conducted on various

materials received from different sources such as

private farms and Government Institutions. The

animals (8) received for post mortem examination

included goats (5), rabbit (1), Himalayan civet cat (1)

and leopard (1). The important observations at

necropsy were cachexia, gastroenteritis, renal oedema

and infarction in goats; chronic hepatopathy in

Himalayan civet cat, and pulmonary haemorrhages

and intestinal nematode infestation in leopard.

Histopathological processing and examination of

tissues was carried out in 129 cases including those

of rabbit, poultry (chicken, quail), mare, buffalo,

sheep, goats and wildlife (lion, hog deer, monkey,

Himalayan civet cat, leopard). The major microscopic

findings included sheep pox disease, verminous

pneumonia in sheep and goats; glomerulo-nephritis

and haemorrhagic gastritis in goats; renal amyloidosis

and severe diffuse interstitial nephritis and hepatitis

in mare; fibrino-purulent pneumonia and pericarditis

in lion; and multifocal glomerulo-nephritis and hepatitis

in Himalayan civet cat. A total of 60 blood samples

from goats, 1 cow, 3 leopards and 2 lions were

subjected to haematological tests such as, estimation

of haemoglobin, packed cell volume, total erythrocyte

count, total leucocyte count and differential leucocyte

count. Physical, chemical and microscopic

examination of urine was done for 6 cows suspected

to be suffering from Enzootic bovine haematuria and

urine samples of goats (60) maintained on sole oak

leaves feed. Faecal examination was done in 60

samples including those from cow (56), buffalo (2),

bullock (1) and dog (1). The major parasitic eggs

4 5

observed included Paramphistomum and Strongylus

spp. mixed infection (4), Fasciola hepatica and

Strongylus spp. mixed infection (2), Paramphistomum

and Moniezia spp. mixed infection (2), Moniezia and

Strongylus spp. mixed infection (2), Toxocara

vitulorum and Paramphistomum spp. mixed infection

(2), Fasciola hepatica and Paramphistomum spp.

mixed infection (1), Trichuris and Paramphistomum

spp. mixed infection (1), Fasciola hepatica (2)

(Buffalo-1), Strongylus spp. (4), Paramphistomum

spp. (11), Toxocara vitulorum (3), Trichuris spp. (1),

Ancylostomum caninum (1) (dog) and negative (27).

Culture sensitivity test was done in 16 samples from

human beings and one bullock. Field visits were

organized in 8 villages of district Kangra and Mandi,

Himachal Pradesh, to study the animal husbandry

and health practices and technical know-how was

provided on the queries raised by the farmers.

6. EXOTIC AND EMERGING DISEASES

(1) AVIAN INFLUENZA

(a) Vaccine development

(i) Development and evaluation of neuraminidaseDIVA marker vaccines against highly pathogenicH5N1 avian influenza viruses in chickens:Antigenic and genetic analysis of Indian isolates of

highly pathogenic avian influenza H5N1 viruses from

Indian outbreaks from 2006 to 2010 for selection ofhaemagglutinin gene donor vaccine candidate

revealed no major antigenic differences among these

viruses in the four antigenic sites of HA1 sequence,

except for few differences in the antigenic site B.

Based on the 3-D and 2-D antigenic cartography (Figs.

34 and 35) constructed on cross-HI data, H5N1 strain

A/chicken/West Bengal/80995/2008 was selected asthe best fit HA gene donor for reverse genetics based

DIVA marker vaccine. For development of reverse

genetics based non-pathogenic H5 vaccine strain,

the basic amino acid cleavage site RRRKKR*GLF in

the HA gene of H5N1 strain A/chicken/West Bengal/

80995/2008 was modified to IETR*GLF by sitedirected mutagenesis so that the recombinant virus

made through incorporation of mutated HA gene in

the reverse genetics backbone of type A influenza is

non-pathogenic and hence can be used as a vaccine

candidate.

Fig. 34: Antigenic map (3-D) of selected H5N1 influenza

viruses isolated at HSADL from 2006 to 2010. As shown

in the map, strain 80995 is located in the centre of all the

three axes of the map, hence, would be at a minimum

distance from all other viruses representing a best fit as

an HA gene donor virus.

Fig. 35: Antigenic map (2-D) of selected H5N1 influenza

viruses isolated at HSADL from 2006 to 2010. The relative

positions of strains (coloured with full virus name) and

antisera (grey coloured with only number format) were

adjusted such that the distances between strains and

antisera in the map represent the corresponding HI

measurements with the least error. The periphery of each

strain denotes the total error; thus, size and shape

represent a confidence area in the placement of the strain.

The vertical and horizontal axes both represent antigenic

distance. The spacing between grid lines is 1 unit of

antigenic distance - corresponding to a twofold dilution

of antiserum in the HI assay. As evident from the map,

the antisera against H5N1 strains - 142119, 100879,

155505, 80995 and 81760 are at a position in the map,

where most of the viruses are covered within two units of

antigenic distance (2 grid radius).

(ii) MicroRNAs differentially expressed in chickenlungs during H5N1 infection target immuneresponse genes and genes in the influenza Apathway: Four novel chicken miRNAs were identifiedfrom the high throughput sequencing data. 3135 target

genes were identified for the 36 upregulated and 5655

target genes were identified for the 90 down regulated

miRNAs databases namely miRDB and TargetScan.

389 genes involved in chicken immunology and 21

genes involved in the influenza A pathway were

predicted to be targets of the upregulated miRNAs,

while 677 genes involved in chicken immunology and

51 involved in the influenza A were predicted to be

targets of the downregulated miRNAs. Target sites

of several of the differentially expressed miRNAs

were identified in the segment 2 and segment 8 of

H5N1.

(b) Diagnostic development

(i) Development of an immunochromatographictest for the diagnosis of avian influenza virusinfection in chicken: The recombinant M1 and NPhas been expressed by induction of recombinant

E.coli BL21(DE3)pLyS with 1mM IPTG. The

recombinant proteins were bulk purified under native

conditions. Two sets of mice were inoculated with

AIV rM1 and rNP separately. The spleenocytes from

immunized birds were fused with myeloma cells and

4 6

selected 10 hybrids of M1 ab and seven hybrids of

NP ab were subcloned and MAbs were characterised.

The MAbs produced by rM1 hybridoma subcloneswere tested for their reactivity in dot blot and western

blot. They produced intense reaction with rM1 and

M1 of AIV H5N1. They did not react with allantoic

fluid from control SPF, NDV, bacterial cell Lysate or

with other HIS tagged recombinant proteins (NP of

AIV and Nipah Virus). However, they also did notreact with AIV H9N2 and SIV H1N1. Ten high reactive

clones have been cryopreserved. The MAbs produced

by rNP hybridoma subclones were tested for their

reactivity in dot blot and western blot. They produced

intense reaction with rNP but produced a mild reaction

with AIV H5N1.

(c) Characterization of viruses

The HA gene of 10 H5N1 viruses isolated fromWest Bengal (2), Jharkhand (1), Bihar (1), Meghalaya

(1) and Tripura (5) were sequenced. Further, the PB1

gene of 15 H5N1 viruses (Meghalaya-2, West Bengal-

2, Maharashtra-2, Jharkhand-2 and Tripura-7) were

also carried out. The phylogenetic analysis of HA

and NA genes indicated that the 2011-2012 H5N1viruses belonged to clade 2.3.2.1 and the 2008

viruses belonged to clade 2.2 H5N1 viruses (Figs.36

and 5). The PB1 gene of some of the clade 2.3.2

viruses isolated from chickens in Meghalaya grouped

with the unknown lineage of H9N2 viruses isolated

from Tripura in 2008 and Haryana in 2005 indicatingreassortment between the two subtypes of avian

influenza viruses (Fig.37). The antigenic relationship

of 16 clade 2.3.2 viruses isolated from various states

with that of clade 2.3.2 viruses isolated from Tripura

in 2011 and clade 2.2 virus isolated in 2008 was

studied. Antigenic analysis revealed 32 to 256-foldreduction in the HI titres between clade 2.3.2.1 H5N1

viruses and clade 2.2 viruses indicating that these

nine clade 2.3.2 isolates were antigenically similar

to Tripura clade 2.3.2 viruses and different from clade

2.2 viruses.

Fig. 35: Phylogenetic relationships of the

haemagglutinin genes of representative H5N1 influenza

A viruses. The tree was rooted to A/Goose/Guangdong/

1/96. Numbers near the node indicate bootstrap values

of ?90%. Clade/subclade are shown to the right. Scale

bar indicates nucleotide substitutions per site. The

isolates in red are sequenced during this year.

Fig. 37: Phylogenetic relationships of the PB1 genes of

representative H5N1 influenza A viruses. The tree was

rooted to A/Goose/Guangdong/1/96. Numbers near the

node indicates bootstrap values of ?90%. The isolates

in red are sequenced during this year.

(i) Pathogenic characterization of the viruses

isolated by IVPI test: The IVP index of 10 H5N1

viruses isolated from Tripura (2 from ducks and 5

from chickens), Jharkhand (2- crows) and West

Bengal (1-chicken isolated in 2008) ranged from

2.525/3.00 to 2.96/3.00 indicating that these isolates

are highly pathogenic to chickens. The IVP index of

one H9N2 virus isolated from a chicken in West Bengal

was found to be 0.325/3.00 indicating low

pathogenicity to chickens.

(d) Disease monitoring and surveillance

(i) Surveillance of Indian poultry and imported

samples: A total of 79,371 samples (45,806 tissue

and 33,565 serum) were received from various parts

of the country for avian influenza virus surveillance

during the year. Out of 44,910 tissue samples tested,

86 samples from nine States (5 from Assam, 6 from

West Bengal, 7 from Bihar, 12 from Jharkhand, 10

from Maharashtra, 5 from Meghalaya, 34 from Odisha,

4 7

Pig sera samples (507) were tested for antibodies

against H1N1 by HI test, 118 samples found positive.

Of the 507 pig sera samples tested for antibodies

against H5 and H9 by HI test, all were found negative.

(3) BOVINE VIRAL DIARRHOEA/BORDER

DISEASE:

(a) Disease monitoring and surveillance:

Diagnostic samples from cattle, buffaloes,

sheep, goats and imported biologicals (bull semen,

FBS, ABS, other biologicals) submitted by various

Govt. and private agencies and collected from field

were tested following the OIE prescribed methods.

A total number of 1096 samples were tested during

the period. Testing of 151 samples submitted through

AQCS showed the presence of BVDV neutralizing

antibodies in four imported FBS, and four adult bovine

serum samples. Of the 166 samples from cattle,

buffaloes and bisons belonging to various states

tested, eight cattle sera were found positive for BVDV

antibodies. Of the 779 samples (390 blood leukocytes

and 389 serum) from sheep, BDV was isolated from

a sheep (both leukocytes and serum) from a farmer's

flock migrating in Madhya Pradesh. Repeat testing

indicated that the lamb was persistently infected with

BDV. A high percentage of sheep (38.5% of 389

tested) were found to possess BDV neutralizing

antibodies.

(b) Effect of si-RNAs on BVDV-1 replication in

MDBK cells

The effect of small interfering (si) RNAs

(synthetic and cocktail) on BVDV replication in

cultured bovine cells showed that the siRNA cocktail

and three synthetic siRNAs produced moderate anti-

BVDV effect in-vitro as shown by 25-40% reduction

in BVDV antigen production, 7.9-19.9-fold reduction

in viral titre and 21-48 fold reduction in BVDV RNA

copy number. The siRNA cocktail was found to be a

better BVDV inhibitor than the earlier reported

individual siRNAs targeting 5'UTR and the structural

envelope region of BVDV can be effective targets

for designing siRNAs.

(c) Alterations in immunocompetent cells and

cytokines in the pathogenesis of acute

Bovine Viral Diarrhoea Virus infection in

sheep

Experimental acute BVDV-1 infection was

induced in 4-month-old lambs through intranasal

inoculation of Indian BVDV-1 isolate, Ind-17555.

Results demonstrated that the Indian BVDV-1

isolated can cause mild to moderate disease in sheep

characterized by mild increase in rectal temperature,

occasional diarrhoea, leukopenia, thrombocytopenia,

enlargement of enteric lymph nodes, lymphoid

depletion, petechiation in spleen, duodenal

congestion, and haemorrhage and bronchopneumonia

One from Uttar Pradesh and 6 from Tripura) have

tested positive for H5N1 virus by isolation. One of

the samples received from West Bengal was positive

by virus isolation but negative by RT-PCR and Real

time RT-PCR tests. Six H9N2 viruses were isolated

from three States viz. Odisha (4), Gujarat (1) and

Maharashtra (1). 18 suspected samples from Bhutan

were received for testing against AIV. Of these, 8

samples were positive for H5N1 virus by Real time

RT-PCR, RT-PCR and virus isolation. A total of 5,792

imported pork and poultry samples were also tested

for isolation and found negative. A total of 30,389

serum samples had been tested and none of the

samples were positive for H5 antibodies. A total of

853 serum samples from day old chicks of imported

grand parent stock have been tested and all the

samples were negative by AGID test.

(ii) Surveillance of avian influenza in migratorybirds: A total of 152 serum and 4490 swabs/tissues/

dead bird samples received from various parts of the

country were tested for avian influenza. Ten samples

from ducks (Jharkhand - 9 and Odisha - 1) were found

positive for H5N1 AIV by Real Time PCR, ELISA

and virus isolation. One each of H11N6 and H4N6

subtypes of avian influenza virus were also isolated

from duck samples collected from Jharkhand State.

(iii) Investigation of H5N1 avian influenza

outbreaks in crows: Reports of unusually highmortality in the crow populations from Jharkhand,

Odisha, Bihar, Maharashtra and Uttar Pradesh were

investigated in detail and the samples from crow

carcasses were tested for the presence of H5N1

influenza virus. A total of 38 crow samples were found

positive for H5N1 virus from all the above states

indicating a serious threat to not only the crow

population in the country, but also to the human and

other livestock population in view of the proximity of

crows to these populations.

(iv) Persistence of H5N1 avian influenza virus:

Persistence of H5N1 avian influenza virus in different

lake and water samples was studied at two different

temperatures. Considerable variation was observed

in the survivability of virus in different water samples

at various temperatures. The survivability of the virus

ranged from 2-5 days in the lake water and up to 10

days in pond water at 24º C. At 10º C, the virus

survived for 7-11 days in lake water and up to 18

days in pond water.

(2) SWINE INFLUENZA

(a) Surveillance of swine influenza (H1N1)

among pig population of India

The serological evidence of swine influenza

was recorded around 23% in pigs and there was no

evidence of any antibody against H5 or H9 Avian

influenza viruses. Pig nasal swabs (495) tested from

different states of India were found negative for H1N1.

4 8

due to secondary infections (Figs.38 and 39).

Immunopathogenesis of acute BVDV-1 infection in

lambs included changes in CD4+ and CD8+ T-cell

subset counts, up-regulation of pro-inflammatory (IL-

1 and TNF-α) and regulatory (IL-10 and TGF-β)cytokines in lymphoid organs.

Fig. 38: Demonstration of BVDV-1 antigen by indirect

immunofluorescent test in a) Brunner's gland of

duodenum and b) tonsil.

Fig. 39: Follicular lymphoid depletion in mesenteric lymph

node of BVDV-1 infected sheep.

(4) MALIGNANT CATARRHAL FEVER

(a) Diagnostic preparedness

Wild bison from Zoo at Bengaluru and a cattle

sample from the state veterinary hospital at Bengaluru

tested positive for ovine herpes virus-2 by OIE

approved primers for diagnosis by PCR and Nested

PCR (Fig.40). The results were confirmed by

sequencing and submitted to Genebank (Accession

No.: JQ801454).

Fig. 40: PCR amplification of tegument region with

primers set Bax-556 and Bax- 755 for outer PCR

Lane 1 Negative control; Lane 2 Positive control;Lane

3 Tissue sample cattle; Lane 5 Tissue sample cattle-2;

Lane 9 Blood sample bison; Lane 11 Tissue sample

sheep; Lane 1, 4, 6, 7, 8, 10 Negative field sample

(5) CRIMEAN-CONGO HEMORRHAGIC FEVER

(a) Diagnostic development

Developed novel molecular beacon probe

based diagnostic test for detection of CCHFV.

(b) Detection and molecular characterization

Detected Crimean-Congo haemorrhagic fever

virus in cattle in India. Phylogenetic analysis of 'S'

segment sequence of CCHFV revealed that the Indian

isolate is closest to Tajakistan virus (AY049083/TAJ/

HU8966) falling in Asia-2 group of the CCHFV (Figs.

41 and 42).

Fig.41: Full length amplification of CCHFV 'S' segment.

Lane 1. PCR product (1.67 Kb), Lane M. 1 Kb ladder

Fig. 42: Phylogenetic tree of CCHFV 'S' segment

constructed using Maximum Likelihood method.

Maximum Likelihood trees with 500 bootstrap replicates

were inferred using MEGA5. Phylogenetic analysis

reveals that Indian isolate falls in Asia-2 group of CCHF

virus.

4 9

(6) WEST NILE FEVER

(a) Diagnostic preparedness and surveillance in

migratory birds

A micro plaque reduction neutralization test

was optimized for detection of West Nile virus

neutralizing antibodies in wild birds. A total of 488

sera samples from different species of wild resident

and migratory birds were tested and 13 samples were

found positive for WNV antibodies by plaque reduction

neutralization test providing serological evidence of

WNV infection. Testing of 177 cloacal swabs, 20 oral

swabs belonging to seven states of India revealed

absence of WNV genomic RNA by real time RT-PCR.

Testing of 29 dead birds sampled from areas showing

high crow mortality during 2011-12 were tested

negative for WNV infection by real-time RT-PCR and

virus isolation.

(7) RABBIT HAEMORRHAGIC DISEASE

(a) Diagnostic preparedness

A total of 183 serum samples were received

from the Animal Quarantine and Certification Services

(Chennai) for the diagnosis of RHD in imported rabbits

and all were found negative by ELISA test.

(8) NIPAH VIRUS

(a) Surveillance in India

There was no evidence of Nipah virus infection

in sampled fruit-bat colonies from West Bengal and

no antibodies against NiV in pigs surveyed from W.

Bengal, Uttar Pradesh, Madhya Pradesh, Tripura and

Assam. Pig sera (240) samples tested for antibodies

against Nipah virus by ELISA and Western Blot and

all samples were negative. Bat urine samples (68)

and pig nasal swabs (113) were processed and tested

by RT-PCR for Nipah virus, all were negative. Bat

urine/faecal samples (78) and swine nasal swabs (15)

were tested for Nipah with Taqman real-time RT-PCR

and all found negative.

(9) PICOBIRNA VIRUS

Picobirna virus, a dsRNA bi-segmented virus

was detected in diarrhoeal cases of cow and buffalo

calves. The genome segment 2 encoding RNA

dependent RNA polymerase has been amplified and

sequenced which also confirms the picobirnavirus

existence in bovines. The virus isolates have been

found to be of genogroup I.

7. DEVELOPMENT OF ALTERNATE

SYSTEM OF THERAPY

(1) HERBAL THERAPY

(a) Development of herbo-mineral formulation for

amelioration of lead toxicity

Experiment I: Ameliorative potential against lead in

circulation was best observed after 60 days in group

given extract of black garlic + zinc sulphate (3.07

ppm). Findings also indicating the immediate effects

of zinc on lead level in blood. The administration of

lead caused a marked increase in the relative liver

weight (10-40%) in all the treated groups, when

compared with negative control (3.56 g/100g b. wt).

However, relative increase in liver weight (g/100g b.

wt) amongst treated groups was least in group given

extract of black garlic + zinc sulphate (4.76). Results

indicated that supplementing zinc salt increased CMI

response

Experiment II: Results of the experiment indicated

ameliorative effect of calcium salt against lead

toxicity, however better results were obtained in

c o m b i n a t i o n w i t h M E D - P K - 5 ( Spirulina powder).

(b) Pharmacodynamic investigations of Entada

pursaetha and its therapeutic potential

Entada pursaetha stem extract referred here

in 'EPE' was investigated for its potential in modulating

the effect on inflammatory processes. Anti-

inflammatory effect of EPE with cellular model of

LPS stimulated RAW 264.7 cells was elucidated.

Some of the key proinflammatory cytokines and

mediators including TNF-α, IL-1β were studied by EIAkit. EPE significantly inhibited the production of TNF-

α, IL-1β and NO in LPS- stimulated RAW 264.7 cellsthan that of single LPS -stimulated cells. Based on

these results EPE in the doses of 20, 30, 50 µg/ml

was found to have anti-inflammatory effect and low

cell toxicity in MTT assay suggesting itse potential

therapeutic application in regulation of inflammatory

responses. EPE was studied for its antioxidant

activity in vitro by iron (III) and Iron (II) reducing activity

and Ascorbate Iron catalyzed phospholipid

peroxidation. EPE showed iron (III) to iron (II) reducing

activity, which increased with increase in

concentration. EPE also showed inhibition of

phospholipid peroxidation, with increase in

concentration of EPE. EPE (30 µg/ml) showed nitric

oxide free radical scavenging activity.

In conclusion, EPE was found to have anti-

inflammatory effect in in vitro system of inflammation

as evident by reduction of TNF-α, IL-1β and NO levelsin culture medium. Extract also possessed

antioxidant activity in in vitro test.

(c) Efficacy studies of some promising essential

oil preparations in experimental and clinical

haemonchosis and fasciolosis

In clinical cases of haemonchosis in sheep,

the formulations (EO-S1 and EO-S2) caused marked

reduction in EPG of Haemonchus contortus.

However, EO-S1 appeared more potent in reducing

EPG as compared to EO-S2. The essential oil

5 0

formulations (EO-S1 and EO-S2) were administered

orally to overnight off-feed sheep at a dose rate of 40

mg/kg t.i.d. at one hour interval with prior

administration of 10 ml Tyrode's solution. The effect

persisted for a period of 14 days. In some sheep,

EPG was reduced to zero while in other sheep there

was 80-90% reduction. In clinical cases of

haemonchosis in goat, both the formulations (EO-

G1 and EO-G2) produced marked reduction in EPG

of H. contortus in 60% of goats.

In experimentally infected sheep with Fasciola

gigantica both the formulations (EO-F1 and EO-F2)

produced diametrically different results. EO-F1

reduced the F. gigantica EPG to zero on 7th day

post-treatment and the effect persisted for one month.

However, EO-F2 did not reduce the EPG.

In conclusion, the essential oil formulations

(EO-S1 and EO-S2) showed marked efficacy against

H. contortus in sheep. Formulations EO-G1 and EO-

G2 produced marked but inconsistent effect against

H. contortus in goats. Formulation EO-F1 exhibited

highly significant efficacy against F. gigantica in

experimentally infected sheep.

(d) Assessment of cardioprotective effect of

herbal preparations

Standardization of the cardiomyopathy or

cardiac injury model in rat was done. Rats were

divided into two groups i.e. control and isoprenaline-

treated rats. Isoprenaline was used to create the

myocardial injury and infarction in the rat heart.

Different parameters were analyzed in control and

isoprenaline-treated rats as blood pressure, heart rate,

body weight, serum lactate dehydrogenase (LDH),

creatine kinase-myocardial band (CK-MB), triglyceride

and tissue lipid peroxidation, superoxide dismutase

(SOD). Blood pressure was recorded by invasive

method of carotid artery cannulation using reusable

transducer (AD Instruments, Australia). Isoprenaline

significantly decreased the blood pressure of the rat

in comparison to control. Lipid peroxidation was

increased while the SOD was decreased in

isoprenaline-treated rats. Isoprenaline increased

significantly (p<0.05) LDH, CK-MB, triglycerides level

in the serum. Heart weight of isoprenaline-treated rats

was increased significantly as compared to control

animals while body weight of the isoprenaline-treated

rats was decreased in comparison to control.

In conclusion, isoprenaline produced

myocardial injury and myocardial infarction in rat.

(e) Evaluation of therapeutic potential of

polymeric nanoparticle encapsulated

curcumin for management of subclinicalmastitis

A Method was standardized for preparation of

polymeric nanaoparticle-encapsulated curcumin.

Curcumin-loaded nanoparticles were formulated by

solid-in-oil-in-water emulsion technique with PLGA

(carrier) and PVA (stabilizer). The yield of the

nanoparticle-encapsulated curcumin was found to be

88%. The corresponding encapsulation efficiency of

curcumin in the nanoparticle was found to be 86%.

The curcumin-loaded PLGA nanoparticle prepared

was completely dispersed in aqueous media with no

clumps.

(f) Herbal acaricides

Following intensive screening, two herbal

acaricides have been identified and tested against

resistant ticks and found highly efficacious. Acarides

were also found efficacious against dog tick (R.

sanguineus) and buffalo lice. With 7-8%

concentration, 76-88% mortality and 47.2-59.6%

inhibition of oviposition (IO) in dog ticks was recorded.

In case of lice, 62.5-80% mortality was observed with

7-8% extract.

(i) Herbal acaricide I: The HPTLC finger printing

profile revealed the presence of "Rutin" as one of the

components in the extract (Fig. 43). The LC85 value

of the extract was determined as 8.05% through dose-

response bioassay against IVRI-I line of ticks. The

extract was found effective against resistant tick

lines (IVRI-IV) showing 20-100% mortality with 33.8%

IO while 40-100% ticks of IVRI-V line (multi-acaricide

resistant tick) were dead with 40.2% IO of the

survived ticks.

Fig. 43: HPTLC profile and identification of compound

in NBA-13/B/2 extract

In the challenged infestation, the efficacy of

the extract (E %) was obtained as there was 70.4 with

61.4% reduction in tick number (DT %). However, the

extract efficacy slightly decreased on 15 and 30 days

post treatment. There was no significant difference in

the DO % of ticks, however, DR % was decreased

from 10.6 to 5.4%. The overall efficacy was constant

up to 15 days post application (Fig.44).

5 1

Fig. 44: In vivo efficacy against R. (B.) microplus

Clinical trial using the formulation was

conducted on 60 cross-bred cattle stationed at

commercial dairy farm. Animals were treated with

optimum concentration of the extract and the efficacy

was monitored at 15 days intervals. The tick load

before each application was compared with the mean

pre-treatment tick load. The overall average

protection from tick infestation was obtained up to

86.9% during six applications. During the

experimentation period, the application of any

chemical acaricides was suspended.

(ii) Herbal acaricide II: Precocene-I was identifiedas one of the active components in the extract (Fig.

45). The LC90 value of the extract was determined

as 5.91% by dose-response bioassay against

acaricide susceptible IVRI-I line of R. (B.) microplus.

The anti-tick activity of the extract against resistant

IVRI-IV & V line of R. (B.) microplus was recorded in

the range of 60-80%. The extract was also found

effective (60-100% mortality) against dog tick,

Rhipicephalus sanguineus.

Fig. 45: HPTLC profile of acaricide II showing active

compound

The hexane and chloroform guided fractions

of the extract showed 60-100% and 60-80% efficacy

at 3% and 6% concentration, respectively, against

IVRI-II line of Hyalomma anatolicum. While in case

of lice, hexane and chloroform fractions exhibited 90-

100 and 60-90% mortality, respectively, when treated

with 6% concentration.

The efficacy (E%) of the extract in a pen trial

was found 67.0% and it persisted after 15 days of

extract application. However, direct effect of extract

(DT%) on the tick infestation was recorded as 45.3%

which reduced to 39.0% after 15 days. The extract

adversely affected the oviposition of ticks with 43.2%

reduction (Fig. 46). Repeat application of extract on

cattle was recommended in 15 days interval as

aqueous solution.

Fig. 46: In vivo data of acaricide II

The clinical field trial with the extract was

conducted at commercial dairy farm, where 75-80%

tick control was achieved when the extract wasapplied at 15 days interval by swabbing.

(iii) Resistance status of R. (B.) microplus tosynthetic pyrethroids (SP): The average resistancefactor (RF) of 6.1 (level II) was recorded in the ticks

collected from northern sub-temperate trans-gangetic

plains while high average RF values of 26.65 (level

III) was recorded in the ticks collected from tropicalmiddle-gangetic plains.

The overall prevalence of SP- resistant R. (B.)

microplus among the sampled farms was 66.6%. Out

of these 18 areas resistance to deltamethrin at level

I was detected in 08 areas (resistance factor=2.0-

4.9), at level II in 09 areas (RF = 5.2-11.8), at level

III in 01 area (RF=34.9) and at level IV in 01 area(RF=95.7). The resistance to cypermethrin was

detected in 16 areas and level of resistance was

detected at level I in 10 areas (RF=2.06-4.64) and at

level II in 06 areas (RF=5.13-9.88). At 05 places

amitraz resistance was found at level II (RF=9.3-23.3)

while the highest resistance factor of 27.3 (level III)was found in R. (B.) microplus at Sikar district of

Rajasthan. At 03 places amitraz resistance was

recorded at level I.

(g) Arsenic in food chain: cause effect andmitigation

Administration of an in-house poly-herbal

formulation and methionine was found to amelioratearsenic induced hematopoetic, hepatotoxic and

oxidative injuries in poultry model and was found to

reduce arsenic deposition in vital organs like liver

and kidney. Hematological parameters reflected a

5 2

marked impact of arsenic over the hematopoeticsystem as evident by significant (P<0.01) decline inhemoglobin level, TEC and TLC of the birds.Significant (P<0.05) rise of plasma ALT (alanine aminotransferase) and AST (aspartate amino transferase)profiles indicated severe hepatic insults followingarsenic exposure. However, administration ofmethionine and poly-herbal formulation exertedhepatoprotective effect as evidenced by normalserum enzyme level. Again, both the poly-herbalformulation and methionine prevented the elevationof erythrocytic lipid peroxidation and depletion of SOD(superoxide dismutase), catalase and GSH (reducedglutathione) in birds displaying their potentiality tosupport antioxidant defense system. Interestingly,the formulation and methionine also significantly(P<0.01) reduced the deposition of arsenic in vitalorgans like kidney and liver (Fig. 47 and 48). Itindicated that methionine as well as the herbalformulation increased the excretion of arsenic andprevented their long-term damage to host cell.

The dramatic ameliorative potentiality of theherbal formulation may be extended to the benefit ofother livestock and human being under chronicarsenic exposure. However, a long-term clinical trial

is also required for the same.

Fig. 47: Bar diagram displaying arsenic deposition inkidney tissue of the poultry birds. The data were

expressed as mean ± standard error. Different letters

shows statistical difference between the groups.

Fig. 48: Bar diagram displaying arsenic deposition in

liver tissue of the poultry birds. The data were expressed

as Mean ± SE. Different letters shows statistical difference

between the groups.

(h) Bio-prospecting of sea buckthorn(Hippophae) species for biomolecules withtherapeutic potential

Bioprospecting of sea buckthorn leaves for

antioxidant activity was carried out. Initially the sea

buckthorn leaves were extracted using different

solvents and solvent combinations such as methanol,

water and 50% methanol. The extracts were tested

for antioxidant activity using DPPH assay along with

standards. Though all the extracts showed very high

level of the activity, 50% methanol extract had slight

edge over the others. These extracts were also

analyzed with other antioxidant assays such as FRAP

and ABTS assays which showed antioxidant activity

in proportion to that of DPPH assay. These extracts

were analyzed in HPLC and number of

phytochemicals detected was more in 50% methanol

extract in comparison to the other extracts.

In order to further purify and identify the

compound responsible for antioxidant activity in the

methanol extract, bioactivity guided fractionation was

carried out. The extract was subjected to slilca gel

column chromatography and the fractions were

analyzed in thin layer chromatography (TLC) for

identification of the compounds and antioxidant

activity (in situ DPPH assay). The percentage

inhibition in DPPH assay varied from 4 to 96% in

different fractions and the fraction with more number

of bands in TLC had relatively higher antioxidant

activity.

(i) Clinical evaluation of herbal and homeopathicagents for augmentation of wound healingin domestic ruminants

Two square 2x2cm full-thickness skin excision

wounds, one on either side of dorsal midline and

2.5cm from the dorsal midline were made in rabbits

and medicaments were applied and the following

observations were made for subjective evaluation of

healing in wounds:

In the first step, wound healing potential of

Tridax procumbens extract was evaluated on

excisional wounds in rabbits. The wounds were

assigned randomly to 2 treatment groups. Tridax

procumbens extract applied topically over the wound

surface (treatment) and sterile normal saline dressing

(Control). Treatment was initiated immediately after

creation of wounds. Wounds treated with injection of

topical application of Tridax procumbens extract

showed better healing than control wounds and early

and faster epithelialization, wound contraction, and

shorter duration of complete healing in excisional

wounds. Histopasthological results confirmed

increased cellular proliferation (fibroplasia), early

control of inflammatory reaction, increasing the

formation of granulation tissue, neovascularization,

synthesis of collagen and better epithelialization and

early histological maturation than in control. It was

5 3

concluded that Tridax procumbens extract induced

faster healing as compared to control.

In second step, herbal group consisted of 5

treatments; topical application of Calendula officinalis(CO), Adansonia digitata (AD), oral administration of

graphites (G) and combination of Calendula officinalis

and graphites (CG). The findings of present study

indicated that application of CO, AD,G and CG

treatments augmented healing of excisional wounds,

but CG treatment resulted in early and faster woundcontraction, granulation tissue appearance and

shorter duration of complete healing in excisional

wounds than CO, AD, G and NS. Histopathological

and histochemical studies revealed that both CG and

CO augmented wound healing activity significantly

by increasing cellular proliferation (fibroplasia), earlycontrol of inflammatory reaction, increasing the

formation of granulation tissue, neovascularization,

synthesis of collagen and better epithelialization and

early histological maturation than control treatments.

(2) HOMEOPATHIC THERAPY

(a) Evaluation of certain homeopathic medicinesfor their immunomodulatory and/orantioxidant potential

Evaluation of homeopathic drugs for their

antioxidant and immunomodulatory potential through

a three tier system involving in vitro tests, in vivo

tests in laboratory animals and in vivo tests in clinical

cases indicated Azadirachta indica to be possessing

antioxidant potential and selenium to be possessing

immunomodulatory potential.

(b) Evaluation of potential of homeopathic systemfor clinical management of mastitis, fever,diarrhoea, skin ailment and injury

Homeopathic drugs (including phytolacca,

calc. flour., silicia, belladona, bryonia, podophyllum,

arnica, Calendulla officinalis etc.) were tried for their

efficacy against clinical conditions like mastitis/fever/diarrhoea/skin ailment/injury/milk enhancement and

retention of placenta. Homeopathic medicines/

combinations used were all tested to be safe.

Effective formulations could be prepared against the

indicated clinical conditions

(3) STEM CELL BASED THERAPY

Bone marrow derived mesenchymal stem cells

(BM-MSCs) from bubaline and caprine bone marrowwere isolated by ficoll density gradient method and

cultured in DMEM supplemented with fetal bovine

serum (FBS) using the standardized laboratory

protocol and characterized according to morphology,

growth dynamics, cell surface antigen profile, and

differentiation repertoire in vitro (Fig. 49).

MSCs showed high proliferation ratios,

expressed doubling time of 30-35 h and were found

positive for alkaline phosphatase. Buffalo and goat

BM-MSCs have the capacity to form plastic adherent

clusters of fibroblast-like cells when cultured in vitro.

Colony forming unit assay confirmed their clonogenic

property. These cells when subjected to RT-PCR were

found to be expressing surface markers viz., CD-73,CD-90 and CD-105 and their respective proteins were

localized through immunostaining. However, these

MSCs were found to be negative for haematopoietic

marker CD-34. Furthermore these cells expressed

pluripotency markers like Oct-4, Nanog and Sox2

when subjected to FACS analysis followed byimmunostaining (Fig. 50). In conclusion, bone marrow

derived MSCs could be successfully generated from

buffalo and goat, characterized through different

surface markers, showed high pluripotency potential.

Osteogenic differentiation was induced in vitro, after

21 days, the differentiated osteogenic cell populationshowed mineral deposits which were assessed by

Von Kossa and Alizarin Red staining (Fig. 51). These

cells are being expanded ex-vivo at P-10 level for

further therapeutic work. To the best of our knowledge

this is the first global report of buffalo BM-MSCs

which suggests that MSCs can be derived andexpanded from buffalo bone marrow and can be used

after characterization as a novel agent for

regenerative therapy.

Fig. 49: Buffalo mesenchymal stem cells (BM-MSCs);

alkaline phosphatase positive MSCs; and

normal chromosomal profile of buffalo BM-MSCs

Fig. 50: Localization of Oct 4 (A: Texas Red with nuclear

stain DAPI) and Sox 2 (B: Alexa Fluor 568 with nuclear

stain DAPI) mRNA transcripts by fluorescent in situ

hybridization using RNA specific DNA oligos. (Original

magnifications 400X)

Fig. 51: Osteogenic differentiation of buffalo BM-MSCsdetected by alizarin red Staining (A) and von Kossa

5 4

Staining (B). Buffalo BM-MSCs were incubated in

differentiation media for 21 days and were further

assessed for mineral deposition. (Original magnifications

40X) (C) Adipogenic differentiation of buffalo BM-MSCs

indicating red colored lipid droplets by oil red O staining

(Original magnifications 20X) (D) Chondrogenic

differentiation of buffalo BM-MSCs showing purple

colored metachromatic matrix (Original magnifications

10X).

Caprine Mesenchymal stem cells (MSC) have

been isolated, cultured and characterized. It has been

observed that caprine MSC grew better in 20% FBS

than 10% or 15% in DMEM with low glucose. However,

CR11 media could also be used for better proliferation

of these cells. These MSCs have been differentiated

into cardiomyocytes, which have also been

characterised. Caprine MSCs after tagging with PKH-

26, were transplanted in myocardial infarction in rabbit

and it was observed that these cells stayed in the

rabbit heart and helped in regeneration also, which

has been tested by tracking the cells. A transgenic

MSC expressing green fluorescence protein was also

generated which could be further propagated up to

4th passage.

(a) Caprine iPS colonies

Induced pluripotent stem cells (iPS) like cell

colony have been derived from buffalo fetal fibroblast

transected with lentivirus vector which is carrying four

pluripotent genes. The iPS colonies expressed

pluripotent markers and showed pluripotent gene

expression.

(b) Caprine neural stem cells

Neural stem cells have been isolated and

characterized from caprine fetal brain for the first time

in India. The neural stem cells expressed Pax6,

Nestin and SOX2 and Mushashi1 (Fig. 52). Neurons

have been developed from caprine mesenchymal

stem cells and they have been characterized.

Fig. 52: Molecular characterization of neural stem cell

markers. Lane M: Marker; Lane 1: Pax6; Lane 2: Sox2;

Lane 3: Nestin; Lane 4: GAPDH

(4) BACTERIOCIDAL EFFECT OF 2-

NITROPROPANOL AGAINST SELECTIVE

FOOD-BORNE BACTERIAL PATHOGENS

In-vivo effect of 2-nitropropanol (2-NPOH) in

chick model was studied using 4 days old chick.

Before using 2-NPOH, total count of intestinal

bacterial flora was assessed as 23x106 per gram of

faeces. After use of 2-NPOH (MIC dosage) total

bacterial count in such fresh chicks reduced to

14.6x106 per gram of faeces. Young grown culture of

Shiga toxic E. coli (STEC) and Salmonella gallinarum

was fed to fresh group of chicks and total bacterial

flora count was recorded as 33x107 and 29x107 per

gram of faeces. 2-NPOH (MIC dosage) was used in

this group of chick and total bacterial count was noted

as 11.2 x106 and 9.4x106 per gram of faeces. Above

all, the findings suggested that 2-NPOH in its MIC

dosage in chick facilitates its growth inhibitory effect

on Shigatoxic E. coli and S. Gallinarum.

8. MOLECULAR MECHANISM OF DRUGS

AND THEIR MONITORING IN ANIMAL

SYSTEM

(1) PHARMACOKINETIC STUDIES OfGATIFLOAXCIN IN SHEEP

The pharmacokinetics of gatifloxacin was

studied in non-lactating sheep. Gatifloxacin was

administered as a single intramuscular dose of 5 mg/

kg b.wt. Following intramuscular administration of

gatifloxacin (5 mg/kg), the drug was absorbed rapidly

and appreciable concentration of the drug was

detectable in plasma at 5 min i.e. 0.36 0.04 µg/ml

which continued to increase gradually to attained

Cmax of 1.24 0.24 µg/ml at 1.0 h (tmax). Thereafter,

the plasma levels declined gradually till 12 h (0.09

0.02). The concentration of gatifloxacin was

undetected at 24 h. Mean absorption and elimination

half-lives were found to be 0.27±0.06 and 2.88 ±0.26

h, respectively. The high value of AUC observed

i.e. 6.75±1.24 µg.h.ml-1 reflects the vast area of body

covered by drug concentration. Similarly high value

of Vd(area) 3.08±0.46 L/kg also indicate extensive

distribution of the drug into various body fluids and

tissues. The total body clearance (ClB) was found to

be 0.74±0. 14 ml/kg/h and MRT was 4.51±0.74 h.

Bioavailability of gatifloxacin after intramuscular

administration was found to be 61.6%. On the basis

of pharmacokinetic parameters obtained, it is

suggested that gatifloxacin may be used at a dosage

of 7.5 mg.kg-1 intravenously and 10 mg.kg-1

intramuscularly every 12 h for treatment of infections

in sheep.

9. ENVIRONMENTAL POLLUTANTS/

XENOBIOTICS AND THEIR IMPACT

ON ANIMAL HEALTH AND

PRODUCTION

(1) MONITORING IN CATTLE AND BUFFALOCARCASSES SURVEYED IN 2009-10 ANDINVESTIGATING OTHER CAUSES OF

MORTALITY IN VULTURES IN INDIA

The survey of 2009-10 included buffaloes (537),

cattle (1303), goats (37), sheep (9), dogs (5), horses

(4) and three non-descript samples out of 1898 liver

5 5

samples. Extract was prepared from each tissue and

stored as two aliquots at -20°C, one set for ELISA

and the other set for LCMS. Out of total 1898 extracts

analysed by indirect competitive ELISA, 156 were

found positive for the presence of diclofenac residue,

indicating 8.22% prevalence. However, these figures

included 310 samples collected from Rajasthan in

2008. Thus, in 2009-10 (by eliminating these 310

samples), 87 out of 1588 extracts were found positive

for diclofenac residue suggesting 5.47% prevalence.

State-wise prevalence was as follows: Andhra

Pradesh (0.61%), Haryana (9.09%), Jammu &

Kashmir (4.59%), Madhya Pradesh (5.22%,

Maharashtra (0.97%), Panjab (8.58%), Uttar Pradesh

(0.56%), West Bengal (2.97%), Rajasthan (19.25%),

and overall: 15.62% in 2010 and 22.25% in 2008. It

is apparent that the prevalence of diclofenac in

Rajathan is very high though in other states it is

declining.

Extracts were also prepared from 66 tissues

(liver and kidney) from 33 vulture carcasses as above

and stored at -20°C for residue monitoring. Out of 33

vultures, 12 were found positive for diclofenac

residue. The concentration of diclofenac residue in

positive samples ranged from 12 to 920 ppb. These

results suggest that in spite of ban on veterinary use

of diclofenac, it is very much in use still and warrants

strict measures to stop the illegal use of diclofenac.

Other conditions responsible for vulture

mortality as diagnosed by post mortem and

histopathology included systemic aspergillosis,

visceral gout, amyloidosis, hepatic cirrhosis and

multiple granulomas in lungs.

(2) EVALUATION OF TOXIC INFLUENCE OF

ARSENIC ON THE PHARMACODYNAMICSOF NONSTEROIDAL ANTI-INFLAMMATORY

DRUGS

The influence of arsenic exposure was

evaluated on the pharmacodynamic effects of a

selective cyclooxygenase-2 (COX-2) inhibitor.

Meloxicam was selected as the selective COX-2

inhibitor and used @ 3 mg/kg b. wt orally based on

the results of a pilot study. Adult male rats were

preexposed to arsenic (1 and 4 ppm of elemental

arsenic concentrations) as sodium arsenite daily

through drinking water for 28 days. Next day, the

pharmacodynamic effects of orally-administered

meloxicam were evaluated in arsenic-preexposed

rats. Inflammatory pain, inflammation and pyretic

responses were assessed through formalin-induced

nociception, carrageenan-induced inflammation and

lipopolysaccharide (LPS)-induced pyrexia,

respectively. Meloxicam decreased the number of

flinches in the late phase, but not in the early phase

of formalin-induced nociception. On the contrary,

arsenic increased the number of flinches in both the

phases. Arsenic-mediated increase in nociception in

the early phase remained unaffected in the rats given

meloxicam. However, both the concentrations of

arsenic attenuated the analgesic effect of meloxicam

in the late phase to the control level. Meloxicam

decreased the carrageenan-induced oedema volume,

while arsenic increased the oedema volume in a

concentration-dependent manner. At 4 ppm

concentration, arsenic inhibited the anti-inflammatory

effect of meloxicam, but not at 1 ppm level.

Meloxicam decreased the LPS-induced pyrexia.

Arsenic preexposure per se did not increase pyrexia,

but enhanced LPS-stimulated pyrexia. Preexposure

to arsenic attenuated the antipyretic effect of

meloxicam. Further, meloxicam strongly inhibited the

activity of COX-2, but caused only insignificant

reduction in COX-1 activity. Effects of arsenic on

COX activities were tissue- as well as COX isozyme-

specific. Arsenic only at the higher concentration

increased the COX-1 activity in rat paw muscle, but

had no effect on the COX-1 activity in rat

hypothalamus. Arsenic caused dose-dependent

increase in the activities of COX-2 in both the muscle

and brain tissues. Meloxicam decreased the levels

of PGE2, TNF-α and IL-1β levels, while arseniccaused dose-dependent increase in the production

of these mediators in rat paw muscle. In

hypothalamus, the LPS-induced increases in these

mediators were further dose-dependently enhanced

by arsenic. However, arsenic preexposure in both

the concentrations caused comparable reduction in

the inhibitory effects of meloxicam on these

inflammatory mediators and brought their activities/

productions to the control levels. These observations

substantiate the COX-2 selectivity of meloxicam as

well as demonstrate the higher susceptibility of COX-

2 to arsenic-mediated induction. Lesser susceptibility

of COX-1 to arsenic is further substantiated by the

insensitivity of COX-1 to arsenic in hypothalamus.

The results suggest functional antagonism of the

effects of meloxicam by arsenic. This may relate to

arsenic-mediated local release of the cytokines, TNF-

α and IL-1β, which cause induction of COX andconsequent release of PGE2, the principal mediator

of pain and inflammation. In conclusion, subacute

exposure to environmentally relevant concentrations

of arsenic through drinking water could exacerbate

pain, inflammation and pyrexia. Thereby, arsenic

could aggravate the pathogenesis of painful

inflammatory conditions and reduce the therapeutic

efficacy of meloxicam in chronically arsenic-exposed

subjects in the arsenic-endemic areas.

(3) T-2 MYCOTOXICOSIS IN ANIMALS:

PATHOLOGY, PATHOGENESIS, DIAGNOSIS

AND AMELIORATIVE MEASURES

Six batches of maize and wheat were cultured

and the T-2 toxin was estimated by TLC and

5 6

spectrophotometry. The levels of T-2 toxin obtained

were in the range of 10.52-32.34 ppm and were later

confirmed by AFAQAL, Namakkal. A total of 74

livestock feed samples were analysed by

aforementioned methods Fourteen samples were

found positive (range 0.035-1.344 ppm) for aflatoxin

while in 5 samples, T-2 toxin could be detected (range

0.25 to 0.642 mg/kg ppm). T-2 induced reproductive

toxicity and teratogenicity in was studied in rats. The

reproductive toxicity was induced in Wistar rats by

feeding T-2 toxin @ 0.25, 0.50 and 0.75 ppm in feed

continuously for 10 weeks. Important findings

observed retardation in growth and reduced

reproductive indices including pregnancy percent,

litter size, foetal body weight and crown-rump lengths

in dose dependent manner. The major gross

malformations were subcutenous hematoma,

macerated foetus, visceral anomalies including

internal hydrocephaly, microphthalmia, rounding of

heart and enlarged renal pelvis. Major skeletal

defects were developmental defects in skull bones,

sternebrae, vertebrae and ribs. The toxicated rats

developed anaemia and thrombocytopenia,

hypoproteinemia, hypoalbuminemia and

hyopglobinemia, increased values of serum ALT,

AST and creatinine in dose and duration dependent

manner in males and females of F0, F1 and F2. The

relative liver, kidneys and brain weights were

significantly higher while spleen, thymus, testes and

ovary weights were significantly reduced in T-2

intoxicated animals of all F0, F1 and F2 generations.

The type, extent and severity of the lesions were

dose dependent. Significant histomorphological

changes were noticed in kidneys, liver and testes,

ovary and uterus.

10.CLINICAL AND SURGICAL

INTERVENTIONS

(1) MANAGEMENT OF CHRONIC PANCREATIC

DISORDERS WITH SPECIAL REFERENCE

TO DIABETES MELLITUS IN DOGS

A total of 251 dogs were screened for diabetes

using blood sugar and clinical parameters and 27

(10.88%) (19 females and 8 males of different breeds)

were found to be diabetic. These dogs were divided

randomly into 3 groups of 9 animals each. One group

of animals received SD 2 @ 50 mg/kg orally daily,

another group received metformin @ 5 mg/kg b. wt.

and remaining group received SD 2 extract @ 50

mg/kg along with metformin 5 mg/kg orally. The

efficacy was assessed on the basis of clinical

response, blood glucose and insulin levels.

Observations were made up to 28 days. The test

extract SD 2 showed pronounced hypoglycaemic,

insulin releasing and hypocholesterolaemic effect in

clinical diabetic dogs.

(2) DEVELOPMENT OF BIODYNAMICTHERAPEUTIC REGIME AGAINST BOVINE

SUB-CLINICAL MASTITIS

A total of 298 lactating cows were screened

for the status of intramammary infection and milk

samples were collected from different villages of

Bareilly District. The preliminary screening for SCM

was done on the basis of CMT + to CMT +++ reaction

of the milk samples. CMT ranged between 0.21 and

2.68 point scores in milk samples either collected

from normal healthy cattle or animals positive for

SCM. The SCC ranged between 2.38 and 11.72 x 10

5 cells / ml of milk collected from normal healthy

cattle and animals positive for SCM. Out of 298 cows

screened, SCM was positive in 28% samples.

Pathogen isolated and identified on

biochemical tests- CNS 56%, S. aureus coagulase

positive 7% (CPS), Colibacilli 13%, Streptococcus

sp 5% and no growth 19%.

Out of 298 milk samples, 57 samples revealed

no growth on culture media on 3 repeated cultures.

Out of 57 samples, 12 samples amplified for Coa

gene by PCR at 809 BP. The overall prevalence of

mastitis was 19.16% and the Staphylococcus aureus

mastitis was 8.64% on quarter basis.

Twenty lactating cows spontaneously infected

with SCM were treated with udder tablets + udder

paste once a day for 15 days and compared with

standard treatment given with above treatment along

with Enrofloxacin @ 1.5 mg /kg b.wt for 3 days by

i.m. route. In cases of SCM, significant reduction of

SCC and TBC to an extent of 35.8% and 29 % (SCC,

9.2 to 6.3 x 105 cells/ml of milk, TBC 12 to 8.5x 103

cells/ml of milk) was recorded 15 days PT,

respectively. Similarly the LDH concentration in serum

reduced significantly on day 18.

Alpha-tocopherol concentration in serum of

lactating bovines ranged between 1.83 and 3.24 µg/

ml serum. The serum copper and zinc concentration

in mastitic cows was lower than normal.

Isolation and biochemical characterization of

polysaccharide fraction from Tinospora cordifolia -

the stem of T. cordifolia extracted with acetone, TCA,

methanol and water revealed the presence of highly

mitogenic polysaccharide fraction, one of the main

components of udder tablet. The phagocytic index

increased in post treated mice with significant

decrease in TBC and COX values.

(3) DEVELOPMENT OF DIAGNOSTIC MARKERS

AND CATALYTIC THERAPY FOR

MANAGEMENT OF HEPATOBILIARY

DYSFUNCTIONS

Common chemically known nutraceuticals

were selected on the basis of their in vitro assessment

by ferric reducing antioxidant power activity assay

5 7

and ascorbate - Iron (III) - catalyzed phospholipids

peroxidation assay. During in vivo study, hepatotoxic

rats receiving selenium as an antioxidant revealed

best followed by vitamin C treated group and zinc

treated group when compared for therapy with single

antioxidant only. During combination (vitamins and

minerals) therapy, best antioxidant potential was

revealed in rats which received Zn + Se + vitamin C,

followed by Zn + Se and Zn + vitamin C. In multiple

combination (vitamins, minerals and standard

hepatoprotectant) therapy which received best

antioxidant potential was revealed in rats Zn + Se +

vitamin C + Silymarin followed by Zn + Se + vitamin

C, Zn + Se and Zn + vitamin C. Study revealed that

use of minerals, vitamins and standard

hepatoprotectant in combination provides synergistic

activity as a potent antioxidant as well as

hepatoprotectant in sub-acute to chronic hepatopathy

of rat.

In vitro assessment for antioxidant potential

of nutraceuticals revealed most potent antioxidant

properties in HNAP-11 among the 11 selected bio-

organics of plants origin, and HNAB-2 among 3 bio-

organics of animal origin. Study conducted to evaluate

hepatoprotective potential of certain nutraceuticals

in sub acute hepatotoxicity in rat model revealed

promising hepatoprotective activity by HNAP-11 and

HNAB-2 individually and also as a combination

therapy. Safety trial of the effective nutraceuticals

did not depict any side effects. Validation of

hepatoprotective potential was done in 12 dogs

confirmed for HBD. Neutraceuticals namely HNAP-

11 @ 100 mg/kg b.wt + HNAB-2 @ 100 mg/kg b.wt

as a combination therapy showed potent

hepatoprotective property in clinical cases of HBD in

dogs.

(4) STUDIES ON HALOTHANE AND

ISOFLURANE INHALATION ANAESTHESIA

IN LARGE RUMINANTS

Six male buffaloes used in groups T and P

were divided in eight subgroups T1, T2, T3, T4, P1,

P2, P3 and P4. In T1 and P1 dexmedetomidine (2.5

µg/kg) and pentazocine (0.05 mg/kg), in T2 and P2

midazolam (0.05 mg/kg) and pentazocine (0.05 mg/

kg), in T3 and P3 dexmedetomidine (2.5 µg/kg) and

butorphanol (0.05 mg/kg) and in T4 and P4 midazolam

(0.05 mg/kg) and butorphanol (0.05 mg/kg) were

administered i.v. In groups T and P, induction was

done by i.v. 5% thiopental and 1% propofol,

respectively. Maintenance was done by isoflurane in

100% oxygen using a large animal anaesthetic

machine. The treatments were compared by

clinicophysiological, haematobiochemical and

haemodynamic parameters.

Dexmedetomidine and pentazocine/

butorphanol were better preanaesthetics as compared

to midazolam and pentazocine/butorphanol for

thiopental/propofol and isoflurane anaesthesia. The

dose sparing effect of these drugs on thiopental and

isoflurane anaesthesia was more as compared to

propofol. All the combinations produced adequate

surgical anaesthesia. However, dexmedetomidine,

butorphanol/pentazocine, thiopental and isoflurane

were found better. Cardiopulmonary functions were

well preserved with all the drugs and none of the

combinations produced any deleterious effects on

vital organ functions and were found safe in buffaloes.

A few better combinations were used in clinical cases

in cattle (14) and buffaloes (12) for the management

of different surgical conditions.

(5) ISOLATION, CULTURE, CHARACTERIZA-

TION AND EVALUATION OF BONE

MARROW DERIVED MESENCHYMAL STEM

CELLS FOR THE HEALING OF SKIN AND

CARTILAGE DEFECTS

The study was conducted to evaluate the

efficacy of bone marrow derived mesenchymal stem

cells (BM-MSCs) for the repair of full thickness skin

wounds in rabbits and compared with control treated

with hydrogel applied topically. Twelve rabbits of 6-8

months of age and 1.5 -2.0 kg of b.wt were divided in

two groups, i.e. treatment and control groups. Two

full thickness skin excision wound, one wound each

on either side of the dorsum were created under

xylazine-ketamine general anaesthesia in all the

animals. BM-MSCs were injected s.c. at four sites

around the wound margins once on day 0 in treatment

group. In control group PBS was injected at four sites

in the similar manner. Subsequently, the wounds in

both groups were cleaned daily with PBS, and pluronic

F-127 hydrogel was applied topically to keep the

wounds moist.

The wounds treated with stem cells showed

rapid contraction between 7th and 14th day, while in

control group rapid contraction was seen between

14th and 21st day. There was a rapid contraction of

the wound in treatment group and the mean wound

size reduced to 10-20% of initial size by day 14, <

1% by day 21 and complete healing was noticed by

day 23. In control group mean wound area was 45-

55% of initial size by day 14, 10-15% by day 21 and

complete contraction was not seen on day 28. Stem

cell treated animals showed complete healing by day

23, while the scab still remained at the wound site on

day 28 in control group, indicating incomplete healing.

There was apparently full covering of wound area with

hair in all the treated animals while control group has

shown sparse hair growth in and around the wound

site. The results of the study indicated that bone

marrow derived stem cells when injected into the

wound margins can enhance the healing of the full

thickness skin wounds in rabbits.

5 8

(6) MESENCHYMAL STEM CELLSCONSTRUCT ON OSTEOGENESIS FORREPAIRING LARGE BONE DEFECTS INANIMAL MODEL

Protocol for isolation, proliferation and culture

of bone marrow derived MSCs from New Zealand

White rabbits was standardized. In vitro osteogenic

differentiation of BM-rMSC was performed in

monolayer culture for 3 weeks. Rabbit MSCs of 4th

passage were induced towards osteogenesis after

reaching 60-70% confluence. For osteogenic

differentiation, cells were cultured in an osteogenic

induction medium, consisting of 10-8 M

dexamethazone, 1M ß-glyserophosphate and 50µg/

ml L-ascorbic acid. Osteogenic induced cell cultures

changed morphology from adherent monolayer of

swirling spindle shaped cells, which was still apparent

in the control cultures, to layered cell clusters

surrounded by a matrix-like substance positive upon

Alizarin Red S. Statistically significant higher

quantities of calcium deposition and alkaline

phosphatase activity at the 90% level were

demonstrated in these osteogenic induced culture

wells. In positive cases, the nucleus of MSCs took

bluish-purple colour.

Flow cytometric analysis for characterization

of rMSC by expressing positive (CD-105, CD-29, CD

44) and negative (CD-34 and CD-45) CD markers was

initiated. The HA/TCP bio-ceramic tissue engineering

construct seeded with rMSCs was developed. In vivo

osteogenesis and osteoinduction by this construct

at 15 mm critical sized radius bone defect in rabbit

model was observed.

(7) DEVELOPMENT OF BIOENGINEEREDCOLLAGEN MATRICES FORRECONSTRUCTIVE SURGERY

The acellular collagen matrices (decellularized

pericardium and diaphragm) were used for 3-D in vitro

growth of mouse embryo fibroblasts (MEF) and were

tested in experimental cases of artificially created

wounds in rats as per standard protocols. All the

wounds implanted with grafts and control wounds

showed wound contraction, scab formation, change

in the wound size and colour. There was gradual

decrease in the wound area as the days of implantation

increased. Maximum reduction in wound area was

observed in bioengineered graft implanted animals.

Bioengineered diaphragm matrix (BDM) and

bioengineered pericardium matrix (BPM) showed a

complete healing of the wound by day 18 and 21,

respectively. On the basis of the results, the acellular

pericardium and diaphragm seeded with mouse

embryo fibroblasts were found to be novel

biomaterials, which have amphipathic character in

full thickness skin repair and enhanced wound

healing. The acellular diaphragm seeded with mouse

embryo fibroblasts have an edge over seeded acellular

pericardium in full thickness skin wound repair. The

acellular pericardium and acellular diaphragm alone

have wound healing potency, however, seeding with

MEF increases the wound healing potency.

(8) DEVELOPMENT OF BIOENGINEERED

COMPOSITE SCAFFOLDS FOR BONEREPAIR USING FETAL CELLS

Femur bone samples of animals aged 1-1.5 yr

from the bovine slaughter house were collected. It

was then cut into small pieces of 20 mm width and

20 mm height by using osteotome. The samples were

made from the cortical as well as cancellous bones.

The decellularization was attempted using three

standard protocols of bone decellularization: (i)

immersing in 250 ml of solution containing a mixture

of 25% acetone and 75% ethanol (vol %) combination,

(ii) immersing in solution containing 1% sodium do-

decyl sulfate, and (iii) subjecting the explants to 5

freeze-thaw cycles. The explants were tested for the

presence of cells by histopathology and scanning

electron microscopy. For the isolation of fetal cells,

two pregnant (full term 30-31 days) New Zealand White

rabbits of 6-8 m of age and 2-3 kg of b. wt were

utilized by performing caesarean section under

xylazine-ketamine anaesthesia. The bone samples

were aseptically taken out; the bone was sectioned

into small pieces and were digested at 37°C for 15

min with 0.25% trypsin and shaken well and laid in a

plastic culture flask with suitable medium. It was then

inverted and incubated in a humidified atmosphere

with 5% CO2 at 37°C. The medium was changed twice

a week till nearly confluent cell layers around the

bone tissue (80% covering of the total culture flask

area) were formed. The normal culture medium

contained DMEM supplemented with 10% v/v FBS,

penicillin and streptomycin. The protocol has been

successfully developed for decellularization of bone

explants by all the methods tried.

(9) STUDIES ON CARDIAC STRUCTURAL ANDFUNCTIONAL ASSESSMENT IN DOGS WITHSPECIAL REFERENCE TO CARDIACIMAGING

Echocardiographic reference values in 48

clinically healthy, adult Spitz (24) and Labrador

retriever (24) dogs of both sexes were compared to

find out the effect of body weight and sex on these

parameters. In Spitz, body weight was found to

significantly affect the values of some of the left

ventricular and mitral valve parameters, which

included left ventricular diameter at diastole (LVDd),

left ventricular diameter at systole (LVDs),

interventricular septal thickness at diastole (IVSd),

intervenricular septal thickness at diastole (IVSs),

left ventricular posterior wall thickness at diastole

(LVPWd), left ventricular posterior wall thickness at

systole (LVPWs), end diastolic volume (EDV), end

systolic volume (ESV), stroke volume (SV),

5 9

maximum amplitude of anterior mitral valve leaflet

(DE amplitude) and E point to septal separation

(EPSS), and had an increasing trend with increase

in body weight. Insignificant effect of gender was

seen on some of the echo parameters but significant

effect was seen on DE amplitude, where males had

significantly higher values. In Labrador retriever, body

weight was found to significantly affect the values

of some of the left ventricular and mitral valve

parameters including LVDd, LVDs, IVSd, IVSs,

LVPWd, LVPWs, EDV, ESV, SV, DE amplitude and

EPSS, and had an increasing trend with increase in

body weight. Insignificant effect of gender was seen

on all the echo parameters.

Fifteen clinical cases of different cardiac

ailments (dilation cardiomyopathy, hypertrophic

cardiomyopathy, mitral regurgitation, pericardial

effusion etc.) in dogs were diagnosed as well as their

therapeutic efficacy was evaluated. Vertebral Heart

Score (VHS) was calculated in 12 adult healthy

mongrel dogs consisting of six males and six females

with an average age of 2.5 yr, and average b. wt of

14.5 kg. VHS in mongrel dogs was 9.7±0.67

vertebrae, VHS in females was 9.8±0.12 and in

males 9.6±0.09. No significant difference (P>0.05)

of VHS was found between males and females.

(10) A NEW THERAPEUTIC APPROACH TO

CANINE MAMMARY TUMOURS

A total of 89 tumour cases (CMT-66%, CTVT-

12% and others 22%) were recorded in canines. The

incidence was highest in the age group of 7-9 yr and

highest in Spitz followed by German shepherd and

mongrel breeds. Histopathologically benign and

malignant tumours were 16% and 84%, respectively.

Different treatments namely mono-

chemotherapy (5-Flurouracil), Anti-angiogenic/

estrogenic therapy (Tamoxifen), cryosurgery,

combination chemotherapy (5-Flurouracil with COX-

2 inhibitor-Etoricoxib), chemotherapy with

immunotherapy (5-Flurouracil with Etoricoxib +

Levamisole), adjuvant chemotherapy (surgery + 5-

Flurouracil + Levamisole) and surgical therapy were

given as per the merit of the case and owner's

consent.

Percentage of apoptotic cells increased at

succeeding weeks of chemotherapy as compared to

pre-treatment values. 5-Flurouracil along with

Etoricoxib + Levamisole was found to be a promising

combination for the treatment of CMT. Anti-

angiogenic drug also showed good response. Large

size mammary tumours responded well to surgery

along with chemotherapy. Higher expression of p-

53, Cox-2 and MMP-7 genes was detected in

mammary tumour tissues than normal mammary

tissues.

(11) DEVELOPMENT AND EVALUATION OFINTERLOCKING NAILS AND LOCKINGPLATES FOR INTERNAL FIXATION OFFRACTURES IN LARGE ANIMALS

An interlocking nail (ILN) system for femur and

humerus of large ruminants was developed. The

optimum dimensions of ILNs for animals weighing

about 50-200 kg were found to be of 18-20 mm in

diameter and 18-24 cm in length. The ILN was then

used successfully for fixation of femur fractures in 3

buffalo calves (in 2 cases by retrograde and in one

case by normograde technique). The angular tibial

ILN was used in 6 cases for tibial fractures in large

ruminants (2 calves, 2 adult buffaloes and 2 cows).

The contoured locking plates for radius and

tibia were designed and developed. The dimensions

of the designer locking plate for tibia include 18-24

cm in length, 5-6 mm in thickness, 15-30 mm in width

with 16-20 locking holes in two rows; screws are of

30-60 mm long and 5.5 mm diameter. The dimensions

of locking plate for radius were 16-22 cm in length, 5-

6 mm in thickness, 25-30 mm in width with 16-20

locking holes in two rows; screws were of 30-60 mm

long and 5-6.5 mm diameter.

(12) DEVELOPMENT OF PHYSICAL THERAPYAND REHABILITATION PROTOCOLS IN

VETERINARY PATIENTS

Clinical studies were conducted in 40 dogs

suffering from hind quarter weakness. The animals

were divided into 5 equal groups, I to V and subjected

to conventional drug therapy, CDT (n=8) alone; and

in combination with therapeutic ultrasound, US (n=8);

electroacupuncture, EA (n=8); static magnetic field,

SMF (n=8); and interferential, IF (n=8) current,

respectively. All treatments were continued for 14

days. CDT was given using methyl prednisolone

acetate, meloxicam, gabapentine, mecobalamine,

vitamins B1, B6, B12 and D-Panthenol. US therapy

was applied at a frequency of 1 MHz and an intensity

of 0.5 Watt/cm2 for 5 min daily in a pulsed mode. The

electro stimulation of acupoints, Bai Hui, BL-30, GB-

34, ST-36, BL-67 and GV-1) using 55-100 mA

intensity, 50 Hz frequency and 9 Volts DD wave

current was given daily for 10 min. For SMF, 4 bipolar

magnets bars, each of 850-950 G strength and

embedded in a bandaged pad, were placed daily for

2 hr on lumbar region in a way that each magnet of a

pair lay on either side of the vertebral column with

the opposite poles facing each other. Interferential

therapy at 4 KHz frequency, using 2 pole electrodes

over the lumbar region was given daily for 10 min. All

the animals regained their normal postural reactions,

except hopping reaction in hind limbs, by day 14 of

the therapy. Hopping reaction was achieved in 25

dogs (2 in group I, 4 in group II, 6 each in groups III

and IV and 7 dogs in group V) by day 14 and in rest

of them by day 28. US therapy was also given to 4

6 0

horses, presented with the symptoms of peripheral

myopathy, at 1 MHz and 1 Watt/cm2 daily for10 min

along with drug therapy. Progressive improvement

was noticed in horses after 3-5 sessions of the

therapy.

11.CLINICAL AND DIAGNOSTIC

SERVICES

(1) CLINICAL DIAGNOSIS, TREATMENT ANDPROPHYLAXIS OF LIVESTOCK DISEASES

Total number of cases presented to Referral

Veterinary Polyclinic of IVRI was 4252. Treatment

was provided to the cattle, buffaloes, horses, sheep,

goats, dogs, cats, and poultry for various diseases

like bloat, ruminal impaction, acidosis, helminthiosis,

theileriosis, anaplasmosis, ketosis, alkaline

indigestion, colibacillosis, babesiosis,

trypanosomiasis, traumatic reticuloperitonitis,

mastitis, colic and tetanus, PPR, mycoplasmosis,

scabies, CD, parvoviral infection, leptospirosis,

babesiosis, ehrlichiosis, pyoderma, congestive heart

failure, renal failure, deworming, vaccination, etc.

Total of 146 cases have been subjected to

ultrasonography, and in 120 cases ECG was done.

(2) CLINICAL AND PREVENTIVE HEALTHCARE OF LIVESTOCK OF IVRI

A total of 4863 morbid cases were treated.

Wound and diarrhoea were the most common

conditions. Activities performed included vaccination

against FMD (1948 animals), PPR (86 animals), HS

(254 animals), enterotoxemia (709 animals) and

sheeppox (160). Deworming was carried out in 1853

animals and ectoparasiticidal dipping/spray in 758

cases. Neonatal care was provided to 102 animals.

Study indicated that skin diseases, diarrhoea,

weakness were associated with a disturbance of

oxidant-antioxidant system and antioxidant

preparation was found to be useful.

Immunomodulatory adjunct therapy was also

beneficial in making the animals recoup in many

clinical states.

A total 1178 cases from livestock farms were

treated for different conditions. Common conditions

included wounds-355, enteritis-286, ringworm/mange-

86, mastitis-83, debility/weakness-76, joint ill/arthritis-

55 and rest of the cases were of pneumonia, tympani,

eye infection, milk fever, spraying, dislocation, hernia,

lameness etc. Besides, the vaccination against FMD

(1372), haemorrhagic septicemia (607), brucellosis

(99) was regularly done in the livestock farm. The

deworming and coccidiostat (832 animals) and

application of ectoparasiticide (1466) were also

accomplished. Supplementation of multivitamins was

given to 405 weak animals.

A total 915 cases reported ailing at LPR pig

during the period; which comprised of wound-680,

lameness-49, enteritis-96, skin lesions/dermatitis/pox

like lesions-12, pyrexia-6, weakness/dullness-68

cases, umbilical hernia one, farrowing difficulty

(dystocia)-1 and hypoglycaemia-2. Besides,

prophylactic measures were also provided, which

included iron and Vit. B-Complex injection at 4th and

14th as well as at 5th and 15th day of age, respectively,

in piglets; annual vaccination against FMD and

classical swine fever in all the stock (except

pregnant). During the year, 160 animals were

vaccinated against FMD and 125 animals were

vaccinated against classical swine fever. The routine

deworming (193 animals) and disinfection were also

done.

(3) TREATMENT OF SURGICAL CASES,PREPARATION OF ANIMAL MODELS,COLLECTION OF BIOPSIES ANDRADIOLOGICAL DIAGNOSIS

During 2011-2012, 2896 surgical cases,

referred by field veterinarians and different sheds of

the Divisions of the institute, were successfully

treated. The maximum number of cases were of

different types of wounds (623), urolithiasis/urinary

obstruction (384), fractures (315), lameness (250),

posterior paresis (220), ocular affections (176),

tumours (162), otitis (76), multiple trauma (75),

castration (69), cesarean sections (50), aural

haematoma (45), congenital conditions (36), rickets/

NBD (36), ovariohysterectomy (34), udder/teat

affections (33), hernias (28), foreign body obstruction

(22), docking (11), rectal/vaginal prolapse (05), and

miscellaneous surgical conditions (246).

Animal models (46) prepared during the period

included castration in pigs (20), cardiac ischemia

model in rabbits (10), uterine flushing for collection

of embryos in goats (08), testicular biopsy in sheep

(06) and vasectomy in buffalo bulls (02).

A total of 766 radiographs were taken for

diagnosis in clinical cases and for the evaluation of

research results in experimental animals (clinical-621,

research and teaching-138). Contrast radiography was

performed in a few cases. Radiographs were also

taken for wildlife cases (03).

A total of 658 ultrasonographic scanning in

experimental and clinical cases in different species

of animals were done for evaluation/diagnosis of

cardiac, reproductive tract disorders of ovaries and

uterus, GIT and urinary tract disorders.

(4) DIAGNOSIS AND TREATMENT OFREPRODUCTIVE PROBLEMS INLIVESTOCK AND FIELD AI WORK ATINSTITUTE POLYCLINIC

A total of 462 cases of bovines (221), canines

(190), caprine (42), equine (08) and ovine (01) were

treated for various reproductive problems as shown

in Table 6. A total of 699 field AI and 83 pregnancy

diagnosis were performed in cattle and buffaloes.

6 1

Table 6: Reproductive problems treated at Institute Polyclinic

Disorders % (No.) Disorders % (No.)

P. D. 22.94 (106) Repeat breeding 6.06 (28)

Metritis/Pyometra 8.8 (41) Dystocia 10.60 (49)

In heat 5.84 (27) Anestrus 3.46 (16)

Uterine Prolapse 3.24 (15) Uterine torsion 3.24 (15)

Abortion 2.3 (11) Ret. of placenta 3.03 (14)

Post mating 1.2 (06) Infantile genetalia 0.4 (02)

Misc. 6.2 (29) Gyne. Exam. 11.68 (54)

Ref. to Surgery 8.8(41) Ref for Medicine 1.2 (06)

Macerated foetus 0.2 (01) Mucometra 0.2 (01)

Total cases treated: 462

were found infected with Theleria annulata and 2 with

Trypanosoma evansi. In equines, Trypanosoma

evansi infection was recorded in 7 of the 65 cases.

Out of the 11 canine skin scrapping samples, 7 were

found positive for Demodex canis and 2 for Sarcoptic

mange. Amongst the faecal parasites, 2 bovine

samples were positive for Fasciola sp. eggs and 1

for mixed infection of Toxocara vitulorum and

strongyle eggs. The canine samples were found

positive for Ancylostoma sp. and Toxocara sp. eggs.

(7) COMPARATIVE EVALUATION OF IMAGINGTECHNIQUES, ELECTROCARDIOGRAPHICCHANGES AND BLOOD BIOCHEMICALFINDINGS TO EVOLVE DIAGNOSTICMARKERS FOR CARDIOPULMONARY ANDUROGENITAL DISORDERS IN CANINES

Out of 372 cases suspected for cardio-

pulmonary disorders, 81 cases showed abnormal

changes in electrocardiography. The cases which

showed abnormality in clinical examination and in

ECG were subjected to further examination like

echocardiography, radiography and cardiac biomarker

estimation to confirm cardio-pulmonary disorder. 16

cases were diagnosed as cardiomyopathy, 41 cases

showed other complications. The biochemical

parameters estimated (41 cases) were creatine

kinase (ck-MB), LDH, sodium, potassium,

magnesium, ALT, AST, BUN and creatinine. The

cardiac biomarkers NT-proBNP, Troponin-I, and

Troponin-T were also estimated. Three cases showed

severe cardiomegaly by Vertebral Heart Score

method in thoracic radiograph. The diagnosed cases

of cardio-pulmonary disorders were treated

accordingly and most of the cases showed

improvement in condition.

(8) EVALUATION OF CYTOLOGICALTECHNIQUES FOR RAPID DIAGNOSIS OF

PET ANIMAL DISEASES

A total of 45 clinical cases of dogs were used

to evaluate cytological techniques in rapid diagnosis.

The samples examined included 38 cases of

(5) PRODUCTION AND SUPPLY OF FROZENSEMEN OF CATTLE AND BUFFALO BULLSAT GERM PLASM CENTER

A total of 41820 frozen semen straws from

Vrindavani (11735 straws), Tharparkar (1235 straws)

and buffalo (28850 straws) bulls were produced.

Frozen semen of 3110 straws from Vrindavani,

Tharparkar and buffalo bulls were supplied to the AI

unit of Cattle and Buffalo farm, Key Village unit of

Animal Reproduction division, Physiology division,

Extension division, IVRI campus of Mukteswar, AGB

division and AR division. A total of 673 ml of liquid

semen from Tharparkar and also 673 ml of liquid

semen from Vrindavani were supplied to LPM section.

592 straws of six Vrindavani, 1657 of three Tharparkar

and 4429 semen straws of nine buffaloes are stored

at Germ Plasm Centre. A total of 13923 straws of

Vrindavani, 1025 straws of Tharparkar and 26109

straws of buffalo semen were sold to outside

agencies.

(6) DIAGNOSTIC SERVICES IN POLYCLINIC

A total of 1221 samples, collected from 716

clinical cases (520 canine, 123, bovine, 65 equine, 1

feline and 7 caprine) were examined. The whole blood

was subjected to haematological tests such as,

estimation of haemoglobin (609), total erythrocyte

count (578), total leucocyte count (611) and differential

leucocyte count (622). The peripheral blood smears

(579) were examined for presence of haemoprotozoan

parasites. Faecal examination was conducted in 359

cases for the presence of eggs/larvae of various

parasites, 43/359 were positive. The skin scrapings

were examined for the presence of mites in 11

animals. Urine samples of 05 animals were subjected

to routine examination.

Among the haemoprotozoan parasites,

Babesia canis, B. gibsoni, Theileria annulata,

Erhlichia canis, Trypanosoma evansi and Anaplasma

sp. were recorded in different animal species. In dogs,

Ehrlichia canis was recorded in 6, Babesia gibsoni in

6, and Babesia canis in 9 cases. In bovine, 4 cows

6 2

neoplasms, 5 urine samples and 2 growths. The

neoplasms of mammary gland (13), skin (5),

connective tissue (3) and genital organs (1) were

studied using cytological and histological techniques.

Cytological techniques used included fine needle

aspiration cytology (FNAC), impression smear and

tissue triturate. A total of 76.2% of the tumours were

diagnosed by FNAC and 85.7% by impression smear

and tissue triturate methods each. Histologically

different tumours diagnosed included squamous cell

carcinoma, malignant trichoepithelioma, anal gland

adenocarcinoma, tubulopapillary adenocarcinoma (1),

solid carcinoma (4), inflammatory adenocarcinoma

(1), complex adenocarcinoma (2) and

carcinosarcoma (1) of mammary gland and fibroma,

fibrosarcoma, mast cell tumour, histiocytoma and

osteosarcoma. FNAC smear stained with Giemsa

stain was found useful for rapid diagnosis of most of

the tumours.

(9) DIAGNOSTIC SERVICES PROVIDED BYVARIOUS LABS OF IVRI

Salmonella

A total of 96 cultures received from different

institutions were subjected to standard method of

serotyping (Kauffman- White scheme). Of these 78

cultures were found positive for Salmonella belonging

to 12 different serotypes. Serotypes identified were

S. Typhimurium, S. S. Enteritidis, S. Virchow, S.

Weltevreden S. Elisabethville, S. London, S. Logos,

S. Essen, S. Drogana, S. Gallinarum, S. Eppendorf

and rough.

Mycoplasma

A total of 187 morbid materials (lung, pre-

scapular LN, liver, nasal swabs and cell line) procured

from goats, ovine, poultry and horses etc were

processed for the isolation of Mycoplasma. Twenty

eight isolates were confirmed to be of either

Mycoplasma spp. (22) or Acholeplasma spp. (6). Out

of 28 caprine serum samples procured, 5 samples

exhibited antibodies for M. mycoides subsp. capri

antigen

Clostridium

A total of 10 samples suspected for clostridial

infections were received. Out of these, 1 sample each

was positive for Clostridium septicum, and

Clostridium perfringens type D and remaining eight

samples were negative for Clostridium spp.

Parasite examination

The results of diagnosis for parasite material/

samples from wild life, domestic ruminants, pet

animals and man, which were received from various

places, are tabulated in Table-7.

Table 7: Biological materials received for diagnosis of parasitic diseases

S.No. Animal Material/Sample Results

1. Turtle Parasite samples (n=3) Ascarids

2. Pangolin Parasites Tapeworm segments, hookworm

3. Guldar Parasites Toxocara cati

4. Dog 1) Blood samples/ 1) Babesia gibsoni-a, d(5), f, h(2)

slides (n=53) Ehrlichia canis-d

2) Skin scraping 2) nil

3) Parasites 3) Dipylidium caninum, Spirocerca lupi

5. Tiger 1) Parasites 1) Toxocara cati, Physaloptera sp.

2) Blood smear 2) nil

6. Lion Blood smear nil

7. Spotted deer/ Faecal samples ( 3+2) F. gigantica and amphistome eggs, amphistome

Cheetal eggs

8. Black buck 1) Faecal samples (3+4) 1) F. gigantica & Strongyle eggs,

Amphistome eggs

2) Parasites 2) Amphistomes

9. Hog deer Faecal samples (1+2) Amphistome eggs, nil

10. Leopard Parasites Hypoderma lineatum

11. Equine 1) Faecal sample 1) Strongyle eggs

2) Blood sample 2) nil

12. Bovine- local Parasite Gigantocotyle sp. amphistome

13. Cattle- cross bred Blood sample Theileria annulata

14. Buffalo Faecal samples (8+5+2) nil, nil, Cryptosporidium sp.

6 3

15. Calf Faecal samples nil, nil, Eimeria oocyst, nil,

(15+20+1+10+2+1) Cryptosporidium, Eimerian oocyst

16 Vrindavani calves Faecal samples nil, nil, nil,

(10+7+5+4) Cryptosporidium sp.

17. Tharparkar calf Faecal samples (2) nil

18. Calf/Heifer Faecal samples (10) Strongyle, Trichuris sp., Eimeria sp.

19. Goat Faecal samples (5+10) Strongyle (all), Trichuris sp.(1)

20. Human 1)Worm specimen - ve for Dracunculus medinensis

2) Blood sample 2) nil

21. Water Worm specimens Hairworms (Gordiacea)

22. Child Worms Chrysomyia spp.

23. Leopard Parasites Toxocara cati, Physaloptera sp

Apart from general health care, specific

ailments in different livestock species (159 cases at

ECH, 248 cases at goat farm, 72 cases at LAPS, 3

cases at equine section, 13 farm bullocks and 47

cases in exp. animals of Virology Division were

treated, accordingly. Besides above, specific

treatments and health care services were also

provided to animals (204) in near by villages during

field visits for attending animal health camps.

12.GENETIC STUDIES RELATED TO

DISEASE RESISTANCE, PRODUCTION

AND REPRODUCTION IN LIVESTOCK

1. GENES RELATED TO DISEASE RESISTANCE

(a) Association of SSCP pattern in Lactoferrinand DRB3.2 with mastitis

Investigation was undertaken to identify singlenucleotide polymorphisms (SNPs) in lactoferrin andDRB3.2 gene and to find its association with mastitissusceptibility/ tolerance. The cows which had neverbeen affected by clinical mastitis during theirproductive life and tested negative for Californiamastitis test and somatic cell count (SCC) weredesignated as mastitis tolerant, whereas the cowsaffected with clinical mastitis at least once duringtheir productive life were taken as mastitissusceptible. A total of 100 crossbred cows (71-mastitis tolerant and 29-clinical mastitis) weregenotyped by SSCP in the exon 4 and introl 6 regionof lactoferin genes and exon 2 of DRB3 gene. A 293bp fragment encompassing partial intron 3 to partialintron 4 and 301 bp fragment from intron 6 of lactoferingene and 284 bp fragment of DRB3.2 gene wereamplified by using sequence specific primers.

PCR SSCP revealed two genotypes each ofexon 4 (Fig.53A) and intron 6 (Fig.53B) of lactoferringene namely EE, EF and AA, AB, respectively. Thegenotypes EF and AA as well as alleles E and Awere predominant genotypes. The genotype EF andAA had significant effect on mastitis incidence incomparison to EE and AB. Sequencing of therepresentative genotypes and its subsequentsequence homology comparison revealed one SNPin allele E and two SNPs in allele F, which changed

(10) CLINICAL AND DIAGNOSTIC SERVICES AT

IVRI MUKTESWAR

A total of 105 thorough necropsy examinations

of different livestock and experimental animals (39-

goats, 7- cattle and 31- rabbits of TAH division and

25-exp.goats and 4- exp. sheep of Virology Division)

were conducted during the period. The major causes

of mortality recorded in cattle were pneumonia and

stillbirth. In small ruminants (sheep and goat)

pneumonia, some time associated with diarrhoea and

dehydration were the cause for mortality. However,

in case of rabbits, coccidiosis, pneumonia, diarrhoea

and were the major causes of mortality. In cattle of

local area, haematuria and bovine pappiloma were

major problems.

Based on results of EPG in representative

animals, strategic deworming was performed at farms.

Further, the tick infestation in case of cattle and lice

infestation in case of goats were controlled

strategically using different acaricidal drugs. For the

control of GI parasites, deworming was performed in

a total of 386 animals (331 cases in goats, 46 cases

in cattle and 9 cases in bullock using different groups

of anthelmintics with different mode of action

(fenbendazole, doramectin and closantel) to minimize

the development of anthelmintics resistance. Ticks

infestation in cattle was controlled (total- 218) by using

flumethrin, Butox (bayticol pour on) and doramectin

(injectable preparation). Lice control in goats (total-

180 cases) and mange control in rabbits was

performed using doramectin injection. Feed

supplement viz. Livol, HB, Monobolus, Ostocalcium

and Agrimin was given to 39 cattle, 213 goats, 356

poultry and 214 laboratory animals. For prevention

of foot and mouth disease in livestock, a total of 219

cattle, 12 bullocks and 124 goats were vaccinated

using FMD vaccine obtained from IVRI, Bangaluru

unit and also 143 goats were vaccinated with PPR.

To assess the antibody titer in these animals, pre

and post vaccination serum samples were collected

and sent to PD, FMD, Mukteswar for further testing.

6 4

amino acid isoleucine to valine in exon 4. In intron 6,there was one SNP in allele A and three SNPs inallele B. Similarly PCR-SSCP of DRB3.2 gene alsorevealed two genotypes namely AA and AB(Fig.53C). Genotype AB was predominantly presentin mastitis tolerant animals with a frequency of 0.72.Analysis of variance for SCC revealed that bothDRB3.2 genotypes had significant effect on SCC.Logistic regression showed that genotype AA washighly significant for mastitis incidence in comparisonto genotype AB. Cloning and sequencing resultsrevealed two SNPs in allele A and four SNPs in allele

B.

Fig. 53: PCR-SSCP pattern for A: 293 bp exon 4 of

lactoferin gene, B: 301 bo of intron 6 of lactoferin gene,

C: 284 bp fragment of DRB3.2 gene on 10 % PAGE in

crossbred cattle.

(b) miRNAs expressed in bubaline mammary

tissue

Small RNAs were extracted from freshly

collected bubaline mammary tissues and enriched

by running small RNA on 15% denaturing (7M urea)

PAGE and its subsequent elution and concentration

by glycogen and precipitation. The enriched small

RNA fractions were ligated with a 3' and a 5' linker in

two separate reactions by using miRCat™ Small RNA

Cloning Kit (IDT). The 5' and 3' ligated RNAs contain

both RNA and DNA regions. These were converted

to DNA by using M-MLV Reverse Transcriptase

(Invitrogen) with the RT/REV primer. Synthesized

cDNA was used as template to amplify the miRNA

by using the primers designed on the known

sequences of linkers. These amplified PCR products

were checked on 15% PAGE. Amplification of

distinct 62 bp band indicated the effective extraction

of miRNAs from bubaline mammary tissues (Fig54).

Fig. 54: PCR amplification of cDNA. Lane L1 and L2:

PCR product of about 62bp. Lane M: 10 bp DNA marker.

(c) Recombinant adenovirus delivering bovine

lactoferrin gene produced and evaluated

Open reading frame (ORF) of bovine lactoferrin

gene was isolated from cow milk. It was then ligated

into a shuttle vector p Shuttle CMV. Recombinant

shuttle vector p Shuttle CMV-bLf was characterized

for the presence of the insert. Bovine lactoferrin gene

was then shuttled to adenoviral transfer vector p

AdEasy-1 to produce adenoviral backbone

recombinant for bovine lactoferrin. This was then

transfected into adenoviral packaging cell line, HEK-

293 to produce recombinant adenovirus expressing

bovine lactoferrin. Produced virus particles lysed the

cells forming characteristic CPE (Fig.55). The primary

virus was amplified by further infecting HEK-293 cells.

Amplified virus was purified, concentrated and

titrated. The titer of the virus was 107 pfu/ml. Purified

adenovirus recombinant for bovine lactoferrin was

characterized for its bovine lactoferrin gene delivery

in vitro in cell culture by using reverse transcriptase

PCR. It delivered bovine lactoferrin gene (Fig.56).

Fig. 55: Characteristic CPE in transfected cells.

Fig. 56: Expression of bovine lactoferrin gene by cells

transduced with adenovirus recombinant for bovine

lactoferrin. M: 100 bp ladder plus; T: transduced cells; C:

control non-transduced cells.

(d) DNA-protein interactions at the 5' end of

bovine TLR4 gene studied by Chromatin

Immunoprecipitation (ChIP) assay

ChIP assay was designed and optimized to

characterize putative binding site at 5' region of

6 5

bovine TLR4 gene in cross-bred cattle. The 5' region

of bovine TLR4 (EU386357.1) was analyzed for

putative CREB binding region by using software

PROMO. PCR primers flanking this region were

designed by using Oligo Analyzer program. Bovine

peripheral blood mononuclear cells (PBMCs) were

isolated and cultured following standard protocols.

Cells were treated with LPS to mimic the process of

inflammation/infection. Cells were fixed with

formaldehyde cross-linking. Chromatin fragmentation

was carried out with different parameters viz. 5S (5

cycles of sonication: each cycle included a pulse of

amplitude 5 for 1 min followed by a resting phase of

1 min in ice) and 10S (10 cycles of sonication: each

cycle included a pulse of amplitude 5 for 1 min

followed by a resting phase of 1 min in ice). Obtained

chromatin fragmentation was characterized. CREB

bound DNA from chromatin fragments was

precipitated with 1-4 µg anti-CREB antibody and

protein A agarose beads. The precipitated immune

complexes were washed and eluted. The DNA-protein

cross-links were then reversed to isolate DNA

involved in DNA-protein interactions. The DNA

containing putative CREB binding site at the 5' region

of TLR4 gene was amplified. An amplicon of 167 bp

was obtained.

(e) Genetics of host resistance against

Mycobacterium avium partuberculosis

Protocol for isolation and maintenance of

peripheral blood momonuclear cells (PBMC) derived

macrophages in goat and buffalo has been optimized.

PBMC derived macrophage cells from goat were

induced with E.coli lipopolysaccharide (LPS) and

expression profile of some of the important candidate

genes (viz., IFN-G, IL-10, NRAMP1 and TNFα ) wereassayed using real time PCR. Expression of IFN-G

remained unchanged. While expression of IL2 and

IL-10 was up-regulated (P<0.01) by 1.5 to 2 folds

due to induction with LPS. However, expression of

NRAMP1 was down-regulated (P<0.01) (Fig.57).

Fig. 57: Differential expression of candidate genes in

macrophages while induced/challenged with E. coli

derived LPS. In contrast to down-regulation (P<0.01) of

NRAMP1, expression of IL10 and TNF-alpha up-

regulated (P<0.01).

2. GENES RELATED WITH PRODUCTION

(a) Polymorphism in IGFBPs and Leptin genes

and it association with body weight in rabbits

Birth weights and subsequent body weights

of individual kits of New Zealand White rabbits were

analyzed to estimate the impact of direct additive

genetic, maternal additive genetic and permanent

environmental litter effect on growth traits i.e. birth

weight (BW), 15th day b. wt (15dW), 30th day b. wt

(30dW), and 90th day b. wt (90dW) and 180th day b.

wt (180dW). Effect of litter size was significant on all

the growth traits except 90dW. Kits born in winter

season had significantly higher BW, 30dW and 90dW

than the kits born in summer season. The heritability

estimate for BW ranged from 0.266 (Sire Model) to

0.540 (Animal Model 2). The permanent effect of litter

(c2) was highest (0.288 to 0.310) just before weaning

at 30dW and decreased after weaning. The effect of

indirectly inherited maternal genetic effect (m2) was

present at early juvenile stage of growth (15dW, 30dW

and 90dW) and was nil for 180dW. Selection for better

growth would be more reliable at 180dW because at

this age both c2 and m2 become lower than in previous

stages of growth. Using Animal Model 1,

repeatabilities of doe effects on BW, 15dW, 30dW,

90dW and 180dW were 0.35, 0.44, 0.40, 0.35 and

0.01, respectively. Animal Model 1 was better than

Animal Model 2 in partitioning of variances when the

maternal genetic variance (σ2m) was very low or zero.

For explaining the variation in growth of rabbits,

Leptin and IGFBP4 were taken as candidate genes.

Two amplicons of leptin gene of 204 (exon 1) and

265 (exon 2) base pair were amplified using genomic

from 120 New Zeeland White rabbits as template.

The primers for amplifying these two fragments were

F: 5- GGT GGT TCC TTC TGC CTT CA- 3 & B: 5-

AGC CTC TGT ACC GTG TGT GAG-3 and F: 5-AAT

AGC CAA CGA CCT GGA GAA CCT-3 & B: 5-GAT

TCT TTC CTC AGC GTG GTC CTT-3, respectively.

Both of these fragments revealed monomorphic

single-strand conformation polymorphism (SSCP)

profile, suggesting no polymorphism. In contradiction

with reports in other species it was found that in

rabbits the amplified fragments of leptin has no role

in influencing body weight growth. Exon 2 (258bp)

and exon 3 (135bp) of IGFBP-4 also showed no

polymorphism as evident from monomorphic SSCP

pattern in 15% PAGE.

(b) In-vitro knockdown of myostatin gene

Primary culture for foetal and adult myoblast

was developed from caprine muscle tissue. Myoblast

cell lines were confirmed using specific cell marker

of myogenic cells (i.e., Desmin Antibody) as well as

amplification of the myogenic markers using

quantative Real Time PCR (RT-qPCR). Best in vitro

model for studying MSTN knockdown was assessed.

6 6

The best in vitro model should have enough

endogenous expression of MSTN so that any down-

regulation due to knocking down could be measured.

Accordingly, endogenous expression of MSTN and

other associated myogenic genes were studied in

fibroblast, foetal and adult myoblast, and myotubules.

The caprine foetal myoblast cell lines showed highest

level of MSTN expression indicating its suitability as

the best possible model.

Three siRNAs were designed on the basis of

caprine MSTN sequences. Transfection protocol

using siPORT NeoFX (Ambion, USA) was optimized.

The above three siRNAs were individually transfected

into caprine foetal myoblast cells using siPORT

NeoFX (Ambion, USA) as transfecting agent. Each

individual transfection was performed in triplicates.

After 48 hr of transfection, total RNA was isolated

from the transiently transfected cells. cDNA was

synthesized and checked for the efficient knockdown

using RTqPCR. Knockdown of MSTN gene has been

observed for each of the three siRNAs (Fig. 58). There

was no significant difference in the expression of

OAS-1 gene among the three siRNAs with respect

to control. All three siRNAs did not induce OAS-1 in

transfected caprine foetal myoblast cells. To

downregulate MSTN gene, three shRNA individually

cloned into pLKO.1-puro-CMV-tGFP vector were used

for stable transfection using Lentiviral particles as

carrier. After optimizing the multiplicity of infection

(MOI), Foetal myoblast cells were transduced

individually with each lentiviral construct. The stably

transduced myoblast cells having significant MSTN

down regulation were established.

Fig. 58: Knock down effect of different siRNAs (1, 2 & 3)

transfection on Myostatin (MSTN) and associated genes

(Myogenin: MYOG; Myogenic factor 5: Myf 5 and

Myogenic differentiation 1: MyoD) in primary caprine

foetal myoblast cells

(c) SSCP in ATP1A1 gene

The ATP1A1 gene is one of the important

candidate genes for heat tolerance. A 301bp fragment

of ATP1A1 gene consisting of exon 17 was

successfully amplified using a set of forward (5'- ACA

AAC AAA AGG GTC ACA ACA T -3') and reverse

(5'- CTT ACC CTA GAT CCT GGC TCA T -3') primers

using genomic DNA as template from 100 crossbred

cattle and 75 Tharparkar cattle, and DNA was

isolated. The PCR-SSCP of 301 bp of exon 17 of

this gene revealed polymorphism (Fig.59).

Fig. 59: Polymorphic SSCP pattern for 301 bp fragment

of ATP1A1 gene in crossbred cattle.

(d) RNA interference (RNAi) in regulation of fattyacid synthesis

With the aim to produce designer pig with lower

fat in meat, two genes belonging to fatty acid

synthase systems were targeted by RNA interference.

Established mesenchymal stem cells (MSC) for

generating induced pluripotent stem (iPS) cells and

validated expression of ELOVL6 and SCD1 genes in

pig tissue samples and in MSC (Fig. 60).

Fig. 60: Culture and characterization of pig

mesenchymal stem cells

3. GENES RELATED WITH REPRODUCTION

(a) SNPs associated with CatSper1 geneinfluencing sperm motility

The study was undertaken to identify SNPs in

CatSper1 gene, which is known to control sperm

motility. Randomly selected 111 Vrindavani

(crossbred) cattle were included. PCR-SSCP

technique was used to detect polymorphism in five

fragments i.e. fragment I (299 bp), fragment II (376

bp), fragment III (237 bp), fragment IV (385 bp) and

fragment V (282 bp) of CatSper1 gene. The fragment

I was found monomorphic in all the animals. The

fragment II revealed polymorphism exhibiting four

genotypes i.e. AA, BB, CC and AB. The fragment III

(237 bp) was also polymorphic, which revealed five

genotypes i.e. DD, EE, FF, GG and HH. The

polymorphism was also observed in the fragment IV

(385 bp), which revealed four genotypes II, JJ, KK

6 7

and LL. The fragment V revealed three genotypes

viz. MM, MN and NN. Only exonic SNPs (that were

responsible for alteration in amino acid) were included

for haplotype determination. Thus a total of three

haplotype viz haplotype I, haplotype II and haplotype

III were obtained. The least square analysis of

variance revealed a significant (P<0.01) effect of

haplotype on all the three motility parameters, viz.

mass motility (MM), initial progressive motility (IPM)

and post thaw motility (PTM) .

(b) Microarray analysis for identifying genesinfluencing sperm motility

Seminal parameters viz., volume,

concentration, mass motility, initial progressive

motility, post thaw motility, live count and HOST in

freezable and non freezable semen samples from

crossbred bulls were evaluated. Microarray analysis

using RNA from spermatozoa in freezable and non-

freezable semen was done. A total of 160 up-regulated

genes and 145 down-regulated genes were identified.

Among these, up-regulation of CTRB1

(chymotrypsinogen B1) gene and down-regulation of

CYB5R4 (cytochrome b5 reductase 4) gene was

validated using real time qPCR.

(c) FecB gene in sheep

FecB gene was genotyped in 1410 animals

belonging to 16 Indian sheep breeds by using forced

PCR-RFLP, viz. Muzaffarnagari (100), Jalauni (100),

Deccani (100), Madgyal (40), Madras Red (88), Garole

(100), Kuzi (100), Patanwadi (100), Nellore (104),

Mandya (36), Vembur (76), Kilakarsal (104), Ramnad

White (112), Balangir (100), Shahabadi (100) and

Bonpala (50). The results of genotyping of FecB locus

revealed that there was presence of FecB mutation

in Garole, Kuzi and Shahabadi sheep of breeds.

Genotyping of Garole results showed 67% were

FecBBB, 20% were FecBB+ and 13% were FecB++.

Similarly in Kuzi, 65% were FecBBB, 30% were

FecBB+ and 5% were FecB ++, whereas in Shahabadi

76% were FecB B+ and 24% were FecB ++.

Genotyping of Muzaffarnagari, Jalauni, Madgyal,

Deccani, Madras Red, Patanwadi, Nellore, Mandya,

Vembur, Kilakarsal, Ramanand White, Bonpala and

Balangir were FecB ++ carrier with a genotypic

frequency of 1. The least square mean for litter size

based on 100 observations of Garole, Kuzi and

Shahabadi were 1.585 ± 0.055, 1.780 ± 0.062 and

1.141 ± 0.02, respectively; whereas least square

means for litter size of 13 non-prolific sheep breeds

were 1.00 ± 0.00. The sequencing of representative

samples of FecB gene from each breed showed point

mutation i.e. G to A at 110th position in FecBBB/

FecBB+ carrier and absence of point mutation in

FecB++ non-carriers. The point mutation G to A

translated glutamine to arginine amino acid at position

249 of the mature protein in FecB carriers. The study

showed that Kuzi is equally prolific and higher body

weight than Garole.

(d) Fec G gene

A total of 450 animals of five sheep breeds,

viz. Garole, Kuzi, Shahabadi, Balangir and Bonpala

were evaluated for FecG gene using forced PCR-RFLP. The results of genotyping of FecG locus in

these breeds showed only one genotype, i.e. FecGHH

(Fig. 61). Sequencing of representative samples of

FecG gene in each breed showed point mutation C

to T at 105th position in FecG carrier. The point

mutation C to T translated the amino acid from serineto phenyl alanine at position 77 of mature peptide.

There was no infertility observed in these five breeds.

This may be due to FecG action nullified by epistatic

action of FecB gene or breed variation. The result

also suggested that FecG gene is fixed in all these

five sheep breeds. Based on the results, it issuggested that FecB gene is the reliable genetic

marker for evaluation of prolificacy in sheep. Forced

PCR-RFLP method is useful method to evaluate the

allelic variants of FecB and FecG genes. Kuzi the

best alternative source for FecB gene than Garole to

increase prolificacy and body weight in non-prolific

breeds of India.

Fig. 61: Genotypic pattern of 139 bp amplicon of FecG

gene/ DdeI PCR RFLP. M: 100 bp ladder; Lane 1-14: HH

genotype.

(e) SNPs in the candidate genes influencingprolificacy in Black Bengal goat

Complete coding region of several candidate genes

namely Growth Differentiation Factor 9 (GDF9), Bone

Morphogenetic Protein 15 (BMP15), BMP Receptor

1 B (BMPR1B), IGF-1, IGF-2 and Follistatin in five

different breeds of goat were amplified, cloned and

characterized. More than 25 novel sequences of these

candidate genes were obtained in different breeds.

Novel SNPs in the exonic regions of BMP15, GDF9,

BMPR1B, IGF-I, IGF-II, Follistatin and IGFBP3

genes were identified using SSCP and targeted re-

sequencing of polymorphic SSCP patterns (Fig. 62).

Fig. 62: Native PAGE showing the SSCP in Exon 2 of

BMP15gene

6 8

13.LIVESTOCK PRODUCTION AND

MANAGEMENT

(1) MULTIPLICATION AND EVALUATION OF

VRINDAVANI CATTLE

The opening balance of Vrindavani cattle as

on 01.04.2011 was 500 heads (95 males and 405

females). Additions in the herd were due to birth of

82 female and 93 male calves (175 heads). The

closing balance of the Vrindavani cattle herd as on

31.03.2012 was 358 heads (46 males and 312

females).

The overall mortality per cent was 5.78%. The

overall female mortality was 5.95%, whereas for

males it was 5.32%. The overall culling per cent was

27.56 with respective values for male and female

culling % as 25.00 and 28.54, respectively.

The overall conception rate in Vrindavani cattle

herd was 52.33%. The figures in heifer and adult

groups were 60.97 and 49.08%, respectively. The

overall calving abnormalities were 30.29%, which

included 8.00% abortions, 6.29% unseen abortions,

1.71% dystokia, 6.29% retained placenta, 5.14%

premature births, 1.14% prolapse, 1.14% still births.

The least squares' means (LSM) for age at first

calving, service period, dry period and calving interval

were 989.44±17.95 days, 102.83±5.87 days,

97.50±22.39 days and 445.21±24.08 days,

respectively.

Vrindavani cattle produced 536846.0 kg milk

during the current year. On an average, 78.80% of

the total adult Vrindavani females were in the milk

during the current year. Means for overall wet and

herd averages were 10.53 and 8.31 kg, respectively.

The Fat, SNF and Total Solids were 4.30%, 8.76%

and 13.06%, respectively. The LSM's for total

lactation milk yield, total lactation length, milk yield

per day of total lactation length, 305 days' milk yield,

milk yield per day of 305 days lactation period, peak

yield, days to attain peak yield and weight at calving

were 3499.48±38.11 kg, 316.33±3.81 days,

10.74±0.14 kg/d, 3492.63±73.59 kg, 11.46±0.24 kg/

d, 18.41±0.26 kg, 71.42±7.91 days and 405.96±4.23

kg, respectively.

The least squares' means (LSM) for overall

live body weights at birth, 3, 6, 12, 18 and 24 months

of age were 22.25±0.33, 45.23±0.95, 90.92±1.59,

150.15±3.22, 246.23±3.53 and 300.08±4.06 kg,

respectively.

(2) THARPARKAR CATTLE

The opening balance of Tharparkar cattle as

on 01.04.2011 was 154 heads (30 males and 124

females). The M:F ratio of new calvings was

1.00:0.95. The closing balance of the Tharparkar

cattle herd as on 31.03.2012 was 98 cattle heads

(15 males and 83 females).

The overall mortality per cent in Tharparkar

herd was 4.62%. The overall conception rate in

Tharparkar herd was 64.78%. The figures in heifer

and adult groups were 63.63 and 65.30%,

respectively. The overall calving abnormalities were

34.15%, which included 7.32% abortions, 2.44%

unseen abortions, 7.32% retained placenta, 2.44%

premature births, 9.76% prolapses and 4.88% still

births. The least squares' means (LSM) for age at

first calving, service period, dry period and calving

interval were 1056.67±90.22, 230.34±20.63,

292.05±118.36 and 472.46±28.95 days, respectively.

Tharparkar cattle produced 21679 kg milk

during the current year. Means for overall wet and

herd averages were 3.39 and 1.48 kg, respectively.

On the basis of analysis of 384 milk samples, the

overall Fat, SNF and Total Solids were 4.34, 8.77

and 13.12%, respectively.

The least squares' means (LSM) for overall

live body weights at birth, 3, 6, 12, 18 and 24 months

of age were 21.27±0.48, 56.18±2.33, 108.52±3.27,

171.34±7.77, 230.79±2.56 and 260.06±3.98 kg,

respectively.

(3) MURRAH BUFFALO

The opening balance of Murrah buffaloes as

on 01.04.2011 was 223 heads (62 males and 161

females). Additions in the herd were due to birth of

23 female and 31 male calves (54 heads). The closing

balance of the buffalo herd as on 31.03.2012 was

150 buffalo heads (118 females and 32 males).

The overall mortality was 6.07%. The overall

female and male group mortality were 3.38% and

15.87%, respectively. A total of deaths were recorded

in buffalo herd during the current year (10 males and

5 females).

The overall conception rate was 50.00%. The

figures in heifer and adult groups were 43.24% and

53.84%, respectively. The overall calving

abnormalities were 18.64%, which included 1.69%

abortions, 1.69% unseen abortions, 1.69% dystokia,

5.08% retention of placenta, 1.69% prolapse and

6.77% premature births and still births. The least

squares' means (LSM) for age at first calving, service

period, dry period and calving interval were

45.61±3.22 months, 152.91±20.66 days,

207.38±22.22 days and 460.89±17.90 days,

respectively.

The least squares' means (LSM) for overall

live body weights at birth, 3, 6, 12, 18 and 24 months

of age were 32.75±0.63, 63.40±1.95, 123.73±3.41,

226.53±7.84, 308.13±7.21 and 377.90±6.53 kg,

respectively. The weight at first calving during the

current year was 498.44±16.72 kg.

Means for overall wet and herd averages were

5.82 and 3.39 kg, respectively. On an average,

57.44% of the total adult females were in the milk

6 9

during this period. The LSM's for total lactation milk

yield, average lactation length, average 305 days'

yield and peak yield were 2208.41±70.08 kg,

308.75±07.72 days, 2276.82±82.85 kg and

11.54±0.37 kg, respectively. The Fat, SNF and Total

Solids were 8.08, 9.67 and 17.76 %, respectively.

(4) DEVELOPMENT OF APPROPRIATE MILKPRODUCTION MODELS FOR SELECTIONOF VRINDAVANI CATTLE AND MURRAHBUFFALOES

Ten-year data (1.4.1999 to 31.3.2009) on

Vrindavani cattle and Murrah buffaloes on milk

production along with initial reproduction traits were

used.

In Vrindavani, prediction of ATLMY(average

total lactations milk yield), based on overall records

up to eight parities indicated that out of five initially

expressed traits, FLL (first lactation length) followed

by FCI (first calving interval) and FDP (first dry period)

could follow the significant criterion obtained through

stepwise procedure of regression analysis. Up to 4th

parity, FLL was the main predictor variable followed

by AFC, FCI and FSP and beyond this, FDP followed

by FCI were the main predictors for estimation of

parities-wise TLMY based on these traits. Curve

estimation suggests that for AVTLMY, quadratic

function had significant association, whereas for

individual parities, TLMY logarithmic function was the

best fit. In Murrah, FLL was the only initial trait and

the reason of non-inclusion of other traits may be

introduction of new animals. S-curve was the best

fit. Estimation of TLMY in first parity showed the

inclusion of FLL in the model with best fitness of S-

curve.

(a) Lifetime milk yield estimation with principalcomponents as predictors

Lifetime milk yield production estimate was

made based on data records (1999-2009) on parity

wise part milk yields (100, 170 and 240 days yields)

and respective total milk yields, for evolvement of

models for lifetime milk yield (total up to 4th parity-

PTLMY4, and 5th parity-PTLMY5) using principal

component regression analysis for both the species.

Principal component analysis could retain three

components, which explained 93.08% and 94.09%

variation of the original variables in Vrindavani cattle

and Murrah buffaloes, respectively.

(b) Lifetime milk production estimation withrespect to early expressed traits

In Vrindavani, stepwise regression analysis for

PTLMY4 with respect to early growth, reproduction

and part lactation milk yields (BWT, AFC, FLL, FCI,

FSP, FDP, my100_1, my170_1, my240_1, tlmy1,

my100_2, my170_2, my240_2, tlmy2), could retain

part total milk yield at 240 days of second lactation

(my240_2) together with first lactation milk yield

(TLMY1) and part total milk yield at 170 days of

second lactation (my170_2) as predictors and jointly

explained 40.32% variation in estimated value.

However, for prediction of PTLMY5 part total

milk yield at 240 days of second lactation (my240_2)

together with first lactation length (FLL) as predictors

jointly explained 26.71% variation in estimated value.

In Murrah buffaloes, stepwise regression

analysis for PTLMY4 with respect to my100_1,

my170_1, my240_1 and tlmy1, could retain part milk

yield of 240 days (my240_1) and part milk yield of

100 days (my100_1) of first lactation as predictors

(when significance level was fixed at 5%) and

explained 65.19% variation in estimated value (R2)

of PTLMY4.

(5) DEVELOPMENT OF DATABASE PACKAGE

FOR PROCESSING OF VRINDAVANI

CATTLE DATA

To monitor performance of our dairy farm and

to make decisions based on real-time data on various

growth, production and reproduction aspects of

Vrindavani cattle since 1969, a database package is

being developed in MS Access. The relationships

amongst files having information on daily milk yield,

gestation, animal pedigree, growth and milk yield have

been established for preparation of database.

(6) DEVELOPMENT OF PACKAGE OF

PRACTICES FOR WEANING OF MURRAH

BUFFALO CALVES

The overall least squares' means for monthly

milk consumption by Murrah buffalo calves under

suckling system during month 1 (MC1) to month 7

(MC7) were 92.72±27.99, 126.63±3.90, 121.54±2.62,

128.72±2.21, 132.69±1.00, 128.69±4.41 and

111.22±27.240 kg/month. The overall least squares'

means for total milk consumption (TC), duration of

milk consumption (DC) and per day milk consumption

(PDMC) were 547.83±39.80 kg, 131.91±6.68 day and

4.07±0.45 kg/day, respectively. Highly significant

effect (P=0.01) of rearing system was evident on total

milk consumption and duration of milk consumption,

however, its effect on PDMC was non-significant.

The total milk consumption in calves of suckling

system was higher than weaned system due to the

fact that under weaning system the milk at

predetermined recommended levels was fed for 71 d

only whereas under suckling system it was continued

up to 203.75±3.05 d. The per day milk consumption

was slightly higher in suckling calves (4.23±0.21 kg/

d) as compared to their weaned counterparts

(3.93±0.19 kg/d).

For fertility response of both groups, the

concentrations of progesterone and estrogen were

measured in blood serum of weaning as well as

suckling groups up to 42 days post partum collected

7 0

at weekly interval. The mean serum progesterone

and estrogen differed significantly (P<0.05) between

weaning and suckling groups of animals. Animals in

weaning group have shown higher estrogen and

progesterone levels at 28 and 38 days, respectively,

indicating of early resumption of cyclicity in weaned

buffaloes.

(7) LEVEL OF INBREEDING IN VRINDAVANIHERD AND ITS IMPACT ON GROWTH,PRODUCTION AND REPRODUCTIONPERFORMANCE

Collected and computerized pedigree records

of 8609 Vrindavani cows/bulls. Information consisted

of animal number, animal breed, sire number, sire

breed, dam number, dam breed, date of birth and

sex. Performance recording and further

computerization is under progress. Pedigree file will

be used to determine the level of inbreeding in

Vrindavani herd across the years.

(8) DESIGN AND DEVELOPMENT OFCLEANING AND COLLECTIONEQUIPMENTS FOR LIVESTOCK FARM

The prototype for the new equipment was

designed and fabrication of the frame has been

completed. The fabrication of transportation unit and

collection unit is underway.

(9) CHARACTERIZATION AND DOCUMENTA-TION OF ROHILKHANDI GOAT

Total milk yield of 90 days averaged 58.77

litres with average ADMY 0.65 litre/day. The fat, SNF,

protein and lactose were 5.28%, 7.89%, 2.87% and

4.44%, respectively. The fat in T1, T2 and T3 group

were 5.89%, 5.88% and 4.15%, respectively. The

fat per cent was similar in T1 and T2 groups and was

higher than T3 which differed significantly (P<0.05).

The SNF in T1, T2 and T3 groups was 7.75%, 8.02%

and 7.95%, respectively. The protein and lactose were

lower (2.77% and 4.30%, respectively) in T1 in

comparison to other two groups. Overall milk

production in rainy season (0.726l/d) was significantly

(P<0.01) higher than winter season (0.657l/d).

Udder morphology for the local goat was

measured. The udder volume (UV) in primiparous and

multiparous goats was 516.54 ± 74.52 ml and 940.76

± 46.47 ml, respectively. These mean values were

statistically significant (P<0.05). The values of udder

length (UL), udder depth (UD), udder circumference

(UC), udder row width (URW) and udder column width

(UCW) for primiparous goats were 10.41±0.60,

11.58±0.63cm, 28.34±1.12cm, 8.74±0.45 and

7.66±0.52 cm, respectively. Corresponding values

of UL, UD, UC, URW and UCW for multiparous goats

were 12.14±0.38cm, 14.74±0.39cm, 35.20±0.69cm,

10.83±0.28cm and 9.30±0.32 cm, respectively. The

value of various teat parameters viz. teat length (TL),

teat diameter (TD), teat circumference (TC), teat

height from ground (THG) and distance between teats

(DBT) for primiparous goats were 9.07±0.57cm,

3.02±0.27cm, 10.09±0.88cm, 20.83±1.02cm and

8.22±0.88cm, respectively. Corresponding values for

multiparous goats were 9.58±0.35, 4.28±0.17,

13.52±0.55, 18.42±0.64 and 10.04±0.56,

respectively. The UL, UD, UC, URW and UCW were

significantly (P<0.05) higher than primiparous goats.

Average daily milk yield is positive and significantly

(P<0.01) correlated with udder volume, udder length,

udder depth, udder circumference, udder row width,

teat diameter and teat circumference, except for teat

height from ground. The same trend was also observed

for the total milk yield with the udder morphological

and teat characteristics.

(10) SWINE PRODUCTION FARM

(a) Establishment of pure Landrace nucleus herd

Pure Landrace nucleus herd, established in

the year 2006-07, is being maintained. Eleven females

farrowed in the year 2011-12. Herd strength at the

beginning of the year (as on 01.04.2011) was 109

(52 males and 57 females), whereas at the end of

the year (on 31.03.2012), it was 65 (27 males and 38

females). Piglets attained live weight of 8.59±0.16

kg at weaning (42 days of age) and average daily

gain during pre-weaning period was 172.19±3.66 g/

d. Overall mortality was 13.89%.

All the females were bred with 98% conception

rate with 1.09 services per conception. A herd of 65

Landrace pigs (27 males and 38 females) was

maintained (as on 31.03.2012) after selecting from a

total stock of 642. Birth weight and body weight at

weaning were 1.34±0.02kg and 9.39±0.16 kg,

respectively. Overall growth rate up to 24 weeks of

age was 378.64 g/d. Mean litter size at birth was

9.82±0.50 and at weaning it was 8.14±0.51. Overall

mortality rate in Landrace pigs was 3.89%.

A low-cost wooden dummy was designed for

training of boars for semen collection. A span of 22

days was required to train the boars for mounting the

dummy after first exposure to the dummy. First

ejaculation was obtained after 28 days from start of

the training. Semen collection was done by gloved

hand method. A total of 48 collections were studied

for semen biology in two Landrace boars. Average

ejaculate volume was 254.44±19.45 ml (gel fraction:

41.11±4.47 ml and sperm-rich fraction: 213.33±15.36

ml). The mean sperm concentration was

279.44±62.08 millions/ml. Artificial insemination was

done following standard technique in available

oestrous sows.

(b) Crossbred swine

During the year, inter se mating was carried

out to study the performance of the crossbred pigs.

A total of 146 crossbred pigs (52 males and 94

7 1

females) were present on 01.04.2011, whereas the

balance at the end of the year (as on 31.03.2012)

was 82 (37 males and 45 females). A total of 215

piglets (101 males and 114 females) were born,

whereas 279 pigs (116 males and 163 females) were

disposed off. Overall mortality rate was 11.27%.

Number of services per conception was

1.10+0.01. The litter size was 10.23±0.64 and litter

weight was 11.68±0.62 kg at birth; whereas, at

weaning litter size was 8.89±0.67 and litter weight

was 79.00±4.81 kg. Average daily gain of pre-weaning

piglets was 189.15±8.52 g/d and that of post weaning

(up to 32 weeks of age) pigs was 420.76±18.62 g/d.

Studies on the feed conversion efficiency in

crossbred boarlings (5-20 weeks of age) revealed that

overall feed consumption was 2.50±0.05 kg for one

kg of body weight gain. In order to bring down the

Landrace inheritance to 75%, 12 indigenous animals

were maintained.

(11) LABORATORY ANIMAL SECTION

Four laboratory animal species are being

maintained at LAR section i.e. rabbits (New Zeeland

and Angora breeds), rat (Wister strain), mice (Albino

strain) and guinea pig (Dunkin Hartley strain). Also,

for scaling up the rabbit production to fulfill the demand

of swine fever vaccine, demand a separate extension

of rabbitary unit was established. The opening

balance, on 1st April, 2011 for rabbit, guinea pig, rat,

and mice were 319, 246, 1061 and 896, respectively;

whereas closing balance on 31st March, 2012 were

301, 323, 706 and 751, respectively. During the year,

440 rabbits, 466 guinea pigs, 2932 rats and 3143

mice were supplied for production of biologicals and

for research work.

(12) EXPERIMENTAL CATTLE HERD,MUKTESWAR

The experimental dairy farm maintained initial

(opening balance on 01.04.2011) strength of 126, out

of which 35 cows were in milk, 18 dry cows, 25 heifers

above 18 months of age, 23 heifers between 6 and

18 months, 8 female calves, 13 male calves, 2

breeding bulls, one teaser bull and one pony. The

respective closing balance (as on 31.03.12) was a

total of 127 herd strength of which, 33 cows were in

milk, 16 dry cows, 25 heifers above 18 months of

age, 18 heifers between 6-18 month age, 11 female

calves, 24 male calves, 1 breeding bull and 2 teaser

bulls. During the period a total of 31 calving were

achieved, out of which maximum calving occurred in

the month of July (22.58%) followed by September

(16.13%) and January (12.90%). Total 6 heifers calved

during the period and the age at first calving (AFC)

averaged 1811.67±66.58 days. Average dry period

and inter-calving period in the herd were 137.0±18.21

and 442.24±22.43 days, respectively. One

primiparous cow calved twin healthy female calves.

Out of 32 calves born, 16 were male and 16 were

female calves. During the period a total of 7 deaths

occurred in the herd. Calf mortality was 6.25%.

During the period, mean milk production per

day per cow was 7.65 L, which is 0.5 L higher than

the previous year. Average per day milk production

was maximum (243.54 L) during the autumn season

(October-November), followed by summer season

(236.12 L), while it was minimum during the winter

season (192.64 L). The average milk production per

cow per day was highest (8.41 L) during the rainy

season (July-Sept.), followed by autumn season (8.01

L), while it was lowest in the winter season (6.94 L).

During the period total cow days were 10691 and

average cows in milk per day were 29.22 giving a

total annual milk production of 81875.4 L with average

milk production per day 223.71 L.

The milk analysis revealed that mean fat%,

SNF%, protein% and density in the herd were 4.87

±0.03, 8.48 ±0.02, 2.94 ±0.01 and 28.04 ±0.07,

respectively. The average 305 days milk yield in the

first and other lactation was 2112.83 ±134.26 and

2395.74 ±110.52 L, respectively. Total lactation yield

and total lactation length in the herd was 2203.11

±103.83 L and 307.04 ±2.82 days, respectively. The

wet and herd average milk production of the farm

was 7.65 L and 5.22 L, respectively. During the period,

81875.40 L total milk was produced.

Average number of AI required per conception

was 2.6. Conception rate to the first AI was 42% and

overall conception rate to all AI was 39%. Wet: dry

cows' ratio in the herd was 66.04: 33.96. Production

data of cattle born from 1989-2005 at Experimental

Cattle Herd was computerized. Mean lactation milk

yield and 305 days milk yield were 2486.34 ± 26.70

(n=809) and 2240.53 ±20.21 L (n=633), respectively.

Average daily milk yield of cow was 6.91 ±0.06 L

(n=731). Mean lactation length, dry period and calving

interval were 363.59±2.95 (809), 83.36 ±2.64 (731)

and 447.73 ±9.07 (731) days, respectively. Mean age

at first calving was 1325.30 ±18.01 (248) days. Mean

herd life and number of calving were 3295.15 ±74.16

(189) days and 4.38 ±0.17 (189), respectively.

(13) EXPERIMENTAL GOAT FARM,

MUKTESWAR

The experimental goat farm at Surmane had

maintained an initial strength (on 01.04.11) of 167

goats comprising of 26 Pashmina, 84 local hill goats,

33 Jhakharana, 21 Jamunapari goats and 3 sheep.

On 31.03.12, it had a total strength of 86 goats

comprising of 9 Pashmina, 58 Local hill goats, 10

Jhakharana goats and 9 Jamunapari goats. During

the year there were 31 kiddings (2 Pashmina, 19 local

hill goats, 5 Jhakharana and 5 in Jamunapari).

Comparative study of birth weight and weight

gain among different breeds of goats at different time

7 2

interval till 12 months revealed that birth weight was

highest in Jamunapari (2.7 kg) followed by Jakhrana

goats (2.6 kg) and it was lowest in local hill goats

(1.8 kg). Similarly, body weight at 12 month age was

also highest in Jamunapari goats (18.0 kg) followed

by Jakharana female goats (17.6 kg) and lowest in

local hill goats (14.8 kg).

(14) LABORATORY ANIMAL PRODUCTIONSECTION, MUKTESWAR

The laboratory animals are being maintained

to meet out the needs of different laboratories of this

campus as well as other institutes. The laboratory

animal section maintained an initial strength of 19

NZW rabbits, 17 GG rabbits, 14 SC rabbits, 8 Angora

rabbits, 140 guinea pigs and 483 mice; with closing

strength of 31 NZW rabbits, 22 GG rabbits, 19 SC

rabbits, 4 Angora rabbits, 141 guinea pigs and 618

mice. During the period a total of 72 rabbits, 233

guinea pigs and 266 mice were issued to various

Institutions; and 9 rabbits, 24 guinea pigs and 140

mice, and 16.5 kg Angora wool were sold. Among

rabbit breeds litter size at birth and body weight at

day 50 was higher in GG (4.8 and 852.5 g) than NZW

(4.6 and 776.5 g) and SC (4.7 and 731.4 g).

(15) EQUINE FARM, MUKTESWAR

The equine section initially maintained 4 ponies.

During the period 2 ponies were auctioned and one

pony was issued to Izatnagar.

(16) POULTRY REARING, MUKTESWAR

Two batches of broiler chicks were reared in

cage as well as in litter system. In May batch (from

20.05.11 to 11.07.11) a total of 592 day old chicks

were reared in both the systems and 20 birds died

(3.4% mortality) and 572 birds were sold. Similarly,

in September batch (form 15.09.11 to 04.01.12) 903

day old chicks were reared in the two rearing systems,

206 birds died (22.8% mortality) and 697 birds were

sold.

Layer birds were reared in cage and litter

systems. During the period (01.04.11 to 23.08.11)

368.5 kg eggs were sold. 60 turkey birds aged 6

months (about 50% male/female each) were reared

(from 01.07.11 to 27.03.12) in semi-intensive type of

housing and in laying at about 8 months of age.

Average egg laying was on alternate day and average

egg wt. was 96 g.

(17) ESTABLISHMENT OF ELITE FLOCK OF

BLACK BENGAL GOAT, ERS, KOLKATA

One animal shed at IVRI, ERS Kalyani Farm

has been renovated and a total of 15 pure Black

Bengal goats (10 females and 5 males) have been

procured and maintained to establish an elite flock

of Black Bengal goat unit. A total of 56 ejaculates

were collected from 6 bucks and evaluated for their

physical characteristics (Table-8).

Table 8: Black Bengal buck semen characteristic at different seasons (mean ± SE)

Parameters May- June Sept- Nov Overall mean

Volume (ml) 0.65±0.32 0.56±0.05 0.60±0.04

Colour Creamy Creamy white

Progressive motility (%) 90.7±0.40 89.1±0.66 89.9± 0.8

Live sperm (%) 90.0±0.57 88.2±0.60 89.1±0.9

Abnormality (%) 6.6±0.38 8.0±0.60 7.3±0.7

Sperm Concentration (X 109/ml) 3.16±0.5 X 109 3.18±0.5 X 109 3.17± 0.10 X 109

pH 6.79± 0.31 6.71±0.03 6.75 ± 0.04

(18) HYPOXIA INDUCIBLE FACTOR-1 (HIF-1)AS MARKER OF ADAPTATION TO HIGHALTITUDE

(a) Expression of goat HIF-1 alpha protein

Primer pairs were designed using gene tool

software and custom synthesized. PCR amplification

was done as per the standard protocol and

amplification was confirmed by gel electrophoresis.

PCR product was purified using QIAGEN kit and

protocol. Purified product was cloned in BL21 host

cells using pET-32a vector and restriction enzymes

as Bam H-1 and Hind III. Cloned BL21 cells were

induced for protein expression using 100 mM IPTG

and ampicillin and chlormphenicol as antibiotics of

choice. It was found that protein expression was

highest at 6 hr of induction and a product of about 50

kda was seen in SDS PAGE.

For full length sequencing of HIF-1α, twooverlapping sets of primers (set1 F-5'

GGGCACCGATTCACCATGGAG 3' and R-5'

TCTTGAATCTGGGGCATGGTAAA 3' and set 2 F-5'

CTTTTACCATGCCCCAGATTCA 3' and R-5'

GCCACCAGTGTCCAAAAAAAGG 3') were designed

and standardized using GAPDH as internal control

and cDNA derived from Jakharana goats blood. The

amplified fragments were cloned in pGM-T easy

vector using Top 10' host cells. Positive clones were

sequenced from automated sequencer (from South

Campus, University of New Delhi). The obtained

sequences were rearranged and submitted to the

NCBI gene bank and accession No. JN897021.1 was

obtained. Obtained sequence was analyzed for

sequence homology using ClustalW method of

MegAlign module in Mega 5.0. It showed 99.2%

7 3

homology with cattle, 99.3% with antelope, 99.3%

with yak, 99.4% with sheep (partial), 96.7% with pig,

90.0% with mouse 78.9% with chicken and 95.1%

with human, which indicates close evolutionary

relationship. In phylogenetic analysis, goat, sheep,

cattle, yak and antelope HIF-1α genes showedidentical lineage. However, pig, human and chicken

sequences showed dissimilarities suggesting different

ancestry. Predicted HIF-1α protein of goat possessesmolecular weight of 92 kDa with 823 amino acids.

The deduced amino acid sequence of the goat HIF-

1α showed higher identities with the human (90%),bovine (92%), mouse (86%), Norway rat (86%),

chicken (76%), African claw flow (53%) and rainbow

trout (40%). Analyzed the specific functional portions

namely: basic-Helix-Loop-Helix (b-HLH) from position

23 to 78, Per/Arnt/Sim-A (PAS-A) from position 87

to 153, Per/Arnt/Sim-B (PAS-B) from position 230 to

296, Oxygen-dependent degradation domain (ODD),

N-Transactivation domain (N-TAD), C-Transactivation

domain (C-TAD) and Nuclear Localization Signal

domain (NLS).

(b) Glutathione peroxidase (GPx) assay

GPx assay was performed in preserved plasma

samples of poultry and goat using glutathione

peroxidase assay kit (Cayman chemical company).

GPx activity in chicken increased after transport to

Mukteswar and it was highest on day 2 of transport

and came to the normal level on day 35 indicating

that stress due to transport and hypoxia was

minimized after a week. It may be due to gradual

adaptation of birds to the prevailing climate. GPx

activity in goats also increased gradually after

transport to Mukteswar and it was highest on day 10

of transport and came to the normal level on day 35

indicating that stress due to transport and hypoxia

was minimized after a month. It may be due to gradual

adaptation of goats to the prevailing climate.

(c) Expression profile of HIF-1αααα mRNA in goatstransported from Makhdoom to Mukteswar

Blood samples were collected from six male

Jakharana goats before transport and at day 2, 5

and 10 of transport. cDNA was synthesized and PCR

and real time PCR was performed for HIF-1α usingGAPDH as internal control. Study revealed that there

was no significant change in mRNA expression after

transport of goats from plains to high altitude at IVRI,

Mukteswar.

14. REPRODUCTIVE MANAGEMENT AND

AUGMENTATION OF FERTILITY

(1) INNATE IMMUNITY MARKERS IN CATTLE

AND BUFFALOES IN RELATION TO UTERINE

INFECTIONS

The first experiment was conducted to

evaluate the relative mRNA expression profile of

cytokines i.e., IL-1β, IL-8, TNFα and IL-4 in peripheralblood mononuclear cells (PBMCs) in buffaloes with

and without endometritis.

A total of 15 buffaloes were included in this

study of which, 9 buffaloes were diagnosed positive

for endometritis based on presence of mucopurulent

discharge on vaginal inspection and positive colour

reaction to white side test of cervico-vaginal mucus,

whereas 6 buffaloes having no symptoms of

endometritis were considered as healthy control. All

the three target pro-inflammatory cytokines (IL-1β,IL-8 and TNF-α) mRNA were expressed differentiallyin PBMCs of endometritic buffaloes. The expression

level of IL-1β and IL-8 was increased 2.15 and 1.92fold (P<0.05), respectively in endometritic buffaloes

as compared to healthy control, whereas the

expression of TNF-α was found to be the highest(3.27 fold) in buffaloes with endometritis compared

to other pro-inflammatory cytokines. No significant

change was observed in IL-4 expression between

endometritic and non-endometritic buffaloes (P>0.05).

Second experiment was carried out to evaluate

the immune status and mRNA expression profile of

IL-2, IFN-γ and IL-4 cytokine gene in PBMCs duringperiparturient period in buffaloes. The blood

leucocytes count, PMN cell functions, plasma levels

of nitric oxide (NO) and 13, 14-dihydro-15-keto-

prostaglandin F2α (PGFM) were analyzed andcorrelated with the occurrence of postpartum

reproductive disorders.

A total of 20 pregnant Murrah buffaloes of 2nd

to 4th parity were observed during one week pre-

calving to four weeks post-calving period for

occurrence of retention or expulsion of foetal

membranes, metritis, pyometra, endometritis etc.

Those buffaloes did not develop any metritis, clinical

endometritis and delayed uterine involution,

cumulatively called as postpartum reproductive

disorders (PRD), of which a representative number

(n=6) was included in Gr. I (healthy), while the animals

which experienced PRD were assigned into Gr. II

(n=6).

The results revealed that the development of

PRD was related to increased TLC and neutrophil

count along with reduced PMN cells. A significant

decrease in lymphocytes count (%) during

periparturient period was observed in buffaloes that

developed PRD particularly at day of calving

(47.10±2.42 vs. 56.98±2.85), and 1st (48.77±2.71 vs.

56.29±3.00) and 4th (54.36±2.37 vs. 65.66±3.28) week

following calving as compared to healthy. The results

indicated a reduced superoxide (∆O.D./2×106 PMNs/30 min) and H

2O2 (µM/L) production by PMN cells in

buffaloes with PRD at different sampling time.

The buffaloes with PRD had elevated PGFM

levels (ng/ml) that indicate a kind of inflammation

during the periparturient period. The plasma PGFM

7 4

concentration was higher in buffaloes that developed

PRD as compared to healthy, during all sampling days

and found significant (P<0.05) at calving (2.51±0.43

vs. 1.267±0.30) and 2nd week postpartum (1.058±0.22

vs. 0.431±0.08).

The relative expression profile of IL-2, IFN-γ

and IL-4 was studied in PBMCs in buffaloes with and

without postpartum reproductive disorders. The

expression of IL-2 cytokine mRNA before parturition

was lower than those after parturition in both healthy

and PRD groups, however, a significantly higher

expression of IL-2 was observed in healthy buffaloes

at 2nd week (1.53 vs. 0.32 fold, P<0.05) and 4th week

postpartum (1.09 vs. 0.32 fold, P<0.10) as compared

to PRD buffaloes. Further, the expression of IL-2 was

significantly up-regulated from prepartum to day of

calving (P<0.05), and declined gradually during the

postpartum period in the buffaloes with PRD. The

expression profile IFN-γ was also tended to be greaterin healthy buffaloes during calving to 3rd weeks

postpartum. As a whole the mean fold change of IL-

4 cytokine mRNA was numerically higher throughout

the periparturient period in healthy buffaloes than PRD

and the expression was significantly greater (P<0.05)

during 1st week (3.33 vs. 0.69 fold), 2nd week (4.32

vs. 0.56 fold) and 4th week (5.57 vs. 0.19 fold).

From this study it can be concluded that

impaired PMN functions in terms of production of

superoxide and hydrogen peroxide before parturition

and during postpartum period may predispose

buffaloes to develop reproductive disorders. Higher

total leucocytes, neutrophil and band cells count and

sustained elevation in plasma levels of prostaglandin

metabolites and nitric oxide in buffaloes with PRD

may be due to uterine infections in postpartum period.

A lower expression in IL-2, IFN-γ and IL-4 mRNA inPBMC, at calving might impair activation of

inflammation and clearance of microbes and lead to

development of postpartum reproductive disorders.

(2) EXPRESSION AND LOCALISATION OFAUTOCRINE AND PARACRINE FACTORSAND THEIR RECEPTORS REGULATINGCORPUS LUTEUM FUNCTION DURING THEOESTRUS CYCLE OF BUFFALOES(BUBALUS BUBALIS)

Real time PCR conditions for amplifying

various angiogenic growth factors viz. VEGF 120,

VEGF164, VEGF188, Flt-1 and Flk-1 were optimized

using factor specific primers. For primer design the

Fast PCR. (Version: 6.2.73) software was used.

(3) AUGMENTATION OF OVARIAN FUNCTION,OESTRUS RESPONSE AND FERTILITY INDELAYED PUBERTAL HEIFERS USINGHERBAL PLANTS AND AREA SPECIFICMINERAL MIXTURE

Twenty three delayed pubertal heifers with the

history of anoestrus were treated with herbal plants

Aegle marmelos and Murraya koenigii (HERB @ 200

g powder/animal/day) for 9 days (n=13) and 10 were

with area specific mineral mixture (ASMM @ 40 g/

animal/day) supplemented in concentrate mixture for

one month or the earliest point of oestrus onset

whichever is earlier. 69.2% heifers in herbal and

90.0% in mineral mixture group showed cyclicity

within 20 days from the start of the treatment. The

mean interval between the start of treatment and the

appearance of first clinical signs of oestrus was

8.75±1.96 (range 3-16 days) and 18.88±13.21 days

(range 7-44 days) in HERB and ASMM groups,

respectively. Besides, 3 heifers in HERB group also

showed delayed response and exhibited oestrus

beyond 20 days and within 70 days from the start of

treatment. One heifer in each group showed silent

oestrus and was confirmed by the presence of corpus

luteum gynaeco-clinically between 10 and 12 days.

Under validation trial (conducted at DUVASU,

Mathura), 8 delayed pubertal heifers aged >3 years

were treated with HERB and 6 were kept as untreated

control. 87.5% and 16.7% heifers showed behavioural

signs of oestrus in herbal and control group,

respectively. The mean size of the largest follicles

monitored by trans-rectal ultrasonography was

12.77±0.08 mm and 8.70±0.62 mm in herbal and

untreated control groups, respectively. The present

study demonstrated the potential therapeutic use of

Aegle marmelos and Murraya koenigii leaves and area

specific mineral mixture for induction of oestrus and

cyclicity in delayed pubertal heifers.

(4) SEMEN QUALITY AND FREEZABILITY OF

INDIGENOUS AND CROSSBRED BULLS

Semen ejaculates were collected in winter

(Jan.-Feb.) and summer (May-June) seasons from

Tharparkar bulls to study the effect of season on

semen characteristics.

The mean reaction time was significantly

(P<0.05) higher in summer (157.63 ± 17.98 sec) than

in winter (107.75 ±26.94 sec). The overall mean

reaction time was 132.69 ±18.74 seconds. It varied

inversely with the testosterone concentration in both

the seasons. There was no significant difference in

testosterone concentrations (ng/ml) in winter

(10.67±1.63) and in summer (8.53±1.35).

The mean values of ejaculate volume, sperm

concentration, mass activity, per cent motile, live,

HOST positive sperm, acrosome integrity and

abnormality in fresh semen were 3.56±0.22,

1093.73±71.26 x 106/ml, 4.03±0.11, 84.00±3.03,

88.23±1.82, 81.43±1.49, 90.77±1.68 and 9.47±0.43

in winter season, whereas 4.45±0.18, 936.51±67.52

x 106/ml, 3.97±0.13, 83.00±2.16, 88.60±1.71,

78.20±1.94, 91.47±1.61 and 9.30±0.35 for summer

season, respectively. There were significantly

(P<0.01) higher volume in summer and higher HOST

7 5

reacted sperm in winter season ejaculates. There was

significant difference (P<0.05) in per cent intact

acrosome at both pre-freeze and post-thaw level

between winter and summer season ejaculates with

substantial reduction in motility, livability and HOST

reactive sperm after freezing in both seasons.

The concentration of Na+, K+ and Cl- did not

differ significantly between the winter and summer

seasons. Low level of potassium at post-thaw stage

indicated lesser membrane damage during

cryopreservation of semen.

The mean (±SE) of TSPP of the winter

(10.02±0.66 g%) showed no statistical difference from

the summer (9.75±0.25 g%). Similarly LPO (nmol/

108 sperm cells) did not differ significantly between

the summer and winter either in the fresh (1.13±0.05

and 1.22±0.05, respectively) or pre-freeze (1.6±0.04

and 1.69±0.05, respectively) stage. But significantly

lower LPO was observed in winter (4.26±0.07) than

in summer (4.48±0.07) at post-thaw stage.

LDH (P<0.05) and GOT (P<0.01) activity was

significantly higher in summer season in comparison

to winter season at pre-freeze stage. At post-thaw

stage, SOD (P<0.05) was significantly higher in winter

season while catalase was significantly (P<0.01)

higher in summer season ejaculates. Cholesterol

content was significantly (P<0.05) higher at pre-freeze

stage in winter as compared to summer season. A

significant lower value of motility, livability and HOST

positive sperm was observed during different

durations from 0 min to 120 min of post-thaw

incubation test. No significant difference was

observed in spermatozoal mRNA expression of HSP

70 and HSP 90 during winter and summer season in

Tharparkar bull semen.

(5) EFFECT OF LIQUID VS. FROZEN SEMEN ON

CONCEPTION RATE IN REPEAT BREEDER

VRINDAVANI AND THARPARKAR CATTLE

The investigation was carried out with the

objectives to evaluate the effect of liquid vs. frozen

semen on conception rate in repeat breeder

Vrindavani and Tharparkar cattle.

Out of total 41 repeat breeders (34 Vrindavani

and 7 Tharparkar) inseminated with liquid semen,

36.58% [11 Vrindavani (32.35%) and 4 Tharparkar

(57.14%)] animals were found pregnant. While, out

of 26 repeat breeders (20 Vrindavani and 6

Tharparkar) inseminated with frozen semen, only

19.23% [4 Vrindavani (20%) and 1 Tharparkar

(16.66%)] animals were settled. Hence, the per cent

repeat breeders settled and conception rate was found

to be almost doubled with liquid semen as compared

with frozen semen.

(6) ISOLATION AND CHARACTERIZATION OF

HEPARIN BINDING PROTEINS WITH

SPECIAL REFERENCE TO PDC-109 AS

FERTILITY MARKER IN BUFFALO BULLS

A total of 42 ejaculates were collected from 4

buffalo bulls with >75% progressive motility. These

ejaculated were evaluated and subjected to further

freezing. On the basis of post-thaw recovery

percentage these ejaculates were categorized in

freezable and non-freezable ejaculates. Ejaculates

of freezable nature had motility at fresh and post-

thaw stage as 78.14% and 50.53%, respectively;

however, those of non-freezable nature had motility

at fresh and post-thaw stage as 77.97% and 23.67%,

respectively. Seminal plasma of all these ejaculates

were separated and stored at -200C for further

estimation of heparin binding proteins and PDC-109.

Total seminal plasma protein was found 31.60-35.96

mg/ml and concentration of HBPs was found 1.07-

2.276 mg/ml of seminal plasma.

(7) STRATEGIES TO COMBAT REPEAT

BREEDING IN CATTLE WITH REFERENCE

TO ANTISPERM ANTIBODIES

Blood samples from 8 heifers, 8 pregnant, 41

normal and 43 repeat breeding cows were collected;

serum was separated and preserved at -20°C for

investigation of antisperm antibodies. The cervical

mucus was also collected from 15 animals after

screening with the White Side test for any nonspecific

infections and preserved. Sperm antigen was

prepared by 10 times intermittent freezing thawing in

LN2 and after sonication of spermatozoa. Antigen

was injected s.c. in three rabbits and subsequently

four boosters were given at 15 days interval. Blood

was collected from rabbits after last booster and

presence of antibodies was ascertained using sperm

agglutination and immuno-gel diffusion test. After

confirmation, blood was collected directly from heart

of each rabbits, serum was separated and preserved

at -20oC. Blood was also collected from guinea pigs,

serum was separated and preserved at -80oC to be

used as complement for detection of antisperm

antibodies in serum by sperm immobilization method.

(8) PROTEOME ANALYSIS OF BUFFALO

SPERM FOR PRE-SEXING OF SEMEN

(a) Expression of buffalo SRY gene

Expression was attempted with IPTG induction

from 1mM-5mM and incubation time from 2-8 h.

Optimum expression was observed at 2mM IPTG

induction and incubation time of 4 h (Fig.63). The

expressed protein was purified with cobalt immuno-

affinity column. The expressed protein was further

characterized by Western blotting using anti-histidine

antibodies. The protein showed a molecular weight

of ~28kDa on SDS-PAGE and Western blotting

7 6

(Fig.64). Further analysis of the SRY sequence data

using ExPaSy Proteomics Server predicted a

theoretical molecular weight of 28.268 kDa and

isoelectric point 9.21. Whole sequence analysis

revealed that the peptide sequence contains highest

percentage of serine residue (11.4%) and is rich in

positively charged protein with total number of 35

positively charged amino acid residues out of 245

(14.28%).

Fig.63: SDS-PAGE of showing expression of

recombinant SRY protein ~28kDa.

Lane 1, 2 and 3: Recombinant clone 1, 2, 3 post-induction;

Lane 4 and 5: Non-recombinant clone 6 hr post-induction;

Lane M: Molecular weight markers.

Fig.64: Western blot showing recombinant SRY protein~28kDa using anti-His antibodies. Lane M: Prestained

molecular weight markers; Lane 1: 2 h post-induction

whole cell lysate of recombinant clone; Lane 2: 2 h post-

induction whole cell lysate of non-recombinant clone.

(b) Sperm cell surface proteome analysis

The sperm cell surface proteins werebiotinylated and then purified by immuno affinity

column using cell surface protein isolation kit (Peirce).

The surface proteins were initially characterized by

SDS-PAGE stained by silver staining. Later the

proteins subjected 2D-Gel electrophoresis and few

spots were subjected to LC-MS/MS analysis forprotein identification. The proteins identified were

shown in table 9.

Table 9 : Sperm cell surface proteins identified by LC-MS/MS analysis

Sl. Accession No. Protein Mol. wt. (Da) Score pI valueNo

1 gi|189054178 Unnamed protein product 66151 530 7.62

2 gi|57100954 GTP-specific succinyl-CoA 47149 241 6.79

synthetase beta subunit

3 gi|28317 Unnamed protein product 59720 223 5.17

4 gi|27805977 Keratin, type I cytoskeletal 10 54815 135 5.05

5 gi|51092303 Try10-like trypsinogen 27255 49 4.83

6 gi|297469372 Seminal plasma protein A3-like 16657 194 7.42

7 gi|27807445 Peroxiredoxin-5, mitochondrial 23481 254 8.62

precursor

8 gi|23013704 ABC-type branched-chain amino 10314 53 5.61

acid transport systems, ATPase

component

(9) DEVELOPMENTALLY IMPORTANT GENES

IN BUFFALO PRE-IMPLANTATION

EMBRYOS

Expression pattern of essential oocyte marker

genes viz., BMP15 (bone morphogenic protein 15),

GDF9 (growth and differentiation factor 9), MATER

(Maternal Antigen That Embryo Requires), ZAR1

(Zygote Arrest 1) and IGFBP1 (insulin like growth

factor binding protein 1) revealed that transcripts for

these genes were found in significantly higher quantity

in oocytes and early stage embryos when compared

to later stages thus help in evaluating the

developmental competence of buffalo oocytes used

in IVEP. All the developmentally important genes

were up regulated for the in vivo produced embryos

except the thermo tolerance marker i.e. heat shock

protein, for which higher copy number was recorded

through Q-PCR, hence it could potentially be used

as a stress biomarker for the study of the

consequences of in vitro conditions on embryo quality

7 7

Glucose transporter-5 was absent during the transition

phase from maternal to zygotic transition. During the

period of preimplantation development, metabolism

switches from utilization of lactate and pyruvate to

glucose as main energy substrate which requires

glucose transporter molecules to facilitate glucose

transport and citrate synthase as a key regulatory

metabolic enzyme that catalyzes the first step in tri-

carboxylic acid (TCA) cycle. Temporal and spatial

pattern of pluripotency markers viz. OCT-4, NANOG

and SOX-2 showed that the embryos are in a state

of pleuripotency. Protein products of these genes

followed similar trend. Based on the findings, the

existing procedures and protocols may be modified

to better mimic the in vivo condition thereby improving

the efficiency of IVP.

(10) DEVELOPMENTAL POTENCY OF

PARTHENOGENETIC GOAT EMBRYOS

It was observed through micro array data

analysis that a large number of genes were up and

down regulated in diploid parthenogenetic caprine

embryos as compared to IVF derived embryos. The

comparative gene expression analysis has also been

done among parthenogenetic and SCNT embryos.

Six genes which showed up or down regulation in

diploid parthenogenetic embryos as compared to IVF

embryos were validated. One gene which may be

responsible for spontaneous parthenogenesis in

turkey was found expressing in caprine embryos.

15. NUTRITION FOR HEALTH AND

WELFARE OF LIVESTOCK, PETS AND

WILDLIFE

(1) EFFECT OF SOURCE OF PROTEIN ON THERESPONSE TO PROBIOTICSUPPLEMENTATION OF DOGS REARED ONHOME MADE DIETS

With an objective to ascertain the impact of

sources of protein on the response to probiotic

supplementation, 16 Labrador female dogs were

distributed into four equal groups. Two different

protein sources namely, a vegetable protein blend

(VPB) and poultry by-product meal (PBM), were used

for comparison, both with and without probiotic

supplementation (Lactobacillus acidophillus at 109cfu/

d). The experimental duration of 9-weeks had a

experimental protocol in terms of monitoring of BW

and DM intake, a 4-d digestion trial following 30d of

feeding, physical, biochemical and microbial

assessment of faecal quality, periodic assessment

of blood metabolic and erythrocytic antioxidant

profiles, and assessment of the humoral and cell-

mediated immunity. There were no variations among

the groups with respect to voluntary food intake. The

digestibility of DM remained similar irrespective of

dietary treatments. However, digestibility of ether

extract was found higher and that of crude protein

was lower when PBM was compared with VPB.

Further, crude protein digestibility was improved when

probiotics was supplemented to VPB-based diet, but

not in case of PBM-based diet. Physical

characteristics of faeces remained unaltered due to

dietary treatments. However, faecal biochemical

attributes including lactate and ammonia varied

differently based on the source of basal protein.

Faecal counts of health-positive and health-negative

bacteria revealed that lactobacillus count exhibited

higher values in both probiotics supplemented groups

compared to their respective controls, with a similar

trend for bifidobacteria. A reverse trend was apparent

for the health-negative clostridia and coliforms.

However, it was evident that the positive shifts in

faecal microbes were more pronounced in case of

probiotics supplementation of VPB- than PBM-based

diet. The data on general metabolic indices indicated

plasma glucose, total protein, albumin, globulin and

their ratio did not show any variations attributable to

dietary treatments. Overall, the results highlighted

that the response to probiotics supplementation

varied depending on the source of protein in the basal

diet.

(2) EFFECT OF SHORT-TERM HIGH LEVEL

SUPPLEMENTATION OF PHYTOCHEMICAL

FORMULATION (COMB1) ON NUTRIENT

METABOLISM, ANTIOXIDANT HEALTH AND

IMMUNITY OF GROWING KIDS

An experiment was conducted using goat kids

to assess the effect of supplementing the formulation

COMB1 at 0-4% (developed based on preliminary

studies) on nutrient metabolism, growth performance,

metabolic profile, erythrocytic antioxidant status and

immune response. Accordingly, 15 Jamunapari goats

of about 10 months of age were randomly distributed

into three equal groups, and fed the formulation

COMB1at 0%, 3.0% and 4.0% levels for a period of

6 weeks. Blood from individual animals were collected

at 0, 14, 28, and 42 days of experimental feeding to

assess the metabolic profile and erythrocytic

antioxidants profile. The cell-mediated immune (CMI)

response was assessed at the end of the feeding

trial. Humoral immune response was assessed by

inoculation of PPR antigen and monitoring the antigen

response by competitive ELISA. Growth and feed

conversion efficiency of the kids remained similar

(P>0.05) across the three groups. The results on the

metabolism trial conducted following 35 d of

experimental feeding indicated no effect of the dietary

intervention on nutrient intake and digestibility,

nitrogen retention or plane of nutrition by the goats.

Likewise, no positive effects in terms of growth, feed

consumption or feed efficiency were evident. The

effect of the short-term-high-level supplementation

on erythrocytic antioxidant indices indicated no major

influence except for a reduction in SOD (P=0.073)

7 8

and GST (P<0.05) in goats fed the supplement at

4% level. Blood metabolic profile of the goats under

the three groups also remained similar except for

higher serum total protein and globulin at 3% level of

supplementation. Delayed-type hypersensitivity

(CMI) response to intra-dermal PHA-P tended

(P=0.088) to have higher response at 3% level of

supplementation. Humoral immune response against

PPR antigen monitored weekly till 28 d post-inoculation

revealed no differences among the groups. The

available results are indicative of absence of any

significant effects of supplementing COMB1 on

voluntary feed intake, nutrient utilization and nitrogen

metabolism, except for subtle influence on selected

antioxidant indices and CMI response when

supplemented at a high rate for 6 weeks.

(3) EFFECT OF SHORT-TERM

SUPPLEMENTATION OF PHYTOCHEMICAL

FORMULATION (COMB2) ON NUTRIENT

METABOLISM, ANTIOXIDANT HEALTH ANDIMMUNITY OF GOATS

In light of the results obtained from previous

experiments, further experimentation was taken up

using the second formulation (COMB2). Accordingly,

15 adult Jamunapari goats of about 14-15 months of

age were randomly distributed into three equal groups,

and fed the COMB2 formulation at 0%, 2.0% and

3.0% levels for a period of 60 days. Blood from

individual animals were collected at 0, 15, 30, 45

and 60 days of experimental feeding to assess the

metabolic profile, erythrocytic antioxidants profile.

Both cell-mediated and humoral immune response

was assessed towards the end of the feeding trial.

There was no difference among the groups with

respect of voluntary feed consumption, although there

appears to be a linear positive effect of the

supplementation. Results of the metabolism trial

carried out towards the end of the study revealed

that the digestibility of nutrients especially the fibre

fractions were apparently higher in goats

supplemented at 2% level; similar improvements were

also observed in the nitrogen metabolism. The values

obtained for haematological and biochemical variables

in blood showed no variations among the three groups;

however, total protein level in the serum was

significantly higher in the group supplemented at 3%

level. A similar trend was evident with regard to serum

globulin as well. The activity of AST exhibited a

gradual decline with increased levels of

supplementation. The activity of catalase was found

to increase significantly (P<0.05) in group

supplemented at 2% level compared to control. There

was no effect of the polyherbal supplement on the

activities of other erythrocytic antioxidant indices.

Supplementation of the polyherbal formulation was,

however, effective in enhancing the cell mediated

immune response of the goats. The humoral immune

response data revealed that there were no variations

(P>0.05) in the antibody titre against chicken RBC

by the goats.

(4) EFFECT OF DIETARY CADMIUM ANDARSENIC ON HEALTH AND PRODUCTIVITYOF ANIMALS

(a) Effect of addition of 10 ppm Cd and differentameliorative agents in the diet on theperformance of guinea pigs

Seventy guinea pigs were divided into 7 equal

groups and fed a common basal diet, except for the

Cd and ameliorative agent supplementation. Group I

served as control, while groups II, III, IV, V, VI and

VII were supplemented with 10 ppm Cd along with

no ameliorative agent; 50 and 100 ppm Zn; 0.2 and

0.4 ppm Se; and 100 IU Vit E, respectively.

Experimental feeding was done for 91 days. Addition

of 10 ppm Cd in the diet had no effect on intake and

digestibility of DM, OM, CP, EE, NDF and

hemicelluloses, and retention of N, Ca, P, Cu, Fe,

Zn and Mn. Intake of TDN, DCP and TDN were also

comparable among the different groups. However,

intake, outgo and balance of Cd were significantly

higher in Cd treated groups (II, III, IV, V, VI and VII).

The retention of Cd was decreased in group IV (Zn-

100 ppm) and VII (Vit E-100 IU). Hb and PCV, TP,

albumin, globulin, A: G ratio and level of creatinine,

activity of AST and ALT, serum hormones (T3 and

T4), testis weight were adversely affected in group

II, but improved in the groups treated with any of the

ameliorative agents. The overall antibody production

was significantly reduced in group II as compared to

control, and supplementation of dietary ameliorative

agents invariably improved the levels of antibody titer

with best results in the group supplemented with 100

IU of Vit E. Cd concentration was significantly

increased in all the organs in Cd supplemented group

II as compared to other groups, and supplementation

of Zn, Se and Vit E significantly reduced the Cd

concentration in the vital organs. Growth rate was

significantly lower in group II (10 ppm Cd) but

improved in all the ameliorative agent treated groups

with best results in groups IV and VII. Liver, lungs,

kidneys and testes of Cd treated animals showed

moderate to severe degenerative changes in

comparison to improvement in the animals given

ameliorative agents, with best results in groups given

100 IU Vit E, followed by 100 ppm Zn.

(b) Effect of addition of 10 ppm Cd and differentameliorative agents in the diet on theperformance of kids

Twenty four healthy male goat kids (4-6 m)

were divided into 4 equal groups and offered a

common diet (NRC, 2007), except for the Cd and

ameliorative agent supplementation. Group I served

as control i.e. without any supplementation, while

other groups were supplemented with 10 ppm Cd

7 9

alone (Gr II) or with 100 ppm Zn (Gr III) and 100 IU

Vit E (Gr IV) for 180 days. Addition of 10 ppm Cd in

the diet had no effect on intake and digestibility of

the nutrients (DM, OM, CP, EE, NDF, ADF,

hemicelluloses, celluloses) and retention of N, Ca,

P, Cu, Fe, Zn and Mn but Cd intake, outgo through

faeces, urine, total outgo and balance were

significantly higher in Cd treated group (II) as

compared to control. However, Cd excretion

increased in groups III and IV. Intake of DM, CP,

TDN and DOM, and CP, DCP and TDN values of the

diets during metabolic trials were comparable

(P>0.05) among the groups.

Growth rate was significantly lower in group II

(10 ppm Cd) and improved in both the ameliorative

agent treated groups. It was observed that Hb and

PCV values significantly decreased in group II and

improved in groups III and IV. The supplementation

of 10 ppm of Cd had no effect on serum total protein,

albumin, A:G ratio, glucose, urea and creatinine

levels. The level of globulin significantly increased

and cholesterol significantly decreased in the group

II, which were improved with ameliorative agents.

Though the activity of AST and ALT was within the

normal range, their values were significantly higher

and ALP activity was lower in group II than other

groups, and ameliorative agents decreased the level

of these enzymes almost similar to control. Serum

hormones (T3 and T4) were reduced by 10 ppm Cd

and improved in groups III and IV. The activities of

most of the antioxidant enzymes such as catalase,

SOD, GSH-Px and GSH of erythrocytes were

significantly reduced and LPO was significantly

increased in group II, and improved in both the

ameliorative groups. Serum Ca and P levels were

low in group II in comparison to other groups. The

mean Cu, Fe, Zn, Se and Mn levels in serum of goat

kids were comparable (P>0.05) among different

groups. The serum Cd level was significantly higher

in all the Cd supplemented groups than control group.

The supplementation of dietary ameliorative agents

significantly increased serum Ca and P levels and

decreased Cd levels.

Antibody production was significantly reduced

in group II as compared to control, but

supplementation of ameliorative agents improved the

level of antibody titer. The testes weight was

significantly lower in Cd supplemented group. The

Zn levels in lungs, heart and spleen were significantly

lower and in kidney significantly higher in group II,

and supplementation of Zn and Vit E could ameliorate

the adverse effect of Cd on Zn metabolism. Cu

concentration was significantly reduced in liver, lungs

and spleen but significantly higher in kidney in group

II.

Supplementation of Zn, Se and Vit E

significantly (P<0.05) reduced the Cd concentration

in the vital organs. Cd treated animals showed

moderate to severe degenerative changes in

comparison with improvement in the animals given

ameliorative agents, with best results reported in

groups given 100 IU Vit E, followed by 100 ppm Zn.

(c) Effect of different sources of arsenic (As)exposure on the performance of guinea pigs

Twenty eight adult male guinea pigs

(584.2±10.66 g b.wt) were randomly divided into 4

groups and were fed a basal diet (NRC, 1995) added

with no arsenic (control, Gr. I) or 50 ppm arsenic

through feed from sodium arsenite (Gr. II) or arsenic

trioxide (Gr. III) or 200 ppb arsenic through water as

sodium arsenite for 77 days. Intake of DM, OM, and

other nutrients significantly reduced in the As

supplemented groups, but intake of digestible

nutrients was similar in all groups. There was no

adverse effect of As on haemoglobin, creatinine, urea,

cholesterol, glucose, total protein, albumin, calcium

and phosphorus. However, there was significant

increase in serum AST, ALT and ALP activities and

decrease in LDH activities particularly in the 50 ppm

As fed groups. Gr. II animals showed hypertrophied

liver and congested lungs. The growth rate

significantly reduced in all the As supplemented

groups being 0.91 g/d, 1.11 g/d and 1.64 g/d in Gr. II,

III, and IV, respectively as compared to 1.99 g/d in

the control. The worst performance was obtained in

the animals fed 50 ppm As (as sodium arsenite)

through feed.

(d) Effect of different levels of arsenic throughfeed and water on the performance of guineapigs

Seventy two male guinea pigs (390.1±10.4 g

b.wt) were randomly divided into 9 groups and fed

either control (NRC, 1995) diet (Gr. I) or supplemented

with arsenic either through feed @ 20 (Gr. II), 40 (Gr.

III), 60 ppm (Gr. IV) or through water @ 50 (Gr. V),

100 (Gr. VI), 200 (Gr. VII), 500 (Gr. VIII) and 1000

ppb (Gr. IX) for 189 days. Feed intake was

significantly reduced in Gr. IV and IX and digestibility

in Gr. IV only, indicating that oral supplementation of

60 ppm As in feed was the most harmful to the

animals. The growth rate was reduced in all the As

supplemented groups, with worst performance in the

animals fed 60 ppm As through feed. There was no

effect of As on haemoglobin, creatinine, urea,

cholesterol, calcium and phosphorus. However, there

was significant increase in serum glucose, total

protein, albumin, globulin, AST, ALT and ALP

activities and decrease in LDH activity in As fed

groups, particularly in Gr. III and IV. The animals

exposed to arsenic showed sluggishness, dull hair

coat and loss of alertness up to some extent when

compared to the control groups, which was

progressively higher as level of As increased. The

guinea pigs particularly those of Gr. II, III, IV, VIII

8 0

and IX showed edematous oral cavity with clearly

evident swelling around head after five months of

experiment. Some of the animals in groups III, IV,

VIII and IX showed reddish coloured urine. The

stomach of most of the high As treated animals were

atrophied being of 5.64-7.3 g (normal, 20 g). The liver,

testes, lungs, kidneys and heart also followed the

same trend except one or two animals in these groups

whose organs were similar in size to normal ones.

Vital organs, particularly liver, lungs, kidneys, testes

and heart showed atrophy with prominent

haemorrhages and congestion lesions in liver, lungs,

spleen and stomach.

(5) EFFECT OF INORGANIC AND ORGANIC

COPPER AND ZINC ON HEALTH AND

PRODUCTIVITY OF THE RUMINANTS

An experiment was conducted on 15 male goat

kids (Avg. b.wt 9.5 kg, aged 4-6 m) divided into 3

groups of 5 kids in each, on the basis of their body

weight. All the kids were offered wheat straw and

concentrate mixture in the ratio of 60:40 to meet their

nutrient requirement. The kids in group II were

supplemented with 7 ppm copper (copper sulphate)

and 40 ppm of zinc (zinc sulfate), and group III with

7 ppm copper (copper methionine) and 40 ppm of

zinc (zinc methionine), to their basal diet.

Supplementation of copper and zinc had no effect

on digestibility of proximate principles and cell wall

constituents. Balances of N, Ca, P, and Mo were

also similar (P>0.05) in three groups. Copper and

zinc retention (mg/d) was significantly (P<0.05) higher

in groups III and II as compared to group I. The

average daily body weight gain was, 34.1, 31.7 and

35.0 g/d in Gp I, II and III, respectively, which did

not differ (P>0.05) due to treatments. Hb and PCV in

blood, and glucose, total protein, albumin, globulin,

A:G ratio, urea, creatinine and cholesterol in serum

did not differ due to copper and zinc supplementation.

Activity of ALP, SGOT, SGPT and ceruloplasmin

were similar in three groups, while SOD showed

significantly (P<0.05) higher value in Gp III and Gp II

than Gp I. Concentration of serum T3 and T4 level

not affected by copper and zinc supplementation.

There was significant (P<0.05) improvement in cell

mediated immunity and humoral immune response

in Gp III and Gp II as compared to Gp I, the values

were significantly (P<0.05) higher in Gp III than Gp

II. It may be concluded that supplementation of copper

and zinc through inorganic (sulphate) or organic

(methionine) sources, to a basal diet containing 13.7

and 26.0 ppm of copper and zinc, respectively, had

no effect on growth, feed efficiency, digestibility of

nutrients, blood biochemicals and serum enzymes

except SOD. However, there was significant (P<0.05)

improvement in cell mediated immunity and humoral

immune response in Gp III and Gp II as compared to

Gp I, with a higher value in Gp III than Gp II.

(6) ASSESSMENT OF MAHUA SEED CAKE(SAPONIN) AS FUNCTIONAL FEED ON

COURSE OF FASCIOLOSIS ANDPERFORMANCE OF RUMINANTS

In vitro studies indicated 100% mortality of

juvenile flukes with 60 µg saponin/ml of extract at 3

h post incubation. BW gain and feed conversion

efficiency (FCE) were significantly (P<0.01)

depressed in control infected (CI), however, DMSC

supplementation significantly (P<0.01) improved the

performance. The nutrient intake, digestibility and

plane of nutrition were not affected by trickle infection

with F. gigantica/DMSC supplementation in crossbred

calves and lambs. The faecal fluke egg count was

significantly (P<0.01) lower in mahua cake fed

infected (MCI) group as compared to CI group

throughout the study period (150-180 days). Lower

values of Hb, PCV, total protein, albumin, AG ratio,

serum Ca and P, higher concentration of total

cholesterol, serum enzymes and antibody titre

compared to control group were the characteristic

features of infection in CI group. As a result of DMSC

supplementation, an improvement in the

concentration of Hb, PCV, total protein, albumin, AG

ratio, serum P was observed in MCI group. These

coupled with comparatively lower value of cholesterol,

antibody titre and serum enzymes revealed that

DMSC supplementation helped to minimise the

severity of trickle infection with F. gigantica.

Moreover, cytokine expression study revealed that

level of IL-6 was significantly (P<0.05) lower in MCI

group compared to CI group. During the recovery

period also, the CI group had lower body weight

(180.4kg vs 192.4kg) and FCE compared to control

group, whereas in MCI group, the above parameters

were comparable to control group. The MCI group

gained normal values of Hb, PCV, serum AST, LDH

and GGT earlier than CI group. The studies suggested

that supplementation of 10% DMSC in the

concentrate mixture of crossbred calves and lambs

were an effective strategy to reduce the severity of

trickle infection (30-35%) with F. gigantica.

(7) EFFECT OF UNCONVENTIONAL FEEDS ON

GASTRO INTESTINAL PARASITISM FORBETTER NUTRITIONAL EFFICIENCY OF

RUMINANTS

Among eight oil cakes tested, the extracts of

karanj and neem seed cake exhibited maximum effect

on motility and mortality (100% at 6 h) of H. contortus.

The other cakes viz., mustard oil cake, mahua cake,

cotton seed meal, castor bean meal, jatropha meal

and guar meal had varying effects from 43.8-56.3%.

The reduction of parasitic load (as EPG) and egg

hatchability was found in karanj and neem seed (at

5% level in concentrate mixture) cake fed lambs as

compared to infected positive control, however, the

reduction was more in karanj cake fed lambs. The

8 1

higher level of blood Hb, PCV, TEC, total serum

protein, serum albumin and A:G ratio and the

reduction of blood TLC, eosinophils, SGPT, SGOT

and ALP level were observed in karanj and neem

seed cake fed lambs. The humoral immune response

(against Brucella abortus S-99) was also significantly

(P<0.01) higher in karanj and neem seed cakes fed

lambs in comparison to infected lambs. However,

the overall performance of karanj cake fed lambs was

better (ADG: 48.6 vs 33.9) than neem seed cake fed

lambs. Therefore, based on overall performance

including general health, it is revealed that regularly

feeding of karanj cake at 5% level in the concentrate

mixture may be used to control the GI nematodes in

sheep. In another experiment, inclusion of karanj

plus neem seed cake (5% each in concentrate

mixture) was found better as compared to karanj cake

alone for controlling the GI nematodes.

(8) INFLUENCE OF DURATION AND LEVEL OF

FEEDING ON FEED CONSUMPTION,NUTRIENT UTILIZATION, SERUM

METABOLITE AND MINERAL STATUS INSEMI-CAPTIVE ASIATIC ELEPHANT

(ELAPHUS MAXIMUS)

(a) Comparative evaluation of nutrient utilization

in semi-captive Asiatic elephants (Elephasmaximus) fed different types of supplements

A feeding trial was conducted to evaluate

nutrient utilization in semi-captive Asiatic elephants

fed either wheat roti or rice-lentil mixture as a

supplement. Six sub-adults (7-12 yr old) were

distributed into two groups of 3 each. The design of

experiment was 3×2 (animals periods) switch over

design. Elephants in groups I and II received

concentrate supplement consisting of wheat roti and

rice-lentil, respectively. Cut grasses (Narkul) (Arundo

donox) were offered 20% in excess of intake to each

animal during night time. Rest of the time they were

allowed to graze in the nearby grasslands/forests.

During night time they were tied in respective

individual enclosures (night shelter) so that faeces

of each individual elephant were collected separately

and animals had no access to the feed materials of

other animals. Faeces voided during grazing were

collected in full, representative samples of browses

consumed were taken and intake during grazing was

measured indirectly using lignin as a marker. Intake

(kg/d) of cut grasses in both groups was similar.

Elephants in both groups consumed similar amount

of browses. Apparent digestibility of CP was higher

(P<0.05) in group II, but digestibility of other nutrients

was comparable in both groups. Intake of zinc was

also higher in elephants fed rice-lentil based

supplement. Intake, outgo as well as absorption of

Ca, Co and Cu did not differ between the groups.

Absorption of P, Fe and Zn was higher (P<0.05) in

group II. Blood metabolites, serum enzymes activities

and concentration of serum minerals were not altered

by type of supplement. It was concluded that rice-

lentils is a better source of supplement for growing

elephants in comparison to wheat roti.

(b) Faecal microbial profile of semi-captive

Asiatic elephant

The relative population of Fibrobacter

succinogenes and Ruminococcus flavefaciens and

total fungi numerically increased in working as

compared to non-working elephants. The relative

population of total bacteria numerically increased

10.25 fold in elephants supplemented with roti in

comparison to those supplemented with rice-lentil.

Relative population of Ruminococcus flavefaciens

and total fungi increased by 1.18 and 1.02 fold,

respectively, in elephants supplemented with wheat

roti. Relative population of Fibrobacter succinogenes

and methanogens reduced in elephants supplemented

with wheat roti. The relative population of cellulolytic

bacteria viz., Fibrobacter succinogenes and

Ruminococcus flavefaciens increased in elephants

fed 100 and 120 kg of Rohini tree in comparison to

those fed 80 kg of Rohini tree.

16. EXPENDING FEED RESOURCES AND

IMPROVING NUTRIENT EXTRACTION

FROM BIOMASS

(1) EFFECT OF DETOXIFIED OIL CAKES AS

ALTERNATE PROTEIN SUPPLEMENT FOR

SHEEP AND GOATS

Effect of supplementation of detoxified karanj(Pongamia glabra) cake on performance of

growing kids

The study was conducted to establish the

nutritive potential of karanj cake for small ruminants

following detoxification using the method developed

and reported earlier and to assess nutritive potential

in rats and kids. Based on the results of in vitro and

laboratory animal (rat) experiments, non-descriptive

kids (24) were randomly allocated to four dietary

treatments viz., control (dKC-0), dKC-25, dKC-50 and

dKC-75 substituting 0%, 25%, 50% and 75% crude

protein moiety of soyabean meal by detoxified karanj

cake (dKC), respectively. Voluntary feed intake data

during the 120-d experimental duration revealed no

untoward effects of feeding dKC on feed consumption

and palatability. However, digestibility of DM and OM

were significantly improved (P<0.01) in dKC fed

groups. The CP digestibility was significantly higher

(P<0.05) in dKC-75. Intake of DCP and TDN was

comparable among dietary treatments, however, DCP

and TDN content (%) of composite diets was

significantly lower (P<0.01) in control as compared

to dKC fed groups. Nitrogen retention (g d-1), final

body weights (kg), faecal egg count, metabolic profile

and immune response in kids were comparable

8 2

irrespective of treatments. However, total gain in

body weight, ADG and FCR were significantly

(P<0.05) compromised in kids under the group dKC-

75. Blood biochemical indices including liver function

specific enzymes and thyroid hormones were not

affected by dietary treatments. Cell-mediated immune

response in terms of DTH response to PHA-P and

humoral response to chicken-erythrocytes were

similar across the four groups. Carcass

characteristics, meat quality, chemical composition

and physico-chemical properties of L dorsi muscle

did not differ significantly among treatments. Residual

karanjin and pongamol were not detected in L dorsi

muscle or in the vital organs. Organoleptic evaluation

for appearance, flavour, juiciness, texture and overall

acceptability of chevon were comparable among all

the groups. It is concluded that following removal of

karanjin, pongamol and trypsin inhibitors through the

developed detoxification method, the detoxified cake

can safely replace soyabean meal protein moiety up

to 50% without any apparent adverse effect on DM

intake, nutrient utilization, growth rate, FCR,

metabolic profile, immune response, carcass

characteristics and meat quality in kids.

(2) FEED AND SOLID MULTI-NUTRIENTBLOCKS FOR IMPROVING LIVESTOCKHEALTH AND PRODUCTIVITY:FORMULATION OF COMPRESSEDCOMPLETE

To assess the effect of feeding compressed

complete feed block (CCFB) containing 5% DMSC

or 5% guar meal on the performance (body weight

gain, methane production and energy utilization) of

the crossbred calves, a study was conducted on 18

male growing crossbred calves (age, 6-12 months

and body weight, 141 kg) divided into three groups.

The animals of control group (T0) were fed CCFB

and of treatment groups were fed CCFB containing

5% DMSC (T1) or 5% guar meal (T2). All the diets

were iso-nitrogenous and formulated to meet the

requirement of 600 g/d growth (NRC, 2001). All the

animals were dewormed and vaccinated before the

start of experiment. The dry matter intake (kg/d or

per kg W0.75) among three groups was comparable.

The intake and digestibility coefficients of DM, OM,

CP, NDF and ADF did not differ significantly (P>0.05)

among three groups. Overall average daily gain (g)

was also not significantly (P>0.05) different among

the groups. Overall FCR (kg DM/ kg gain) also did

not differ significantly (P>0.05) among three groups.

The mean values for Hb (mg/dl), serum glucose (mg/

dl), total protein (g/dl), albumin (g/dl), globulin (g/dl),

A:G ratio and SGOT/ SGPT (IU/L) and serum urea-N

(mg/dl) of all the experimental calves remained

statistically similar (P>0.05) among three groups.

Methane production did not differ significantly

(P>0.05) among 3 groups, however total methane

production (L/d) was 11.97% and 17.4% lower in T1

and T2, respectively than control group (T0), but

methane production in L/kg DMI and L/kg DMD was,

respectively, lower in treatment groups (17.57% and

16.59% in T1; 13.75% and 16.87% in T2) in

comparison to control group (T0). The energy

metabolism studies showed non-significant

differences (P>0.05) with respect to total energy

intake, DE, ME, energy lost in faeces, urine and heat

production. The performance of crossbred calves was

comparatively better in treatment groups than control

group. Thus, inclusion of DMSC and Guar Meal @

5% in CCFB showed improvement in performance

vis-a-vis reduced (L/kg DMI) methane production

(13.75 to 17.57%).

(3) COMPARATIVE ASSESSMENT OFNUTRIENT UTILIZATION, ENERGYMETABOLISM AND RUMEN MICROBIALPROFILE IN CROSSBRED CATTLE ANDBUFFALOES

Comparative efficiency was assessed in terms

of nutrient utilization and microbial fermentation

pattern in cattle and buffaloes. Six adult cattle and 6

buffaloes were fed TMR having concentrate to wheat

straw ratio of 50:50, 20:80 and 80:20 in a 3x3 switch

over design. Metabolism trial was conducted after

21 days of feeding. The DM digestibility (%) was

comparable in cattle (60.25%) and buffaloes (60.34%).

Per cent DM intakes in cattle (1.83) and buffaloes

(1.76) were also similar. DM intake (DMI g/BW0.75)

in cattle (71.02) and buffaloes (72.92) was also

similar.

(4) UTILIZATION OF REGIONALLY AVAILABLEPROANTHOCYANIDIN-RICH TREEFORAGES AS SUPPLEMENTARY FEED FORENHANCED ANIMAL PRODUCTION

The proanthocyanidins (PAs) isolated from

mature leaves of selected tree forages were purified

and studied for their in vitro biological properties. The

protein precipitation capacity of PAs of tremal (Ficus

roxburghii) was lesser than the PAs of oak (Quercus

leucotrichophora), kachnar (Bauhinia variegata) and

biul (Grewia optiva) at equivalent concentration of

PAs and protein. The thin-layer chromatography of

F. roxburghii, Q. leucotrichophora, B. variegata and

G. optiva PAs gave multiple band profile with limited

resolution. The antioxidant activity of PAs of Q.

leucotrichophora, F. roxburghii, B. variegata and G.

optiva, was determined and it was highest in the PAs

of B. variegata, followed by Q. leucotrichophora, F.

roxburghii and G. optiva. These were compared to

the activity of standard PAs - catechin and

epicatechin. The antioxidant activity was also

evaluated by the IC50 values of these PAs. The

antibacterial activity of these tannins against strains

of Escherichia coli, Micrococcus luteus,

Staphylococcus aureus and Arthrobacter

protophormiae was evaluated and it also varied

between different tree forages. Based on their

8 3

antioxidant and antibacterial effects, the PAs of B.

variegata, had the highest activity followed by the

PAs of Q. leucotrichophora, F. roxburghii and G.

optiva.

(5) EFFECT OF DIFFERENT PHYSICAL

TREATMENTS ON TOTAL PHENOL ANDTANNIN FRACTIONS OF FICUSROXBURGHII LEAVES

The fresh mature tree leaves of Ficus

roxburghii were manually lopped from local forest area

of Kangra district and the leaves were subjected to

various physical treatments viz., chopping (T2) and

chopping and sun drying (T3). The chemical

composition and tannin fraction of fresh leaves and

treated leaves were estimated. Condensed tannin and

other fractions of tannins were estimated as per the

method described by Makkar (2003). The data

obtained were analysed by using SAS software (SAS,

2003).

F. roxburghii leaves contained 13.92% CP,

4.2% EE, 51.43% NDF and 35.92% ADF on DM

basis. Total phenol, non-tannin phenol, total tannin,

condensed tannin and hydrolysable tannin content

(% DM basis) of fresh F. roxburghii leaves were 6.27

± 0.17, 1.12 ± 0.01, 5.15 ± 0.17, 1.63 ± 0.04 and

3.52 ± 0.18, respectively. Both physical treatments,

chopping (T2), and chopping and sun drying (T3),

significantly (P<0.0001) reduced total phenol, total

tannin and hydrolysable tannin content (% DM basis)

of F. roxburghii leaves. However, condensed tannin

content significantly (P<0.0001) increased in both the

treatments. Though chopping reduced (P<0.0001)

non-tannin phenol content, chopping and sun drying

increased it.

(6) PROFILING AND DOCUMENTATION OFNUTRIENTS AND PLANT SECONDARY

METABOLITES IN COMMON FODDERS OFHIMACHAL PRADESH

The leaves of Salix spp. given to livestock as

unconventional supplementary feed in the region were

identified as S. tetrasperma and S. alba, and analysed

for nutrients and anti-nutrients. The nutrient value of

the mature leaves of S. tetrasperma and S. alba were

compared with the proximate composition of the

mature leaves of commonly used tree forages viz.,

Bauhinia variegata, Dendrocalamus hamiltonii, Ficus

roxburghii, Grewia optiva, Celtis australis and Quercus

leucotrichophora. It was inferred from the proximate

composition that the mature leaves of S. tetrasperma