Annotation of Anopheline Genomes at VectorBase Dan Lawson, VectorBase & The Anopheles Genomes Cluster Consortium EMBL-EBI
Dec 29, 2015
Annotation of Anopheline Genomes at VectorBase
Dan Lawson, VectorBase & The Anopheles Genomes Cluster ConsortiumEMBL-EBI
Anopheline species in this study: Current status
Genome sequencing
• 9 of 16 species assembled and annotated
RNAseq
• 10 of 12 species sequenced
Isolate re-sequencing
• 12 of 12 species sequenced
Genome annotation
• First-pass genome annotation is almost always based on “automatic” computational approaches
• ab initio
• Similarity based
• Transcript (ESTs, RNAseq)
• Protein (nr protein database)
Genome annotation
• First-pass genome annotation is almost always based on “automatic” computational approaches
• ab initio
• Similarity based
• Transcript (ESTs, RNAseq)
• Protein (nr protein database)
Genome annotation
• First-pass genome annotation is almost always based on “automatic” computational approaches
• ab initio
• Similarity based
• Transcript (ESTs, RNAseq)
• Protein (nr protein database)
Genome assembly
Map Repeats
Genefinding
Protein-coding genes
Map Transcripts Map Peptides
nc-RNAs
Functional annotation
Submission to archival databases (Release)
Genome annotation - building a pipeline
Automatic annotation strategies
similarityab initio
Genome annotation: resources
• ab initio predictions using SNAP and Augustus
• Mixed whole animal RNAseq datasets generated using Illumina sequencing
• Assembled using Trinity (Broad Institute)
• Many dipteran proteomes (including 4 mosquitoes & D. melanogaster)
• All arthropod/metazoan proteomes
MAKER annotation with RNAseq and reference proteomes
• Aim:
• Gene prediction aggregation for the masses.
• Used for a number of arthropod genome projects
• Touted as the default pipeline for many more (part of the GMOD toolkit)
• Overview
• ab-initio gene predictions from SNAP, Augustus & FGENESH
• Final gene models from MAKER
• Similarity alignments from both EXONERATE and BLAST
• Repeats from RepeatFinder & RepeatMasker
• Additional data sets integrated via GFF3 files (RNA-Seq)
• Uses MPI for parallelization over a compute farm
• Summary
• Iterative runs give acceptable reference gene sets.
• Used for Heliconius, Glossina, sandflies and the first tranche of the 16 Anophelines
Current VectorBase annotation pipeline
• MAKER based automatic annotation
• includes SNAP training and ab initio
• RNAseq based transcript similarity prediction
• Taxonomically constrained peptide similarity prediction
• 2 rounds of prediction refinement & final round includes all peptide similarity
• Community annotation phase
• Capture gene structure changes
• Metadata associated with locus (symbol, description, citation)
• Submission to INSDC, propagation to UniProt
• Presentation through VectorBase
Start
1.0 set(automatic
)
1.1 set(published
)
Projection from a reference annotation
Gene prediction based on projection from reference annotation
• Local alignment of An. gambiae CDS to the assemblies provide a platform for improving gene predictions.
• Example loci: Rps7 (AGAP008916)
• Potential for transcript based assembly improvement via seqedits of genome sequence
Annotation: Preliminary genesets
• 10,738 - 13,162 predictions
• no ncRNAs yet predicted
Preliminary comparative analysis
• OrthoMCL runs including 17 species
• An. gambiae PEST 12,810 protein-coding genes
An. darlingi
Glossina morsitans
Lutzomyia longipalpis
Phlebotomus papatasi
Preliminary comparative analysis
• OrthoMCL runs including 17 species
• No. of clusters containing all 13 mosquitoes 4961 (≃ 39%)
An. darlingi
Glossina morsitans
Lutzomyia longipalpis
Phlebotomus papatasi
Preliminary comparative analysis
• OrthoMCL runs including 17 species
• No. of clusters containing all 13 mosquitoes 4961 (≃ 39%)
• No. of clusters containing all 11 Anophelines 5463 (≃ 43%)
An. darlingi
Glossina morsitans
Lutzomyia longipalpis
Phlebotomus papatasi
Preliminary comparative analysis
• OrthoMCL runs including 17 species
• No. of clusters containing all 13 mosquitoes 4961 (≃ 39%)
• No. of clusters containing all 11 Anophelines 5463 (≃ 43%)
• No. of clusters containing 10 Anophelines (minus darlingi) 6606 (≃ 52%)
An. darlingi
Glossina morsitans
Lutzomyia longipalpis
Phlebotomus papatasi
Preliminary comparative analysis
• OrthoMCL runs including 17 species
• No. of clusters containing all 13 mosquitoes 4961 (≃ 39%)
• No. of clusters containing all 11 Anophelines 5463 (≃ 43%)
• No. of clusters containing 10 Anophelines (minus darlingi) 6606 (≃ 52%)
• No. of clusters containing 9 Anophelines (minus darlingi & christyi) 7477 (≃ 58%)
An. darlingi
Glossina morsitans
Lutzomyia longipalpis
Phlebotomus papatasi
Preliminary comparative analysis
• OrthoMCL runs including 17 species
• No. of clusters containing all 13 mosquitoes 4961 (≃ 39%)
• No. of clusters containing all 11 Anophelines 5463 (≃ 43%)
• No. of clusters containing 10 Anophelines (minus darlingi) 6606 (≃ 52%)
• No. of clusters containing 9 Anophelines (minus darlingi & christyi) 7477 (≃ 58%)
• No. of clusters containing representatives of the gambiae complex (ar/ga/qu) 9089 (≃ 71%)
An. darlingi
Glossina morsitans
Lutzomyia longipalpis
Phlebotomus papatasi
Preliminary comparative analysis
• OrthoMCL runs including 17 species
• No. of clusters containing all 13 mosquitoes 4961 (≃ 39%)
• No. of clusters containing all 11 Anophelines 5463 (≃ 43%)
• No. of clusters containing 10 Anophelines (minus darlingi) 6606 (≃ 52%)
• No. of clusters containing 9 Anophelines (minus darlingi & christyi) 7477 (≃ 58%)
• No. of clusters containing representatives of the gambiae complex (ar/ga/qu) 9089 (≃ 71%)
• No. of clusters containing 8 Anophelines (- darlingi & christyi) but not gambiae 600
An. darlingi
Glossina morsitans
Lutzomyia longipalpis
Phlebotomus papatasi
All genomes deserves a home
• Genome browser
• Similarity searches
• BLAST/BLAT
• Query tools
• Simple keyword
• Complex queries
• DownloadsSimilarity searches
Query tool
Downloads
Browser
Browser
Compara
VectorBase
• Long term home for these genomes is VectorBase.
• NIAID-funded Bioinformatic Resource Center focused on arthropod vectors of human pathogens
• Ensembl genome browser
• Similarity searches
• File downloads
Anopheles Genomes Cluster wiki site
Thematic analysis groups & community annotation
• Community led annotation of the genomes using the Community Annotation Portal (CAP)
Community annotation decision tree
Community annotation decision tree
Community annotation decision tree
Community annotation decision tree
Community annotation workflow
ARTEMIS APOLLO
scf7180000638805 ptn2genome ptn_match 52 605 892 + . ID=xxxx;Name=tr|Q3UIQ2|scf7180000638805 ptn2genome ptn_match 78 205 960 + . ID=xxxx2;Name=tr|Q3TIU7|scf7180000638805 ptn2genome ptn_match 52 305 696 + . ID=xxxx3;Name=sp|Q91VD9|scf7180000638805 ptn2genome ptn_match 78 205 950 + . ID=xxxx2;Name=tr|Q3VIU732|
scf7180000638805 ptn2genome ptn_match 52 605 892 + . ID=xxxx;Name=tr|Q3UIQ2|scf7180000638805 ptn2genome ptn_match 78 205 960 + . ID=xxxx2;Name=tr|Q3TIU7|scf7180000638805 ptn2genome ptn_match 78 205 950 + . ID=xxxx2;Name=tr|Q3VIU732|
>MY SUPERCONTIGATATATGCGTTGAGCTGCGTTACGTTCGGGATGCGTTAGGCTTGTGAGCTGGATCGGTCCTGCCTGCGTCGATATAAACGACCT…
Identify gene
Modify model
SubmitCAP
GFF3 FASTA
CAP reporting
• Email report back to submitter to show status
• If successful then the model is stored in a local database and then presented to the genome browser via DAS
• Failed submissions have (some) information as to why. Submitters then need to correct these errors and re-submit
CAP submissions displayed in the genome browser
• Similarity track for supporting evidence (from previous updates)
Genome annotation metrics
• Metrics for quality of a gene set are far from standardised but...
• Simple statistics (length, number of exons, intron size)
• Level of support from transcript data (how many genes have overlapping EST/RNAseq)
• Junction data (confirmation of introns)
• Comparison to public datasets (UniProt)
• Protein domains (InterPro)
• Comparative analysis - orthologs/paralogs
Still to do...
Primary annotation
• Still 7 genomes outstanding from the Broad Institute - de novo repeat finding and MAKER annotation
Analysis
• Whole genome alignments and (12 Drosopholid analysis pipelines from Kellis group - Rob Waterhouse)
• Data presentation (Trinity clusters, correlation with legacy Hittinger clusters, velvet assembled 37 bp reads)
• Variation (SNP calls) from each of the 16 species
Other genomes
• New version of the An. darlingi genome (Osvaldo Marinotti, recently published in NAR)
• New version of the Indian strain of An. stephensi (Jake Tu)
Acknowledgements
VEMBL-EBI
Imperial College
Daniel Lawson, Gareth Maslen, Mikkel Christensen, Nick Langridge, Derek Wilson, Gautier Koscielny, Karyn Megy, Martin Hammond, Daniel Hughes, Ewan Birney, Paul Kersey
Fotis Kafatos, Bob MacCallum, George Christophides, Seth Redmond, Timo Tiirikka
NoTre Dame
HaRvardIMBB
New MexicO
ASequencers
Ensembl GEnomes
Maggie Werner-Washburne Phil Baker
Bill Gelbart, Susan Russo, Dave Emmert, Pinglei Zhou, Lynn Crosby, Kathy Campbell
Kitsos Louis, Pantelis Topalis, Emmanuel Dialynas, Vicky Dritsou
TIGR/JCVI WashU Broad Institute, Baylor College
Frank Collins, Greg Madey, Rob Bruggner, Nate Konopinski, EO Stinson, Scott Emrich, Andrew Sheehan, Rory Carmichael, Dave Cieslak, Dave Campbell, Ryan Butler, Katie Cybulski, Neil Lobo, Gloria Calderon, Greg Davis
Dan Neafsey, Brian Haas Nora Besansky, Michael Fontaine
Michael Nuhn
Rob Waterhouse Paul Howell
Contact [email protected] or [email protected]
Anopheles Genomes Cluster Consortium
Steering committee
Community liaisons