Amplification, In-silico classification, characterization and molecular modeling of Histone H2B gene from Setaria cervi

MAIN

©1996-2012 All Rights Reserved. Online Journal of Bioinformatics . You may not store these pages in any form except for yourown personal use. All other usage or distribution is illegal under international copyright treaties. Permission to use any of thesepages in any other way besides the before mentioned must be gained in writing from the publisher. This article is exclusivelycopyrighted in its entirety to OJB publications. This article may be copied once but may not be, reproduced or re-transmittedwithout the express permission of the editors. This journal satisfies the refereeing requirements (DEST) for the HigherEducation Research Data Collection (Australia). Linking:To link to this page or any pages linking to this page you must linkdirectly to this page only here rather than put up your own page.

OJBTM

Online Journal of Bioinformatics ©

Volume 13(2):232-245, 2012

Amplification, In-silico classification, characterization and molecular modeling ofHistone H2B gene from Setaria cervi

Sudhanshu Shekhar Yadav1, Vinay Kumar Singh2, Eva Liebau3, Sushma Rathaur1*

1Department of Biochemistry, 2Centre for Bioinformatics, Faculty of Science, Banaras Hindu University, Varanasi 221005, U.P.,India 3Westfalische Wilhelms-Uinversitat, Institute of Animal Physiology, Department of Molecular Physiology,Hindenburgplatz-55, Muenster, Germany.

ABSTRACT

Yadav SS, SinghVK, Liebau E, Rathaur S., Amplification, In-silico classification, characterizationand molecular modeling of Histone H2B gene from Setaria cervi, Online J Bioinform, 13(2):232-245, 2012. Setaria cervi was screened for antifilarial agents by gene identification, behavior andgenome organization. H2B gene was identified using primers generated from closely relatedspecies Brugia malayi. A 0.75kb amplified product from cDNA of S. cervi was used as template;gene sequences (JQ622388; AFI23673) were 83.3% of Brugia malayi and Loa loa. Functionaldomain analysis with Interproscan server revealed an amplified putative protein similar toHistone H2B (IPR000558), Histone core (IPR007125) and Histone fold (IPR009072) patterns.Model structure (PM0078101) and classification lineage (1.10.20.10) suggested that the existingprotein was a histone subunit consisting of an alpha fold with orthogonal bundle architecture.H2B-DNA interactions stabilize the nucleosome and H2B could modulate chromatin structureduring DNA repair, replication, transcription and chromatin compaction. DNA-Histone proteininteraction showed that residues 61Asn, 62Lys, 63Arg, 67Ser, 69Arg, 67Arg, 89Ser, 93Lys, 97Lys, 99Asnand 102Lys of H2B protein binded with wrapped DNA in genome of S. cervi. H2B histone proteincould be a potential drug target for filariasis since inhibition of histone protein (H2B) synthesisblocks the cell division at S-phase of cell cycle which could prevent its transmission.

Keywords: Amplification, Homology modeling, Histone H2B, Setaria cervi, Filariasis, Drug target.

INTRODUCTION

In eukaryotic cells, DNA is packaged with histones and other proteins into chromatin (Felsenfeldand Groudine, 2003). Histones are the major complex family of highly conserved basic proteincomponent of nucleosomes and de novo histone synthesis is essential for packaging newlyreplicated DNA into chromatin (Igo-Kemenes et al. 1982; Isenberg, 1979). The principalpackaging unit is the nucleosome, which consists of approximately 146 bp of DNA wrappedaround a protein core of one histone H3-H4 tetramer and two histone H2A-H2B dimers (Ren etal. 2000; Albig and Doenecke, 1997; Marzluff et al. 2002). Histone H2B proteins have beenstudied in a variety of species-including chicken, mouse, rat, and human with respect to theirsubtype diversity (Branson et al. 1975; Jackson, 1985; Stein et al. 1984; Zweidler, 1980).Because of their close association with DNA in the nucleosome, histones play integral roles inDNA template processes, such as DNA transcription, replication, cell growth control,recombination and repair. There is a fundamental requirement for de novo histone proteinsynthesis to package newly replicated DNA during the S-phase of the cell cycle, and significantcellular resources are dedicated to the concerted regulation of histone protein biosynthesis(Osley, 1991). The organization of histone genes into clusters persists throughout the course ofevolution from yeast to human (Schaffner et al. 1978). The replication-dependent and tissue-specific H2B proteins are easily detected in most species, the replacement histone H2B proteinsare not always observed in humans, possibly due to the lack of sensitivity of the assay (Stein etal. 1984). Replication-dependent histone genes do not contain introns (Erkmann et al. 2005),and their mRNAs are structurally simple; they are not polyadenylylated and have short 5’-leaderand 3’-trailer sequences (Hentschel and Birnstiel, 1981).

To date, H2B histone gene organization and expression have been studied most thoroughly inthe chicken; five replication- dependent, one partially replication-dependent, oneuncharacterized, and one testis-specific chicken H2B genes have been described (Challoner etal. 1989; Grandy et al. 1982; Grandy and Dodgson, 1987; Hwang and Chae, 1989). Althoughseveral human histone H2B replication-dependent genes and one pseudogene have beendescribed (Heintz et al. 1983; Marashi et al. 1984; Plumb et al. 1983a, b; Prokopp, 1984; Sierraet al., 1982; Stein et al., 1984; Zhong et al. 1983), no H2B genes have been reported in filarialparasites.

Since H2B-DNA interactions play an important role in stabilizing the nucleosome (Luger et al.1997a; Luger et al., 1997b; White et al., 2001) and H2B might also play specific role in themodulation of chromatin structure during DNA repair, transcription, replication andinternucleosomal interactions that might also contribute to chromatin compaction (White et al.2001).

In this work we have amplified histone H2B gene from the nematode Setaria cervi first time.Gene amplification, sequencing, insilico characterization and molecular modeling of histoneH2B gene/protein from S. cervi (a bovine filarial parasite) were done using molecular biologyand bioinformatics techniques. S. cervi closely resembles with W. bancrofti a human filarialparasite in nocturnal periodicity, antigenic pattern and response to drug. Inhibition of histone

protein synthesis may help in prevent the growth of filarial parasites. Designed drug/ inhibitorsagainst these H2B genes may be used to cure the filarial disease.

MATERIALS AND METHODS

cDNA preparation and Gene amplificationRNA was extracted from specified cell lines using Trizol reagent (Gibco) according to themanufacturer’s protocol. Total DNA-free RNA was quantitated and 1 µg added to a reversetranscriptase reaction using “first strand cDNA synthesis” kit (fermentas) for cDNA preparation,using manufacturer instruction. Varying dilutions of cDNA were used as templates in PCRreactions (50μl) containing, 1 unit Taq-Polymerase, 1x dNTPs mixed, 10x Taq buffer and 10pmol of each primer (Forward, 5’ GCGCGGTTTAATTACCCAAGTTTGAG 3’ and Reverse, 5’ATATGGGCCCTCAGACCTTGACACCATTGCG 3’). Standard PCR programme was used for ScGRH2B gene amplification; 35 cycles at 95 °C for 4 min, 52 °C for 40 sec and 72 °C for 50 sec.

Agarose-gel electrophoresis of DNAThe size of a DNA fragment can be determined by comparison with standard DNA marker ofidentified size (0.25 to 10 Kb). DNA was mixed with 6x loading dye run parallel to DNA ladder in1% agarose in 1x TAE buffer and band was visualized by using Geldock documentation.

DNA sequencing and DepositionThe PCR product was purified by “DNA purification kit” (Neucleo spin DNA quick pure). Thepurified DNA was used for sequencing. The sequences obtained from amplified product weremerged and the overall sequences of both strands were aligned by using the Intelli Geneticscomputer software package. Well annotated nucleotide with 309bp and their putative protein102aa sequences has been successfully deposited in NCBI with Accession number JQ622388;AFI23673.

Sequence and Phylogenetic analysisPutative protein sequence was used for functional domain analysis using Interproscan(http://www.ebi.ac.uk/Tools/pfa/iprscan/). Basic local alignment search tool (BLAST;http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used for similarity search against various organismdeposited in NCBI database. Selected similar sequences from different organism was used forphylogenetic classification multiple sequence alignment was done using ClustalW(http://www.genome.jp/tools/clustalw/) and Phylogenetic tree was constructed usingMEGA5.0.

Comparative molecular modeling, simulations and refinementComputationally characterized protein was further used for structural modeling andclassification by using Discovery studio 3.1tool and SCOP (http://scop.mrc-lmb.cam.ac.uk/scop/) server respectively. Predicted model quality and quantity were checkedusing RAMPAGE (http://mordred.bioc.cam.ac.uk/~rapper/rampage.php), Verify3D(http://nihserver.mbi.ucla.edu/ Verify_3D/), ERRAT (http://nihserver.mbi.ucla.edu/ERRATv2/),VADAR (http://vadar.wish artlab.com/) and PROSA

(https://prosa.services.came.sbg.ac.at/prosa.php). Best refined and evaluated model wassuccessfully deposited in protein model database with PMDBID.

DNA –Protein interactionBest reliable model of H2B protein was used for interaction study with reported DNA structure(PDBID: 2NQB; 146bp) and Hex server (http://hexserver.loria.fr/) used for DNA-Proteininteraction.

RESULTS

Gene amplification and sequence match analysisThese studies were designed to amplify and insilico characterization of histone H2B mRNA innematode bovine filarial parasite S. cervi. PCR Amplified H2B gene product size was measuredin agarose gel electrophoresis with comparison of standard molecular weight marker rangefrom 0.25 to 10 kb. The H2B gene length was 309 bp and size of band was 0.75 kb (Figure 1).

Figure 1: Amplification of H2B gene from S. cervi

Sequence analysis and Phylogenetic classificationFurther Setaria cervi H2B protein (AFI23673.1) was used for similarity search against otherorganisms. The homologues sequences were selected which having more than 70% sequencesimilarity with different organisms. The H2B protein sequence from Setaria cervi was found tobe identical to the GenBank accession no. XP_003146042.1 and XP_001895510.1 showingmaximum similarity with Loa loa and Brugia malayi respectively. Setaria cervi H2B proteinshaving ~71 % similarity with Silurana_tropic and Canis_lupus and ~72% similar with Bos taurus,Macaca mulatta, Oryctolagus cuniculus, Equus caballus, Rattus norvegicus, Danio rerio, Gallusgallus, Mus musculus and Acyrthosiphon pisum, ~73% similar with Taeniopygia guttata, Anoliscaroline, Homo sapiens and Loxodonta africana, ~77% similarity with Caenorhabditis sp. and83.3 % similar with Loa loa and Brugia malayi. Therefore, our data indicate that the S. cervihistone gene is closer to lower invertebrates than vertebrates (figure 2).

AFI23673.1 Setaria cervi

XP 003146042.1 Loa loa

XP 001895510.1 Brugia malayi

NP 505197.1 Caenorhabditis ele

XP 003110319.1 Caenorhabditis

XP 001947771.1 Acyrthosiphon p

XP 003227271.1 Anolis caroline

NP 956411.1 Danio rerio

NP 001026652.1 Gallus gallus

XP 002942895.1 Silurana tropic

XP 002192994.1 Taeniopygia gut

XP 003409563.1 Loxodonta afric

NP 783595.1 Mus musculus

NP 003510.1 Homo sapiens

XP 539321.2 Canis lupus

XP 001054927.1 Rattus norvegic

XP 001498394.1 Equus caballus

XP 002714193.1 Oryctolagus cun

XP 001086637.2 Macaca mulatta

XP 001788832.2 Bos taurus

Figure 2: Phylogenetic classification of H2B gene from S. cervi with various organisms

Sequence alignment with different organisms was found to be five substitutions at differentposition in H2B gene of S. cervi. Tyrosine (Y126), Methionine (M145), Arginine (R158), Serine(S173) and Histidine (H195) is replaced with Asparagine (N17), Lysine (K36), Glycine (G49),Leucine (L64) and Proline (P86) respectively (Figure 3 and Table 1). Substitution of amino acidsincreases the hydrophobicity of the protein, which helps in protein folding and stabilizes theprotein structure (Alberts et al. 2002). Based on alignment study it has been found that thereare eight multilevel consensus sequences (RKESY, VLKQVHPDTG (I/V)SSK,I(L/M)(K/N)SFVND(V/I/L)FE, E(A/S)SRL, (Q/H)YNKR, T(L/I)(S/T)SRE(I/V)QTA VRL(I/L) LPGELAK,

AVSEGTK and VTKY) present within all selected organisms.

Figure 3: Multiple sequence alignment of H2B genes of Setaria cervi from various organisms

Table 1: Substitution of amino acids in Setaria cervi with closely related organisms Brugiamalayi and Loa loa.Brugia malayi(XP_001895510.1;211aa)

Loa loa (XP_003146042.1;122aa)

Setaria cervi(AFI23673.1;102aa)

Amino acidSubstitution

Tyrosine (126) Y37 Asparagine (17) Tyr-AsnMethionine (145) M56 Lysine (36) Met-LysArginine (158) R69 Glysine (49) Arg-GlySerine (173) S84 Leucine (64) Ser-LeuHistidine (195) H106 Proline (86) His-Pro

Functional elucidationTo investigate the functional domain of putative protein H2B of Setaria cervi and Interproscanstudy was done. It has been found that selected protein was showing matches with HistoneH2B (IPR000558), Histone core (IPR007125) and Histone fold (IPR009072) (Figure 4). H2B is oneimportant histone protein in the eukaryotic nucleosome. Histone H2B is a small, highlyconserved nuclear protein that involved together with 2 molecules each of histones H2A, H3and H4, forms the eukaryotic nucleosome core (octamer), [Wells and Brown, 1991] which windsto ~146 DNA base-pairs of double helical DNA and help in genome organization of organisms.

Figure 4: Functional domain analysis using INTERPROSCAN

Homology modeling, simulation, refinement and structure validation

H2B protein from Setaria cervi was use for homology modeling using Discovery studio 3.1.Using PDB advance blast it has been found that selected target protein is showing 78% identitywith 85% positivity of PDB ID 2NQB used as template structure. RAMPAGE study of predictedmodel was showing 1.1% residues (Gly81) in outlier region. Further model structure was usedfor simulation using Discovery studio 3.1 with conjugant gradient method. There was no

residues were found in outlier region, 100% residues were found in favoured region. PDBSumRamachandran plot statistics resulted that 98.7% of total residues in the most favored regionsand 1.3% of residues in additional allowed regions. No residues were found in generouslyallowed regions and disallowed region (Figure 6A and B). Successfully refined, validated modelof H2B protein from S. cervi was deposited to PMDB database with PMDB ID PM0078101. UsingVMD and PDBSum server it has been found that the predicted structure contains 4 helices (14-26, 32-62, 67-79, 80-101), 3 helix-helix interacs, 5 coils and 1 β-turn (Figigure 5A, B and C.) assecondary elements. There were no beta-strands (sheets) available in this model protein.Energy was observed using Discovery studio 3.1 in which PDF Total energy was 238.4046 withDOPE score was -7606.245117 and PDF physical energy was 170.691236 (Table 2). The modelwas also validated using ERRAT server (Figure 7). The quality factor of 93.902% suggests thatthe model has good quality as a score higher than 50 % is acceptable for a reasonable model.Verify 3D score lied between 0.28 – 0.12. VADAR statistics showed modeled H2B proteinstructure containing 80% Helices, 20% Coils and 13% turns (Figure 9). Overall fractionalaccessible area, residues volume and packing quality index were found to be good using VADARserver (Figure 8 A, B and C).

A

B

C

Figure 5: Structre of H2B gene from S. cervi. (A) 3D structure, (B) surface structure and (C)secondary structure.

Table 2: DOPE score, PDF physical energy of predicted model of H2B protein using Discoverystudio3.1

A B

Figure 6: Ramachandran Plot Statistics showing before simulation (A) and after simulation (B)using Discovery studio3.1

Figure 7. The 3D profiles of S. cervi H2B protein verified using ERRAT server, expressed as thepercentage of the protein to which the calculated error value falls below the 95% rejectionlimit. Good high resolution structures generally produce value around 95% or higher. For lowerresolutions (2.5 to 3Ǻ) the average overall quality factor is around 91%. On the error axis, twolines are drawn to indicate the corlidence with which it is possible to reject regions that exceedthat error value.

A B

C

Figure 8. Fractional accessibility surface area (A), residual volume (B) and Stereo quality index(C) of H2B protein using VADAR server

Figure 9: Evaluation/Verification of 3D structure of H2B protein

Histone - DNA interactionsThe nucleosome core particle consist with 146 bp of DNA wrapped in 1.67 left-handedsuperhelical turns around the octamer histone protein. Hex6.3 was used for DNA-proteinintraction. Top ten interaction orientation has been found in which oreintation one hasminimum energy of interaction -455.68 (Table 3). The residues of H2B protein 61Asn, 62Lys,63Arg, 67Ser, 69Arg, 67Arg, 89Ser, 93Lys, 97Lys, 99Asn and 102Lys are involved in interactionwith wrapped DNA which may help in the basic genome organization of Setaria cervi.

Table 3: DNA- Histone (H2B) protein interaction details

Orientation Picture Energy Residues involved (AFI23673.1)

1 -455.68 61Asn, 62Lys, 63Arg, 67Ser, 69Arg, 67Arg, 89Ser, 93Lys,97Lys, 99Asn and 102Lys

2 -305.11 26His,76Arg, 81Gly, 82Glu,85Lys, 88Val, 89Ser, 92Thr,96Thr,102Lys

3 -286.58 28Asp, 60Tyr, 62Lys, 69Arg, 76Arg, 77Leu, 81Gly, 83Leu,88Val, 92Thr, 96Thr

4 -277.06 22Leu ,26His, 28Asp, 29Thr, 34Lys, 60Tyr,77Lys, 78Ile

5 -268.95 57Leu, 60Tyr, 61Asn,70Arg,73Thr, 86Pro, 89Ser, 93Lys,99Asn

6 -263.31 61Asn, 63Arg, 72Gln, 76Arg, 80Pro, 81Gly, 82Glu, 84Ala,88Val, 96Thr, 97Lys, 99Asn, 100Ser, 101Ser, 102Lys

7 -258.41 26His, 27Pro, 28Asp, 60Tyr, 61Asn,63Arg, 69Arg, 93Lys,96Thr, 97Lys,100Ser, 101Ser

8 -254.70 55Ser, 59Gln, 63Arg, 64Leu

9 -250.86 24Gln, 25Val, 26His, 27Pro, 28Asp, 29Thr, 69Arg, 77Leu,83Leu, 93Lys

10 -247.69 23Lys, 24Gln, 27Pro, 60Tyr, 69Arg, 77Leu, 80Pro, 82Glu,83Leu, 89Ser, 92Thr, 94Lys

DISCUSSIONSetaria cervi a bovine filarial parasites closely resemblance with human filarial parasites can beused for screening of antifilarial agents against filariasis. H2B genes/proteins play importantrole in stabilizing the nucleosome, modulation of chromatin structure during DNA repair, DNAreplication, transcription and internucleosomal interactions contribute to chromatincompaction in lower invertebrates. In S. cervi there was no H2B gene/protein has beenreported earlier. Based on Brugia malayi (a model genome), we have designed a primer pairsfor H2B gene for amplification respective genes in S. cervi. We have successfully amplified andsequenced H2B gene (309bp; 102aa) in S. cervi. Insilico techniques were used forcharacterization of H2B gene (JQ622388). Sequence analysis of S. cervi H2B protein(AFI23673.1) found with 83.3% closely similar nematodes L. loa and B. malayi. The crystalstructure of H2B protein in S. cervi has not yet been determined. Therefore, we built a modelusing homology modeling approach to understand the structure of H2B protein in S. cervi. Themodel was stereo chemically good, with 98.7% residues falling in the most favored regions ofthe Ramachandran plot statistics with G-factors of 0.15. The VERIFY3D plots for these modelsalso showed satisfactory for all the residues. The ERRAT result shows that the quality factor ofthe protein is 93.902%. The energetic architecture predicted by PROSA score was closely similarwith X-ray/NMR datasets (Z-score -2.96) for the modeled protein which almost same fortemplate (-3.08). The accuracy of the model was good using WHATCHECK server. The abovefindings indicate that the predicted structure can be accepted as best quality model. In-silicoDNA-Histone protein interaction shows that residues 61Asn, 62Lys, 63Arg, 67Ser, 69Arg, 67Arg,89Ser, 93Lys, 97Lys, 99Asn and 102Lys of H2B protein are involved in binding (energy -455.68) withwrapped DNA will play important role in the genome organization specially contribute tochromatin compaction of S. cervi. These result showed that the interaction of histone proteinwith DNA are mainly due to the basic amino acids (~63%) of the histone protein.ConclusionStructural classification and functional motif study of histone protein will be helpful to studyprotein/ DNA/ Drug interaction. DNA-Histone protein interactions of H2B protein with 146bpDNA are interacting with the basic amino acids of the histone protein. Because the basicresidues are positively in nature and may binds to the phosphate groups of the DNA sugar-phosphate backbone i.e. ionic interaction. Inhibition of histone protein (H2B) synthesis mayprevent cell cycle during S-phase and inhibit the nucleosome assembly i.e. inhibit the growth ofthe organisms, can be used as a good target for drug discovery. This will be helpful to developnew antifilarial drug against filariasis.AcknowledgementsThe authors gratefully acknowledge the financial support from AVH fellowship Germany andUGC research fellowship BHU, Varanasi. The computational biology facilities provided by DBTfunded SUB-DIC, Centre for Bioinformatics, School of Biotechnology, Faculty of Science, BanarasHindu University, Varanasi is also thankfully acknowledged.REFERENCES

Alberts B, Alexander J, Julian L, Martin R, Keith R, Peter W (2002) The Shape and Structure ofProteins. Molecular Biology of the Cell; Fourth Edition. New York and London: Garland Science.ISBN 0-8153-3218-1Albig W, Doenecke D (1997) The human histone gene cluster at the D6S105 locus. Hum Genet.101(3):284-294 PubMed PMID: 9439656.Branson RE, Grimes SR Jr, Yonuschot G, Irvin JL (1975) The histones of rat testis. Arch BiochemBiophys 168(2):403-412 PubMed PMID: 1094956.Challoner PB, Moss SB, Groudine M (1989) Expression of replication-dependent histone genesin avian spermatids involves an alternate pathway of mRNA 3'-end formation. Mol. Cell. Biol.9:902-913 PubMed PMID: 2471062.Eisenberg D, Lüthy R, Bowie JU (1997) VERIFY3D: assessment of protein models with three-dimensional profiles. Methods Enzymol. 277:396-404 PubMed PMID: 9379925.Erkmann JA, Sànchez R, Treichel N, Marzluff WF, Kutay U (2005) Nuclear export of metazoanreplication-dependent histone mRNAs is dependent on RNA length and is mediated by TAP.RNA 11:45-58 PMID: 15611298.Felsenfeld G, Groudine M (2003) Controlling the double helix. Nature. 421(6921):448-53PubMed PMID: 12540921.Grandy DK, Dodgson JB (1987) Structure and organization of the chicken H2B histone genefamily. Nucleic Acids Res. 15(3):1063-1080 PubMed PMID: 3822819.Grandy DK, Engel JD, Dodgson JB (1982) Complete nucleotide sequence of a chicken H2bhistone gene. J. Biol. Chem. 257(15):8577-8580 PubMed PMID: 7096326.Heintz N, Sive HL, Roeder RG (1983) Regulation of human histone gene expression: kinetics ofaccumulation and changes in the rate of synthesis and in the half-lives of individual histonemRNAs during the HeLa cell cycle. Mol. Cell. Biol. 3(4):539-550 PubMed PMID: 6406835.Hentschel CC, Birnstiel ML (1981) The organization and expression of histone gene families.Cell. 25(2):301-313 PubMed PMID: 6793234.Hwang I, Chae CB (1989) S-phase-specific transcription regulatory elements are present in areplication-independent testis-specific H2B histone gene. Mol. Cell. Biol. 9(3):1005-1013PubMed PMID: 2725487.Igo-Kemenes T, Horz W, Zachau HG (1982) Chromatin. Annu. Rev. Biochem. 51: 89-121 PubMedPMID: 6287925.Isenberg I (1979) Histones. Annu. Rev. Biochem. 48:159-191 PubMed PMID: 382983.Jackson V, Chalkley R (1985) Histone synthesis and deposition in the G1 and S phases ofhepatoma tissue culture cells. Biochemistry. 24(24):6921-6930 PubMed PMID: 3935167.Leigh W, Anuj R, Haiyan Z, Hassan M, Robert FB, Brian DS, David SW (2003) VADAR: a webserver for quantitative evaluation of protein structure quality. Nucleic Acids Res. 31(13):3316-3319Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ (1997a) Crystal structure of thenucleosome core particle at 2.8 A resolution. Nature. 389:251-260Luger K, Rechsteiner TJ, Flaus AJ, Waye MM, Richmond TJ (1997b) Characterization ofnucleosome core particles containing histone proteins made in bacteria. J. Mol. Biol. 272:301-311

Marashi F, Prokopp K, Stein J, Stein G (1984) Evidence for a human histone gene clustercontaining H2B and H2A pseudogenes. Proc. Natl. Acad. Sci. USA. 81(7): 1936-1940 PubMedPMID: 6326092.Marzluff WF, Gongidi P, Woods KR, Jin J, Maltais LJ (2002) The human and mouse replication-dependent histone genes. Genomics. 80(5):487-498 PubMed PMID: 12408966.Osley MA (1991) The regulation of histone synthesis in the cell cycle. Annu. Rev. Biochem.60:827-861 PubMed PMID: 1883210.Plumb M, Stein J, Stein G (1983) Coordinate regulation of multiple histone mRNAs during thecell cycle in HeLa cells. Nucleic Acids Res. 11(8):2391-2410 PubMed PMID: 6304651.Plumb M, Stein J, Stein G (1983) Influence of DNA synthesis inhibition on the coordinateexpression of core human histone genes during S phase. Nucleic Acids Res. 11(22):7927-7945PubMed PMID: 6647036.Prokopp KM (1984) M.S. Thesis, University of Florida.Ren B, Robert F, Wyrick JJ, Aparicio O, Jennings EG, Simon I, Zeitlinger J, Schreiber J, Hannett N,Kanin E, Volkert TL, Wilson CJ, Bell SP, Young RA (2000) Genome-wide location and function ofDNA binding proteins. Science. 290(5500):2306-2309 PubMed PMID: 11125145.Schaffner W, Kunz G, Daetwyler H, Telford J, Smith HO, Birnstiel ML (1978) Genes and spacersof cloned sea urchin histone DNA analyzed by sequencing. Cell. 14(3):655-671 PubMed PMID:688387.Sierra F, Lichtler A, Marashi F, Rickles R, Van DT, Clark S, Wells J, Stein G, Stein J (1982)Organization of human histone genes. Proc. Natl. Acad. Sci. USA. 79(6): 1795-1799 PubMedPMID: 6281786.Stein GS, Stein JL, Marzluff WF, Eds (1984) Histone genes, structure, organization andregulation. John Wiley and Sons, New York. Pp. 65-105Wells D, Brown D (1991) Histone and histone gene compilation and alignment update. NucleicAcids Res. 19:2173-2188 PubMed PMID: 2041803.White CL, Suto RK, Luger K (2001) Structure of the yeast nucleosome core particle revealsfundamental changes in internucleosome interactions. EMBO J. 20:5207-5218Zhong R, Roeder RG, Heintz N (1983) The primary structure and expression of four clonedhuman histone genes. Nucleic Acids Res. 11(21):7409-7425 PubMed PMID: 6647026.Zweidler A, (1980) Nonallelic histone varients in development and differentiation. Deu.Biochem. 15:47-56