Aliya Tariq_Plant Pathology_2020 arid rwp prr.pdf - Pakistan ...

i

CHARACTERIZATION AND BIO-CONTROL OF FRUIT AND

ROOT ROT PATHOGENS OF BELL PEPPER

ALIYA TARIQ

08-arid-22

DEPARTMENT OF PLANT PATHOLOGY

FACULTY OF CROP & FOOD SCIENCES

PIR MEHR ALI SHAH

ARID AGRICULTURE UNIVERSITY RAWALPINDI

PAKISTAN

2020

ii

CHARACTERIZATION AND BIO-CONTROL OF FRUIT AND

ROOT ROT PATHOGENS OF BELL PEPPER

by

ALIYA TARIQ

(08-arid-22)

A thesis submitted in partial fulfillment of

the requirement for degree of

Doctor of Philosophy

in

Plant Pathology

DEPARTMENT OF PLANT PATHOLOGY

FACULTY OF CROP & FOOD SCIENCES

PIR MEHR ALI SHAH

ARID AGRICULTURE UNIVERSITY RAWALPINDI

PAKISTAN

2020

iii

iv

v

vi

vii

DEDICATED TO

My Loving Parents

and

Caring Sisters

viii

CONTENTS

Page

List of Tables ix

List of Figures xi

List of Appendix xix

List of Abbreviations xxi

Acknowledgements xxii

ABSTRACT xxiii

Chapter 1 INTRODUCTION 1

Chapter 2 REVIEW OF LITERATURE 5

Chapter 3 MATERIALS AND METHODS 13

3.1 SURVEY FOR THE FRUIT AND ROOT ROT

PATHOGENS

13

3.2 ISOLATION AND PURIFICATION OF PATHOGENS 16

3.3 PRESERVATION OF FUNGI 16

3.4 CULTURAL/MICROSCOPIC CHARACTERISTICS 17

3.5 PATHOGENICITY TEST 17

3.6 GENOMIC DNA EXTRACTION 22

3.7 PCR AMPLIFICATION, SEQUENCING AND

PHYLOGENETIC ANALYSIS

22

3.8 IN VITRO MANAGEMENT OF HIGHLY PREVALENT

FRUIT ROT PATHOGEN WITH NATURAL COMPOUNDS

23


FRUIT AND ROOT ROT PATHOGEN WITH VOLATILE

COMPOUNDS

23


ROOT ROT PATHOGEN WITH ANTAGONISTIC FUNGI

26

Chapter 4 RESULTS AND DISCUSSION 27

4.1 PREVALENCE AND INCIDENCE OF FRUIT ROT

DISEASES

27

4.1.1 Prevalence and Incidence of Fruit Rot Diseases in 27

ix

Greenhouses

4.1.2 Prevalence and Incidence of Fruit Rot Diseases in Open Fields 31

4.2 PREVALENCE AND INCIDENCE OF ROOT ROT

DISEASES

36

4.2.1 Prevalence and Incidence of Root Rot Diseases at Seedling

Stage in Greenhouses

37

4.2.2 Prevalence and Incidence or Root Rot Diseases at Seedling

Stage in Low Plastic Tunnels

41

4.2.3 Prevalence and Incidence of Root Rot Diseases at Maturity

Stage in Greenhouses

44

4.2.4 Prevalence and Incidence of Root Rot Diseases at Maturity

Stage in Open Fields

46

4.3 ISOLATION OF PATHOGENS 51

4.4 PRESERVATION 52

4.5 MORPHOLOGICAL CHARACTERIZATION 52

4.5.1 Morphological Characterization of Colletotrichum truncatum 52

4.5.1.1 Colony diameter 52

4.5.1.2 Colony color and orientation 53

4.5.1.3 Texture 53

4.5.1.4 Conidia 54

4.5.1.5 Setae 54

4.5.1.6 Appressoria 55

4.5.2 Morphological Characterization of Fusarium incarnatum 64


4.5.2.2 Colony color 64

4.5.2.3 Texture 65

4.5.2.4 Sporodochia 65

4.5.2.5 Conidia and conidiophores 65

4.5.3 Morphological Characterization of Fusarium proliferatum 71



4.5.3.3 Texture 71

x


4.5.3.5 Conidia 71

4.5.4 Morphological Characterization of Botrytis cinerea 75



4.5.4.3 Texture 76

4.5.4.4 Sclerotia 76


4.5.5 Morphological Characterization of Alternaria alternata 77



4.5.5.3 Concentric rings 87

4.5.5.4 Texture 87


4.5.6 Morphological Characterization of Fusarium equiseti 88



4.5.6.3 Texture 94



4.5.7 Morphological Characterization of Rhizoctonia solani 97



4.5.7.3 Texture 101


4.5.7.5 Hyphal characteristics 102

4.5.8 Morphological Characterization of Sclerotium rolfsii 109



4.5.8.3 Texture 110


4.5.8.5 Hyphal characteristics 111

xi

4.6 PATHOGENICITY TEST 112

4.7 MOLECULAR CHARACTERIZATION 128

4.7.1 Molecular Characterization of Colletotrichum truncatum 128

4.7.2 Molecular Characterization of Fusarium spp. 129

4.7.3 Molecular Characterization of Botrytis cinerea 134

4.7.4 Molecular Characterization of Alternaria alternata 136

4.7.5 Molecular Characterization of Fusarium equiseti 137

4.7.6 Molecular Characterization of Rhizoctonia solani 138

4.7.7 Molecular Characterization of Sclerotium rolfsii

(Teleomorph: Athelia rolfsii)

140

4.8 IN-VITRO BIO-CONTROL 141

4.8.1 In-vitro Bio-control using natural compounds 141

4.8.2 In-vitro Bio-control using volatile compounds 143

4.8.3 In-vitro Bio-control using Antagonistic Fungi 147

SUMMARY

LITERATURE CITED

149

152

xii

List of Tables

Table No. Page

3.1 The localities of tehsils of district Rawalpindi, Chakwal,

Attock and Islamabad territory surveyed for incidence and

prevalence of root rot and fruit rot pathogens of bell pepper

15

3.2 Inoculums potential of fungal spores used for the

pathogenicity test

18

3.3 Disease rating scale (0-5) for Anthracnose disease 19

3.4 Disease rating scale for Fusarium and Botrytis fruit rot 20

3.5 Disease rating scale for Alternaria fruit rot 20

3.6 Disease rating scale for Fusarium root rot 21

3.7 Disease rating scale for Rhizoctonia root rot 21

3.8 Disease rating scale for Sclerotium root rot 22

3.9 Primers used in PCR amplification and sequencing 25

4.1 Location wise mean disease incidence (%) of fruit rot

diseases in greenhouse during January 2016 and 2017

29

4.2 Location wise mean disease incidence (%) of fruit rot

diseases in open fields during May 2016 and 2017

33

4.3 Percent mean disease incidence of root rot diseases in

greenhouse at various locations during November 2015 and

2016

40

4.4 Percent mean disease incidence of root rot diseases in low

plastic tunnels at various locations during February 2016

and 2017

42

4.5 Percent mean disease incidence of root rot diseases in

greenhouse at various locations during February 2015 and

2016

45

4.6 Percent mean root rot disease incidence caused by 3

pathogens in open fields at various locations during May,

2016 and 2017

47

4.7 Cultural Characteristics of Colletotrichum truncatum 58

xiii

4.8 Microscopic Characteristics of Colletotrichum truncatum 61

4.9 Cultural Characteristics of Fusarium incarnatum 67

4.10 Microscopic characteristics of Fusarium incarnatum 69

4.11 Cultural characteristics of Fusarium proliferatum 73

4.12 Microscopic characteristics of Fusarium proliferatum 74

4.13 Cultural characteristics of Botrytis cinerea 80

4.14 Microscopic characteristics of Botrytis cinerea 84

4.15 Cultural and microscopic characteristics of Alternaria

alternata

91

4.16 Cultural and microscopic characteristics of Fusarium

equiseti

98

4.17 Cultural and microscopic characteristic of Rhizoctonia

solani

105

4.18 Cultural and microscopic characteristics of Sclerotium

rolfsii

113

4.19 Percent disease severity index of C. truncatum 121

4.20 Percent disease severity index of Fusarium spp. 122

4.21 Percent disease severity index of Botrytis cinerea 123

4.22 Percent disease severity index of Alternaria alternata 124

4.23 Percent disease severity index of Fusarium equiseti 125

4.24 Percent disease severity index of Rhizoctonia solani 126

4.25 Percent disease severity index of Sclerotium rolfsii 127

xiv

List of Figures

Figure No. Page

3.1 Map showing the localities of Study area 14

3.2 Bell pepper seedlings of yolo wonder variety for

pathogenicity test

18

4.1 Percent mean disease incidence of various fruit rot diseases

in greenhouses during February 2016 and 2017

27

4.2 Fusarium mold symptoms; a. Water-soaked lesions with a

white-light gray mold b. whitish-gray hyphal growth on the

seeds

28

4.3 Gray mold symptoms; a. Water-soaked spots, yellowish-

brown or grayish-brown lesions b. gray brown conidia and

conidiophores

28

4.4 Black mold symptoms; a. Circular to irregular, sunken

lesions covered with black spores b. fungal growth on

seeds and inner fruit wall

29

4.5 Tehsil wise mean disease incidence (%) of fruit rot

diseases in greenhouse during January 2016 and 2017

30

4.6 Percent mean disease incidence of various fruit rot diseases

in open fields during May 2016 and 2017.

31

4.7 Anthracnose fruit rot; a. Circular to irregularly-shaped,

sunken, brown to black lesions (acervuli) of fungi b.

misshapen and rotted fruit

32

4.8 Tehsil wise mean disease incidence (%) of fruit rot

diseases in open fields during May 2016 and 2017

34

4.9 Percent mean disease incidence of various root rot diseases

in greenhouse during November 2015 and 2016.

37

4.10 Symptoms of Fusarium root rot with dark brown to

black, discolored and rotted roots, stunted growth and

38

xv

wilting

4.11 Roots infected with Rhizoctonia root rot appears brown,

somewhat mushy and plant tops collapsed, formation of

brown-black cankers on stem at or below the soil line

39

4.12 White cottony growth of Sclerotium root rot covered the

infected roots surface

39


in greenhouse located in 5 tehsils during November 2015

and 2016

40

4.14 Percent mean disease incidence caused by various root rot

pathogens in low plastic tunnels during February 2016 and

2017

41


in low plastic tunnels located in 9 tehsils/territory during

February 2016 and 2017

43

4.16 Percent mean disease incidence caused by various root rot

pathogens in greenhouses during February 2016 and 2017

44


in green house located in 5 tehsils during February 2016

and 2017

45


in open fields during May 2016 and 2017

46


in open fields located in 9 tehsils during May 2016 and

2017

49

4.20 Colonies of various fungi grown on PDA a. Colletotrichum

truncatum. b. Fusarium sp. c. Botrytis cinerea d.

Alternaria alternata e. Rhizoctonia solani f. Sclerotium

rolfsii

51

4.21 a. Colonies of group 1 isolates displayed white to ash gray

colony with small dot like acervuli b. ash gray color in

reverse

55

xvi

4.22 Colonies of group 2 isolates displayed light-dark gray

color, comprised of 4-5 concentric rings, with dense

acervuli b. dark gray to black color in reverse

55

4.23 a. Colonies of group 3 isolates were radiating, dark gray to

black in color, with abundant acervuli b. dark gray to black

in reverse

56

4.24 a. Colonies of group 4 isolates comprised 2-3 concentric

rings, dark gray to black in color, abundant thick acervuli

b. black in reverse

56

4.25 a. Colonies of group 5 isolates were pale gray or light to

dark gray with abundant conidial masses, small scattered

acervuli b. cream to dark gray in reverse

56

4.26 Conidia of C. truncatum (light microscope, x1000) stained

with cotton blue, Scale bar=10 μm

57

4.27 Setae of C. truncatum 57

4.28 Appressoria of C. truncatum 57

4.29 a. Colonies of F. incarnatum having white color b. beige to

pale cream coloration on the reverse side of petri dish

64

4.30 a. Colonies of F. incarnatum having white to light beige

color b. beige coloration on the reverse side of petri dish

65

4.31 Micro-conidia, meso-conidia and macro-conidia of F.

incarnatum (light microscope, x1000) stained with cotton

blue, Scale bar=10 μm

66

4.32 Monophialidic and polyphialidic conidiophores of F.

incarnatum

71

4.33 a. Purple-grey colonies of F. proliferatum b. dark purple

coloration on reverse side of PDA media

72

4.34 Conidia, of F. incarnatum (light microscope, x1000)

stained with cotton blue, Scale bar=10 μm

75

4.35 Monophialidic conidiophores of F. proliferatum b.

Polyphialidic conidiophores of F. proliferatum

75

4.36 Colonies of B. cinerea developed a. aerial mycelial masses 78

xvii

without sporulation b. aerial mycelial masses with

sporulation c. short mycelium without sporulation d. thick

and wooly mycelium e. thin sparse hyphae

4.37 Sclerotia of B. cinerea a. solitary to aggregated sclerotia b.

round sclerotia on whole petri dish c. abundant round to

irregular sclerotia on whole petri dish d. Round sclerotia

predominantly at periphery of petri dish e. Few scattered

sclerotia

79

4.38 Conidia and conidiophores of B. cinerea (light microscope,

x1000) stained with cotton blue, Scale bar=10 μm

87

4.39 a. Light to dark brown colonies of A. alternata with

appressed growth b. Dark brown colonies on the reverse

side of PDA medium

89

4.40 a. Dark brown colonies of A. alternata with appressed

growth b. Black colonies on the reverse side of PDA

medium

89

4.41 Olive brown colonies of A. alternata with velvety texture

b. light to dark brown colonies on the reverse side of PDA

medium

89

4.42 Colonies of A. alternata displayed concentric rings 90

4.43 Conidia and conidiophores of A. alternata, scale bar=10

μm

90

4.44 Conidia of A. alternata, Scale bar=10 μm 90

4.45 a. Light cream colony of F. equiseti b. beige coloration on

the reverse

95

4.46 a. Cream colony of F. equiseti b. beige coloration on the

reverse

95

4.47 a. Light brown colony of F. equiseti b. brown coloration on

the reverse

95

4.48 a. White colony of F. equiseti b. white to light cream

coloration on the reverse

96

xviii

4.49 Conidia of F. equiseti (light microscope, x1000) stained

with cotton blue, Scale bar=10 μm

97

4.50 Chlamydospores of F. equiseti (light microscope, x1000)


97

4.51 a. Creamish colony of R. solani, developed aerial sclerotia

at periphery b. creamish brown colony on the reverse side

of petri dish

103

4.52 a. Brown to creamish colony of R. solani b. creamish to

light brown colony on the reverse side of petri dish

103

4.53 a. Light brown colony of R. solani, aerial sclerotia

predominantly at periphery b. creamish brown colony on

reverse side of petri dish

103

4.54 a. Dark brown colony of R. solani, sclerotia scattered on

whole petri dish b. dark brown colony on reverse side of

petri dish

104

4.55 Colony of R. solani developed dark brown aerial sclerotia 104

4.56 Colony of R. solani developed dark brown surface sclerotia

at center of petri dish

104

4.57 Hyphae of R. solani 109

4.58 White to light cream, thin-flat colony of S. rolfsii 111

4.59 Silky-white, fluffy colony of S. rolfsii on PDA medium 111

4.60 a. Sclerotia scattered on whole petri dish b. sclerotia

scattered on periphery of petri dish

112

4.61 Hyphae of Sclerotium rolfsii 112

4.62 Symptoms of anthracnose caused by C. truncatum a.

sunken, water-soaked lesions with acervuli b. white to gray

mycelia with small dot like acervuli

119

4.63 Symptoms of Fusarium fruit rot a. white mycelial growth

surrounded by water-soaked, greenish lesions b. white

mycelial growth surrounded by water-soaked, light brown

necrotic lesions

119

xix

4.64 Symptoms of Botrytis cinerea a. water-soaked lesions b.

grayish-brown hyphae of B. cinerea covered with conidia

and conidiophores

120

4.65 Symptoms of Alternaria alternata; water-soaked, grayish-

black lesions, rotted fruit

120

4.66 Fusarium root rot caused by F. equiseti; symptoms include

leaf chlorosis, wilting and leaf dropping

120

4.67 Root rot caused by R. solani; plant top collapsed, reddish-

brown or black cankers girdle the stem

128

4.68 Root rot caused by S. rolfsii; Poor top growth and wilting

of the leaves

128

4.69 Molecular phylogeny of C. truncatum, generated from a

maximum parsimony analysis tree obtained from the

dataset containing the partial DNA sequences of ITS,

GAPDH, ACT, CHS-1, HIS3 and TUB2 genes

130

4.70 Molecular phylogeny of F. incarnatum, generated from a


dataset containing the partial DNA sequences of EF1- α

gene.

131

4.71 Molecular phylogeny of F. proliferatum, generated from

maximum parsimony analysis tree inferred from the

dataset containing the partial DNA sequences of EF1- α

gene.

132

4.72 Molecular phylogeny of F. incarnatum and F.

proliferatum, generated from a maximum parsimony

analysis tree obtained from the dataset containing the

partial DNA sequences of EF1- α gene

133

xx

4.73 Molecular phylogeny of B. cinerea, generated from a


dataset containing the partial DNA sequences of ITS gene.

135

4.74 Molecular phylogeny of B. cinerea, generated from a


dataset containing the partial DNA sequences of partial

GAPDH gene

136

4.75 Molecular phylogeny of A. alternata, generated from a


dataset containing the partial DNA sequences of beta-

tubulin gene

137

4.76 Molecular phylogeny of F. equiseti, generated from a


dataset containing the partial DNA sequences of partial

TEF gene.

138

4.77 Molecular phylogeny of R. solani, generated from a


dataset containing the partial DNA sequences of RS gene

139

4.78 Molecular phylogeny of S. rolfsii, generated from a


dataset containing the partial DNA sequences of LSU gene

140

4.79 Percent radial mycelial growth inhibition of C. truncatum

after 7 days of incubation at 25°C treated with chitosan,

salicylic acid and calcium chloride. Means showing the

same letters are not significantly different according to the

LSD (P<0.05)

141

4.80 Radial mycelial growth of C. truncatum after 7 days of

incubation at 25°C treated with chitosan (a) 0.5% (b) 1%

(c) 1.5% (d) 2% (e) 2.5%

142

xxi


incubation at 25°C treated with Salicylic acid (a) 0.5 % (b)

1% (c) 1.5 % (d) 2 % (e) 2.5 %

143


incubation at 25°C treated with calcium chloride (a) 0.5%

(b) 1% (c) 1.5% (d) 2% (e) 2.5%

143

4.83 Percent radial mycelial growth inhibition of C. truncatum

at four concentrations of trans-2-hexenal, 1-hexanol and 1-

octen-3-ol after 7 days. Means showing the same letters are

not different significantly according to the LSD (P<0.05)

144

4.84 Percent radial mycelial growth inhibition of F. equiseti at

four concentrations of trans-2-hexenal, 1-hexanol and 1-

octen-3-ol after 7 days. Means showing the same letters are

not different significantly according to the LSD (P<0.05)

144


incubation at 25°C treated with trans-2-hexenal (a) Control

(b) 10 ppm (c) 50 ppm (d) 100 ppm

145


incubation at 25°C treated with 1-hexanol (a) Control (b)

10 ppm (c) 50 ppm (d) 100 ppm

145


incubation at 25°C treated with 1-octen-3-ol (a) Control (b)

10 ppm (c) 50 ppm (d) 100 ppm

145

4.88 Radial mycelial growth of F. equiseti after 7 days of

incubation at 25°C treated with trans-2-hexenal (a) Control

(b) 10 ppm (c) 50 ppm (d) 100 ppm

146


incubation at 25°C treated with 1-hexanol (a) Control (b)

10 ppm (c) 50 ppm (d) 100 ppm

146


incubation at 25°C treated with 1-octen-3-ol (a) Control (b)

146

xxii

10 ppm (c) 50 ppm (d) 100 ppm

4.91 Percent RMGI of antagonistic fungi 147

4.92 Colonies of F. equiseti confronted with antagonistic fungi

after 7 days of incubation at 25°C

148

xxiii

List of Appendix

Appendix

No.

Page

A Location wise mean disease incidence (%) of fruit rot

diseases in greenhouses during February 2016 & 2017

175

B Location wise mean disease incidence (%) of fruit rot

diseases in open fields during May 2016 & 2017

176

C Location wise mean disease incidence (%) of root rot

diseases at seedling stage in greenhouses during

November 2015 & 2016

178

D Location wise mean disease incidence (%) of root rot

diseases at seedling stage in low plastic tunnels during

February 2016 & 2017

179

E Location wise mean disease incidence (%) of root rot

diseases at maturity stage in greenhouses during

February 2016 & 2017

181

F Location wise mean disease incidence (%) of root rot

diseases at maturity stage in open fields during May

2016 & 2017

182

G Strains of Colletotrichum used in the study 184

H ANOVA table for the data regarding in vitro bio-

control using natural compounds (Figure 4.73)

185

I ANOVA table for the data regarding in vitro bio-

control using volatile compounds against C. truncatum

(Figure 4.83)

185

J ANOVA table for the data regarding in vitro bio-

control using volatile compounds against F. equiseti

(Figure 4.84)

185

K ANOVA table for the data regarding in vitro bio-

control using antagonistic fungi (Figure 4.91)

185

xxiv

List of Abbreviations

& And

et al. And others

bp Base pair

BLAST Basic Local Alignment Search Tool

°C Centigrade

CFU Colony forming unit

CV Coefficient of variation

° Degree

DEPC Diethtylpyrocarbonate

DNA Deoxyribonucleic acid

DI Disease incidence

DSI Disease severity index

GAPDH Glyceraldehyde phosphate dehydrogenase

G3PDH Glyceraldehyde-3-phosphate dehydrogenase

g Gram

gL-1 Gram per liter

> Greater than

GLVs Green leaf volatiles

ITS Internal Transcribed Spacer

LSU Large subunit

LSD Least significant difference

≤ Less than or equal to

μL Micro Liter

mL Millilitre

mm Millimeter

mM Millimolar

Mins Minutes

xxv

MEGA Molecular evolutionary genetics analysis

ng/μL Nanogram/microliter

NCBI National Center for Biotechnological

Information

PPM Parts per million

% Percentage

pH Potential hydrogen

± Plus Minus

PCR Polymerase Chain Reaction

PDA Potato Dextrose Agar

RMG Radial mycelial growth

RMGI Radial mycelial growth inhibition

rpm Revolutions per minute

sp. Species

SDW Sterile distilled water

TEF Translation elongation factor

TE Tris EDTA

VOCs Volatile organic compounds

v/v Volume/Volume

xxvi

Acknowledgements

All praises and thanks to “Al-Mighty Allah”, the most gracious and the most

merciful, the source of knowledge and wisdom endowed to mankind, who

conferred me with the power of mind and capability. All respects are for the most

beloved “Holy Prophet “Muhammad (PBUH)”, who is forever a symbol of

direction and torch of guidance for humanity as whole.

I consider it a privilege to express my sincere and deepest gratitude to a very

hardworking, visionary supervisor, Dr. Farah Naz, Associate Professor,

Department of Plant Pathology for her insight advice, constant encouragement,

moral support, scholarly criticism and generous use of her time throughout my

doctoral program.

I wish to extend my sincere gratitude with the profound thanks to the members

of my supervisory committee, Prof. Dr. Abdul Rauf, Professor, Department of

Plant Pathology and Dr. Muhammad Azam Khan, Director Advance Studies for

their thoughtful and consistence guidance and professional expertise.

A special thanks to Dr. Gulshan Irshad, Assistant Professor and Dr. Abid

Riaz, Associate Professor, Department of Plant Pathology for their kind support

and endearment guidance during the whole study period.

I am very thankful to the Higher Education Commission Indigenous Fellowship

(PIN no. 213-55464-2AV2-003) for providing me fund to pursue my Ph.D. at

Department of Plant Pathology, PMAS-Arid Agriculture University Rawalpindi.

Financial assistance received from HEC, under IRSIP program (PIN no. IRSIP 34

Agri 15) is highly acknowledged.

I wish to express gratitude to Prof. Joan Wennstrom Bennett, Distinguished

Professor and Dr. Ning Zhang, Associate Professor, Department of Plant Biology

and Pathology, Rutgers The State University of New Jersey, USA for their

continued support, encouragement and guidance during my research work.

xxvii

I am grateful to my friends Zobia Jabeen and Alveena Mumtaz for their help

and moral support throughout the study period. I am heartily thankful to my

colleagues, Hira Manzoor, Muhammad Anwar and Salman Ghuffar for their

help and memorable company.

Sincere thanks are extended to lab fellows especially Muhammad Shahid,

Dr. Amjad Shahzad, Dr. Abdul Sattar, Dr. Muhammad Fahim Abbas,

Beenish Gul, and Kamran Aslam for their valuable help and support. I am very

thankful to Muhammad Ehsan, Lab Assistant and Arshad Mehmood, Naib Qasid

for their sincere help.

I wish to thank my sisters; Hina Tariq, Aiman Tariq, Mamoona Tariq,

brother-in-law Muhammad Waqas, Samreen Tariq, brother-in-law Usman Arif,

niece Humnah Usman, nephews Shaheer Usman and Hammad Waqas for their

love and sincere prayers throughout my studies. Lastly, I would like to express my

heart-felt gratitude and thanks to my Parents, Mr. and Mrs. Tariq Hussain for all

their deep-rooted love, moral support, encouragement and great patience. This

thesis is truly a fruit of my Parents lifelong affection and prayers.

May Allah Bless them all, Ameen.

ALIYA TARIQ

[email protected]

xxviii

ABSTRACT

Bell pepper (Capsicum annuum L.) belongs to family ‘Solanaceae’ is among

the most popular and highly profitable vegetable throughout the world. Among

various biotic constraints fruit and root rot fungal pathogens contribute the most in

reducing the bell pepper produce qualitatively and quantitatively throughout the

worldwide including Pakistan. No detailed studies prior to this work have been

conducted in Pothohar plateau, Punjab, Pakistan. Consequently, there was a dire

need to conduct a comprehensive study for documenting prevalence and incidence

of fruit and root rot diseases. Moreover, fungicides are being used extensively

against the disastrous fruit and root rot pathogens. These fungicides not only

contaminate the environment but also are health risk for human beings. During

2015-16 and 2016-17 bell pepper cropping season, extensive surveys were

conducted in 9 tehsils/territory of Attock, Chakwal, Jhelum, Rawalpindi and

Islamabad territory. A total of 8 greenhouses and 45 farmer’s fields/low plastic

tunnels were visited at seedling and maturity stage to document fungal pathogen

associated with fruit and root rot of bell pepper and their incidence.

The survey revealed four pathogens viz. Colletotrichum, Fusarium, Botrytis,

and Alternaria were found responsible for fruit rot in bell pepper. In greenhouse,

Botrytis was mainly found associated with fruit rot with 15.13 percent fruit rot

incidence (%FRI) followed by Fusarium (13.63%) and Alternaria (9.69%). In open

fields the Colletotrichum (20.73%) was mainly found associated with fruit rot,

followed by Fusarium (12.04%), Alternaria (8.92%) and Botrytis (6.73%). Three

pathogens viz. Fusarium, Rhizoctonia and Sclerotium were found associated with

root rot. At seedling stage, the mean incidence of Rhizoctonia was the maximum

(19.25%) followed by Fusarium (15.63%) and Sclerotium (4.63%) root rot. In low

plastic tunnels, the overall incidence of Fusarium was the maximum (15.98%)

followed by Rhizoctonia (14.1%) and Sclerotium (7.38%) root rot. At maturity

stage in greenhouses, the incidence of Fusarium was the maximum (9.25%)

followed by Rhizoctonia (6.22%) and Sclerotium (4.94%) root rot. However, in

open fields, the incidence of Sclerotium was the maximum (14.35%) followed by

Fusarium (8.31%) and Rhizoctonia (6.15%) root rot.

xxix

Analysis of fruit and root rot samples employing morphological

characterization, showed prevalence of 8 fungal species (Colletotrichum

truncatum, Fusarium incarnatum, Fusarium proliferatum, Botrytis cinerea,

Alternaria alternata, Fusarium equiseti, Rhizoctonia solani and Sclerotium rolfsii)

belonging to 6 genera. Phylogenetic analysis showed the genetic homology of the

subject isolates with previously submitted isolates in GenBank, confirming the

morphological characterization. Highly virulent isolates of the most prevalent

pathogen from fruit (C. truncatum isolate ACT12) and root (F. equiseti isolate

FJH15) established during the pathogenicity test were selected for in vitro bio-

control trials. Among natural compounds, chitosan was found the most effective

with 55.55% radial mycelial growth inhibition at 2.5% concentration followed by

salicylic acid (53.33%) and calcium chloride (27.77%). All the tested volatiles

completely inhibited the radial mycelial growth at 100 ppm. Out of three

Trichoderma species, T. harzianum was found the most effective with the

maximum percent RMGI of 56.1%, followed by T. viride (53.5%) and T. hamatum

(48.7%). The present study documents the fruit and root rot pathogens in Pothohar

Plateau, Punjab, Pakistan. The morpho-molecular characterization further identifies

pathogens up to specie level. The exploration of bio-control strategies in vitro will

help to develop effective management under field conditions.

1

CHAPTER 1

INTRODUCTION

Bell pepper (Capsicum annuum L.) belongs to the ‘Solanaceae’ family which

includes other highly economic important crops such as potato and tomato (Dias et

al., 2013). It is native to Mexico, Central and South America and cultivated

extensively throughout the tropics, subtropics and temperate regions (Manrique,

1993; Walsh & Hoot, 2001). It is commonly known by various names such as

vegetable paprika, capsicum, bell pepper, sweet pepper and green pepper etc. It is

commonly named as ‘Shimla Mirch’ in Pakistan (Nadeem, Anjum, Khan, Saeed, &

Riaz, 2011). In American English, it is named as ‘Bell Pepper’ or ‘Chili Pepper’. In

British English, all Capsicum species are named as ‘Peppers’. In India and

Australian English, the name ‘Capsicum’ is exclusively used for non-pungent

varieties (Grubben & Denton, 2004).

The genus Capsicum (chili and other pepper) consists of approximately 31

species (Moscone et al., 2006). Among which, Capsicum annum Linn., Capsicum

frutescens Linn., Capsicum pubescens Ruiz & Pavon., Capsicum chinese Jacq. and

Capsicum baccatum Linn. var. pendulum are domesticated worldwide and other

are wild-type species (Basu, De, & De, 2003). The C. annuum is the world’s

extensively cultivated species followed by C. frutescens (Bosland & Votava, 2003).

Commercial bell pepper fruit is of various colors; green, red, yellow, orange,

cream, brown, purple and white depending on the genotype (Jovicich, Cantliffe, &

Vansickle, 2004). Bell pepper is extremely nutritious and have an excellent source

of vitamins A, Vitamin C, Niacin, Thiamine, pyridoxal phosphate, pantothenic

acid, riboflavin, folate, phenolics, polyphenols, flavonoids, beta-carotene, folic

acid, and minerals (iron, calcium, magnesium, phosphorus, zinc and potassium

(Shotorbani, Jamei, & Heidari, 2013). All these compounds are known for their

great antioxidant activity (Nadeem et al., 2011).

In the world, the bell pepper area and production are merged with that of chili

pepper. Hence the pepper (chili pepper and bell pepper) statistics was available as a

whole in the world and Pakistan. Pepper is cultivated worldwide, and Asia is the

2

largest producer contributing 64.1 per cent of the world’s production share by

region followed by America (13.4 %), Europe (12.3%), Africa (9.9%) and Oceania

(0.2%). Aggregate production of chilies and green pepper in world is about

36092631 tonnes with total area harvested and yield is 1987059 hectare and

181638 hectogram/hectare respectively. China the major capsicum producing

country, contributing 17795349 tonnes of the world’s production share followed by

Mexico (3296875 t), Turkey (2608172 t), Indonesia (2359441 t) and Spain

(1277908 t) (FAOSTAT, 2018). In Pakistan, chilies are cultivated on an area of

65275 ha with the production of 148114 t (GOP, 2019). However, the statistical

data regarding only bell pepper area and production was not found in the literature.

Capsicum (chili and bell pepper) contributes a major share among vegetables in

Pakistan. Chili is a valuable cash crop whereas, bell pepper is usually popular

vegetable among small land holders. It was estimated that, in Punjab province the

area under bell pepper has been found higher than the land utilized in planting chili

however, in Sindh province chili cultivation was fairly dominant. In Northern parts

of Khyber Pakhtunkhwa (KPK) province bell pepper cultivation was more as

compared with chili, whereas, in Balochistan province, area under chili was

dominant over bell pepper (Hussain Shah, Fahim, Hameed, & Haque, 2009).

Chilies are cultivated on an area of 54006 ha (Sindh), 6839 ha (Punjab), 4111 ha

(Balochistan) and 319 (KPK) (GOP, 2019).

Green bell pepper is generally cultivated in open fields in summer, while

colored pepper is grown extensively in greenhouse, shade structures and high

tunnels (Elio Jovicich, VanSickle, Cantliffe, & Stoffella, 2005). In controlled

structures, the environmental conditions are modified by lowering the temperature

during the warm season and maintaining a higher temperature during winter.

Consecutively, it provide the optimal conditions for the maximum growth, vigor

with improved quality and yield for good economic return (Jovicich et al., 2004).

Bell pepper is a perishable vegetable and fruit being hollow inside limits the

shelf-life less than a week and limits export to distant markets (Maalekuu, Elkind,

Tuvia-Alkalai, Shalom, & Fallik, 2003). Disease is the major contributing factor

that reduces the shelf life of bell pepper. During long-term storage, the postharvest

3

quality of fruit is affected by various pathological factors. Among which fungal

pathogens are major damaging cause (Hardenburg, Watada, & Wang, 1990) which

results in significant yield losses and reduce the quality of fruit (Rahimi,

Aboutalebi, & Zakerin, 2013). Bell pepper crop is affected by number of diseases

incited by various fungal pathogens such as anthracnose (Colletotrichum capsici

(Synd.) Butler and Bisby), damping-off (Pythium aphanidermatum (Edson) Fitzp.),

root rot (Rhizoctonia solani Kuhn), stem rot (Sclerotium rolfsii Sacc.), fruit rot

(Phytophthora nicotianae Breda de Haan) (Yabuuchi, Kosako, Yano, Hotta, &

Nishiuchi, 1995), white mold (Fusarium solani), gray mold (Botrytis cinerea) and

black mold by Alternaria alternata (Barkai-Golan, 2001). The primary microbial

decay of bell pepper is caused by A. alternata and B. cinerea (Elazar Fallik et al.,

1999).

Fungicides are being used extensively against the disastrous root rot and fruit

rot pathogens. These fungicides contaminate the environment and also have various

harmful effects on human health such as prevalence of multi-nutritional

deficiencies, persistence of toxic residues in the ecosystem and ground water

contamination etc. Moreover, the repetitive fungicide application leads to the

appearance of new resistant pathogenic strains / races and destruction of natural

parasites and predators (Yoon, Cha, & Kim, 2013). The consumer awareness about

hazardous residual effects of these fungicides, food quality and safety has increased

the demands for the development of nonhazardous, ecofriendly alternative

strategies for effective disease management (Faoro, Maffi, Cantu, & Iriti, 2008;

Terry & Joyce, 2004).

Use of natural substances such as edible coating of fresh agricultural products

is one of the promising healthy and environmentally conscience approach (Dhall,

2013). Biodegradable edible coating of polysaccharide chitosan has also been

found promising in the management of anthracnose of various tropical fruits (Ali,

Maqbool, Ramachandran, & Alderson, 2010). It has the innate antimicrobial

activity; improving the shelf life through prevention of excessive moisture loss and

control of gas exchange (Dutta, Tripathi, Mehrotra, & Dutta, 2009). Antagonistic

fungi such as Trichoderma species have the ability to control various soil-borne

4

pathogenic fungi (Whipps & Lumsden, 2001). Similarly, volatile organic

compounds released by fungi (FVOCs) have been recognized as an efficient

biocontrol agents (Morath, Hung, & Bennett, 2012). Green Leaf Volatiles (GLVs)

belonging to family of C6 compounds play a vital role in plant defenses (Scala,

Allmann, Mirabella, Haring, & Schuurink, 2013).

Fruit and root rot diseases of bell pepper are presently, causing significant

losses in Pakistan. Although some work has been conducted on the incidence and

management of fruit and root rot diseases of bell pepper in Pakistan (Abbasi,

Ashraf, Ali, & Butt, 2015; Jabeen, Javaid, Ahmed, & Sharif, 2014; Javaid & Iqbal,

2014; Sahi & Khalid, 2007), but these studies carry limited details regarding

incidence of various casual agents of these diseases. Moreover, no studies have

been carried prior to this work in Pothohar plateau related to incidence, prevalence

and molecular characterization of the pathogens involved. Consequently, there was

a dire need to conduct a comprehensive study for documenting incidence of fruit

and root rot diseases, identification of pathogenic species employing morphological

as well as molecular tools. The development of in vitro, eco-friendly management

approaches for the most prevalent fruit and root rot pathogen. Therefore, the

present study was carried out with the following objectives;

1. Survey of bell pepper fields and greenhouses for documenting fruit and root

rot diseases in Pothohar plateau

2. Morphological and molecular characterization of pathogens isolated from

symptomatic fruits and roots of bell pepper

3. In vitro management of most prevalent pathogen through natural

compounds, volatile compounds and antagonistic fungi

5

CHAPTER 2

REVIEW OF LITERATURE

Disease is one of the crucial factor, causing significant reduction in yield and

quality of bell pepper. A wide range of pathogens are responsible for causing

infectious diseases on bell pepper crop, among which, the plant diseases caused by

fungal pathogens are highly important. Pre- and post-emergence damping-off is

caused by a number of fungi belonged to various genera including, Fusarium,

Rhizoctonia, Phythium, Phythopthora and Sclerotium. These fungi are also

responsible to cause root rot, fruit rot, collar rot, stem rot, wilting and canker etc.

Major fruit rot diseases, known to deteriorate the bell pepper fruit quality are;

anthracnose, gray mold, Alternaria fruit rot and Fusarium fruit rot.

Anthracnose is an important disease of pepper; causes considerable yield

reduction worldwide mainly in the tropical and sub-tropical regions (Than,

Prihastuti, Phoulivong, Taylor, & Hyde, 2008) It causes both pre- and postharvest

fruit rots in major producing countries. The marketable yield loss of 100% has been

reported under favorable circumstances of rainy and warm seasons (Lewis Ivey,

Nava-Diaz, & Miller, 2004). Typical symptoms on fruit develop as necrotic,

sunken lesions that coalesce later; making the fruit non-marketable. The presence

of salmon or tan colored conidia within a lesion is a source of secondary inoculum

(Roberts, 2001).

The disease occurring typically on ripened fruit and considered a ‘ripe-rot’

disease (Kim, Oh, & Yang, 1999; Kwon & Lee, 2002). The disease has also been

found on young bell pepper fruit cultivated in the State of Florida and Ohio and

contrasts with previous reports that constricts it a ripe-rot disease (Harp et al.,

2008). Various Colletotrichum species infect pepper fruit at different growth

stages. C. truncatum is widespread usually on red color ripe pepper fruits, whereas

C. gloeosporioides, C. scovillei and C. acutatum are more prevalent on immature

green pepper (Kanto et al., 2014; Than et al., 2008).

Pepper anthracnose is caused by Colletotrichum complex with up to eleven

6

species: C. truncatum (Damm, Woudenberg, Cannon, & Crous, 2009), C.

gloeosporioides (Ramdial & Rampersad, 2015), C. acutatum (Harp, Kuhn, Roberts,

& Pernezny, 2014), C. coccodes (Shin, Xu, Zhang, & Chen, 2000), C. fructicola

(Sharma & Shenoy, 2014), C. siamense (Weir, Johnston, & Damm, 2012), C.

dematium (Than et al., 2008), C. boninense (Diao, Fan, Wang, & Liu, 2013), C.

brevisporum, C. scovillei and C. cliviae (Kanto et al., 2014).

Colletotrichum truncatum was typified, formally described on Phaseolus

lunatus, and has been known to cause anthracnose disease on legume crops, pepper

and many other hosts. C. capsici taxon was synonymized with C. truncatum, based

on morphological characterization and multi-locus phylogenetic approach (Damm

et al., 2009). Regardless, all scientists are not in agreement with this viewpoint

(Hyde et al., 2009). The C. capsici typified by other researchers and causes

anthracnose on a broad host range, including legume and pepper crop (Hyde et al.,

2009; Shenoy et al., 2007). Anthracnose caused by C. truncatum is a significant

disease of bell pepper in Pakistan, infecting 40 to 72% of the fruits and causing a

significant yield reduction (Tariq et al., 2017). The pathogen was previously found

on bell pepper in Mississippi (Roy, Killebrew, & Ratnayake, 1997) and Trinidad

(Ramdial & Rampersad, 2015) and has been reported on chili pepper in many

countries of the world (Katoch, Prabhakar, & Sharma, 2016).

Fruit, crown and stem rot of commercial grown bell pepper in greenhouse was

observed in Hungary. The disease was found to be caused by Fusarium solani

having Nectria haematococca as perfect stage. The same disease was also appeared

in Ontario and British Colombia (Canada) in 1991, where the Fusarium stem and

fruit rot cause up to 50% losses (Jarvis, Khosla, & Barrie, 1994). In England the

disease caused approximately 1% losses (Fletcher, 1994). Internal fruit rot of bell

pepper was emerged as a significant disease in greenhouses of British Columbia in

2002. The seedlings (3%) germinated from seeds were covered with mycelium and

causal agent was found to be Fusarium subglutinans (Wikkebweber & Reinking)

(Utkhede & Mathur, 2003; Utkhede & Mathur, 2004). This suggests that the

pathogen may be seed-transmitted.

The internal fruit rot in Alberta was associated to be caused by Fusarium lactis

7

based on morphological and nucleotide evidence of the β-tubulin, elongation factor

and mitochondrial small sub-unit ribosomal DNA (Yang, Kharbanda, Howard, &

Mirza, 2009). The disease was subsequently found in Saskatchewan in 2006,

Ontario in 2007, Netherlands and Belgium (Frans, Aerts, Van Calenberge, Van

Herck, & Ceusters, 2016). The closely associated fungi Fusarium proliferatum,

Fusarium oxysporum and Fusarium verticillioides have been associated to cause

fruit rot of bell pepper (Utkhede & Mathur, 2003; Yang et al., 2009).

Fruit Rot of bell Pepper in Trinidad (West Indies) was caused by Fusarium

solani. Disease incidence reached 80% with an estimate yield loss of 40 to 60%

(Ramdial & Rampersad, 2010). Fusarium lactis is responsible for causing fruit rot

of pepper in Korea with estimated disease incidence of 5% of 30 tons of harvested

peppers approximately (Choi, Hong, Kim, & Lee, 2011). In open fields of the Mid-

Atlantic regions of the USA, the internal F. lactis causes the fruit rot of bell pepper

ranging between 1% to 50% depending on the cultivar (Kline & Wyenandt, 2014).

F. incarnatum (Desm.) Sacc. causing a fruit rot of bell pepper in Trinidad which

belongs to the F. incarnatum-equiseti species complex. Yield losses were estimated

to be between 20 to 40% in fields (Ramdial, Hosein, & Rampersad, 2016).

Infection initiates when spore of the pathogen enters the flower stigma via air

or insect vector (Kharbanda, Yang, Howard, & Mirza, 2006). Typically, internal

fruit rot symptoms included the appearance of whitish-gray hyphal growth on the

seeds, placenta and inner fruit wall. The external symptoms on outer surface of

fruit occur as greenish to dark brown lesions only in severe infection. The infected

fruits generally show rare or few external disease symptoms such as sunken lesions

and fruits may not be discarded before transport to market, they might be

purchased and consumed (Yang et al., 2010).

Pepper root and basal stem rot has been incited by various strains of Fusarium

oxysporum and Fusarium solani species complex (Joffe & Palti, 1972; Rahin &

Sharif, 1985). Pepper wilting was attributed to be caused by F. oxysporum f. sp.

vasinfectum (Miller, Rowe, & Riedel, 1996), F. oxysporum var. redolens (Rahin &

Sharif, 1985), F. oxysporum f. sp. capsici (Black, Green, Hartman, & Poulos,

8

1993). In Almeria (Spain) F. oxysporum f. sp. radices capsici f. sp. nov was found

to be host specific to pepper plant (Lomas-Cano et al., 2014).

Botrytis fruit rot (also called gray mold or ash mold) caused by B. cinerea

[Botryotinia fuckeliana (de Barry) Whetzel] is a significant post-harvest decay

pathogen of pepper plant (Pernezny, Roberts, Murphy, & Goldberg, 2003). It

causes blight and rot of leaves, flowers and fruits of pepper (Domsch, Gams, &

Anderson, 1980). In capsicum fruit gray mold causes high postharvest losses (20 to

25%) (Fallik, Grinberg, Lomaniec, Lurie, & Lalazar, 1993). The infected tissues

are brown-gray, water-soaking of parenchyma tissues and covers the decayed tissue

with gray-brown conidia and conidiophores with small black sclerotia (Williamson,

Tudzynski, Tudzynski, & van Kan, 2007). Gray mold infection might occur

anywhere on stem-end and blossom-end of the fruit (Snowdon, 1990).

Gray mold on young pepper seedling cause damping-off with water-soaked,

tan-brown lesions near the soil line. Older lesions are girdle with thick, gray-brown

conidia and conidiophores and eventually cause sudden collapse of plant. Under

cool and wet conditions, gray-tan powdery spores frequently appear on dead plant

tissues (Akbudak, Tezcan, Akbudak, & Seniz, 2006). B. cinerea can cause

infection at many developmental stages during flowering, early or mature stages of

fruit development, even seedlings. Following the infection of flowers, B. cinerea

remains latent for long periods until environmental conditions are favorable during

the ripening process, initiates physiochemical and biochemical changes that leading

to fruit rot (Droby & Lichter, 2007).

Black mold of pepper is caused by Alternaria alternata and it infects wide

range of crops worldwide (Snowdon, 1990). The fungus has been reported to cause

allergies, respiratory disorders and also contributes a significant portion of the

aerospora (Green, Mitakakis, & Tovey, 2003). The fungus is of polyphagous nature

and produces toxic metabolites of carcinogenic and teratogenic properties (Woody

& Chu, 1992). The fungus causes fruit rot, black spots on fruit, internal mold of

fruit and blossom end rot. Following infection of flowers via the stigma and the

style, the fungus develops compact masses of hyphae and conidia on seed surface

(Halfon-Meiri & Rylski, 1983). A study was carried out to document fungi causing

9

fruit rot and dieback of chilli in Faisalabad. Among the fungi isolated, 4 were

proved to be pathogenic including C. capsici, C. lunata, F. oxysporum and A.

alternata (Khaleeque & Khan, 1991). In a study carried out on fruit rot of chillies

in Pakistan; A. tenuissima was documented as the causal agent. The pathogen

caused 100% and 55% infection on injured and uninjured fruit respectively at 20-

30°C (Kamal & Tahir-ud-din, 1970).

Damping-off is an important yield constrains that causes the death of

germinating seeds and young seedlings both in fields and nurseries. The most

frequently associated pathogens with damping-off are Fusarium sp., Pythium sp.,

Phytophthora sp. and Rhizoctonia sp. (Lamichhane et al., 2017). Pre-emergence

damping-off occur prior to seed germination; seeds soften, rotted and fail to

germinate. The germinating stems are also affected, and water-soaked lesions

developed at or below the soil line. The lesions later become darken, brown,

reddish-brown or black and quickly girdles the tender and young stems with the

progression of the disease (Landis, 2013). In post-emergence damping-off, the

seedlings wilt and rot after emergence resulting in the decay and death of the

seedlings (Horst, 2013).

In pepper, R. solani mainly cause hypocotyl rot and root rot. The fungus also

infects leaf and fruit near or on the soil line. The most common symptoms are

reddish-brown lesion on stems and roots. The pathogen is active in cool and moist

soils and survive as sclerotia in soil for many years (Vásquez, Tlapal, Yáñez, Pérez,

& Quintos, 2009). AG-4 is the key AG worldwide, associated to cause root rot in

pepper (Mikhail, Sabet, Omar, Asran, & Kasem, 2010). AG-3 is the major agent

causing damping-off disease in directly seeded Capsicum. Additionally, AG-1 also

has been documented from pepper (Bolkan & Ribeiro, 1985). In Turkey, strains of

AG-4, AG-2 type-1, AG-8 as well as binucleate Rhizoctonia sp. (AG-F, AG-A)

have been reported on pepper (Demirci & Doken, 1995; Tuncer & Erdiller, 1990).

Damping-off caused by Pythium species accounting more than 60% death of

seedlings both in main field and nursery (Manoranjitham, Prakasam, Rajappan, &

Amutha, 2000). P. aphanidermatum is associated with pre- and post-emergence

damping-off (Sutton et al., 2006). Affected plants shows the symptoms of stunted

10

growth, leaf chlorosis, leaf dropping and sudden wilting. P. myriotylum and P.

aphanidermatum are reported to cause root rot in the southeastern USA (Chellemi,

Mitchell, Kannwischer-Mitchell, Rayside, & Rosskopf, 2000). P. aphanidermatum

was reported on C. annuum in Australia (Stirling, Eden, & Ashley, 2004), Northern

Italy (Garibaldi, Gilardi, Ortu, & Gullino, 2014) and southeast Spain (de Cara,

Pérez-Hernández, Aguilera-Lirola, & Gómez-Vázquez, 2017).

The oomycete P. capsici Leonian, is the most destructive soil-borne pathogen

on peppers around the world (Hwang & Kim, 1995; Ristaino & Johnston, 1999).

The pathogen causes damping-off, root, crown or fruit rots, stem and leaf blight

depending on the plant stage and can infect all plant parts (Hausbeck & Lamour,

2004). The pathogen dispersed via surface water, water splashing within the soil

and has both sexual and asexual life cycle (Ristaino, Larkin, & Campbell, 1993). P.

capsici survives in soil by means of oospores and also infect roots by producing

motile zoospores. Phytopthora infection and zoospore production peaks during wet

and temperatures between 27 and 32°C (Gevens, Roberts, McGovern, & Kucharek,

2008).

Sclerotium rolfsii is a soil borne fungal pathogen that associated to cause white

mold, southern blight and stem rot. On global perspective, estimated yield loss of

1-60% and 10-20 million dollars have been linked with S. rolfsii (Kator, Hosea, &

Oche, 2015). The disease favors in moist conditions and temperature above 29°C.

Affected plants may emerged singly or grouped in circular patches with early

symptoms appeared as water-soaked spots on crown part and lower stem at or near

the soil line. Diseased foliage turns pale green, chlorosis and wilting and sudden

death. A dense whitish fungal hypha appeared on the crown and lower stem. The

dark brown sclerotia were later produced and serve as inoculums for the next crop

(Remesal, Lucena, Azpilicueta, Landa, & Navas-Cortés, 2010; Xie & Vallad,

2016).

Various negative effects of fungicides have been attributed to their persistent

application (Kookana, Baskaran, & Naidu, 1998). One such environmentally

conscience approach is the edible coating of fresh agricultural products through the

use of natural substances (Dhall, 2013). Chitosan is a ‘crustacean derived plant

11

defense booster’. The polysaccharide is composed of 2-amino-2 deoxy–β-D–

glucosamine. The chitosan is derived from chitin and the primary unit in the chitin

polymer is 2-deoxy-2-acetylamino glucose (Muzzarelli et al., 1986). Chitosan

inhibits with negatively charged molecules of the fungal cell, initiates leakage of

proteinaceous compounds and intracellular electrolytes (Leuba & Stossel, 1986).

The interaction between chitosan and fungi inhibits mRNA and protein synthesis

(Hadwiger, 1999). Application of chitosan coatings induce resistance against

several postharvest pathogens (Benhamou, 1996). Antifungal properties of chitosan

is well-known against various postharvest pathogens (El Ghaouth, Arul, Grenier, &

Asselin, 1992).

Use of volatile organic compounds (VOCs) is among the promising approaches

for biological control of disease (Herrmann, 2010). These are carbon containing

low molecular weight compounds, capable of converting to the gaseous state and

evaporate easily at normal temperature and pressure. Exposure and contact to high

concentrations of volatile such as formaldehyde, benzene, toluene, xylene and

methylene chloride, are ascertained to have harmful effects on human health (Plog,

Niland, & Quinlan, 1996).

Green leaf volatiles (GLVs) contain family of C6 compounds formed from

linolenic or linoleic acids. They are released by plants after tissue damage with the

distinctive fragrance of grass clipping. These GLVs derive from the hydroperoxide

lyase chain of the oxylipin pathway (Matsui, 2006). Aromatic oxylipins as well as

many of volatile compounds were found in essential oils of herbs and spices, in

fruit and vegetables. They are biologically active against various fungi (Tripathi &

Dubey, 2004). (E)-2-hexenal and 1-hexanol have been checked for their anti-

fungal activity against number of postharvest fungal pathogens (Corbo, Lanciotti,

Gardini, Sinigaglia, & Guerzoni, 2000; Cruz et al., 2012; De Lucca, Carter-

Wientjes, Boue, & Bhatnagar, 2011; Gardini, Lanciotti, & Guerzoni, 2001; Neri,

Mari, & Brigati, 2006).

C8 compounds isolated from molds and mushrooms are the most common

oxylipins. The most common reported volatile from fungi is 1-octen-3-ol, also

called as “mushroom alcohol,” or “matsutake alcohol”. It was first found from

12

Tricholoma matsutake mushroom (Wood & Fesler, 1986). It is synthesized via

enzymatic oxidation and linoleic acid cleavage through hydroperoxide lyase and

lipoxygenase and autoxidation of linoleic acid (Combet, Henderson, Eastwood, &

Burton, 2006). 1-Octen-3-ol is a fungal VOCs produced by various fungi

(Fusarium, Aspergillus, Stachybotrys, Penicillium, etc.) and frequently found in

water damaged buildings (Korpi, Järnberg, & Pasanen, 2009; Moularat, Robine,

Ramalho, & Oturan, 2008).

Trichoderma is another excellent eco-friendly, bio-control agent which

produces abundant spores on many substrates. It is a filamentous, free living fungi

and reproduced asexually and has a wide host range and easy growth pattern

(Whipps & Lumsden, 2001). It is an avirulent plant symbiont which kills various

soil borne pathogens through mycoparasitism. It is also a prolific producer of

antifungal compounds, antibiotics, enzymes and secondary metabolites. In vitro

association between C. capsici (isolated from pepper) and T. harzianum displayed

that colony diameter of C. capsici significantly reduced as compared to the control.

The percent radial growth inhibition ranges 44-48.71% (Ekefan, Jama, & Gowen,

2009).

The volatile compounds produced form Trichoderma harzianum, Trichoderma

viride, Trichoderma saturnisporum, Trichoderma reesei showed 30-67% inhibition

of C. capsici isolated from Capsicum frutescence. However, culture filtrate or non-

volatile compounds from T. harzianum, T. reesei and T. saturnisporum inhibits C.

capsici by 21-68%. T. viride at the concentration of 3-4% completely inhibit

mycelial growth (Ajith & Lakshmidevi, 2010). Similarly, both of T. viride and T.

harzianum showed high in vitro antifungal activity against Fusarium solani,

Macrophomina phaseolina and Rhizoctonia solani, and inhibited their radial

mycelial growth by 80-87% (Madbouly & Abdelbacki, 2017).

13

CHAPTER 3

MATERIALS AND METHODS

In the present studies, laboratory work, including isolations, morphological

characterization, preservation, pathogenicity tests and in vitro bio-control through

chitosan and antagonistic fungi were performed at the Fungal Plant Pathology

Laboratory, Department of Plant Pathology, PMAS-Arid Agriculture University

Rawalpindi, Pakistan. Field work was undertaken in bell pepper production fields in

Pothohar Plateau during 2015-16 and 2016-17 crop season. Molecular

characterization and in vitro bio-control through volatile compounds was conducted at

Department of Plant Biology and Pathology, Rutgers, The State University of New

Jersey, USA.

3.1 SURVEY FOR THE FRUIT AND ROOT ROT PATHOGENS

In the present study, farmer’s fields/greenhouses/low plastic tunnels of bell pepper

were surveyed during 2015-16 and 2016-17 for the assessment of prevalence and

incidence and collection of diseased samples. Samples showing typical symptoms of

fruit and root rot were collected after intensive fields inspection in Pothohar Plateau,

which includes Rawalpindi division (Rawalpindi, Chakwal, Jhelum and Attock

district) and Islamabad territory (Figure 3.1). A total of nine tehsils/territory were

visited.

In greenhouse cultivation a total of 8 greenhouses were visited. In open field

cultivation, 5 fields from each tehsil/territory were visited and a total of 45 fields were

surveyed. Survey was carried out twice in greenhouses/low plastic tunnels/open fields

at both seedling and maturity stage. The same number of 8 greenhouses and 45 fields

were visited at both stages (seedling and maturity) and cropping years (2015-16 and

2016-17) (Table 3.1).

For root rot diseases positive/symptomatic sampling (chlorosis, wilting, fallen

seedlings) was done twice; first at seedling stage and second at fruiting

stage/maturity. 30-40 days old seedlings were inspected and sampled during

November 2015 and 2016 in green house and February 2016 and 2017 in low plastic

14

Figure 3.1: Map showing the localities of study area

15

Table 3.1: The localities of tehsils of district Rawalpindi, Chakwal, Attock and

Islamabad territory surveyed for incidence and prevalence of root rot and fruit rot

pathogens of bell pepper.

District/

Territory

Tehsil/

Territory

Localities visited

Greenhouses Open fields

Rawalpindi Rawalpindi Adyala, Dhoke Budhal Adyala, Dhoke Budhal,

Chauntra, Chakri, Chak

Beli Khan

Taxila Taxila Taxila, Wah

Gujar Khan Jatli Jatli, Sukho, Daultala

Chakwal Chakwal Bhoun, Thoa Bahdar Bhoun, Dhudial, Dab,

Thoa Bahdar

Kallar Kahar Miani, Buchal Kalan

Choa Saidan

Shah

Dalelpur, Dulmial

Jhelum Sohawa Sohawa, Domeli

Attock Fateh Jang Bahter, Hasan Abdal

Islamabad Islamabad Chak Shehzad, Rawat Chak Shehzad, Rawat

tunnels. The seedling planted in low plastic tunnels were later transplanted in open

fields.

The survey and sampling of fruit rot diseases was done at maturity stage in green

house in February 2016 and 2017. In open fields, along with fruit rot diseases, survey

and sampling of root rot diseases was also carried out in May 2016 and 2017. The

same farmer fields/greenhouses/low plastic tunnels were surveyed during both years.

The disease incidence and prevalence were recorded to assess fruit and root rot

disease distribution in surveyed localities. For fruit rot diseases sampling was done in

×+ manner. Percentage prevalence and incidence of disease was calculated following

the given formula;

16

Disease prevalence (%) = Locations displayed root/fruit rot symptoms x 100

Total no. of locations visited

Disease Incidence (%) = ____No. of infected fruits/roots ____ x 100

Total no. of fruits/roots observed

From surveyed fields symptomatic/diseased samples were collected carefully. A

total of 360 samples were collected during 2015-16 and 2016-17. At seedling stage, a

total of 32 samples were collected from greenhouse and 95 samples were collected

from low plastic tunnels. At maturity stage, a total of 63 samples were collected from

greenhouses and 170 from open fields. The samples were properly labeled and time,

date, location was indicated and placed in sterile paper bags. Samples were brought

back to the lab. for the isolation of their respective causal pathogen. All samples were

carefully examined and typical symptoms were noted following pepper diseases

compendium (Roberts, Murphy, & Pernezny, 2003).

3.2 ISOLATION AND PURIFICATION OF PATHOGENS

The diseased fruit/root of bell pepper were rinsed under tap water for removal of

dirt and other contaminants, dried completely over sterile filter paper. The

symptomatic portions of fruit/root were cut into 5 to 10 mm2 pieces and tissues were

surface sterilized by dipping in sodium hypochlorite (1% NaCLO) for 1-2 mins,

dipped thrice in sterile distilled water (SDW) and blotted dry under several folds of

filter paper. After that the sterilized tissues were plated on petri dish (90 mm)

containing 9 mL potato dextrose agar (Lab M). The petri plates were incubated in a

growth chamber at 25 ± 2°C for 4-5 days for the growth of fruit/root rot fungi. The

cultures were purified by taking agar plug from actively growing colony edge and

placed on PDA plates. The plates were incubated for 7-10 days at 25 ± 2 ºC. The

whole procedure was performed in aseptic conditions under laminar airflow chamber.

3.3 PRESERVATION OF FUNGI

Pure fungal cultures were maintained on silica gel for long term preservation.

Vials were 1/3 filled with sterilized beads of silica gel. Conidial suspension was

prepared in cold skimmed milk (5% w:v). The vials with silica gel beads were chilled

before use and 100 µL of conidial suspension was added in it. Vials were incubated in

17

a growth chamber at 25 ± 2°C for 10 days. When silica gel beads crystallized, and

fungal growth was observed, bottles were stored at 4°C (Perkins, 1962). For the

revival of cultures few granules of silica gel were sprinkled onto fresh PDA and

incubated for 7 days at 25±2°C. The remaining beads were resealed and stored at 4°C.

3.4 CULTURAL/MICROSCOPIC CHARACTERISTICS

The isolated fruit/ root rot causing pathogens were characterized on the basis of

cultural, microscopic studies and compared with taxonomic keys documented in

literature for respective fungi. Colony characters of mature colony grown on PDA for

7 days at 25±2 ºC with alternate light and dark cycles were chosen for cultural studies.

The colony diameter was averaged by taking three measurements at right angle and

diagonal. The colony color, reverse color, texture, topography, margin of colony,

hyphal characteristics and resting structures (sclerotia) were visually studied. Conidia

were taken, mixed thoroughly in in a drop of lactophenol blue stain and examined

under high power microscope (Nikon YS 100). The microscopic characters viz. spore

color, shape, dimension (length × width), number of septations, hyphal dimensions

were noted. The mean and standard deviation data for radial mycelial growth and

conidial dimensions was analyzed statistically using SPSS statistical software 16.020.

3.5 PATHOGENICITY TEST

For pathogenicity test, yolo wonder variety was used, that was widely planted by

growers at the time of survey (Figure 3.2). Pathogenicity tests for fruit rot pathogens

were performed on young, healthy bell pepper fruit. Prior to inoculation fruits were

rinsed with SDW, dipped in 1% NaCLO for 1 min. and washed in SDW three times.

Seven days old, pure culture grown on PDA was used for pathogenicity test. In each

petri dish 7 mL SDW was added. Conidia were harvested by scraping 7-days old pure

cultures with sterile glass rod. The spore suspension was filtered, and final

concentration was adjusted with hemocytometer (Table 3.2). Three fruits per isolate

was inoculated with 20 µL spore suspension and applied as a droplet. Three control

fruits per isolate was treated with same volume of SDW. All inoculated and control

fruits were kept in plastic containers and incubated at 25 ± 2°C in a growth chamber

for 7-10 days and 60-70% moisture.

To determine pathogenicity for root rot pathogens potting mixture consisting of

18

Figure 3.2: Bell pepper seedlings of yolo wonder variety for pathogenicity test

Table 3.2: Inoculums potential of fungal spores used for the pathogenicity test

Fungal Genera Inoculums Potential Reference

Alternaria 2×105 cfu’s/ml (Halfon-Meiri & Rylski, 1983)

Colletotrichum 1×106 cfu’s/ml (Ramdial & Rampersad, 2015)

Fusarium 1×106 cfu’s/ml (Ramdial & Rampersad, 2010)

Botrytis 1×106 cfu’s/ml

(Le, McDonald, Scott, & Able,

2013)

soil, sand and manure (1:1:1) was fumigated with formalin (37%) and covered with

sheet of polyethylene for 48 h. The potting mixture was air dried for 3-4 days till the

formalin volatilized (Naz, Rauf, Abbasi, Haque, & Ahmad, 2008). For root rot

pathogen (Fusarium equiseti), 4-week old bell pepper seedlings (3 seedlings for each

isolate) of yolo wonder variety was inoculated by root drenching using 20 mL

conidial suspension (Table 3.2). For Rhizoctonia and Sclerotium isolates, inoculum

was colonized on wheat grains for 14 days. Three days prior to transplantation 10-12

seeds mixed in the upper 2 cm fumigated soil layer. Additional three bell pepper

seedlings per isolate were included without inoculation (10-12 healthy wheat seeds),

served as control. The control and treated seedlings were maintained in a growth

chamber for 15 days at 22-30°C day temperature, 20-22ºC night temperature and 60-

70% moisture.

19

The disease severity for anthracnose (Table 3.3), Fusarium and gray mold (Table

3.4), Alternaria fruit rot (Table 3.5), Fusarium root rot (Table 3.6), Rhizoctonia root

rot (Table 3.7) and Sclerotium root rot (Table 3.8) was determined according to the

development of 0-5 visual disease ratings scale or following the disease rating scale of

reference authors with slight modifications in symptoms observed. DSI (%) was

calculated by the formula given below:

DSI (%) = 0(n1) + 1(n2) + 2(n3) + 3(n4) + 4(n5) + 5(n6) × 100

N 5

Where,

n1 = number of fruits/plants in 0 score






N = Total number of fruits/plants observed.

Based on disease severity index value, isolates were grouped as highly virulent

(DSI=100%), moderately virulent (DSI>50%), and low virulent (DSI≤50%). The

highly virulent isolates were chosen for molecular characterization.

Table 3.3: Disease rating scale (0-5) for Anthracnose disease (Dasgupta, 1981)

Disease Score Symptoms Detail

0 No visible lesions

1 1–2% of the fruit area surrounded with water-soaked, necrotic

lesions

2 >3–5% of the fruit area surrounded with water-soaked, necrotic

sunken lesions, acervuli may be present


sunken lesions, acervuli present


sunken lesions, acervuli present

5 >25% of the fruit area surrounded with water-soaked, necrotic

sunken lesions, abundant acervuli, fruit rotted

20

Table 3.4: Disease rating scale for Fusarium and Botrytis fruit rot



1 1-2% of the fruit area surrounded with water-soaked, discoloured

necrotic lesions, without visible fungal outgrowth

2 >3-5% of the fruit area surrounded with water-soaked,

discoloured necrotic lesions, with visible fungal outgrowth

3 >6–15% of the fruit area surrounded with water-soaked,

discolored necrotic lesions, with visible fungal outgrowth

4 >16–25% of the fruit area surrounded with water-soaked,

discoloured necrotic lesions, with visible fungal outgrowth,

rotting

5 >25% of the fruit area surrounded with water-soaked,

discoloured necrotic lesions, with visible fungal outgrowth,

rotting and leakage of fruit

Table 3.5: Disease rating scale for Alternaria fruit rot



1 1-2% of the fruit area covered with velvety black lesions

2 >3-5% of the fruit area covered with velvety black lesions

3 >6-15% of the fruit area covered with velvety black lesions

4 >16-25% of the fruit area covered with velvety black lesions,

misshapen fruit, rotting

5 >25% of the fruit area covered with velvety black lesions, rotting

21

Table 3.6: Disease rating scale for Fusarium root rot (Cerkauskas, 2017)


0 No disease symptoms

1 Minor stunting, light plant discoloration, wilting and drooping

of a few leaves

2 Evident stunting, wilting/drooping of a few leaves, chlorosis

and some necrosis

3 Obvious stunting, extreme wilting/drooping of foliage, followed

by chlorosis and some necrosis

4 Extreme stunting, extreme wilting/drooping of foliage, followed

by chlorosis and necrosis, and external discoloration

5 Death of plant, 100% rotted

Table 3.7: Disease rating scale for Rhizoctonia root rot (van Schoonhoven, 1987)


0 No disease symptoms

1 Light plant discoloration, slight wilting affecting 10% root

tissues

2 Reddish brown to black dry necrotic lesions, wilting, rotting

affecting 25% root tissues

3 Reddish brown to black superficial, dry necrotic lesions,

extreme wilting, girdling of stem, rotting affecting 50% roots

tissues

4 Root blackened, roots misshapen, plant tops collapsed, rotting

affecting 75% roots tissues


22

Table 3.8: Disease rating scale for Sclerotium root rot (Le, Mendes, Kruijt, &

Raaijmakers, 2012)


0 No visual disease symptoms

1 Symptoms without visible fungal outgrowth, slight wilting

2 Symptoms with visible fungal outgrowth, partial wilting, rotting

affecting 25% root tissues

3 Extensive wilting of the plant, drooping of whole plant to

ground, rotting affecting 50% root tissues

4 Complete wilting of the plant, drooping of whole plant to

ground, rotting affecting 75% root tissues


3.6 GENOMIC DNA EXTRACTION

DNA of pure fungal cultures was extracted by harvesting mycelia from colonies

grown on PDA plates for 7 days at 25±2°C. The fungal mycelia were crushed with

liquid nitrogen and transferred in a sterile microcentrifuge tube containing 1000 µL

extraction buffer and 500 µL phenol chloroform isoamyl-alcohol (Raeder & Broda,

1985). The vials were centrifuged at 10000 rpm for 10 min. The obtained supernatant

was collected in a new nuclease free sterile microcentrifuge tube (1.5 mL). The

isopropanol (500 µL) and sodium acetate (50µL) was mixed in vials and then placed

in a centrifuge at 10,000 rpm for 10 min. The DNA pellet was washed with 500µL of

ethanol (70%), followed by centrifugation at 10,000 rpm for 10 min. The pellet was

air-dried and re-suspended in 100µL TE buffer.

3.7 PCR AMPLIFICATION, SEQUENCING & PHYLOGENETIC ANALYSIS

The PCR was performed using universal and specific primers (Table 3.9). PCR

mixture comprised of 1 μL DNA (50 ng/μL), ddH2O (9.5 µL), 12.5 μL of 2 × PCR

MasterMix (New England BioLabs, Maine). PCR was carried in a C1000 TouchTM

thermal cycler (Bio-Rad Laboratories) using cycling conditions as described by

reference authors (Table 3.9).

23

The amplified product of PCR was purified using ExoSAP-IT (Affymetrix,

California) and sequenced in both directions by Genscript Inc. (Piscataway, New

Jersey) with the same PCR primers. Sequences of the partial forward and reverse

regions were aligned with MUSCLE (Edgar, 2004). The representative isolates of

present study as well as reference sequences from GenBank based on high similarity

index were selected for phylogenetic analysis. Maximum parsimony tree was

generated with MEGA 7 (Felsenstein, 1985; Nei & Kumar, 2000).

3.8 IN VITRO MANAGEMENT OF HIGHLY PREVALENT FRUIT ROT

PATHOGEN WITH NATURAL COMPOUNDS

The in vitro efficacy of natural compounds viz. chitosan, salicylic acid and

calcium chloride was evaluated against highly virulent isolate of Colletotrichum

truncatum (ACT12) using poisoned food technique (Naz et al. 2006). PDA medium

was amended with five concentrations each of natural compounds (Sigma Aldrich)

viz. chitosan (0.5%, 1.0%, 1.5 %, 2.0%, 2.5%), salicylic acid (0.138 gL-1) (0.5%, 1%,

1.5%, 2%, 2.5%) and calcium chloride (0.5%, 1.0%, 1.5 %, 2.0%, 2.5%). The control

plates were inoculated only with pathogen. Chitosan solution was prepared by

dissolving chitosan powder (2 g) in distilled water (100 mL) containing acetic acid

(0.5 ml v/v). The solution was agitated constantly on hotplate magnetic stirrer at 40

°C. The chitosan solution was sterilized for 15 min and pH was adjusted to 5.6 using 1

N NaOH. This stock solution was used to prepare different concentrations of chitosan.

The natural compounds amended plates and control plates were inoculated with

pathogen and incubated at 25±2 ºC. Each treatment was replicated six times. The

colony diameter was monitored daily and then final data (% RMGI) was noted after 7

days (Tiru, Muleta, Bercha, & Adugna, 2013). The data was analyzed statistically

following a completely randomized factorial design using SPSS software 16.020.

Means were separated using LSD test at p≤0.05.

3.9 IN VITRO MANAGEMENT OF HIGHLY PREVALENT FRUIT AND

ROOT ROT PATHOGEN WITH VOLATILE COMPOUNDS

Highly virulent isolate of Fusarium equiseti (FJH15) and Colletotrichum

truncatum (ACT12) was grown on PDA and incubated at 25±2ºC. I plates (100 × 15

mm) were used and one half of the plate contained PDA (10 mL) and other half

contained a sterile glass cover slip (22 mm × 22 mm). Mycelial plugs were taken from

24

7 days actively growing colony and placed onto PDA medium in one half of the I

plates. Liquid aliquots of the volatiles being tested was placed on a sterile glass cover

slip in another half. The amount of each volatile was calculated according to the

density and volume of the container. The volatiles tested were trans-2-hexenal (0.846

g/mL), 1-octen-3-ol (0.83 g/mL) and 1-hexanol (0.82 g/mL) having the concentrations

of 10, 50 and 100 ppm. In control petri plates drop of distilled water was placed on

sterile glass cover slip. Inoculated and control plates were sealed with two layers of

parafilm and incubated at 25°C. The colony diameter was monitored daily and then

final data (% RMGI) was noted after 7 days (Tiru, Muleta, Bercha, & Adugna, 2013).

All treatments were replicated six times. The data was analyzed statistically following

a completely randomized factorial design using SPSS software 16.020. Means were

separated using LSD test at p≤0.05.

3.10 IN VITRO MANAGEMENT OF ROOT ROT PATHOGEN WITH

ANTAGNOSTIC FUNGI

Three Trichoderma species, viz. T. harzianum, T. viride and T. hamatum were

tested employing dual culture technique against highly virulent isolate of F. equiseti

(FJH15). The culture was grown on PDA. Agar discs of 6mm in diameter were taken

from one week old culture of the pathogen or antagonistic fungi and placed 2cm apart

from opposite edges of the petri dish. Both discs were 5 cm apart from each other. In

control treatment, the sterile PDA disc of 6 mm was placed in petri dish instead of

Trichoderma species. The colony diameter was monitored daily and then final data

(% RMGI) was noted after 7 days (Tiru, Muleta, Bercha, & Adugna, 2013). Each

treatment was replicated six times. The data regarding inhibition of percent radial

mycelial growth was analyzed statistically following a completely randomized

factorial design using SPSS software 16.020. Means were separated using Fisher’s

LSD test at p≤0.05.

25

Table 3.9: Primers used in PCR amplification and sequencing

Locus Primer name Sequence Product

size (bp)

Used in Organism

group

Reference

5.8S nrRNA gene with the

two flanking internal

transcribed spacers (ITS)

ITS1

TCCGTAGGTGAACCTGCGG

650-700 Colletotrichum,

Botrytis

(White, Bruns, Lee, & Taylor,

1990)

ITS4 TCCTCCGCTTATTGATATGC

Partial actin gene (ACT)

ACT-512_F

ATGTGCAAGGCCGGTTTCGC

316

Colletotrichum (Carbone & Kohn, 1999)

ACT-512_R

TACGAGTCCTTCTGGCCCAT

Partial glyceraldehyde-3-

phosphate dehydrogenase

gene (GAPDH)

GAPDH_F

GCCGTCAACGACCCCTTCATTGA

308 Colletotrichum (Guerber, Liu, Correll, &

Johnston, 2003)

GAPDH_R GGGTGGAGTCGTACTTGAGCATGT

Chitin synthase 1 (CHS-1)

CHS-79F

TGGGGCAAGGATGCTTGGAAGAAG

300 Colletotrichum (Carbone & Kohn, 1999)

CHS-354R

TGGAAGAACCATCTGTGAGAGTTG

Histone3 (HIS3)

CYLH3F

AGGTCCACTGGTGGCAAG

412 Colletotrichum (Crous, Groenewald, Risède,

Simoneau, & Hywel-Jones,

2004) CYLH3R

AGCTGGATGTCCTTGGACTG

26

Beta-tubulin (TUB2)

T1 AACATGCGTGAGATTGTAAGT 716 Colletotrichum

Alternaria

(O'Donnell & Cigelnik, 1997)

T2

TAGTGACCCTTGGCCCAGTTG

Partial glyceraldehyde-3-

phosphate dehydrogenase

gene (G3PDH)

G3PDH_F

ATTGACATCGTCGCTGTCAACGA

886 Botrytis (Staats, van Baarlen, & van

Kan, 2004)

G3PDH_R ACCCCACTCGTTGTCGTACCA

Partial translation

elongation factor 1-alpha

gene (TEF)

EF-1

ATGGGTAAGGARGACAAGAC 700 Fusarium (O'Donnell, Cigelnik, &

Nirenberg, 1998)

EF-2 GGARGTACCAGTSATCATGTT

LSU D1/D2 LROR

ACCCGCTGAACTTAAGC 800-1300 Sclerotium (Vilgalys & Hester, 1990)

LR5 TCCTGA GGGAAACTTCG

RS RS1

CCTGTGCACCTGTGAGACAG 475-550 Rhizoctonia (Camporota, Soulas, & Perrin,

2000)

RS4 TGTCCAAGTCAATGGACTAT

27

CHAPTER 4

RESULTS AND DISCUSSION

4.1 PREVALENCE AND INCIDENCE OF FRUIT ROT DISEASES

During the month of February in 2016 and 2017, prevalence and incidence of fruit

rot diseases in greenhouses was calculated for each visited locality as shown in

Appendix A.

4.1.1 Prevalence and Incidence of Fruit Rot Diseases in Greenhouses

Three diseases viz. Fusarium fruit rot (internal fruit rot), Botrytis fruit rot (gray

mold) and Alternaria fruit rot (black mold) was found responsible for fruit rot disease

in bell pepper. Their prevalence was found 100%. However, the overall mean

incidence of Botrytis fruit rot was found the maximum (15.13%) followed by

Fusarium fruit rot (13.63%) and Alternaria fruit rot (9.69%) in greenhouse cultivated

bell pepper as shown in figure 4.1.

Figure 4.1: Percent mean disease incidence of various fruit rot diseases in

greenhouses during February 2016 and 2017.

The rotting symptoms caused by three pathogens were distinctive upon the bell

pepper fruit. Symptoms caused by Fusarium on outer surface of fruit appeared as

discolored, greenish to light brown, water-soaked lesions covered with a white-light

28

gray mold more common upon calyx (Figure 4.2a). Typically, Fusarium fruit rot

symptoms included the appearance of whitish-gray hyphal growth on seeds, placenta

and inner fruit wall (Figure 4.2b). Infected fruits generally show external disease

symptoms generally after severe infection inside the fruit.

Botrytis fruit rot symptoms appeared as water-soaked spots that enlarge rapidly

into yellowish-brown or grayish-brown lesions with soft and spongy in texture

(Figure 4.3a). Decayed tissues were covered with gray-brown conidia and

conidiophores occasionally with small black sclerotia (Figure 4.3b).

The Alternaria fruit rot appeared as sunken, circular to irregular lesions covered

with black spores (Figure 4.4a). The infected tissue is brown, becomes water-

soaked, soft and shriveled. The fungus developed compact masses of mycelia and

conidia on seeds, placenta and inner fruit wall (Figure 4.4b).

Figure 4.2: Fusarium mold symptoms; a. Water-soaked lesions with a white-light

gray mold b. whitish-gray hyphal growth on the seeds

Figure 4.3: Gray mold symptoms; a. Water-soaked spots, yellowish-brown or grayish-

brown lesions b. gray brown conidia and conidiophores

29

Figure 4.4: Black mold symptoms; a. Circular to irregular, sunken lesions covered

with black spores b. fungal growth on seeds and inner fruit wall

The significant variation in mean incidence was observed at various localities

(Table 4.1). Based upon two years mean data (Figure 4.5), the highest mean incidence

of Fusarium fruit rot was recorded in tehsil Chakwal (18.3%), followed by Gujar

Khan (15%) and Rawalpindi (12.3%). Whereas, the lowest incidence was recorded in

Islamabad (10.5%). The mean incidence for Botrytis fruit rot was predominantly high

in Islamabad (24%), followed by Rawalpindi (15.8%) and Taxila (15.5%). The lowest

incidence was recorded in Chakwal (6%). The mean incidence for Alternaria fruit rot

was high in Gujar Khan (12.5%), followed by Rawalpindi (11.3%) and Taxila (10%)

and the lowest incidence was found in Chakwal (8.3%).

Table 4.1: Location wise mean disease incidence (%) of fruit rot diseases in

greenhouse during January 2016 and 2017

Tehsil Location

Surveyed Fusarium FR Botrytis FR Alternaria FR

Rawalpindi Adyala 11 12 10

Dhoke Budhal 13.5 19.5 12.5

Taxila Taxila 12 15.5 10

Gujar Khan Jatli 15 14 12.5

Chakwal Dab 19 0 0

Thoa Bahdar 17.5 12 16

Islamabad Chak Shehzad 11 25.5 8.5

Rawat 10 22.5 8

Mean 13.63 15.13 9.69

30

Figure 4.5: Tehsil wise mean disease incidence (%) of fruit rot diseases in greenhouse during January 2016 and 2017

31

4.1.2 Prevalence and Incidence of Fruit Rot Diseases in Open Fields

During the month of May in 2016 and 2017, percent mean prevalence and

incidence of bell pepper fruit rot was calculated for each visited locality in open fields

as presented in Appendix B. Four diseases viz. Colletotrichum fruit rot (anthracnose),

Fusarium fruit rot, Botrytis fruit rot and Alternaria fruit rot were found responsible

for fruit rot disease in bell pepper grown in open fields. The prevalence of

Colletotrichum fruit rot, Fusarium fruit rot and Alternaria fruit rot was found 100%.

Whereas, the prevalence of Botrytis fruit rot was 41.7%. The anthracnose disease was

prevailing in open fields of the study area with the maximum mean percent incidence

of 20.73, followed by Fusarium fruit rot (12.04%), Alternaria fruit rot (8.92%) and

Botrytis fruit rot (6.73%) as shown in figure 4.6.

Figure 4.6: Percent mean disease incidence of various fruit rot diseases in open fields

during May 2016 and 2017.

Anthracnose symptoms appeared as circular to irregularly-shaped, sunken water-

soaked lesions which later turned brown to black and coalesce covering a large

portion of the fruit (Figure 4.7a). The lesions were later covered with black

fruiting bodies (acervuli) bearing salmon colored spore masses. At this stage the fruit

became misshapen and completely rotted (Figure 4.7b).

32

Figure 4.7: Anthracnose; a. Circular to irregularly-shaped, sunken, brown to black

lesions (acervuli) of fungi b. misshapen and rotted fruit

The mean incidence in open fields for Colletotrichum fruit rot, Fusarium fruit rot,

Botrytis fruit rot and Alternaria fruit rot was the maximum in Bhoun (Chakwal)

38.5%, Dhoke Budhal (Rawalpindi) 19%, Chak Shehzad (Islamabad) 16.5% and

Domeli (Jhelum) 12.5% respectively (Table 4.2). Whereas, in surveyed tehsils (Figure

4.8), the highest mean incidence for Colletotrichum fruit rot was recorded in tehsil

Chakwal (30.9%), followed by Jhelum (26.3%) and Gujar Khan (22.5%). The lowest

incidence was in Taxila (14.3%). The mean incidence for Fusarium fruit rot was the

maximum in Chakwal (15%), followed by Rawalpindi (14.1%) and Jhelum (12.8%).

The lowest incidence was in tehsil Taxila (7.3%). The mean disease incidence for

Botrytis fruit rot was high in Islamabad (14.5%), followed by Attock (12.8%) and

Taxila (7%), while Kallar Kahar (4%) showed the lowest incidence. The highest mean

incidence for Alternaria fruit rot was recorded in tehsil Gujar Khan (10.6%), followed

by Jhelum (10.5%) and Kallar Kahar (9.5%). The lowest incidence was in Attock

(6.5%).

During the survey, it was noted that farmers have limited knowledge about exact

name of planted variety and called it as hybrid variety. This information is therefore

limited to ascertain the resistant behavior of the varieties. The greenhouse cultivation

was mostly practiced in government research and training institutes. Only a few

farmers have grown bell peppers in greenhouses at their private farms. Farmers have

small land-holdings and lots of money is required to meet the high cost of green

house. Adequate knowledge of advanced technologies is also essential for greenhouse

maintenance. The production cost in greenhouse is expensive (USD 1.13/0.5 kg) as

33

compared to production in open field (USD 0.48/0.5 kg) (Seepersad, Iton, Paul, &

Lawrence, 2013).

Table 4.2: Location wise mean disease incidence (%) of fruit rot diseases in open

fields during May 2016 and 2017

Tehsil Location Colletotrichum

FR

Fusarium

FR

Botrytis

FR

Alternaria

FR

Rawalpindi Adyala 19.5 12 12.5 8.5

Dhoke Budhal 20.5 19 0 8.5

Chauntra 22.5 11.5 12.5 9.5

Chakri 20.5 15.5 0 7.5

Chak Beli

Khan 24.5 12.5 0 6.5

Taxila Taxila 15.5 8.5 14 10.5

Wah 13 6 0 7

Gujar

Khan Jatli 24 13 11.5 13

Sukho 21.5 11.5 0 9.5

Daultala 22 12.5 8 9.5

Chakwal Bhaun 38.5 12 11 9

Dhudial 27.5 15.5 0 6

Dab 30.5 14.5 0 10.5

Thoa Bahdar 27 18 10.5 7.5

Kallar

Kahar Miani 16.5 12 8 9

Buchal Kalan 18 9 0 10

Choa

Saidan

Shah

Dalelpur 15 11 0 11.5

Dulmial 15 8.5 10 8.5

Fateh Jang Bahter 17.5 12 13 7.5

Hasan Abdal 17.5 10 12.5 5.5

Jhelum Sohawa 30.5 11 0 8.5

Domeli 22 14.5 9 12.5

Islamabad Chak Shehzad 0 9 16.5 7.5

Rawat 18.5 10 12.5 10.5

Mean 20.73 12.04 6.73 8.92

34

Figure 4.8: Tehsil wise mean disease incidence (%) of fruit rot diseases in open fields during May 2016 and 2017

35

Fusarium fruit rot was found prevalent in all visited greenhouses (February) and

open fields (May) during both years (2016 and 2017) (Table 4.1, 4.2). Since,

Fusarium fruit rot might be an internal seed borne disease and availability of disease-

free seeds to the farmers was limited. It seems, if the seeds were treated with an

appropriate systemic fungicide, there would have been no disease. Moreover, the

temperature (25-30°C) favoring the plant growth at fruiting stage is also conducive

for the pathogen growth and sporulation (Frans, Aerts, Van Laethem, & Ceusters,

2017). Temperature plays an important role in pathogen growth, disease

susceptibility of the host and Fusarium fruit rot incidence (Rossi et al., 2009). In

controlled experiment, the maximum growth and sporulation for FLASC (Fusarium

lactis species complex) and F. oxysporum was observed at 25°C (Scott, Gordon,

Shaw, & Koike, 2010; Webb, Brenner, & Jacobsen, 2015) but F.

proliferatum exhibited a maximum sporulation at 30°C (Marin et al., 1999;

Samapundo, Devliehgere, De Meulenaer, & Debevere, 2005).

Mean incidence of Botrytis fruit rot disease in green house (15.13%) was

comparatively high than in open fields, which was 6.73% (Table 4.1, 4.2), that might

be due to availability of conducive environmental conditions including favorable

temperature, higher relative humidity and dense plant canopy in controlled structures.

Whereas, in open fields higher relative humidity and dense plant canopy is less

frequently available. It was observed that the disease incidence was high at relative

humidity from 70-97% and temperature ranged from 17-28°C (Haware, Faris, &

Gowda, 1992). Disease intensity increases with the increase in period of leaf

wetness beyond 12 h/day (Singh & Kapoor, 1985). Botrytis fungus can grow and

survive at wide temperature range but 25°C is the optimum temperature for fungal

growth, infection and sporulation (Mahmood & Sinha, 1990). Dense canopy and

relative humidity of ≥95% for few hours during the day were most favorable for

fungal infection and rapid disease spread (Tripathi & Rathi, 1992). Under cool and

wet conditions, gray-tan powdery spore masses of gray mold frequently appear on

dead plant tissues (Akbudak, Tezcan, Akbudak, & Seniz, 2006).

Alternaria fruit rot was prevalent in all visited tehsils. During survey,

it was noted that fields repeatedly cultivated have more disease incidence than fields

36

newly brought under cultivation. During an in vitro study, the maximum mycelial

growth of Alternaria tenuissima was at 25°C, while the minimum was observed at

10°C (Azad, Singh, & Kumar, 2016). The conidia of A. alternata germinate rapidly in

the presence of moisture and begin to produce toxin even before penetration to the

tissue (Dehpour, Alavi, & Majd, 2007). The minimum wetting period required for the

infection establishment of various Alternaria species in host tissue ranges from 3 to

72 h (Bautista-Baños, 2014).

The mean incidence (20.73%) of anthracnose in open fields has been found the

highest as compared to other fruit rot diseases (Table 4.2). Chakwal had

comparatively more recorded mean incidence (30.9%) as compared to other tehsils

(Figure 4.8). Colletotrichum fruit rot/anthracnose was not observed in visited

greenhouses. The disease only developed followed by a period of wetness or rain and

usually presence of free water on the surface of a plant canopy was not available

under greenhouse conditions. The infection occurs during high humidity (a mean of

80%) and temperatures around 27°C aggravate the rate of infection of anthracnose

disease (Roberts, 2001). The marketable yield loss of 100% has been reported under

favorable circumstances of rainy, humid and warm seasons. However, the duration of

surface wetness >96 h, seems to have the direct effect on the germination, growth and

infection of the pathogen (Than et al., 2008). Moreover, cropping pattern, sanitation

practices and presence of alternate or weed host in crop vicinity effect the incidence

of disease. Colletotrichum truncatum has a wide host range including pepper,

muskmelon, eggplant, grapes, chickpea and various other plant species (Damm,

Woudenberg, Cannon, & Crous, 2009). Use of disease-free planting material, removal

of weeds, infected debris, proper field drainage are important cultural means of

reducing pathogen inoculum and disease losses. Crop rotation for a minimum of 2

years is also advised for susceptible solanaceous crop (Roberts, 2001).

4.2 PREVALENCE AND INCIDENCE OF ROOT ROT DISEASES

For root rot diseases prevalence and incidence was monitored twice; first at

seedling stage and second at fruiting stage/maturity. 30-40 days old seedlings were

inspected and sampled during the month of November 2015 and 2016 in green house

and during February 2016 and 2017 in low plastic tunnels. Root rot diseases were also

documented at fruiting stage during the month of May in 2016 and 2017.

37

4.2.1 Prevalence and Incidence of Root Rot Diseases at Seedling Stage in

Greenhouses

During the month of November in 2015 and 2016, prevalence and incidence for

root rot diseases were calculated at seedling stage in each visited greenhouse

(Appendix C). Three pathogens viz. Fusarium equiseti, Rhizoctonia solani and

Sclerotium rolfsii were found associated with root rot disease in bell pepper. During

both years (2015 and 2016) in greenhouse, the average mean disease prevalence at

each visited location was found 100% for Fusarium root rot. However, disease

prevalence for Rhizoctonia root rot and Sclerotium root rot was 75% and 37.5%

respectively. However, the overall incidence of Rhizoctonia was the maximum

(19.25%) followed by Fusarium (15.63%) and Sclerotium (4.13%) as shown in figure

4.9.

Figure 4.9: Percent mean disease incidence of various root rot diseases in greenhouse

during November 2015 and 2016.

Symptoms of Fusarium root rot generally develop dark brown to black, discolored

and rotted roots. There is a dark brown vascular discoloration of the internal portion

of the stem. Infected plants had stunted growth, leaf chlorosis, seedlings damping-off,

eventually wilted and died (Figure 4.10). Root rot caused by Rhizoctonia solani

appeared brown, somewhat mushy with collapsed plant tops. The germinating stems

were also affected, and formation of brown-black cankers and water-soaked lesions

developed at or below the soil line. The lesions later become darken, brown, reddish-

brown or black and quickly girdles the tender and young stems with the progression

38

of the disease (Figure 4.11). The initial symptoms of Sclerotium root rot infection is

poor plant growth at the top and wilting of the leaves. Water-soaked lesions appeared

on root and lower stem part near the soil line. White cottony growth covered the

infected roots surface (Figure 4.12). The roots became rotted and plant eventually

died. Numerous mustard seed like sclerotia were often produced on stem and root

surface and the surrounding soil.

There was significant variation in mean disease incidence at various locations.

The maximum Fusarium root rot incidence (24%) was recorded in Thoa Bahdar

(Chakwal). Whereas, the maximum mean Rhizoctonia root rot (38%) incidence was

prevailing in Chak Shehzad (Islamabad) and the maximum (15%) mean disease

incidence recorded for Sclerotium root rot was in Dab (Chakwal) (Table 4.3).

It is obvious from the figure 4.13 that, tehsil wise the maximum mean Fusarium

root rot incidence was observed in tehsil Chakwal (21.5%), followed by Gujar Khan

(17%) and Islamabad (14.5%). However, the minimum incidence was recorded in

tehsil Taxila (9%). Rhizoctonia root rot incidence was predominantly high in

Islamabad (34.5%), followed by tehsil Taxila (28%) and Rawalpindi (19.5%). The

lowest (9%) Rhizoctonia incidence was recorded in tehsil Chakwal. On the other

hand, no disease was recorded in tehsil Gujar Khan. The maximum Sclerotium root

rot incidence was recorded in tehsil Gujar Khan (8%), followed by Chakwal (7.5%)

and Rawalpindi (5%). Conversely, root rot caused by Sclerotium was not observed in

Islamabad and Taxila tehsil.

Figure 4.10: Symptoms of Fusarium root rot with dark brown to black, discolored and

rotted roots, stunted growth and wilting.

39

Figure 4.11: Roots infected with Rhizoctonia root rot appears brown, somewhat

mushy and plant tops collapsed, formation of brown-black cankers on stem at or

below the soil line.

Figure 4.12: White cottony growth of Sclerotium root rot covered the infected roots

surface.

40

Table 4.3: Percent mean disease incidence of root rot diseases in greenhouse at

various locations during November 2015 and 2016

Tehsil Location

Surveyed

Fusarium

RR

Rhizoctonia

RR

Sclerotium

RR

Rawalpindi Adyala 12 17 0

Dhoke

Budhal 15 22 10

Taxila Taxila 9 28 0

Gujar Khan Jatli 17 0 8

Chakwal Dab 19 0 15

Thoa Bahdar 24 18 0

Islamabad Chak

Shehzad 13 38 0

Rawat 16 31 0

Mean 15.63 19.25 4.13

Figure 4.13: Percent mean disease incidence of various root rot diseases in

greenhouse located in 5 tehsils during November 2015 and 2016.

41

4.2.2 Prevalence and Incidence or Root Rot Diseases at Seedling Stage in Low

Plastic Tunnels

During the month of February 2016 and 2017, prevalence and incidence for root

rot diseases at seedling stage was calculated for each visited low plastic tunnel as

shown in Appendix D. The prevalence of Rhizoctonia and Fusarium root rot was

100%. However, disease prevalence for Sclerotium root rot was 77.8%. The overall

incidence of Fusarium was the maximum (15.98%) followed by Rhizoctonia (14.1%)

and Sclerotium (7.38%) root rot as shown in figure 4.14. The seedlings planted in low

plastic tunnels were later transplanted in open fields.

Figure 4.14: Percent mean disease incidence caused by various root rot pathogens in

low plastic tunnels during February 2016 and 2017.

Based upon two years mean data, the highest (29%) mean incidence for

Rhizoctonia root rot was recorded in Chak Shahzad (Islamabad). Whereas, the mean

incidence in low plastic tunnel for Fusarium root rot and Sclerotium root rot was the

maximum in Thoa Bahadar (Chakwal) and Bhoun (Chakwal) with 20.5% and 18%

incidence respectively (Table 4.4). In surveyed tehsils (Figure 4.15), there was the

highest (26.5%) Rhizoctonia root rot mean incidence prevailing in Islamabad,

followed by Attock (20.5%) and Taxila (18.5%). However, the lowest incidence was

recorded at tehsil Kallar Kahar (5.5%). The Fusarium root rot mean disease incidence

was found the maximum in Chakwal (18.3%). However, the lowest disease incidence

was observed in Taxila (12.5%). The highest Sclerotium root rot mean incidence was

42

in tehsil Chakwal (15.5%), followed by Kallar Kahar (15%) and Rawalpindi (6.8%)

and the lowest (4.7%) incidence was in tehsil Gujar Khan. Conversely, Sclerotium

root rot was not observed in Taxila and Choa Saidan Shah.

Table 4.4: Percent mean disease incidence of root rot diseases in low plastic tunnels at

various locations during February 2016 and 2017

Tehsil Location Fusarium

RR

Rhizoctonia

RR

Sclerotium

RR

Rawalpindi Adyala 16 0 11 Dhoke Budhal 19 22 13

Chauntra 14 19 0

Chakri 14 25 0

Chak Beli Khan 13 0 10


Wah 13 17 0


Sukho 12 15 0

Daultala 18 12 0

Chakwal Bhaun 16.5 0 18

Dhudial 19 13 15

Dab 17 15 13

Thoa Bahdar 20.5 17 16

Kallar Kahar Miani 15 11 16

Buchal Kalan 11 0 14

Choa Saidan

Shah Dalelpur 16 15 0

Dulmial 20 13.5 0

Attock Fateh Jang 16 19 12

Hasan Abdal 13 22 0

Jhelum Sohawa 19 17 13

Domeli 16 13 0

Islamabad Chak Shehzad 16 29 0

Rawat 16.5 24 12

Mean 15.98 14.1 7.38

43

Figure 4.15: Percent mean disease incidence of various root rot diseases in low plastic tunnels located in 9 tehsils/territory during February 2016

and 2017.

44

4.2.3 Prevalence and Incidence of Root Rot Diseases at Maturity Stage in

Greenhouses

During the month of February in 2016 and 2017, prevalence and incidence of root

rot diseases at maturity stage was calculated in each greenhouse surveyed (Appendix

E). In all the locations of visited tehsils, there was 100% prevalence of Fusarium root

rot. However, prevalence for Rhizoctonia and Sclerotium root rot was 75% and 50%.

The overall incidence of Fusarium was the maximum (9.25%) followed by

Rhizoctonia (6.22%) and Sclerotium (4.94%) root rot as shown in figure 4.16.

The significant variation in mean disease incidence was observed at all locations

by three root rot pathogens (Table 4.5). The highest mean root rot incidence for

Fusarium, Rhizoctonia and Sclerotium was recorded at Dhoke Budhal (14%) in

Rawalpindi, Rawat (13%) in Islamabad and Dab (15%) in Chakwal respectively.

Tehsil wise, the highest (12%) mean incidence of Fusarium, Rhizoctonia and

Sclerotium root rot was recorded in Rawalpindi (12.3%), Islamabad (11%) and Gujar

Khan (12%) respectively (Figure 4.17)

Figure 4.16: Percent mean disease incidence caused by various root rot pathogens in

greenhouses during February 2016 and 2017.

45

Table 4.5: Percent mean disease incidence of root rot diseases in greenhouse at

various locations during February 2015 and 2016

Tehsil Location

Surveyed

Fusarium

RR

Rhizoctonia

RR

Sclerotium

RR

Rawalpindi

Adyala 10.5 6 2.5

Dhoke Budhal 14 5.25 10



Chakwal Dab 12 0 15

Thoa Bahdar 9.5 6.5 0

Islamabad

Chak Shehzad 8 9 0

Rawat 9 13 0

Mean 9.25 6.22 4.94

Figure 4.17: Percent mean disease incidence of various root rot diseases in green

house located in 5 tehsils during February 2016 and 2017.

46

4.2.4 Prevalence and Incidence of Root Rot Diseases at Maturity Stage in Open

Fields

During the month of May in 2016 and 2017, prevalence and incidence of root rot

diseases at maturity stage was calculated for each open field surveyed (Appendix F).

In all the locations visited, there was 100% prevalence of Fusarium and Sclerotium

root rot. However, prevalence for Rhizoctonia root rot was 88.9%. The overall

incidence of Sclerotium was the maximum (14.35%) followed by Fusarium (8.3%)

and Rhizoctonia (6.1%) root rot as shown in figure 4.18.

Figure 4.18: Percent mean disease incidence of various root rot diseases in open fields

during May 2016 and 2017.

The significant variation in mean disease incidence was observed at all locations

by three root rot pathogens. The highest mean root rot incidence for Fusarium,

Rhizoctonia and Sclerotium was recorded at Chakri (16%) in Rawalpindi, Chak

Shahzad (13%) in Islamabad, and Dab (32%) in Chakwal respectively (Table 4.6).

As we look upon the mean root rot incidence in open fields at five tehsils

surveyed (Figure 4.19), the highest mean Fusarium root rot mean incidence was

found in Islamabad (14%), followed by Attock (12.5%) and Choa Saidan Shah

(11.5%), while the lowest was in Taxila (5.5%) and Kallar Kahar (5.5%). The highest

(12%) incidence of Rhizoctonia root rot was recorded in Islamabad and Attock and

the lowest incidence was recorded in Jhelum (9%). Conversely, no Rhizoctonia root

rot was observed in Choa Saiden Shah (11.5%). The highest Sclerotium root rot mean

incidence was recorded in Chakwal (26.9%), followed by Jhelum (22.5%) and Gujar

Khan (17.7%). The lowest (7%) disease incidence was recorded in Islamabad.

47

Table 4.6: Percent mean root rot disease incidence caused by 3 pathogens in open

fields at various locations during May, 2016 and 2017

Tehsil Location Fusarium

RR

Rhizoctonia

RR

Sclerotium

RR

Rawalpindi

Adyala 0 0 21

Dhoke Budhal 13 12 0

Chauntra 0 10 26

Chakri 16 0 0

Chak Beli

Khan 0 7 0

Taxila

Taxila 11 11.5 17

Wah 0 0 0

Gujar Khan

Jatli 8 0 28

Sukho 0 9 0

Daultala 12.5 12 25

Chakwal

Bhaun 13 0 31.5

Dhudial 15 8 25

Dab 0 10 32

Thoa Bahdar 12 12 19

Kallar Kahar

Miani 11 0 17

Buchal Kalan 0 0 0

Choa Saidan

Shah

Dalelpur 10 0 15

Dulmial 13 11 0

Attock

Fateh Jang 14 12 16

Hasan Abdal 11 0 13

Jhelum

Sohawa 12 9 27

Domeli 0 0 18

Islamabad

Chak Shehzad 13 13 0

Rawat 15 11 14

Mean 8.3 6.15 14.35

48

The high incidence of Rhizoctonia and Fusarium root rot (Table 4.3, Table 4.4) at

seedling stage in greenhouses and low plastic tunnels as compared to surveyed

greenhouse and open fields at maturity (Table 4.5 and 4.6), might be attributed to

repeated cultivation in the same greenhouse/low plastic tunnel or use of same potting

mixture or plots since many years. This lead to accumulation of pathogen inoculum

level in the soil that increase the disease incidence in the next cropping season.

The amount of inoculum in the soil is one of the major factor contributing in high

disease incidence (Buddemeyer, Pfähler, Petersen, & Märländer, 2004). Further,

greenhouses/low plastic tunnels are closed structure to conserve heat. For most of the

day and night, humidity level remains about 90% or greater. Restricted air circulation

results in higher level of atmospheric humidity inside protected greenhouses than

conventional ones. These conditions are ideal for the initiation and proliferation of

disease (Jarvis, 1992). The plastic houses changes the microclimate of crops in

protected cultivation (Coakley, Scherm, & Chakraborty, 1999). These conditions are

also favourable for various diseases including root rot, damping-off, and wilt

(Daughtrey & Horst, 1990; Simone & Momol, 2000).

The higher incidence of Rhizoctonia root rot (Table 4.3 and 4.4) in Islamabad

might be due to the fact that it was comparatively cooler than other visited tehsils. The

climatic conditions prevalent in Islamabad also favored the activation of inoculum

present in the soil and pathogenicity development. The pathogen R. solani is generally

active in cool and moist soils and can survive as sclerotia in unfavorable conditions

for many years (Vásquez, Tlapal, Yáñez, Pérez, & Quintos, 2009). Moreover, the

amount and activation of prevailing R. solani inoculum in the soil is triggered by

excessive soil moisture in protected cultivation (Frank, 1978) which favours the

disease development. This high incidence of Rhizoctonia root rot at seedling stage can

effectively be eliminated by using sterilized potting mixtures in germination trays or

using a virgin land for sowing bell pepper nursery stock.

The highest incidence of Fusarium root rot at seedling stage in green houses and

low plastic tunnels in all visited tehsils (Table 4.3 and Table 4.4) may be attributed to

the prevailing temperature at the time of survey i.e. 20–25°C during the month of

October and 12-22°C during the month of February.

49

Figure 4.19: Percent mean disease incidence of various root rot diseases in open fields located in 9 tehsils during May 2016 and 2017

50

The temperature plays a significant role in incidence, growth and virulence of

Fusarium (Rossi, Scandolara, & Battilani, 2009). Furthermore, in a study it was

shown that the growth of Fusarium sp. was the optimum at 20-25°C, declined

sharply at 35°C and growth completely inhibited at 40°C (Gracia-Garza &

Fravel, 1998; Rekah, Shtienberg, & Katan, 2000).

The highest Fusarium root rot disease incidence in Chakwal in both greenhouse

(15.63%) and low plastic tunnels (15.98) (Table 4.3, 4.4) may be due to high

pathogen’s inoculum level accumulated by repeated cultivation of bell pepper in the

same field. During the survey, it was shared by the farmer that bell pepper is the main

nursery crop which was grown to distribute to the adjacent areas since many years.

The minimum prevalence and incidence of Sclerotium root rot at seedling stage

(Table 4.3, 4.4) as compared with other diseases in green house (2.3%) and low

plastic tunnels (7.28%), may be due to the fact that at the time of survey the

environmental conditions were not favorable for the pathogen development. The

highest mean incidence (14.35%) of Sclerotium root rot in open field (Table 4.6)

during the month of May be attributed to the favorable temperature and humidity for

disease development. The temperature above 29˚C and high humidity are the

conducive environmental conditions for the sclerotium root rot disease development

(Kator, Hosea, & Oche, 2015). Ideal temperature for mycelial growth ranges between

25 to 35oC, and the optimal temperature for sclerotia formation ranges from 27°C to

35°C (Punja, 1985). Mycelial growth is little or none at 10 or 40oC, but sclerotia can

survive at temperature as low as -10oC. Sclerotia germinate well at 25-35% relative

humidity (Edmunds, Gleason, & Wegulo, 2003).

Sclerotium root rot was not observed in Taxila and Choa Saidan Shah (Table 4.3,

4.4), as per observation it might be attributed to cultivation of crop in new fields and

limited or unavailability of plant flora for the growth and proliferation of the

pathogen. During the survey, it was shared by the farmer that, the nursery was planted

for the first time in the planted area. Wheat has been the main crop in visited locations

since decades, however, the introduction of solar tube well scheme and the irrigation

water availability paved the way for cultivation of vegetables crops with higher per

unit area economic returns compared to wheat.

51

4.3 ISOLATION OF PATHOGENS

Colonies of five pathogens viz. Colletotrichum truncatum, Fusarium incarnatum,

Fusarium proliferatum, Botrytis cinerea and Alternaria alternata were isolated from

rotted bell pepper fruits. From the diseased fruit rot samples, a total of 161 isolates

were obtained viz., Colletotrichum truncatum (45 isolates), Fusarium incarnatum (29

isolates), Fusarium proliferatum (11 isolates), Botrytis cinerea (40 isolates) and

Alternaria alternata (36 isolates).

From the diseased root rot samples, a total of 147 isolates were obtained from

fungal colonies and three pathogens viz. Fusarium equiseti (41 isolates), Rhizoctonia

solani (56 isolates) and Sclerotium rolfsii (50 isolates) were found responsible to

cause rotting in bell pepper roots (Figure 4.20). The mentioned number of isolates

were further used for preservation and morphological characterization.

Figure 4.20: Colonies of various fungi grown on PDA a. Colletotrichum truncatum. b.

Fusarium sp. c. Botrytis cinerea d. Alternaria alternata. e. Rhizoctonia solani f.

Sclerotium rolfsii

52

4.4 PRESERVATION

Viability test was performed after 10 days of incubation and before storage of

isolates in refrigerator. Ten isolates of each pathogen were randomly selected from

the preserved isolates. The viability test provided 100% results. The colonies on PDA

media plates were morphologically similar to the original isolates. Silica gel technique

is extremely simple, rapid and inexpensive, can also be used for micro-organisms

other than fungi (Grivell & Jackson, 1969). Preservation using silica gel method

yielded positive survival rate of fungi (Windels, Burnes, & Kommedahl, 1988). Fungi

can be stored successfully up to 11 years on silica gel (Smith & Onions, 1983). Out of

five preservation methods, fungal isolates preserved on silica gel showed the highest

viability after 2 years of storage (Tariq, Naz, Rauf, & Irshad, 2015).

4.5 MORPHOLOGICAL CHARACTERIZATION

4.5.1 Morphological Characterization of Colletotrichum truncatum

Forty-five isolates of Colletotrichum truncatum were selected for morphological

characterization. The isolates were segregated into five groups depending upon their

colony characteristics. Out of 45 isolates; 7 (15.56%), 12 (26.67%), 9 (20%), 7

(15.56%) and 10 (22.22%) were belonged to group 1, group 2, group 3, group 4 and

group 5 respectively. Colletotrichum species are highly variable based on subtle

differences in colony morphology, pigmentation, conidial dimension, appressoria,

presence and shape of setae, pathogenicity, fungicide sensitivity, and various other

traits (Bailey, O'connell, Pring, & Nash, 1992).

4.5.1.1 Colony diameter

The mean colony diameter after 7 days of incubation time at 25±2°C was

shown in Table 4.7. The isolates belonging to the group-2 exhibited the fastest growth

(8.1±0.6 cm). However, the minimum mean colony diameter (5.8±0.5 cm) was noted

in the isolates of group-3. The isolate ACT13 was found the fastest growing (8.4 cm)

in group 1 and ACT24 (7.4 cm) had the slowest mean growth. In group 2, the isolate

ACT21 and ACT37 had the fastest growth (9 cm) and ACT10 (7.5 cm) with the

minimum growth. Among the isolates of group 3, the maximum growth (6.7 cm) was

exhibited by ACT19. Whereas, the least growth (5.2 cm) was shown by ACT23

53

isolate. The isolate ACT6 (8.4 cm) was the fastest growing among the isolates of

group 4 and ACT33 (7.1 cm) was the slowest growing as compared to others. ACT22

(7.2 cm) was the fastest growing within the isolates of group 5. However, ACT4 (5.7

cm) was the slowest growing isolate among the same group.

4.5.1.2 Colony color and orientation

The colonies of isolates of C. truncatum showed variety of colors on PDA i.e. white

to ash gray, ash gray, pale gray, light to dark gray and dark gray to black. The group 1

isolates grown on PDA were ash gray or whitish to ash gray in color with abundant

aerial mycelia, few scattered conidia and dot like partially submerged acervuli. The

colonies were dark gray or ash gray from reverse (Figure 4.21). Group 2 isolates were

light to dark gray or dark gray to black in color with dark gray to black in reverse.

Colonies comprised of 4-5 concentric rings, compact at the center with scattered

acervuli and fluffy at peripheral with dense acervuli and large spore masses in the

center, (Figure 4.22). Group 3 isolates were light gray to black or dark gray to black

in color and dark gray to black in reverse. Colonies were radiating with abundant

acervuli scattered over the colony with few conidial masses near the inoculation point

(Figure 4.23). The isolates of group 4 were dark gray to black in color and black in

reverse. Colonies comprised of only 2-3 concentric rings, abundant thick acervuli

with few conidial masses (Figure 4.24). Group 5 isolates were pale gray or light to

dark gray with cream to dark gray or dark gray to black in reverse. The acervuli were

scattered with abundant light orange conidial masses (Figure 4.25).

Colletotrichum truncatum isolates from bell pepper were grouped by into three

morphological categories depending upon the morphological characteristics of

colonies and spores (Hema Ramdial & Rampersad, 2015). In another study, 88

isolates were recovered from chili pepper that were classified into six morphological

groups based on cultural and morphological characteristics. Out of which, C.

truncatum group contained thirty-two isolates (Liu, Wang, Damm, Crous, & Cai,

2016). However, in the present study the isolates were segregated into five groups

depending upon their colony and microscopic characteristics.

4.5.1.3 Texture

The isolates of C. truncatum showed light fluffy, medium fluffy, thin flat and

54

submerged texture. The colonies of group 1, group 4 and group 5 isolates were

medium fluffy. The isolates of group 2, ACT9, ACT21, ACT37 and ACT42 were

light fluffy. Whereas, rest of all the isolates belonging to group 2 (ACT2, ACT10,

ACT20, ACT26, ACT29, ACT30, ACT35 and ACT41) showed thin sparse growth

pattern. The hyphae of group 3 isolates ACT7, ACT17, ACT19, ACT25, ACT34,

ACT12, ACT23, ACT27 and ACT45 were submerged having sparse growth pattern.

The isolates of C. truncatum in our study showed medium fluffy, light fluffy, thin

sparse and submerged growth pattern. Whereas, all isolates of C. truncatum showed

only moderate aerial mycelia in the study carried out by other scientist (Ramdial &

Rampersad, 2015).

4.5.1.4 Conidia

Microscopic characteristics of C. truncatum was almost same among the five

groups. Hyphae were aseptate, hyaline, smooth walled. C. truncatum produces

hyaline, single celled conidia, slightly constricted in middle and falcate in shape

(Figure 4.26). The overall mean size (L×W) of group 1, 2, 3, 4 and group 5 conidia

was 24.8±2.4×2.4±0.2, 25±1.5×2.5±0.1, 23.4±1.9×2.4±0.2, 26.5±1.1×2.5±0.2 and

25.3±1.7×2.4±0.1 respectively. The longest mean length of conidia in group 1 isolates

was observed in ACT24 (26.8±1.3). The isolate ACT 30 (26±1) and ACT42 (26±1.6)

of group 2 showed the maximum conidial length. Whereas, the isolate ACT 7

(25.3±0.8), ACT33 (27.3±1.1) and AC39 (27±1) belonging to group 3, group 4 and

group 5 respectively showed the longest conidia (Table 4.7). Conidial dimensions in

the present study were found in cognizance with dimensions taken by other scientists

(Damm et al., 2009; Liu et al., 2016).

4.5.1.5 Setae

The isolates from all 5 groups produced setae. The setae originate from acervular

conidiomata that were light-dark brown or black, cylindrical, tapering towards tips

and 3 to 5 septate (Figure 4.27). The mean dimension ranges 82 to 130 × 3.8 to 6 μm

(mean = 104 × 4.6 μm) (Table 4.7). Isolates of group 2 had the longest setae,

averaging 107.8±14.1μm, while isolates of group 4 had the shortest, averaging

100.4±12.7 μm. Setae of group 2 and group 5 were the widest, with an average of

4.7±0.5 μm and 4.7±0.5 μm. Group 3 and group 1 isolates had the narrowest setae,

55

averaging 4.5±0.5 μm.

4.5.1.6 Appressoria

Appressoria were light-dark brown, clavate, ovoid, ellipsoidal or irregular in

shape and 12.5 to 15 × 5 to 7.5 μm (mean = 13.8 × 6.4 μm) (Figure 4.28, Table 4.7).

Isolates of group 4 had the longest appressoria, averaging 12.4±1.4 μm, while isolates

of group 5 had the shortest, averaging 11.7±1.2 μm. Appressoria of group 4 were the

widest, with an average of 6.5±0.3 μm. Group 1 appressoria were the narrowest, with

an average of 5.8±0.4 μm. The appressorial dimensions were found almost consistent

with as described by other scientists (Damm et al., 2009; Liu et al., 2016).

Figure 4.21: a. Colonies of group 1 isolates displayed white to ash gray colony with

small dot like acervuli b. ash gray color in reverse

Figure 4.22: a. Colonies of group 2 isolates displayed light-dark gray color, comprised

of 4-5 concentric rings, with dense acervuli b. dark gray to black color in reverse

56

Figure 4.23: a. Colonies of group 3 isolates were radiating, dark gray to black in

color, with abundant acervuli b. dark gray to black in reverse

Figure 4.24: a. Colonies of group 4 isolates comprised 2-3 concentric rings, dark gray

to black in color, abundant thick acervuli b. black in reverse

Figure 4.25: a. Colonies of group 5 isolates were pale gray or light to dark gray with

abundant conidial masses, small scattered acervuli b. cream to dark gray in reverse

57

Figure 4.26: Conidia of C. truncatum (light microscope, x1000) stained with cotton


Figure 4.27: Setae of C. truncatum

Figure 4.28: Appressoria of C. truncatum

58

Table 4.7: Cultural characteristics of C. truncatum

Sr.

No Isolate Tehsil Location Group

Colony Cultural

orientation Margins Texture

Diameter Color (Front) Color (Reverse)

1 ACT5 Chakwal Dhudial 1 8.2±0.2 White to ash

gray

Ash gray

Regular colony

with small dot like

acervuli and few

conidial masses

Irregular Medium fluffy

2 ACT11 Chakwal Bhoun 1 7.6±0.2 Ash gray Dark grayish Regular Medium fluffy

3 ACT13 Taxila Taxila 1 8.4±0.2 White to ash

gray

Ash gray Irregular Medium fluffy

4 ACT24 Gujar Khan Sukho 1 7.4±0.2 White to ash

gray

Ash gray Irregular Medium fluffy

5 ACT32 Rawalpindi Chak Beli

Khan

1 8±0.1 Ash gray Dark grayish Irregular Medium fluffy

6 ACT43 Rawalpindi Chakri 1 8.2±0.2 Ash gray Dark grayish Regular Medium fluffy

7 ACT44 Attock Bahter 1 7.5±0.1 Ash gray Dark grayish Irregular Medium fluffy

8 ACT2 Chakwal Dab 2 8.8±0.2 Light to dark

gray

Dark gray to

black

4-5 concentric

rings, scattered to

dense acervuli and

large light orange

spore masses at

the center

Irregular Thin flat

9 ACT9 Chakwal Thoa

Bahdar

2 7.6±0.2 Dark gray to

black

Dark gray to

black

Irregular Light fluffy

10 ACT10 Rawalpindi Adyala 2 7.5±0.3 Dark gray to

black

Dark gray to

black

Irregular Thin flat

11 ACT20 Choa Saidan

Shah

Dalelpur 2 8.6±0.2 Light to dark

gray

Dark gray to

black

Irregular Thin flat

12 ACT21 Rawalpindi Chauntra 2 9±0 Dark gray to

black

Dark gray to

black


59

13 ACT26 Rawalpindi Chakri 2 8.1±0.1 Dark gray to

black

Dark gray to

black

Irregular Thin flat


Shah

Dalelpur 2 7.7±0.2 Light to dark

gray

Dark gray to

black

Irregular Thin flat

15 ACT30 Gujar Khan Doltala 2 8±0.2 Dark gray to

black

Dark gray to

black

Irregular Thin flat

16 ACT35 Rawalpindi Adyala 2 7.6±0.1 Dark gray to

black

Dark gray to

black

Irregular Thin flat

17 ACT37 Jhelum Domeli 2 9±0 Light to dark

gray

Dark gray to

black


18 ACT41 Jhelum Domeli 2 7.8±0.2 Dark gray to

black

Dark gray to

black

Irregular Thin flat

19 ACT42 Attock Fateh Jang 2 8±0.1 Light to dark

gray

Dark gray to

black


20 ACT7 Taxila Wah 3 5.8±0.2 Light gray to

black

Dark gray to

black

Colony is

radiating, flat or

few sparse

hyphae, abundant

acervuli and few

conidial masses

near the

inoculation point

Irregular Submerged

21 ACT12 Jhelum Sohawa 3 5.8±0.2 Dark gray to

black

Dark gray to

black

Irregular Thin flat


Shah

Dulmial 3 6.3±0.2 Dark gray to

black

Dark gray to

black

Irregular Submerged

23 ACT19 Kallar

Kahar

Miani 3 6.7±0.1 Light gray to

black

Dark gray to

black

Irregular Submerged

24 ACT23 Chakwal Dab 3 5.2±0.2 Dark gray to

black

Dark gray to

black

Irregular Thin flat

25 ACT25 Chakwal Thoa

Bahdar

3 5.8±0.2 Light gray to

black

Dark gray to

black

Irregular Submerged

26 ACT27 Taxila Wah 3 5.3±0.2 Dark gray to

black

Dark gray to

black

Irregular Thin flat

27 ACT34 Gujar Khan Jatli 3 5.6±0.2 Dark gray to

black

Dark gray to

black

Irregular Submerged

28 ACT45 Chakwal Bhoun 3 5.8±0.2 Light gray to

black

Dark gray to

black

Irregular Thin flat

29 ACT6 Attock Bahter 4 8.4±0.2 Dark gray to

black

Black


30 ACT8 Rawalpindi Dhoke

Budhal


black

Black Irregular Medium fluffy

60

31 ACT15 Gujar Khan Doltala 4 8.1±0.2 Dark gray to

black

Black 2-3 concentric

rings, abundant

dense acervuli

with few conidial

masses


32 ACT18 Kallar

Kahar

Miani 4 7.5±0.2 Dark gray to

black


33 ACT33 Kallar

Kahar

Buchal

Kalan


black


34 ACT38 Rawalpindi Dhoke

Budhal


black


35 ACT40 Gujar Khan Sukho 4 7.5±0.1 Dark gray to

black


36 ACT4 Islamabad Rawat 5 5.7±0.2 Pale gray Cream to dark

gray

Regular colony,

scattered acervuli

and abundant light

orange conidial

masses


37 ACT14 Attock Fateh Jang 5 6.3±0.1 Light to dark

gray

Dark gray to

black

Regular Medium fluffy

38 ACT16 Gujar Khan Jatli 5 6.5±0.1 Pale gray Cream to dark

gray


39 ACT22 Rawalpindi Chauntra 5 7.2±0.2 Pale gray Cream to dark

gray


40 ACT28 Chakwal Dhudial 5 7.5±0.1 Light to dark

gray

Dark gray to

black



Shah

Dulmial 5 6.1±0.1 Light to dark

gray

Dark gray to

black


42 ACT36 Gujar Khan Jatli 5 6.5±0.1 Pale gray Cream to dark

gray


43 ACT39 Islamabad Rawat 5 6.6±0.1 Pale gray Cream to dark

gray


44 ACT46 Taxila Taxila 5 6.2±0.1 Light to dark

gray

Dark gray to

black


45 ACT47 Chakwal Dab 5 6.9±0.1 Pale gray Cream to dark

gray


61

Table 4.8: Microscopic characteristics of C. truncatum

Sr. No Isolate Tehsil Location Group Conidia Appressoria Setae

Length (μm) Width (μm) Length (μm) Width (μm) Length (μm) Width (μm)

1 ACT5 Chakwal Dhudial 1 24.4±2.1 2.4±0.1 9.3±1.5 5.8±0.2 94±2.7 4.4±0.2

2 ACT11 Chakwal Bhoun 1 23.3±2.9 2.4±0.3 9.8±1.7 5.5±0.3 87.4±3.2 4.3±0.3

3 ACT13 Taxila Taxila 1 26±2.3 2.5±0.3 10.4±2.5 6±0.4 124.8±4.5 5.2±0.3

4 ACT24 Gujar Khan Sukho 1 26.8±1.3 2.5±0.1 13.1±1.3 6±0.7 102.6±5.7 4±0.2

5 ACT32 Rawalpindi Chak Beli Khan 1 23.5±2.4 2.5±0.2 9.3±1.2 5.9±0.7 92.2±3.2 4.2±0.2

6 ACT43 Rawalpindi Chakri 1 25.8±1.6 2.3±0.1 10±1.8 5.6±0.3 103.8±4.3 4±0.2

7 ACT44 Attock Bahter 1 24±2.3 2.4±0.1 9.7±1.5 5.5±0.2 104.4±4.5 5.3±0.2

8 ACT2 Chakwal Dab 2 23.9±2 2.5±0.1 11.1±1.2 6.5±0.5 125.6±3.5 4.5±0.2

9 ACT9 Chakwal Thoa Bahdar 2 23.7±1.5 2.5±0.2 10.5±3.3 6.1±0.7 97±6.1 5.5±0.3

10 ACT10 Rawalpindi Adyala 2 24.3±2 2.4±0.1 10.6±3.1 6±0.4 119.2±4.7 4.4±0.3


Shah

Dalelpur 2 25±1.2 2.4±0.1 9.8±2.2 6.5±0.8 91.4±4.4 4.4±0.3

12 ACT21 Rawalpindi Chauntra 2 25.4±1.4 2.4±0.1 8.2±1.4 5.4±0.8 104.4±6.7 4.9±0.1

13 ACT26 Rawalpindi Chakri 2 25.2±1.7 2.4±0.1 12.9±1.8 5.9±0.5 125±3.7 4.1±0.2

62


Shah

Dalelpur 2 25.6±1.1 2.5±0.2 11.6±2.6 6.5±0.5 100±4.7 4.1±0.1

15 ACT30 Gujar Khan Doltala 2 26±1 2.5±0.2 11.1±1.4 6.0±0.7 119.6±3.4 4.1±0.1

16 ACT35 Rawalpindi Adyala 2 25.4±0.7 2.4±0.1 12.4±1.9 6.2±0.3 94.6±4.3 5.2±0.2

17 ACT37 Jhelum Domeli 2 25.5±1.2 2.4±0.1 11.9±2 6.1±0.3 86±3.1 4.6±0.2

18 ACT41 Jhelum Domeli 2 24.3±1.6 2.4±0.2 11±1.3 6±0.4 119±4.5 5.3±0.2

19 ACT42 Attock Fateh Jang 2 26±1.6 2.5±0.1 11.2±1 6.2±0.4 111.4±4.8 4.7±0.2

20 ACT7 Taxila Wah 3 25.3±0.8 2.4±0.1 9.7±1.8 6.2±0.2 95.8±2.9 4.1±0.2

21 ACT12 Jhelum Sohawa 3 25±1.7 2.3±0.1 12.3±2.6 6.1±0.4 92.2±3.9 4.8±0.3


Shah

Dulmial 3 23±2.3 2.4±0.1 11.3±1.2 6.4±0.4 90.2±1.8 4.1±0.1

23 ACT19 Kallar Kahar Miani 3 24±1.6 2.3±0.1 11.8±1.3 6.1±0.6 124.4±3.5 4±0.2

24 ACT23 Chakwal Dab 3 22.5±1.7 2.5±0.2 10.9±1.4 6.7±0.4 104.6±4.6 5.2±0.2

25 ACT25 Chakwal Thoa Bahdar 3 23.2±2.8 2.4±0.2 13.0±1.7 6.6±0.4 114.4±6.8 4.4±0.3

26 ACT27 Taxila Wah 3 22.3±1.8 2.5±0.3 12.6±1.9 6.3±0.3 119.2±3 5.2±0.2

27 ACT34 Gujar Khan Jatli 3 22±2.4 2.5±0.2 10.3±1.7 6.3±0.2 116.4±8.4 4.5±0.1

28 ACT45 Chakwal Bhoun 3 23.4± 2.3±0.2 10.7±2.1 6.3±0.6 98±9.7 4±0.2

29 ACT6 Attock Bahter 4 25.7±1.1 2.5±0.2 12.5±0.9 6.6±0.5 88±2.9 4.8±0.2

63

30 ACT8 Rawalpindi Dhoke Budhal 4 26.1±0.7 2.5±0.2 11.9±1.3 6.5±0.1 118.4±2.4 4.2±0.2

31 ACT15 Gujar Khan Doltala 4 26.4±1.1 2.6±0.2 12.6±1.5 6.7±0.4 101.8±7.9 3.9±0.2

32 ACT18 Kallar Kahar Miani 4 26.7±1.2 2.4±0.1 11.3±0.8 6.5±0.4 117.6±3.4 5.1±0.2

33 ACT33 Kallar Kahar Buchal Kalan 4 27.3±1.1 2.5±0.2 12.4±2.1 6.5±0.2 96.2±2.9 4.7±0.2

34 ACT38 Rawalpindi Dhoke Budhal 4 26.5±0.9 2.5±0.1 13.3±1.8 6.4±0.1 93±3.2 4.6±0.3

35 ACT40 Gujar Khan Sukho 4 27±1.6 2.6±0.1 12.5±1.5 6.3±0.6 88±4.5 5.1±0.2

36 ACT4 Islamabad Rawat 5 25.3±0.6 2.5±0.2 11.8±0.7 6.0±0.7 120.2±3.3 4.2±0.2

37 ACT14 Attock Fateh Jang 5 25.5±1.4 2.4±0.1 12.2±0.7 5.8±0.8 113.8±4.2 4.1±0.1

38 ACT16 Gujar Khan Jatli 5 24.5±1.1 2.5±0.2 10.7±2.2 6.3±0.3 96±2.9 4.2±0.2

39 ACT22 Rawalpindi Chauntra 5 26.4±1.4 2.4±0.1 11±0.5 6.2±0.2 95.8±2.8 5.4±0.1

40 ACT28 Chakwal Dhudial 5 24.5±1 2.4±0.1 12.2±1.9 6.5±0.6 89.2±4.4 5.5±0.2


Shah

Dulmial 5 25±1.9 2.4±0.1 12.3±1.8 6.3±0.6 117.8±1.9 4.1±0.2

42 ACT36 Gujar Khan Jatli 5 25.7±1.1 2.4±0.1 11.9±1.1 6.3±0.4 101.6±2.9 5.5±0.2

43 ACT39 Islamabad Rawat 5 27±1 2.3±0.1 10.8±1 6.1±0.4 94±1.6 4.6±0.3

44 ACT46 Taxila Taxila 5 23±2.5 2.5±0.2 12.2±0.8 6.6±0.3 83.6±1.3 4.6±0.2

45 ACT47 Chakwal Dab 5 26±1.2 2.4±0.1 11.8±0.8 6±0.4 111.4±2.7 4.6±0.1

64

4.5.2 Morphological Characterization of Fusarium incarnatum


The colony diameter of F. incarnatum isolates after seven days of incubation was

shown in Table 4.9. The isolates, FICW5 (8.3±0.2) and FICW16 (8.3±0.3) were

having the highest growth rate among all isolates. On the other hand, the isolate

FICW40 was the slowest growing (6.0±0.1).

4.5.2.2 Colony color

The colonies on PDA media were shown to have variation in colony color with beige,

pale cream, white and white to light beige color. The colonies of isolates, viz. FICW4,

FICW18, FICW24, FICW31, FICW33 and FICW38 were white to light beige with

beige coloration on the reverse side of petri dish (Figure 4.29). The twenty-three

isolates viz. FICW1, FICW2, FICW5, FICW6, FICW7, FICW9, FICW10, FICW11,

FICW14, FICW16 and FICW17, FICW19, FICW21, FICW25, FICW29, FICW30,

FICW32, FICW34, FICW35, FICW36, FICW37, FICW39 and FICW40 produced

white colonies having beige or pale cream coloration at reverse (Figure 4.30).

The isolates of F. incarnatum produced white aerial mycelium having salmon

coloration on the reverse side of PDA medium (Ramdial & Rampersad, 2015).

Figure 4.29: a. Colonies of F. incarnatum having white color b. beige to pale cream

coloration on the reverse side of petri dish

65

Figure 4.30: a. Colonies of F. incarnatum having white to light beige color b. beige

coloration on the reverse side of petri dish

4.5.2.3 Texture

The F. equiseti isolates showed medium fluffy and fluffy texture. The fifteen

isolates, viz. FICW2, FICW5, FICW7, FICW9, FICW11, FICW14, FICW18,

FICW21, FICW29, FICW30, FICW31, FICW33, FICW35, FICW36 and FICW37

showed medium fluffy texture. While the remaining 23 isolates (56.1%) exhibited

medium fluffy texture. The fifteen isolates viz. FICW1, FICW4, FICW6, FICW10,

FICW16, FICW17, FICW19, FICW24, FICW25, FICW32, FICW34 and FICW38

were fluffy in texture. However, isolates used in Ramdial et al. (2015) produced dense

mycelium.

4.5.2.4 Sporodochia

Sporodochia were orange in color and formed by six isolates viz. FICW7,

FICW14, FICW21, FICW29, FICW35 and FICW39. Whereas, the remaining

seventeen isolates did not produce sporodochia on PDA media. Sporodochia may not

be obvious in culture media since they can be masked by the mycelium (Leslie,

Summerell, & Bullock, 2006).

4.5.2.5 Conidia and conidiophores

Microscopic examinations showed the presence of hyaline and septate hyphae and

presence of microconidia, mesoconidia and macroconidia in all the isolates (Figure

66

4.31). Microconidia were hyaline, obovate or pyriform and 0-1 septate. The isolate

FICW11 had the longest (4.5±0.3) micro-conidia. Whereas, isolates viz. FICW6,

FICW21 and FICW38 had the shortest (3.8±0.2 μm) micro-conidia. The isolates

FICW9, FICW10, FICW11, FICW14, FICW19 and FICW24 had the widest (3.9±0.2)

micro-conidia and the isolate FICW39 had the narrowest micro-conidia (3.1±0.5).

Mesoconidia were hyaline, fusoid, spindle-shaped and usually 3 septate. The

meso-conidia of isolate FICW30 and FICW6 were the longest (14.4±1.4 μm) and

shortest (11.3±1.3) respectively. The isolate FICW31 and FICW2 produced the widest

(4.3±0.3 μm) and the narrowest (3.6±0.4 μm) meso-conidia respectively.

Macroconidia were hyaline, cylindrical, slightly curved, tapered at the apex and 3-

5 septate. The macro-conidia of isolate FICW31 and FICW18 were the longest

(34.3±1.8 μm) and shortest (29.7±2.3 μm) respectively. The isolate FICW19 and

FICW34 produced the widest (4.5±0.3 μm) and narrowest (3.8±0.2 μm) macro-

conidia.

In this study the isolates produced monophialidic and polyphialidic conidiophores

(Figure 4.32). Six isolates viz. FICW5, FICW9, FICW16, FICW32, FICW33 and

FICW38 produced polyphialidic conidiophores. The conidiophores of three isolates

including FICW11, FICW21 and FICW36 were monophialidic. The rest of all isolates

developed both monophialidic and polyphialidic conidiophores.

Morphology of F. incarnatum showed resemblance with the characters described

by previous researchers (Leslie et al., 2006; Refai, Hassan, & Hamed, 2015).

Figure 4.31: Micro-conidia, meso-conidia and macro-conidia of F. incarnatum (light

microscope, x1000) stained with cotton blue, Scale bar=10 μm

67

Table 4.9:Cultural characteristics of Fusarium incarnatum

Sr.

No Isolate Tehsil Location

Colony

diameter

(cm)

Colony color

(Front)

Colony color

(Reverse) Margins Texture Sporodochia

1 FICW1 Chakwal Bhoun 7.4±0.1 White Beige Regular Fluffy Not obvious

2 FICW2 Chakwal Thoa Bahdar 6.7±0.2 White Beige Irregular Medium fluffy Not obvious

3 FICW4 Chakwal Dab 7.1±0.1 White to light

beige

Beige Regular Fluffy Present

4 FICW5 Chakwal Dhudial 8.3±0.2 White Beige Regular Medium fluffy Not obvious

5 FICW6 Kallar Kahar Miani 6.2±0.2 White Pale cream Regular Fluffy Not obvious

6 FICW7 Kallar Kahar Buchal Kalan 7.7±0.1 White Pale cream Regular Medium fluffy Present

7 FICW9 Choa Saidan Shah Dulmial 7.2±0.2 White Beige Irregular Medium fluffy Not obvious

8 FICW10 Choa Saidan Shah Dalelpur 6.1±0.1 White Beige Irregular Fluffy Not obvious

9 FICW11 Jhelum Sohawa 8.0±0.2 White Beige Regular Medium fluffy Not obvious

10 FICW14 Jhelum Domeli 8.2±0.2 White Beige Irregular Medium fluffy Present

11 FICW16 Gujar Khan Jatli 8.3±0.3 White Beige Regular Fluffy Not obvious

12 FICW17 Gujar Khan Daultala 7.2±0.2 White Pale cream Irregular Fluffy Not obvious

13 FICW18 Gujar Khan Sukho 7.0±0.2 White to light

beige

Beige Regular Medium fluffy Present

14 FICW19 Taxila Taxila 6.6±0.1 White Pale cream Regular Fluffy Not obvious

68

15 FICW21 Taxila Wah 7.5±0.1 White Pale cream Regular Medium fluffy Present

16 FICW24 Rawalpindi Adyala 8.1±0.2 White to light

beige

Beige Regular Fluffy Present

17 FICW25 Rawalpindi Chakri 7.2±0.2 White Pale cream Regular Fluffy Not obvious

18 FICW29 Rawalpindi Chak Beli

Khan

7.5±0.2 White Pale cream Regular Medium fluffy Present

19 FICW30 Rawalpindi Dhoke

Budhal

7.2±0.2 White Pale cream Irregular Medium fluffy Not obvious

20 FICW31 Rawalpindi Chauntra 7.5±0.2 White to light

beige

Beige Irregular Medium fluffy Not obvious

21 FICW32 Attock Bahter 6.3±0.2 White Beige Regular Fluffy Not obvious

22 FICW33 Attock Fateh Jang 7.0±0.1 White to light

beige

Beige Regular Medium fluffy Present

23 FICW34 Islamabad Chak

Shehzad

8.1±0.1 White Pale cream Regular Fluffy Not obvious

24 FICW35 Islamabad Rawat 7.1±0.1 White Pale cream Regular Medium fluffy Present

25 FICW36 Chakwal Thoa Bahdar 6.7±0.1 White Pale cream Regular Medium fluffy Not obvious


Budhal

8.2±0.2 White Pale cream Irregular Medium fluffy Not obvious

27 FICW38 Islamabad Rawat 6.4±0.1 White to light

beige

Beige Regular Fluffy Not obvious

28 FICW39 Attock Bahter 7.2±0.1 White Pale cream Irregular Fluffy Present


Shehzad

6.0±0.1 White Pale cream Regular Fluffy Not obvious

69

Table 4.10: Microscopic characteristics of Fusarium incarnatum

Sr.


Micro-conidia Meso-conidia Macro-conidia

Phialide

Length (µm) Width (µm) Length (µm) Width (µm) Length (µm) Width (µm)

1 FICW1 Chakwal Bhoun 4.1±0.3 3.7±0.4 13.5±1 3.9±0.1 33.4±1.4 4.1±0.4 Monophialide,

polyphialide

2 FICW2 Chakwal Thoa Bahdar 4.1±0.5 3.5±0.4 13.9±2.2 3.6±0.4 32.8±2.9 4.1±0.3 Monophialide,

polyphialide

3 FICW4 Chakwal Dab 4.2±0.4 3.7±0.3 13.6±2 3.9±0.1 33.4±2.3 4.1±0.5 Monophialide,

polyphialide

4 FICW5 Chakwal Dhudial 3.9±0.2 3.6±0.6 13.5±2.2 4.2±0.4 31.7±3.1 4.3±0.4 Polyphialide

5 FICW6 Kallar Kahar Miani 3.8±0.2 3.6±0.4 11.3±1.3 3.9±0.2 32.8±3.1 4.2±0.3 Monophialide,

polyphialide

6 FICW7 Kallar Kahar Buchal Kalan 4.0±0.3 3.7±0.4 12.9±2.2 4.1±0.4 31.6±2.9 4.2±0.4 Monophialide,

polyphialide

7 FICW9 Choa Saidan

Shah Dulmial 3.9±0.4 3.9±0.2 13.4±1.7 4.2±0.3 30.5±2.2 4.3±0.3

Polyphialide

8 FICW10 Choa Saidan

Shah Dalelpur 4.0±0.5 3.9±0.2 13.6±1.4 4±0.5 33.4±2.7 4.1±0.4

Monophialide,

polyphialide

9 FICW11 Jhelum Sohawa 4.5±0.3 3.9±0.2 13.7±1.5 3.9±0.2 33±3.9 4.4±0.2 Monophialide,

10 FICW14 Jhelum Domeli 3.8±0.3 3.9±0.2 13.1±1.1 3.9±0.2 33.7±1.2 4.3±0.4 Monophialide,

polyphialide

11 FICW16 Gujar Khan Jatli 3.9±0.4 3.8±0.2 14.2±2.2 4.2±0.3 32.9±3 4.1±0.4 Polyphialide

12 FICW17 Gujar Khan Daultala 3.9±0.2 3.8±0.3 12.9±1.5 3.9±0.3 33.2±1.6 4.2±0.5 Monophialide,

polyphialide

13 FICW18 Gujar Khan Sukho 4.1±0.3 3.7±0.4 12.4±1.4 3.9±0.2 29.7±2.3 4.3±0.3 Monophialide,

polyphialide

14 FICW19 Taxila Taxila 3.8±0.3 3.9±0.2 12.8±1.6 4.2±0.2 31.9±2.9 4.5±0.3 Monophialide,

polyphialide

70

15 FICW21 Taxila Wah 3.8±0.2 3.7±0.3 14.1±0.6 4±0.4 31±2.3 3.9±0.2 Monophialide

16 FICW24 Rawalpindi Adyala 4.1±0.2 3.9±0.2 13.9±0.9 3.9±0.2 32.8±2.2 4.3±0.3 Monophialide,

polyphialide

17 FICW25 Rawalpindi Chakri 4±0.4 3.6±0.5 13.4±0.7 3.8±0.2 33.2±2.4 4.4±0.3 Monophialide,

polyphialide

18 FICW29 Rawalpindi Chak Beli

Khan 4.0±0.3 3.6±0.5 14.1±0.8 3.8±0.2 31.6±2.5 4.4±0.3

Monophialide,

polyphialide


Budhal 4±0.3 3.7±0.2 14.4±1.4 4.0±0.3 32.3±1.9 4.3±0.4

Monophialide,

polyphialide

20 FICW31 Rawalpindi Chauntra 4.1±0.3 3.7±0.3 14.2±2 4.3±0.3 34.3±1.8 4.1±0.2 Monophialide,

polyphialide

21 FICW32 Attock Bahter 4±0.4 3.8±0.2 14.1±1.1 4.1±0.3 33.7±2.5 4.3±0.4 Polyphialide

22 FICW33 Attock Fateh Jang 3.9±0.4 3.7±0.6 13.8±0.9 4.1±0.3 31.9±1.7 4.4±0.3 Polyphialide


Shehzad 4±0.6 3.6±0.5 11.3±2.6 4.2±0.2 31.5±2.6 3.8±0.2

Monophialide,

polyphialide

24 FICW35 Islamabad Rawat 4.1±0.4 3.6±0.3 12.6±1.5 4.1±0.4 33.9±1.3 4.1±0.4 Monophialide,

polyphialide

25 FICW36 Chakwal Thoa Bahdar 3.8±0.3 3.5±0.4 14.1±1.3 4.1±0.2 31.6±3 3.9±0.3 Monophialide


Budhal 3.9±0.2 3.6±0.2 13.4±1.1 4.1±0.3 31.7±2 4.1±0.3

Monophialide,

polyphialide

27 FICW38 Islamabad Rawat 3.8±0.2 3.6±0.3 13.9±0.7 3.8±0.4 33.7±2.3 4.1±0.4 Polyphialide

28 FICW39 Attock Bahter 4.1±0.5 3.1±0.5 13.8±1.4 4.1±0.3 33.0±2 4.2±0.6 Monophialide,

polyphialide


Shehzad

4.3±0.4

3.4±0.4 12.7±2.9 3.9±0.3 31.4±3.1 3.9±0.2

Monophialide,

polyphialide

71

Figure 4.32: Monophialidic and polyphialidic conidiophores of F. incarnatum

4.5.3 Morphological Characterization of Fusarium proliferatum


The isolate, FICW3 was the fastest growing (7.9±0.1 cm) among all isolates after

seven days of incubation on PDA. The isolate FICW23 and FICW27 was the slowest

growing (6.2±0.1 cm) (Table 4.11).


The colonies of F. proliferatum produced whitish colony, becoming tinged in

purple grey color. Colonies produced dark purple coloration on reverse side of petri

dishes (Figure 4.33). Pigments produced on PDA varied from colorless, violet to

almost black (Leslie et al., 2006).

4.5.3.3 Texture

All the isolates of F. proliferatum in this study showed medium fluffy texture.

4.5.3.4 Sporodochia

Sporodochia were not obvious on culture plate in all isolates. The sporodochia

often are developed infrequently or are difficult to find since they can be obscured

by the mycelium (Leslie, Summerell, & Bullock, 2006).


72


presence of microconidia and macroconidia in all the isolates. Microconidia formed

abundantly, hyaline, single-celled, oval to club-shaped and have a flattened base

(Figure 4.34). The isolate FICW22 and FICW12 had the longest (9.7±1.4) and

shortest (5.7±0.9) micro-conidia respectively. The isolates FICW8, FICW15, FICW27

and FICW28 had the widest (3.4±0.3 μm) micro-conidia. Whereas, the isolate

FICW12 had the narrowest (2.6±0.5 μm) micro-conidia.

Macro-conidia were hyaline, slightly sickle shaped to straight and 3-5 septate. The

macro-conidia of isolate FICW13 and FICW26 was the longest (40.9±1.2 μm) and

shortest (25.9±1.1 μm) respectively. The isolate FICW27 and FICW20 produced the

widest (3.8±0.2 μm) and narrowest (1.8±0.3 μm) macro-conidia. Chlamydospores

were absent in all the isolates (Table 4.12).

In this study the isolates produced monophialidic and polyphialidic conidiophores

(Figure 4.35). The two isolates viz. FICW12 and FICW22 produced monophialidic

conidiophores. Whereas, the remaining isolates developed both monophialidic and

polyphialidic conidiophores. Conidial morphology of F. incarnatum showed

resemblance with the characters described in previous studies (Leslie et al., 2006;

Nelson, Toussoun, & Marasas, 1983; Refai et al., 2015).

Figure 4.33: a. Purple-grey colonies of F. proliferatum b. dark purple coloration on

reverse side of PDA media

73

Table 4.11: Cultural characteristics of Fusarium proliferatum

Sr.


Colony

diameter

Colony color

(Front)

Colony color

(Reverse) Margins Texture Sporodochia

1 FICW3 Taxila Taxila 7.9±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

2 FICW8 Chakwal Dhudial 6.5±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

3 FICW12 Kallar Kahar Miani 6.9±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

4 FICW13 Kallar Kahar Miani 7.2±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

5 FICW15 Attock Bahter 7.0±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

6 FICW20 Jhelum Domeli 6.6±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

7 FICW22 Jhelum Sohawa 7.6±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

8 FICW23 Islamabad Rawat 6.2±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

9 FICW26 Islamabad Rawat 7.3±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

10 FICW27 Gujar Khan Sukho 6.2±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

11 FICW28 Gujar Khan Jatli 7.3±0.1 Purple grey Dark purple Irregular Medium fluffy Not obvious

74

Table 4.12: Microscopic characteristics of Fusarium proliferatum

Sr. No Isolate Tehsil Location

Micro-conidia Macro-conidia

Phialide

Length (µm) Width (µm) Length (µm) Width (µm)

1 FICW3 Taxila Taxila 6.2±0.6 3.3±0.4 31.4±0.9 2.7±0.4 Monophialide,

polyphialide

2 FICW8 Chakwal Dhudial 8.4±1.7 3.4±0.3 26.5±1.4 2.1±0.2 Monophialide,

polyphialide

3 FICW12 Kallar Kahar Miani 5.7±0.9 2.6±0.5 35.2±1 3.5±0.5 Monophialide

4 FICW13 Kallar Kahar Miani 7.5±0.7 3.0±0.4 40.9±1.2 2.7±0.5 Monophialide,

polyphialide

5 FICW15 Attock Bahter 6.2±1 3.4±0.3 27.7±1.1 3.5±0.4 Monophialide,

polyphialide

6 FICW20 Jhelum Domeli 8.4±1.4 3.0±0.4 38.6±1.5 1.8±0.3 Monophialide,

polyphialide

7 FICW22 Jhelum Sohawa 9.7±1.4 3.3±0.5 27.0±2.1 2.9±0.3 Monophialide

8 FICW23 Islamabad Rawat 8.0±1.8 3.1±0.4 27.7±2.2 3.2±0.5 Monophialide,

polyphialide

9 FICW26 Islamabad Rawat 7.0±0.7 3.2±0.3 25.9±1.1 3.7±0.4 Monophialide,

polyphialide

10 FICW27 Gujar Khan Sukho 9.0±1 3.4±0.3 26.8±1.5 3.8±0.2 Monophialide,

polyphialide

11 FICW28 Gujar Khan Jatli 6.6±2.4 3.4±0.3 31.1±1.3 3.2±0.3 Monophialide,

polyphialide

75

Figure 4.34: Conidia, of F. incarnatum (light microscope, x1000) stained with cotton


Figure 4.35: Monophialidic conidiophores of F. proliferatum b. Polyphialidic

conidiophores of F. proliferatum

4.5.4 Morphological Characterization of Botrytis cinerea


Five isolates, viz. NRCB08, NRCB11, NRCB20, NRCB25 and NRCB32 were

found to be the fastest growing with colony diameter 9.0±0 cm after 7 days of

incubation. The isolates NRCB40 (6.3±0.1 cm) was the slowest growing as compared

to others (Table 4.13).


The colonies of B. cinerea appeared to have variety of colors on PDA i.e. white to

light gray, light gray, light to dark gray and dark gray. The twelve isolates viz.

76

NRCB02, NRCB05, NRCB08, NRCB10, NRCB15, NRCB18, NRCB21, NRCB24,

NRCB26, NRCB32, NRCB37 and NRCB39 were dark gray in color with the light

gray coloration in reverse. The colonies of NRCB11, NRCB13, NRCB16, NRCB17,

NRCB23, NRCB25, NRCB27, NRCB29 and NRCB36 isolates were light gray with

white to light gray color in reverse. The isolates viz. NRCB03, NRCB07, NRCB12,

NRCB19, NRCB28, NRCB34 and NRCB40 had light to dark gray colonies with light

gray or creamish white coloration in reverse. The colonies of isolates NRCB01,


NRCB33, NRCB35 and NRCB38 were white to light gray in color with light gray,

white to light gray and creamish white coloration in reverse. B. cinerea produces

white to gray colonies on PDA and other culture medium (Cantu, Greve, Labavitch, &

Powell, 2009).

4.5.4.3 Texture

The colonies of Botrytis cinerea isolates were diverse in texture. The isolates viz.

NRCB02, NRCB06, NRCB20, NRCB22, NRCB31, NRCB33, NRCB35 and

NRCB38 developed aerial mycelial masses without sporulation after 7 days of

incubation at 25±2ºC. The isolates NRCB05, NRCB08, NRCB10, NRCB15,


NRCB39 developed aerial mycelial masses with sporulation. The isolates viz.

NRCB04, NRCB07, NRCB19, NRCB25, NRCB27, NRCB34 and NRCB36 had a

fewer short mycelium without sporulation. The isolates NRCB03, NRCB11,

NRCB12, NRCB13, NRCB23, NRCB28 and NRCB40 had thick and wooly

mycelium. The mycelial growth of isolates viz. NRCB01, NRCB09, NRCB14,

NRCB16, NRCB29 and NRCB30 were comparatively sparse in texture (Figure 4.36).

4.5.4.4 Sclerotia

The sclerotia were initially white to cream later turning black in color, solitary to

aggregated and developed at the surface of colony. The fourteen isolates (35%) had

round sclerotia and twenty-six isolates (65%) developed round to irregular sclerotia.

The eight isolates (20%) viz. NRCB05, NRCB12, NRCB17, NRCB20, NRCB21,

NRCB24, NRCB32 and NRCB33 formed sclerotia predominantly at periphery of

petri dish. The formation of sclerotia by eleven isolates (27.5%) viz. NRCB03,

77


NRCB36 and NRCB39 were few and scattered. The twenty-one isolates (52.5%)

developed abundant sclerotia on whole petri dish (Figure 4.37).

The isolate NRCB16 had the longest sclerotia, averaging 9.1±0.4 mm, while

isolate NRCB18 (2.8±0.6) had the shortest. Sclerotia of isolate NRCB21 was the

widest, with an average of 5.1±0.4 mm. Isolate NRCB17 was the narrowest,

averaging 2.1±0.4 mm (Table 4.14). Black, melanized, spherical or elongated

sclerotia, 3-5 mm in length are developed under unfavorable conditions in planta and

in vitro (Elmer & Michailides, 2007).


The mycelium was septate, branched, hyaline to brown. Conidia were unicellular,

hyaline or pale brown, ovoid to ellipsoid. Conidiophores were more or less erect,

hyaline or pale to dark brown (Figure 4.38), branched at the apex dichotomously and

measured 14 to 31 μm long. Isolate NRCB20 had the longest conidia, averaging

10.9±0.3 μm, while isolates viz. NRCB15 (7.2±0.8 μm) and NRCB32 (7.2±0.6 μm)

had the shortest conidia. Isolate NRCB21 was the widest (5.1±0.4 μm) and isolate

NRCB17 had the narrowest (2.1±0.4 μm) conidia (Table 4.14). Average conidial

dimension fell in the range of 6.3-11.3 × 4.7-7.6 μm. The conidial dimensions (6-18 ×

4-11 μm) and conidiophores ranged 16-30 μm were almost consistent with that

described by (Ellis & Waller, 1974). B. cinerea had hyaline, branched, filamentous

and septate hyphae with prominent cell wall (Cantu et al., 2009). Most isolates

produce abundant unicellular conidia, smooth, ovoid to ellipsoid, hyaline to slightly

colored conidia, and measure 10-12 × 8-10 μm. Conidia are borne on short sterigmata

with the swollen tips of aerial hyphae and branched conidiophores (Elad, Williamson,

Tudzynski, & Delen, 2004).

4.5.5 Morphological Characterization of Alternaria alternata


Two isolates, viz. ASA11 and ASA29 were the fastest growing with colony

diameter 8.6±0.1cm after 7 days of incubation. The isolate ASA5 (5.5±0.1 cm) was

the slowest growing as compared to others (Table 4.15).

78

Figure 4.36: Colonies of B. cinerea developed a. aerial mycelial masses without

sporulation b. aerial mycelial masses with sporulation c. short mycelium without

sporulation d. thick and wooly mycelium e. thin sparse hyphae.

79

Figure 4.37: Sclerotia of B. cinerea a. solitary to aggregated sclerotia b. round

sclerotia on whole petri dish c. abundant round to irregular sclerotia on whole petri

dish d. Round sclerotia predominantly at periphery of petri dish e. Few scattered

sclerotia.

80

Table 4.13: Cultural characteristics of Botrytis cinerea

Sr.


Colony

Margins Texture

Sclerotium

Diameter Color

(Front)

Color

(Reverse) Color Formation Location Shape

1 NRCB01 Islamabad Chak

Shehzad

7.0±0.1 White to

light gray

White to

light gray

Irregular Thin flat Black on whole

petri dish

Surface Round to

irregular


Shehzad

8.9±0.1 Dark gray Light gray Irregular Aerial mycelial

masses

Black on whole

petri dish

Surface Round

3 NRCB03 Islamabad Rawat 7.7±0.1 Light to

dark gray

Creamish

white

Irregular Thick and

woolly

mycelium

Black Scattered Surface Round to

irregular

4 NRCB04 Islamabad Rawat 7.2±0.1 White to

light gray

Light gray Irregular short mycelium

without

sporulation

Black on whole

petri dish

Surface Round to

irregular

5 NRCB05 Rawalpindi Adyala 8.3±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation

Black Peripheral Surface Round to

irregular

6 NRCB06 Rawalpindi Adyala 6.9±0.1 White to

light gray

White to

light gray

Irregular aerial mycelial

masses

Black on whole

petri dish

Surface Round to

irregular

7 NRCB07 Rawalpindi Chauntra 8.9±0.1 Light to

dark gray


without

sporulation


irregular

8 NRCB08 Rawalpindi Chauntra 9.0±0 Dark gray Light gray Irregular aerial

mycelium with

sporulation

Black on whole

petri dish

Surface Round

9 NRCB09 Attock Bahtar 7.0±0.1 White to

light gray

White to

light gray


petri dish

Surface Round to

irregular

81

10 NRCB10 Attock Bahtar 8.6±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation

Black on whole

petri dish

Surface Round

11 NRCB11 Attock Hasan

Abdal

9.0±0.1 Light gray White to

light gray

Irregular thick and

woolly

mycelium


irregular

12 NRCB12 Jhelum Domeli 7.4±0.1 Light to

dark gray

Light gray Irregular thick and

woolly

mycelium

Black Peripheral Surface Round

13 NRCB13 Jhelum Domeli 8.4±0.1 Light gray White to

light gray

Irregular thick and

woolly

mycelium

Black on whole

petri dish

Surface Round to

irregular

14 NRCB14 Jhelum Domeli 7.1±0.1 White to

light gray

White to

light gray


petri dish

Surface Round

15 NRCB15 Taxila Taxila 7.3±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation


irregular

16 NRCB16 Taxila Taxila 7.7±0.1 Light gray White to

light gray


petri dish

Surface Round to

irregular

17 NRCB17 Chakwal Bhoun 8.3±0.1 Light gray White to

light gray

Irregular aerial

mycelium with

sporulation

Black Central Surface Round to

irregular

18 NRCB18 Chakwal Bhoun 7.5±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation

Black on whole

petri dish

Surface Round

19 NRCB19 Chakwal Thoa

Bahdar

7.2±0.1 Light to

dark gray


without

sporulation

Black on whole

petri dish

Surface Round to

irregular

82

20 NRCB20 Gujar

Khan

Jatli 9.0±0 White to

light gray

White to

light gray


masses

Black Central Surface Round to

irregular

21 NRCB21 Gujar

Khan

Daultala 8.7±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation


22 NRCB22 Kallar

Kahar

Miani 7.4±0.1 White to

light gray

Creamish

white


masses


irregular

23 NRCB23 Kallar

Kahar

Miani 8.2±0.1 Light gray White to

light gray

Irregular thick and

woolly

mycelium

Black on whole

petri dish

Surface Round to

irregular


Shehzad

7.2±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation



Shehzad

9.0±0 Light gray White to

light gray

Irregular short mycelium

without

sporulation

Black on whole

petri dish

Surface Round to

irregular

26 NRCB26 Taxila Taxila 8.9±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation

Black Scattered Surface Round

27 NRCB27 Taxila Taxila 7.6±0.1 Light gray White to

light gray


without

sporulation

Black on whole

petri dish

Surface Round to

irregular

28 NRCB28 Taxila Taxila 6.5±0.1 Light to

dark gray

Creamish

white

Irregular thick and

woolly

mycelium

Black on whole

petri dish

Surface Round to

irregular

29 NRCB29 Chakwal Thoa

Bahdar

7.8±0.1 Light gray White to

light gray

Irregular Thin flat Black Scattered Surface Round to

irregular

83

30 NRCB30 Attock Bahtar 7.4±0.1 White to

light gray

Creamish

white

Irregular Thin flat Black Scattered Surface Round to

irregular


Abdal

7.8±0.1 White to

light gray

White to

light gray


masses


irregular


Abdal

9.0±0 Dark gray Light gray Irregular aerial

mycelium with

sporulation


33 NRCB33 Rawalpindi Adyala 7.5±0.1 White to

light gray

Creamish

white


masses


34 NRCB34 Rawalpindi Chauntra 8.6±0.1 Light to

dark gray


without

sporulation

Black on whole

petri dish

Surface Round

35 NRCB35 Islamabad Rawat 8.2±0.1 White to

light gray

Creamish

white


masses

Black on whole

petri dish

Surface Round to

irregular

36 NRCB36 Islamabad Rawat 8.6±0.1 Light gray White to

light gray


without

sporulation


irregular

37 NRCB37 Jhelum Domeli 7.5±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation

Black on whole

petri dish

Surface Round

38 NRCB38 Jhelum Domeli 8.2±0.1 White to

light gray

Creamish

white


masses

Black on whole

petri dish

Surface Round

39 NRCB39 Gujar

Khan

Jatli 7.0±0.1 Dark gray Light gray Irregular aerial

mycelium with

sporulation


irregular

40 NRCB40 Choa

Saidan

Shah

Dulmial 6.3±0.1 Light to

dark gray

Light gray Irregular thick and

woolly

mycelium

Black on whole

petri dish

Surface Round to

irregular

84

Table 4.14: Microscopic characteristics of Botrytis cinerea

Sr. No Isolate Tehsil Location

Conidia Sclerotium

Length (µm) Width (µm) Length (mm) Width (mm)

1 NRCB01 Islamabad Chak Shehzad 10.6±0.5 4.1±0.9 5.8±0.8 4.1±0.9

2 NRCB02 Islamabad Chak Shehzad 7.6±0.6 2.9±0.2 3±0.4 2.9±0.2

3 NRCB03 Islamabad Chak Shehzad 10.6±0.5 3.4±0.7 3.8±0.6 3.4±0.7

4 NRCB04 Islamabad Rawat 9.5±1.1 2.8±0.3 4.4±1 2.8±0.3

5 NRCB05 Islamabad Rawat 7.9±0.8 2.9±0.4 2.9±0.4 2.9±0.4

6 NRCB06 Taxila Taxila 10.7±0.4 4.1±0.4 6.1±0.5 4.1±0.4



9 NRCB09 Rawalpindi Chauntra 10.7±0.3 2.5±0.5 2.9±0.4 2.5±0.5


11 NRCB11 Rawalpindi Adyala 7.3±0.6 4.2±0.3 6.4±0.7 4.2±0.3


85

13 NRCB13 Attock

Fateh Jhang 7.8±0.5 4.8±0.3 7±0.6 4.8±0.3

14 NRCB14 Attock Fateh Jhang 10.7±0.4 3.1±0.7 3.1±0.7 3.1±0.7

15 NRCB15 Attock Bahter 7.2±0.8 3.9±0.4 6.7±0.6 3.9±0.4


17 NRCB17 Jhelum

Domeli 10±0.7 2.1±0.4 3.3±0.6 2.1±0.4

18 NRCB18 Jhelum Domeli 8.4±0.8 2.8±0.6 2.8±0.6 2.8±0.6

19 NRCB9 Jhelum Domeli 10.7±0.3 2.9±0.7 3±0.6 2.9±0.7

20 NRCB20 Gujar Khan Jatli 10.9±0.3 3.9±0.4 8.8±0.6 3.9±0.4

21 NRCB21 Gujar Khan Jatli 10±0.9 5.1±0.4 5.3±0.6 5.1±0.4

22 NRCB22 Chakwal Thoa Bahdar 9.7±0.5 4.8±0.6 7.4±1 4.8±0.6

23 NRCB23 Chakwal Dulmial 10.7±0.4 2.9±0.7 6.6±0.4 2.9±0.7

24 NRCB24 Chakwal Bhoun 7.9±0.4 3.4±1 3.6±0.7 3.4±1

25 NRCB25 Kallar Kahar Miani 7.9±0.6 4.4±0.4 7.8±0.9 4.4±0.4

86

26 NRCB26 Islamabad Chak Shehzad 7.4±1 4.9±0.7 5±0.8 4.9±0.7

27 NRCB27 Islamabad Rawat 10±0.6 2.8±0.8 3±0.6 2.8±0.8

28 NRCB28 Islamabad Rawat 7.3±0.7 4.4±0.4 7.7±0.6 4.4±0.4



31 NRCB31 Attock Fateh Jang 10.5±0.5 3.9±0.7 3.8±0.6 3.9±0.7




35 NRCB35 Gujar Khan Jatli 8.8±0.5 4.8±0.3 8.2±0.8 4.8±0.3

36 NRCB36 Chakwal Thoa Bahdar 10.3±0.8 2.8±0.3 6.9±0.9 2.8±0.3

37 NRCB37 Kallar Kahar Dulmial 9.2±0.9 4.6±0.4 4.7±0.6 4.6±0.4

38 NRCB38 Choa Saidan Miani 8.6±0.9 4.7±0.7 4.7±0.7 4.7±0.7



87

Figure 4.38: Conidia and conidiophores of B. cinerea (light microscope, x1000)



A. alternata isolates displayed a variety of colors on PDA i.e. olive brown, light to

dark brown and dark brown. The colonies of nine isolates viz. ASA6, ASA13,

ASA17, ASA20, ASA23, ASA28, ASA31, ASA32 and ASA33 were light to dark

brown with dark brown coloration in reverse (Figure 4.39). The isolates ASA7,

ASA10, ASA19, ASA25 and ASA36 produced dark brown colonies with brown to

black or black in reverse (Figure 4.40). The isolates viz. ASA1, ASA2, ASA3, ASA4,

ASA5, ASA8, ASA9, ASA11, ASA12, ASA14, ASA15, ASA16, ASA18, ASA21,

ASA22, ASA24, ASA26, ASA27, ASA29, ASA30, ASA34 and ASA35 produced

olive brown colonies with light to dark brown color in reverse (Figure 4.41).

4.5.5.3 Concentric rings

The colonies of Alternaria alternata produced less to prominent concentric rings

under 12 hours light/ darkness cycle. The no. of concentric rings produced by colonies

ranged from 2 to 9. The colonies of isolates viz. ASA2, ASA6, ASA10, ASA13,

ASA16, ASA19, ASA20, ASA23, ASA31, ASA32, ASA33 and ASA36 formed two

concentric rings. The maximum of 9 concentric rings were produced by ASA18 and

ASA35 isolates (Figure 4.42).

4.5.5.4 Texture

The texture of colonies among isolates were recorded from velvety to appressed. The

colonies of isolates ASA1, ASA2, ASA3, ASA4, ASA5, ASA8, ASA9, ASA11,

88

ASA12, ASA14, ASA15, ASA16, ASA18, ASA21, ASA22, ASA24, ASA26,

ASA27, ASA29, ASA30, ASA34 and ASA35 were velvety in texture. Whereas, the

rest of fourteen isolates viz. ASA6, ASA7, ASA10, ASA13, ASA17, ASA19, ASA20,

ASA23, ASA25, ASA28, ASA31, ASA32, ASA33 and ASA36 had appressed

colonies.


The mycelium was septate, branched and light brown to dark brown.

Conidiophores were erect to sub-erect, arising laterally or terminally from hyphae,

light to dark brown, with 2-6 septa (Figure 4.43). The conidial characteristics of A.

alternata were highly variable. The conidia were solitary, or in short chains, ellipsoid

or long ellipsoid, obclavate, obpyriform and muriform with 0-3 longitudinal and 1–4

transverse septa (Figure 4.44).

The isolate ASA15 had the longest conidia, averaging 31.8±0.8 μm, while isolate

ASA12 (17±4.5 μm) had the shortest conidia. The conidia of the isolate ASA3 had the

maximum mean width (22.4±4.6 μm) and isolate ASA10 had the narrowest (10±0.4

μm) width.

The conidia produced in the isolates were both beaked and un-beaked. Beaks

develop generally from terminal cells, which are commonly light brown in color. The

isolate ASA16 had the longest beak, averaging 9.1±0.4 μm, while the isolates ASA3

(4.8±0.4 μm) and ASA21(4.8±0.3 μm) had the shortest beak (Table 4.15). The

morphological characters of Alternaria alternata depicted in the present study were in

consistence with the previous findings (Simmons, 1995, 2007).

4.5.6 Morphological Characterization of Fusarium equiseti


The isolates of Fusarium equiseti showed variability in colony diameter. The five

isolates viz., FJH3, FJH11, FJH24, FJH33 and FJH38 were the fastest growing with

the colony diameter 9±0 cm after seven days of incubation. The isolate FJH28 and

FJH34 was the slowest growing with colony diameter 6.8±0.1 cm after 7 days of

incubation. The average colony diameter ranges 7.8 cm.

89

Figure 4.39: a. Light to dark brown colonies of A. alternata with appressed growth b.

Dark brown colonies on the reverse side of PDA medium

Figure 4.40: Dark brown colonies of A. alternata with appressed growth b. Black

colonies on the reverse side of PDA medium

Figure 4.41: Olive brown colonies of A. alternata with velvety texture b. light to dark

brown colonies on the reverse side of PDA medium

90

Figure 4.42: Colonies displayed concentric rings

Figure 4.43: Conidia and conidiophores of A. alternata, scale bar=10 μm

Figure 4.44: Conidia of A. alternata, Scale bar=10 μm

91

Table 4.15: Cultural and microscopic characteristics of Alternaria alternata

Sr.

No

Isolate Tehsil Location Colony

diameter

Colony

color

(Front)

Colony

color

(Reverse)

No of

concentric

rings

Margins Texture Conidia Beak

Length

(µm) Length

(µm)

Width

(µm)

1 ASA1 Islamabad Chak

Shehzad

5.6±0.1 Olive

brown

Light-dark

brown

8 Irregular Velvety 25.2±6.4 10.3±0.3 5.0±0.4

2 ASA2 Islamabad Rawat 6.7±0.1 Olive

brown

Light-dark

brown


3 ASA3 Taxila Taxila 5.6±0.1 Olive

brown

Light-dark

brown


4 ASA4 Taxila Wah 7.6±0.1 Olive

brown

Light-dark

brown

7 Irregular Velvety 31.1±1 12.1±0.5 5.2±0.9

5 ASA5 Rawalpindi Chak Beli

Khan

5.5±0.1 Olive

brown

Light-dark

brown


6 ASA6 Rawalpindi Adyala 7.9±0.2 Light to

dark brown

Dark

brown

2 Regular Appressed 26.1±6.8 10.2±0.3 5.1±0.4

7 ASA7 Rawalpindi Dhoke

Budhal

6.8±0.1 Dark brown Brown to

black

3 Irregular Appressed 25.8±0.6 12.2±0.6 5.2±0.5

8 ASA8 Rawalpindi Chauntra 7.2±0.1 Olive

brown

Light-dark

brown


9 ASA9 Attock Bahter 8.4±0.1 Olive

brown

Light-dark

brown


10 ASA10 Attock Bahter 6.2±0.1 Dark brown Black 2 Irregular Appressed 28.8±0.3 10.0±0.4 6.4±0.4

11 ASA11 Attock Fateh

Jang

8.6±0.1 Olive

brown

Light-dark

brown


92

12 ASA12 Gujar Khan Daultala 5.8±0.1 Olive

brown

Light-dark

brown


13 ASA13 Gujar Khan Sukho 7.2±0.1 Light to

dark brown

Dark

brown


14 ASA14 Chakwal Dab 6.4±0.1 Olive

brown

Light-dark

brown


15 ASA15 Chakwal Dhudial 7.8±0.1 Olive

brown

Light-dark

brown


16 ASA16 Chakwal Thoa

Bahdar

5.7±0.2 Olive

brown

Light-dark

brown


17 ASA17 Chakwal Bhoun 7.6±0.1 Light to

dark brown

Dark

brown

3 Regular Appressed 31.2±1 11.0±0.6 4.9±0.4

18 ASA18 Choa

Saidan

Shah

Dulmial 6.2±0.1 Olive

brown

Light-dark

brown


19 ASA19 Choa

Saidan

Shah

Dalelpur 6.9±0.1 Dark brown Brown to

black


20 ASA20 Kallar

Kahar

Miani 5.9±0.1 Light to

dark brown

Dark

brown


21 ASA21 Kallar

Kahar

Buchal

Kalan

8.0±0.1 Olive

brown

Light-dark

brown


22 ASA22 Jhelum Domeli 5.7±0.1 Olive

brown

Light-dark

brown


23 ASA23 Islamabad Chak

Shehzad

6.6±0.1 Light to

dark brown

Dark

brown


93

24 ASA24 Islamabad Rawat 6.0±0.1 Olive

brown

Light-dark

brown


25 ASA25 Taxila Taxila 6.9±0.1 Dark brown Black 3 Irregular Appressed 27.0±3.9 11.5±0.4 6.1±0.6

26 ASA26 Rawalpindi Adyala 6.1±0.1 Olive

brown

Light-dark

brown


27 ASA27 Attock Bahter 7.8±0.1 Olive

brown

Light-dark

brown


28 ASA28 Gujar Khan Daultala 6.6±0.1 Light to

dark brown

Dark

brown


29 ASA29 Gujar Khan Sukho 8.6±0.1 Olive

brown

Light-dark

brown


30 ASA30 Gujar Khan Jatli 7.4±0.1 Olive

brown

Light-dark

brown


31 ASA31 Chakwal Dhudial 6.7±0.1 Light to

dark brown

Dark

brown


32 ASA32 Chakwal Thoa

Bahdar

6.0±0.1 Light to

dark brown

Dark

brown

2 Irregular Appressed 29.0±2.5 11.5±1 5.4±0.4

33 ASA33 Chakwal Bhoun 5.7±0.1 Light to

dark brown

Dark

brown

2 Regular Appressed 28.6±4.1 10.4±4.2 5.5±0.5

34 ASA34 Jhelum Sohawa 6.2±0.2 Olive

brown

Light-dark

brown


35 ASA35 Choa

Saidan

Shah

Dalelpur 6.3±0.1 Olive

brown

Light-dark

brown


36 ASA36 Kallar

Kahar

Miani 6.6±0.1 Dark brown Black 2 Irregular Appressed 25.3±2.3 12.4±2.7 6.0±0.6

94


The colonies were initially white, later turning light cream or cream or light

brown. The isolates, FJH4, FJH19, FJH29, FJH33, FJH34 and FJH41 produced light

cream colonies with beige coloration at reverse (Figure 4.45). The colonies of eight

isolates viz. FJH2, FJH3, FJH5, FJH10, FJH14 and FJH23 were cream in color with

beige coloration at reverse (Figure 4.46). The colonies of isolates FJH1, FJH9, FJH11,

FJH12, FH15, FJH16, FJH17, FJH18, FJH22, FJH26, FJH27, FJH30, FJH32 and

FJH36 were light brown with brown coloration at reverse (Figure 4.47). The isolates

FJH6, FJH7, FJH8, FJH13, FJH20, FJH21, FJH24, FJH25, FJH28, FJH31, FJH35,

FJH39 and FJH40 produced white colonies with light cream or white coloration on

reverse side of petri dish (Figure 4.48).

4.5.6.3 Texture

The Fusarium equiseti isolates showed distinct fluffy and medium fluffy texture.

The eighteen isolates (43.9%), FJH3, FJH4, FJH5, FJH8, FJH9, FJH12, FJH16,

FJH18, FJH19, FJH23, FJH28, FJH29, FJH31, FJH32, FJH35, FJH37, FJH38 and

FJH41 showed fluffy texture. While the remaining 23 isolates (56.1%) exhibited

medium fluffy texture.

4.5.6.4 Sporodochia

Sporodochia were orange in color and formed by nineteen isolates viz. FJH3,

FJH4, FJH5, FJH7, FJH9, FJH11, FJH14, FJH20, FJH21, FJH22, FJH24, FJH25,

FJH27, FJH30, FJH32, FJH35, FJH38, FJH40 and FJH41. Whereas, the remaining

twenty-one isolates did not produce sporodochia on PDA media. Sporodochia may not

be obvious in culture media since they can be masked by the mycelium (Leslie,

Summerell, & Bullock, 2006).



absence of microconidia in all the isolates. Macro-conidia were hyaline, 5 to 6 septate

and developed on branched conidiophores with dorsiventral curvature having

prominent tapered apical cell and foot shaped basal cells (Figure 4.49).

95

Figure 4.45: a. Light cream colony of F. equiseti b. beige coloration on the reverse

Figure 4.46: a. Cream colony of F. equiseti b. beige coloration on the reverse

Figure 4.47: a. Light brown colony of F. equiseti b. brown coloration on the reverse

96

Figure 4.48: a. White colony of F. equiseti b. white to light cream coloration on the

reverse

The isolate FJH15 had the longest macro-conidia, averaging 34.6±4 μm, while

isolate FJH5 (23.9±2.8 μm) had the shortest. The isolate FJH21, FJH31 and FJH38

was the widest (2.3±0.3 μm) and isolate FJH26 had the narrowest (1.7±0.3 μm)

macro-conidia.

Chlamydospores were singly or in clumps, globose to sub-globose (Figure 4.50).

The isolate FJH41 showed the highest mean chlamydospores diameter (10.9±0.9 μm)

and the isolate FJH27 had the shortest diameter (6.5±3.3 μm).

In this study the isolates produced short or long monophialidic and polyphialidic

conidiophores. The seven isolates viz. FJH6, FJH11, FJH17, FJH18, FJH24, FJH32

and FJH39 developed monophialidic conidiophores. The rest of all isolates produced

both monophialidic and polyphialidic conidiophores.

Few isolates of F. equiseti developed microconidia but in previous studies, F.

scirpi is also included in the definition of F. equiseti (Nelson et al., 1983). Other

scientist accepted both F. scirpi and F. equiseti in the description of F. equiseti and

stated that only macroconidia are produced (Gerlach & Nirenberg, 1982).

Morphological characters of F. equiseti showed resemblance with studies carried out

in the past for F. equiseti (Leslie et al., 2006; Nelson et al., 1983).

97

Figure 4.49: Conidia of F. equiseti (light microscope, x1000) stained with cotton blue,

Scale bar=10 μm

Figure 4.50: Chlamydospores of F. equiseti (light microscope, x1000) stained with

cotton blue, Scale bar=10 μm

4.5.7 Morphological Characterization of Rhizoctonia solani


The isolates of Rhizoctonia solani showed variability in colony diameter. The nine

isolates, FJR15, FJR20, FJR24, FJR31, FJR36, FJR37, FJR49, FJR50 and FJR53

were the fastest growing and fills the 9 cm petri dish in 4 days. The isolate FJR55 was

the slowest growing with colony diameter 6.6±0.1 cm after 4 days of incubation.

98

Table 4.16: Cultural and microscopic characteristics of Fusarium equiseti

Sr.


Colony

Margins Texture Sporodochia

Macro-conidia Chlamydo

-spore dia.

(µm)

Phialide

Diameter color

(Front)

color

(Reverse)

Length

(µm)

Width

(µm)

1 FJH1 Chakwal Bhoun 8.9±0.1 Light

brown

Brown Regular Medium

fluffy

Not obvious 30.9±2.7 2.2±0.2 9.2±1.2 Monophialide,

polyphialide

2 FJH2 Chakwal Dab 8.6±0.2 Cream Beige Irregular Medium

fluffy


polyphialide

3 FJH3 Chakwal Dhudial 9.0±0 Cream Beige Regular Fluffy Present 28.9±4.6 2.2±0.2 8.2±0.8 Monophialide,

polyphialide

4 FJH4 Chakwal Thoa

Bahdar

8.6±0.2 Light

cream

Beige Irregular Fluffy Present 26.5±2 1.8±0.3 8.5±2.4 Monophialide,

polyphialide

5 FJH5 Kallar Kahar Buchal

Kalan

8.9±0.1 Cream Beige Irregular Fluffy Present 23.9±2.8 2.1±0.4 8.3±0.7 Monophialide,

polyphialide

6 FJH6 Kallar Kahar Miani 8.4±0.2 White Light

cream

Irregular Medium

fluffy

Not obvious 29.5±2.7 2.2±0.3 7.2±0.8 Monophialide

7 FJH7 Choa Saidan

Shah

Dalelpur 7.7±0.2 White Light

cream

Irregular Medium

fluffy

Present 28±4.5 2.1±0.4 7.8±0.9 Monophialide,

polyphialide

8 FJH8 Choa Saidan

Shah

Dulmial 8.0±0.2 White White Irregular Fluffy Not obvious 26±2.3 2.1±0.4 10.3±1.3 Monophialide,

polyphialide

9 FJH9 Gujar Khan Doltala 7.5±0.1 Light

brown

Brown Irregular Fluffy Present 30.1±4.1 2.1±0.2 8.4±0.9 Monophialide,

polyphialide

10 FJH10 Gujar Khan Sukho 8.4±0.2 Cream Beige Regular Medium

fluffy


polyphialide

11 FJH11 Gujar Khan Jatli 9.0±0 Light

brown

Brown Irregular Medium

fluffy

Present 29.8±3.3 2.2±0.2 8.9±2.1 Monophialide

99

12 FJH12 Jhelum Sohawa 7.8±0.1 Light

brown

Brown Regular Fluffy Not obvious 33.2±5.5 2±0.3 8.2±0.6 Monophialide,

polyphialide

13 FJH13 Jhelum Domeli 8.3±0.3 White White Regular Medium

fluffy


polyphialide

14 FJH14 Jhelum Domeli 7.1±0.1 Cream Beige Irregular Medium

fluffy

Present 30.3±5 2±0.2 9.7±0.9 Monophialide,

polyphialide

15 FJH15 Rawalpindi Dhoke

Budhal

7.7±0.2 Light

brown


fluffy

Not obvious 34.6±4 2.1±0.2 8.4±1.2 Monophialide,

polyphialide

16 FJH16 Rawalpindi Adyala 8.7±0.1 Light

brown

Brown Irregular Fluffy Not obvious 28.3±3 2.0±0.3 8.7±1.4 Monophialide,

polyphialide

17 FJH17 Rawalpindi Chak Beli

Khan

7.9±0.1 Light

brown


fluffy

Not obvious 26.6±4.7 1.9±0.4 9.3±1.2 Monophialide

18 FJH18 Rawalpindi Chauntra 8.2±0.2 Light

brown

Brown Regular Fluffy Not obvious 28.9±3.8 2.1±0.3 9.5±2.3 Monophialide

19 FJH19 Rawalpindi Chakri 8.9±0.1 Light

cream

Beige Irregular Fluffy Not obvious 25.6±2.5 2.1±0.4 8.3±0.8 Monophialide,

polyphialide

20 FJH20 Taxila Taxila 8.3±0.1 White Light

cream

Regular Medium

fluffy

Present 27.4±3.7 2±0.4 8.5±2.3 Monophialide,

polyphialide

21 FJH21 Taxila Wah 8.9±0.1 White Light

cream

Irregular Medium

fluffy

Present 28.6±2.3 2.3±0.3 8.1±0.7 Monophialide,

polyphialide

22 FJH22 Islamabad Chak

Shehzad

7.6±0.1 Light

brown


fluffy


polyphialide

23 FJH23 Islamabad Taxila 8.0±0.1 Cream Beige Regular Fluffy Not obvious 28±2 2.1±0.2 8±0.7 Monophialide,

polyphialide

24 FJH24 Islamabad Rawat 9.0±0 White White Regular Medium

fluffy

Present 30.6±4.7 2±0.5 10.4±1.1 Monophialide

25 FJH25 Attock Fateh Jang 7.4±0.1 White White Irregular Medium

fluffy

Present 31.8±3.8 2±0.4 8.5±0.5 Monophialide,

polyphialide

26 FJH26 Attock Bahtar 8.1±0.1 Light

brown


fluffy

Not obvious 33±3.8 1.7±0.3 8.4±2.3 Monophialide,

polyphialide

100

27 FJH27 Jhelum Sohawa 8.5±0.1 Light

brown


fluffy

Present 29±2.5 2.2±0.2 6.5±3.3 Monophialide,

polyphialide

28 FJH28 Jhelum Domeli 6.8±0.1 White Light

cream

Regular Fluffy Not obvious 32±4 2.1±0.4 8.2±0.9 Monophialide,

polyphialide

29 FJH29 Gujar Khan Sukho 7.2±0.2 Light

cream

Beige Irregular Fluffy Not obvious 32.2±2.8 2.1±0.1 9±1.6 Monophialide,

polyphialide

30 FJH30 Gujar Khan Jatli 7.4±0.1 Light

brown


fluffy

Present 30.9±5 2.2±0.2 10±1.5 Monophialide,

polyphialide

31 FJH31 Gujar Khan Doltala 7.6±0.1 White Light

cream

Irregular Fluffy Not obvious 33.4±3.2 2.3±0.3 8.2±1.1 Monophialide,

polyphialide

32 FJH32 Chakwal Thoa

Bahdar

7.7±0.2 Light

brown

Brown Irregular Fluffy Present 28.1±3.2 1.9±0.2 8.7±1.4 Monophialide


Kalan

9.0±0 Light

cream

Beige Irregular Medium

fluffy

Not obvious 33.5±4.4 2±0.4 8.4±1.5 Monophialide,

polyphialide

34 FJH34 Chakwal Dab 6.8±0.1 Light

cream

Beige Irregular Medium

fluffy

Not obvious 31±3.2 2.1±0.2 8.6±1.5 Monophialide,

polyphialide

35 FJH35 Chakwal Dhudial 7.3±0.3 White Light

cream

Regular Fluffy Present 28.8±6.9 1.9±0.4 8.8±2.4 Monophialide,

polyphialide

36 FJH36 Islamabad Chak

Shehzad

7.3±0.1 Light

brown


fluffy

Not obvious 27.5±4 2.1±0.4 7.9±1.3 Monophialide,

polyphialide

37 FJH37 Choa Saidan

Shah

Dulmial 8.1±0.1 Cream Beige Regular Fluffy Not obvious 28±6.2 2±0.4 9±1.8 Monophialide,

polyphialide


Kalan

9.0±0 Cream Beige Regular Fluffy Present 29.6±5.2 2.3±0.3 8.7±0.4 Monophialide,

polyphialide

39 FJH39 Islamabad Rawat 8.3±0.1 White Light

cream

Regular Medium

fluffy

Not obvious 30.8±5 2±0.4 9.1±1.2 Monophialide

40 FJH40 Attock Fateh Jang 7.1±0.1 White White Regular Medium

fluffy


polyphialide

41 FJH41 Rawalpindi Adyala 7.1±0.1 Light

cream

Beige Regular Fluffy Present 28.2±1.9 2±0.4 10.9±0.9 Monophialide,

polyphialide

101


Colonies were initially white or cream in color, later displayed variation among

different isolates with creamish, brown to creamish, light brown, dark brown color.

The isolates, FJR03, FJR07, FJR14, FJR17, FJR24, FJR25, FJR32, FJR35, FJR42,

FJR52, FJR53 and FJR56 produced creamish colonies with creamish brown or

creamish coloration at reverse (Figure 4.51). The colonies of thirteen isolates viz.

FJR01, FJR04, FJR05, FJR10, FJR11, FJR15, FJR18, FJR19, FJR27, FJR28, FJR37,

FJR48 and FJR51 were brown to creamish with light brown or creamish color at

reverse (Figure 4.52). The isolates, FJR12, FJR13, FJR21, FJR30, FJR31, FJR38,

FJR44, FJR45, FJR46, FJR54 and FJR55 produced light brown colonies with

creamish brown or light brown at reverse (Figure 4.53). The colonies of twenty

isolates, FJR02, FJR06, FJR08, FJR09, FJR16, FJR20, FJR22, FJR23, FJR26, FJR29,

FJR33, FJR34, FJR36, FJR39, FJR40, FJR41, FJR43, FJR47, FJR49 and FJR50 were

dark brown with dark brown color at reverse (Figure 4.54).

The color of a young Rhizoctonia solani colony were initially white, and later

turns to brown. The differences in colony color is caused by differences in pigments

produced by pathogen in the media (Taheri, Gnanamanickam, & Höfte, 2007).

4.5.7.3 Texture

The colonies of R. solani appeared to have variation in texture with fluffy,

medium fluffy and thin flat growth pattern. The colonies of twenty-three isolates

(41.07%), FJR03, FJR04, FJR07, FJR08, FJR10, FJR11, FJR13, FJR14, FJR15,


FJR52, FJR53 and FJR56 had heavy vegetative growth showing fluffy appearance of

mycelia. The nineteen isolates (33.92%), FJR01, FJR02, FJR05, FJR06, FJR16,


FJR47, FJR48 and FJR50 were medium fluffy. Whereas, the rest of fourteen (25%)

isolates colonies, viz. FJR09, FJR12, FJR20, FJR24, FJR25, FJR30, FJR31, FJR33,

FJR35, FJR41, FJR45, FJR49, FJR54 and FJR55 were thin flat in texture.

4.5.7.4 Sclerotia

102

The color of sclerotia produced by isolates showed variation with light brown to

dark brown color. The twelve isolates (21.43%), FJR03, FJR07, FJR11, FJR15,

FJR17, FJR19, FJR32, FJR35, FJR42, FJR52, FJR53 and FJR56 produced light

brown sclerotia. The rest of forty-four isolates (78.57%) had dark brown sclerotia.

The location of sclerotia of R. solani was on surface or aerial hyphae or at both

surface and aerial hyphae. The fourteen isolates (25%) developed sclerotia on aerial

hyphae (Figure 4.55), twenty-five (44.64%) on surface (Figure 4.56) and seventeen

isolates (30.36%) had sclerotia at both aerial hyphae and surface.

The eighteen isolates (32.14%) viz. FJR03, FJR07, FJR08, FJR13, FJR17, FJR18,

FJR24, FJR25, FJR32, FJR36, FJR39, FJR42, FJR45, FJR46, FJR49, FJR52, FJR53

and FJR56 formed sclerotia at periphery of petri dish. The nine isolates (16.07%),

FJR02, FJR06, FJR16, FJR22, FJR29, FJR33, FJR34, FJR43 and FJR47 had

developed sclerotia at center of petri dish. The sclerotia formed by twenty-nine

isolates (51.79%) were scattered on petri dish.

The sclerotial color ranged from light to dark brown, brown, chocolate brown,

black brown, salmon and dark salmon (Hoa, 1994). The sclerotial formation at

peripheral, central, or scattered (Moni et al., 2016). Isolates of R. solani differed in

morphology, sclerotial abundance, distribution, color, size, shape and type of

aggregation (Mekwatanakarn, Kositratana, Phromraksa, & Zeigler, 1999; Pascual,

Toda, Raymondo, & Hyakumachi, 2000; Rashad, Abdel-Fattah, Hafez, & El-Haddad,

2012).

4.5.7.5 Hyphal characteristics

The hyphal branching of all the 56 isolates of R. solani was at right angle. Hyphae

was septate, trinucleate, slightly constricted at the point of the branching of mycelium

and septum. The hyphal branching at right angle is a known feature of R. solani.

Hyphal width ranged from 6.2 μm to 7.3 μm. The maximum hyphal width (7.3

μm) was observed in isolate FJR55 while the minimum (6.2 μm) was observed in

isolate FJR03. Microscopic examination showed morphological characters coinciding

with Rhizoctonia genus (Sneh, Burpee, & Ogoshi, 1991).

103

Figure 4.51: a. Creamish colony of R. solani, developed aerial sclerotia at periphery

b. creamish brown colony on the reverse side of petri dish

Figure 4.52: a. Brown to creamish colony of R. solani b. creamish to light brown

colony on the reverse side of petri dish

Figure 4.53: a. Light brown colony of R. solani, aerial sclerotia predominantly at

periphery b. creamish brown colony on reverse side of petri dish

104

Figure 4.54: a. Dark brown colony of R. solani, sclerotia scattered on whole petri

dish b. dark brown colony on reverse side of petri dish

Figure 4.55: Colony of R. solani developed dark brown aerial sclerotia

Figure 4.56: Colony of R. solani developed dark brown surface sclerotia at center of

petri dish

105

Table 4.17: Cultural and microscopic characteristic of R. solani

Sr.

No

Isolate Tehsil Location Colony Hyphal

Diameter

(µm)

Margins Texture Sclerotium

Diameter Color

(Front)

Color

(Reverse)

Color Formation Location

1 FJR01 Gujar Khan Sukho 7.3±0.1 Brown to

creamish

Creamish 6.9±0.5 Regular Medium

fluffy

Dark brown Scattered Aerial

2 FJR02 Gujar Khan Sukho 8.0±0.1 Dark

brown

Dark

brown

6.6±0.5 Regular Medium

fluffy

Dark brown Central Surface

3 FJR03 Gujar Khan Daultala 8.4±0.1 Creamish Creamish 6.2±0.3 Regular Fluffy Light brown Peripheral Aerial

4 FJR04 Chakwal Thoa

Bahdar

8.0±0.1 Brown to

creamish

Creamish 6.6±0.4 Regular Fluffy Dark brown Scattered Aerial &

surface


Bahdar

8.5±0.1 Brown to

creamish

Creamish 6.5±0.5 Irregular Medium

fluffy

Dark brown Scattered Aerial &

surface

6 FJR06 Chakwal Dhudial 7.3±0.1 Dark

brown

Dark

brown


fluffy


7 FJR07 Chakwal Dhudial 7.9±0.1 Creamish Creamish 6.6±0.5 Regular Fluffy Light brown Peripheral Aerial

8 FJR08 Chakwal Dab 8.9±0.1 Dark

brown

Dark

brown

6.5±0.1 Irregular Fluffy Dark brown Peripheral Surface

9 FJR09 Choa Saidan

Shah

Dalelpur 7.3±0.1 Dark

brown

Dark

brown

6.8±0.3 Irregular Thin

flat

Dark brown Scattered Surface

10 FJR10 Choa Saidan

Shah

Dalelpur 8.4±0.1 Brown to

creamish

Light

brown

6.3±0.1 Regular Fluffy Dark brown Scattered Surface


Shah

Dulmial 7.3±0.1 Brown to

creamish

Creamish 6.5±0.1 Irregular Fluffy Light brown Scattered Aerial &

surface

12 FJR12 Kallar Kahar Miani 7.9±0.1 Light

brown

Light

brown

6.5±0.3 Regular Thin

flat


106

13 FJR13 Jhelum Sohawa 8.5±0.1 Light

brown

Light

brown

6.6±1 Regular Fluffy Dark brown Peripheral Aerial

14 FJR14 Jhelum Sohawa 8.8±0.1 Creamish Creamish

brown

6.7±0.7 Regular Fluffy Dark brown Scattered Aerial &

surface

15 FJR15 Jhelum Domeli 9.0±0 Brown to

creamish

Creamish 7±0.7 Regular Fluffy Light brown Scattered Aerial &

surface

16 FJR16 Islamabad Chak

Shehzad

7.0±0.1 Dark

brown

Dark

brown


fluffy



Shehzad

8.3±0.1 Creamish Creamish

brown

6.8±0.3 Regular Fluffy Light brown Peripheral Aerial

18 FJR18 Islamabad Rawat 7.8±0.1 Brown to

creamish

Creamish 6.6±0.8 Irregular Fluffy Dark brown Peripheral Aerial


creamish

Creamish 6±0.1 Irregular Fluffy Light brown Scattered Aerial &

surface

20 FJR20 Attock Fateh

Jang

9.0±0 Dark

brown

Dark

brown


flat



Jang

8.9±0.1 Light

brown

Light

brown


surface

22 FJR22 Attock Bahter 8.4±0.1 Dark

brown

Dark

brown


fluffy


23 FJR23 Taxila Taxila 7.9±0.1 Dark

brown

Dark

brown

6.8±0.3 Irregular Medium

fluffy


24 FJR24 Taxila Taxila 9.0±0 Creamish Creamish

brown


flat

Dark brown Peripheral Surface

25 FJR25 Taxila Wah 7.4±0.1 Creamish Creamish

brown


flat


26 FJR26 Taxila Wah 7.0±0.1 Dark

brown

Dark

brown


fluffy


27 FJR27 Rawalpindi Dhoke

Budhal

8.9±0.1 Brown to

creamish

Light

brown


surface

107

28 FJR28 Rawalpindi Dhoke

Budhal

8.1±0.1 Brown to

creamish

Creamish 6.5±0.3 Irregular Fluffy Dark brown Scattered Aerial &

surface

29 FJR29 Rawalpindi Chauntra 8.6±0.1 Dark

brown

Dark

brown


fluffy


30 FJR30 Rawalpindi Chakri 8.0±0.1 Light

brown

Creamish

brown


flat


31 FJR31 Rawalpindi Chakri 9.0±0 Light

brown

Light

brown


flat


32 FJR32 Jhelum Sohawa 7.5±0.1 Creamish Creamish 6.5±0.2 Regular Fluffy Light brown Peripheral Aerial

33 FJR33 Jhelum Domeli 8.0±0.1 Dark

brown

Dark

brown


flat


34 FJR34 Gujar Khan Sukho 7.8±0.1 Dark

brown

Dark

brown


fluffy


35 FJR35 Gujar Khan Sukho 7.4±0.1 Creamish Creamish

brown


flat

Light brown Scattered Surface

36 FJR36 Gujar Khan Daultala 9.0±0 Dark

brown

Dark

brown

6.7±0.3 Regular Fluffy Dark brown Peripheral Aerial

37 FJR37 Gujar Khan Daultala 9.0±0 Brown to

creamish

Light

brown


surface


Bahdar

7.9±0.1 Light

brown

Light

brown


fluffy


surface

39 FJR39 Chakwal Dhudial 8.9±0.1 Dark

brown

Dark

brown


fluffy

Dark brown Peripheral Aerial

40 FJR40 Chakwal Dab 7.3±0.1 Dark

brown

Dark

brown


fluffy


surface


Shah

Dalelpur 8.4±0.1 Dark

brown

Dark

brown


flat


108


Shah

Dulmial 7.3±0.1 Creamish Creamish 6.5±0.2 Irregular Fluffy Light brown Peripheral Aerial

43 FJR43 Kallar Kahar Miani 7.9±0.1 Dark

brown

Dark

brown


fluffy


44 FJR44 Kallar Kahar Miani 7.9±0.1 Light

brown

Light

brown


fluffy


surface


Shehzad

8.5±0.1 Light

brown

Light

brown


flat



Shehzad

8.2±0.1 Light

brown

Creamish

brown


fluffy

Dark brown Peripheral Aerial


Shehzad

7.9±0.1 Dark

brown

Dark

brown


fluffy



creamish

Creamish 6.6±0.3 Regular Medium

fluffy


surface

49 FJR49 Islamabad Rawat 9.0±0 Dark

brown

Dark

brown


flat



Jang

9.0±0 Dark

brown

Dark

brown


fluffy


surface


Jang

7.5±0.1 Brown to

creamish

Light

brown


surface

52 FJR52 Attock Bahter 8.5±0.1 Creamish Creamish 7±0.1 Irregular Fluffy Light brown Peripheral Aerial

53 FJR53 Taxila Taxila 9.0±0 Creamish Creamish

brown

6.5±0.2 Irregular Fluffy Light brown Peripheral Aerial

54 FJR54 Taxila Taxila 7.1±0.1 Light

brown

Creamish

brown

7±0.8 Irregular Thin

flat


55 FJR55 Taxila Wah 6.6±0.1 Light

brown

Creamish

brown


flat


surface

56 FJR56 Taxila Wah 8.3±0.1 Creamish Creamish 7.1±0.2 Regular Fluffy Light brown Peripheral Aerial

109

Figure 4.57: Hyphae of R. solani

4.5.8 Morphological Characterization of Sclerotium rolfsii


The whole petri plate was rapidly covered with mycelium in 3 days and aerial

hyphae also cover the lid of the petri plate. The twenty-one isolates of Sclerotium

rolfsii, viz. DGADY10, DGADY11, DGADY12, DGADY14, DGADY15,

DGADY18, DGADY22, DGADY23, DGADY25, DGADY28, DGADY30,


DGADY46, DGADY47, DGADY49 and DGADY50 were the fastest growing and

fills the 9 cm petri dish in 3 days. The isolate DGADY04 was found to be

comparatively slow growing with colony diameter 7.2±0.1cm after 3 days of

incubation.


Pure cultures of S. rolfsii produced white or white to light cream colonies. The

isolates viz. DGADY02, DGADY10, DGADY13, DGADY14, DGADY15,


DGADY37, DGADY38, DGADY39, DGADY41, DGADY43 and DGADY48

produced white to light cream colonies with white or white to light cream color at

reverse of the petri dish (Figure 4.58). The thirty-three isolates (66%) had silky-white

colonies with the same white color at reverse (Figure 4.59).

110

4.5.8.3 Texture

The colonies showed distinct texture i.e. submerged, thin flat, medium fluffy and

fluffy texture. The colonies of seven isolates viz. DGADY04, DGADY21,

DGADY24, DGADY28, DGADY34, DGADY40 and DGADY44 had submerged

hyphae. The ten isolates viz. DGADY03, DGADY06, DGADY07, DGADY14,

DGADY20, DGADY32, DGADY33, DGADY41, DGADY45 and DGADY50 had

thin flat hyphae. The colonies of fifteen isolates, viz. DGADY11, DGADY12,


DGADY37, DGADY38, DGADY39, DGADY46 and DGADY49 were medium

fluffy. Whereas, the rest of twenty isolates, DGADY01, DGADY02, DGADY05,



DGADY31, DGADY42, DGADY43, DGADY47 and DGADY48 were fluffy in

texture.

4.5.8.4 Sclerotia

The sclerotia were round, shiny in appearance and mature sclerotia having the

mustard seed like appearance. The sclerotial diameter ranged from 0.5-2.0 mm. The

sclerotia produced by eight isolates, DGADY06, DGADY11, DGADY19,

DGADY22, DGADY32, DGADY35, DGADY42 and DGADY43 were cream to

brown. Whereas, the rest of forty-two isolates developed dark brown sclerotia.

The thirty-five isolates (70%) developed sclerotia on the surface of colony, and

fifteen isolates (30%) had sclerotia at both aerial hyphae and surface. The formation

of sclerotia by seventeen isolates (34%) viz. DGADY02, DGADY03, DGADY04,



DGADY43 and DGADY47 were scattered throughout the plate. The rest of thirty-

three isolates (66%) formed sclerotia at peripheral ring of petri dish (Figure 4.60).

Sclerotia were small, round and tan to dark brown or black (Zarani & Christias,

1997). The presence of shiny and gummy material on sclerotia surface is owing to the

production of extracellular polysaccharides. The filamentous fungi is promising

producer of β D-glucan as the extracellular matrix and hyphal cell wall contain more

111

than 75% polysaccharides (Flieger, Kantorová, Benešová, Pažoutová, & Votruba,

2003). Variability in mycelial growth rate, cultural morphology, sclerotial colour, size

and formation were observed in S. rolfsii by many researchers (Akram, Iqbal,

Qureshi, & Rauf, 2008; Almeida, Abdelnoor, Calvo, Tessnman, & Yorinori, 2001;

Okereke & Wokocha, 2007).

4.5.8.5 Hyphal characteristics

The fan-shaped mycelial expanse was observed growing outward. The hyphae

were hyaline, thin walled and have infrequent cross walls. All the isolates produced

clamp connections (Figure 4.61). Feeding branches arise from the main branch.

Mycelial branching was at right angles and developed hyphae that are slightly

constricted at the branch origin, often a septum near the origin. The average hyphal

width ranged from 4.8 μm to 5.7 μm. Max. hyphal width (5.7 μm) was observed in

isolate DGADY44 while min. (4.8 μm) was in isolate DGADY09.

Figure 4.58: White to light cream, thin-flat colony of S. rolfsii

Figure 4.59: Silky-white, fluffy colony of S. rolfsii on PDA medium

112

Figure 4.60: a. Sclerotia scattered on whole petri dish b. sclerotia scattered on

periphery of petri dish

Figure 4.61: Hyphae of Sclerotium rolfsii

4.6 PATHOGENICITY TEST

The varying pathogenic behavior of C. truncatum isolates was observed on

artificial inoculated pepper fruit. Typical anthracnose symptoms of sunken, water-

soaked lesions having white to gray mycelia with acervuli was observed on inoculated

fruit surface (Figure 4.62) and the control fruit detected symptomless. In addition, C.

truncatum re-isolated from symptomatic lesions were morphologically identical to the

original isolates grown on PDA, confirming the Koch’s postulates. Notably, 15

(33.33%) isolates viz. ACT2, ACT4, ACT5, ACT6, ACT7, ACT8, ACT9, ACT10,

ACT11, ACT12, ACT13, ACT14, ACT15, ACT16 and ACT17 were the highly

virulent (DSI=100%). The 26 (57.77%) isolates showed moderately virulent response

(DSI>50%) and 4 (8.88%) isolates were low virulent (DSI≤50%) among all the

isolates (Table 4.19).

113

Table 4.18: Cultural and microscopic characteristics of S. rolfsii

Sr.


Colony

Margins Texture

Hyphal

Diameter

(µm)

Sclerotium

Diameter Color

(Front)

Color

(Reverse) Color Formation Location Shape

1 DGADY01 Islamabad Rawat 8.7±0.1 Silky-white White Irregular Fluffy 5.3±0.5 Dark brown Peripheral Surface Round

2 DGADY02 Islamabad Rawat 8.9±0.1 White to

light cream

White Irregular Fluffy 5.1±0.6 Dark brown Scattered Surface Round

3 DGADY03 Attock Fateh Jang 8.4±0.1 Silky-white White Irregular Thin flat 5.2±0.2 Dark brown Scattered Surface Round

4 DGADY04 Attock Fateh Jang 7.2±0.1 Silky-white White Irregular Submerged 5.2±0.6 Dark brown Scattered Surface Round

5 DGADY05 Attock Bahtar 8.3±0.1 Silky-white White Irregular Fluffy 5.4±0.2 Dark brown Peripheral Aerial &

surface

Round

6 DGADY06 Jhelum Sohawa 8.7±0.1 Silky-white White Irregular Thin flat 5±0.4 Cream to

brown

Peripheral Surface Round

7 DGADY07 Jhelum Sohawa 8.3±0.1 Silky-white White Irregular Thin flat 5.1±0.6 Dark brown Scattered Surface Round

8 DGADY08 Jhelum Domeli 8.6±0.1 Silky-white White Irregular Fluffy 5.1±0.3 Dark brown Peripheral Surface Round

9 DGADY09 Jhelum Domeli 8.9±0.1 Silky-white White Irregular Fluffy 4.8±0.3 Dark brown Peripheral Aerial &

surface

Round

10 DGADY10 Taxila Taxila 9.0±0 White to

light cream

White to

light cream

Irregular Fluffy 5.4±0.2 Dark brown Peripheral Surface Round

11 DGADY11 Taxila Taxila 9.0±0 Silky-white White Irregular Medium

fluffy

5.2±0.4 Cream to

brown

Scattered Aerial &

surface

Round

114

12 DGADY12 Rawalpindi Chak Beli

Khan

9.0±0 Silky-white White Irregular Medium

fluffy

5±0.2 Dark brown Scattered Surface Round

13 DGADY13 Rawalpindi Adyala 8.4±0.1 White to

light cream

White Irregular Medium

fluffy

5.2±0.8 Dark brown Scattered Aerial &

surface

Round

14 DGADY14 Rawalpindi Adyala 9.0±0 White to

light cream

White to

light cream

Irregular Thin flat 5.2±0.4 Dark brown Peripheral Surface Round

15 DGADY15 Rawalpindi Dhoke

Budhal

9.0±0 White to

light cream

White to

light cream

Irregular Medium

fluffy

5.3±0.3 Dark brown Peripheral Surface Round


Budhal

8.7±0.1 Silky-white White Irregular Fluffy 5.1±0.5 Dark brown Peripheral Aerial &

surface

Round

17 DGADY17 Chakwal Dab 8.3±0.1 White to

light cream

White Irregular Fluffy 5±0.3 Dark brown Scattered Surface Round

18 DGADY18 Chakwal Dab 9.0±0 White to

light cream

White Irregular Fluffy 5.2±0.8 Dark brown Scattered Surface Round

19 DGADY19 Chakwal Bhoun 8.2±0.1 White to

light cream


fluffy

5.2±0.4 Cream to

brown


20 DGADY20 Chakwal Bhoun 7.3±0.1 Silky-white White Irregular Thin flat 5±0.3 Dark brown Peripheral Surface Round

21 DGADY21 Chakwal Dhudial 8.7±0.1 Silky-white White Irregular Submerged 5.1±0.5 Dark brown Peripheral Surface Round

22 DGADY22 Chakwal Dhudial 9.0±0 Silky-white White Irregular Fluffy 5.5±0.4 Cream to

brown

Peripheral Aerial &

surface

Round

23 DGADY23 Chakwal Thoa

Bahdar

9.0±0 Silky-white White Irregular Fluffy 5.3±0.7 Dark brown Peripheral Aerial &

surface

Round


Bahdar

8.9±0.1 Silky-white White Irregular Submerged 5.2±0.2 Dark brown Scattered Surface Round

115

25 DGADY25 Kallar

Kahar

Miani 9.0±0 Silky-white White Irregular Medium

fluffy


26 DGADY26 Kallar

Kahar

Miani 8.2±0.1 Silky-white White Irregular Fluffy 5.4±0.2 Dark brown Scattered Surface Round

27 DGADY27 Kallar

Kahar

Buchal

Kalan

8.6±0.1 Silky-white White Irregular Fluffy 5.3±0.7 Dark brown Peripheral Aerial &

surface

Round

28 DGADY28 Choa

Saidan

Shah

Dalelpur 9.0±0 White to

light cream

White Irregular Submerged 5.5±0.5 Dark brown Scattered Surface Round

29 DGADY29 Gujar Khan Jatli 7.9±0.1 White to

light cream

White to

light cream

Irregular Fluffy 5.2±0.4 Dark brown Peripheral Surface Round

30 DGADY30 Gujar Khan Jatli 9.0±0 Silky-white White Irregular Fluffy 5.4±0.5 Dark brown Peripheral Surface Round

31 DGADY31 Gujar Khan Doltala 7.9±0.1 Silky-white White Irregular Fluffy 5±0.2 Dark brown Peripheral Aerial &

surface

Round

32 DGADY32 Gujar Khan Doltala 9.0±0 Silky-white White Irregular Thin flat 4.9±0.4 Cream to

brown


33 DGADY33 Jhelum Sohawa 9.0±0 Silky-white White Irregular Thin flat 5.3±0.7 Dark brown Peripheral Surface Round

34 DGADY34 Jhelum Sohawa 8.6±0.1 Silky-white White Irregular Submerged 5.1±0.2 Dark brown Scattered Surface Round

35 DGADY35 Jhelum Domeli 8.4±0.1 Silky-white

to light

cream


fluffy

5.4±0.3 Cream to

brown

Scattered Aerial &

surface

Round

36 DGADY36 Attock Bahter 8.6±0.1 Silky-white White Irregular Medium

fluffy


116

37 DGADY37 Attock Fateh Jang 9.0±0 White to

light cream


fluffy



light cream


fluffy



light cream


fluffy

5±0.5 Dark brown Peripheral Aerial &

surface

Round

40 DGADY40 Rawalpindi Adyala 9.0±0 Silky-white White Irregular Submerged 5.3±0.8 Dark brown Peripheral Surface Round

41 DGADY41 Rawalpindi Adyala 7.4±0.1 White to

light cream

White to

light cream

Irregular Thin flat 5.3±0.7 Dark brown Peripheral Surface Round


Budhal

9.0±0 Silky-white White Irregular Fluffy 5.3±0.4 Cream to

brown

Scattered Aerial &

surface

Round

43 DGADY43 Rawalpindi Chak Beli

Khan

8.5±0.1 White to

light cream

White Irregular Fluffy 5.3±0.7 Cream to

brown

Scattered Surface Round

44 DGADY44 Gujar Khan Jatli 9.0±0 Silky-white White Irregular Submerged 5.7±0.4 Dark brown Peripheral Surface Round

45 DGADY45 Gujar Khan Doltala 8.5±0.1 Silky-white White Irregular Thin flat 5.3±0.3 Dark brown Peripheral Surface Round

46 DGADY46 Chakwal Bhaun 9.0±0 Silky-white White Irregular Medium

fluffy

5.3±0.7 Dark brown Peripheral Aerial &

surface

Round

47 DGADY47 Chakwal Dhudial 9.0±0 Silky-white White Irregular Fluffy 5.3±0.3 Dark brown Scattered Aerial &

surface

Round

48 DGADY48 Chakwal Dab 8.6±0.1 White to

light cream

White Irregular Fluffy 5.3±0.7 Dark brown Peripheral Aerial &

surface

Round


Bahdar

9.0±0 Silky-white White Irregular Medium

fluffy


50 DGADY50 Kallar

Kahar

Miani 9.0±0 Silky-white White Irregular Thin flat 5.2±0.5 Dark brown Peripheral Surface Round

117

In a study, symptoms produced by C. truncatum isolates on artificially inoculated

different pepper cultivars were dry, brown-black lesions. Whereas, C. gloeosporiodes

isolates produced soft, sunken and water-soaked lesions (Hema Ramdial &

Rampersad, 2015). Pathogenicity testing of C. truncatum on pepper developed

abundant black acervuli with setae and on decaying fruits dirty white conidial masses

were produced (Fangling Liu et al., 2016). Pathogenicity of C. truncatum isolates

were evaluated with a cross-inoculation assay using pepper, physic nut and papaya.

The results showed that the isolates could infect the three host, regardless of the

inoculation method (Torres‐Calzada et al., 2018).

The isolates representative of the two colony types (F. incarnatum and F.

proliferatum) showed typical symptoms of Fusarium rot on detached bell pepper fruit.

After 5 days, white mycelial growth surrounded by water-soaked, greenish to light

brown necrotic lesions appeared identical to the symptomatic fruits observed in the

greenhouses and open fields (Figure 4.63). However, no symptoms were shown on

control fruits. Differences in virulence among the isolates were observed. The 10

(25%) isolates viz. FICW3, FICW5, FICW7, FICW8, FICW10, FICW11, FICW12,

FICW15, FICW16 and FICW17 were the highly virulent. The 18 (45%) isolates

exhibited moderately virulent response. However, 12 (30%) showed low virulence

towards disease (Table 4.20). In a study, the isolates of FIESC were inoculated with

105 conidia/mL developed necrotic lesions at the point of inoculation (H Ramdial,

Hosein, & Rampersad, 2016). In another experiment, isolates of F. lactis caused

infection on pepper fruits. Whereas, isolates of F. proliferatum caused internal fruit

infection (Yang, Kharbanda, Howard, & Mirza, 2009).

Pathogenicity test showed that all isolates of B. cinerea were able to infect the bell

pepper fruits. After 5 days, the symptoms produced on artificially inoculated fruits

identical to those observed in the field and showed water-soaked lesions, with

grayish-brown hyphae that were later covered with conidia and conidiophores. The

fruit become soft and rotted (Figure 4.64). However, the degree of aggressiveness

varied among the isolates. Notably, 10 (25%) isolates viz. NRCB03, NRCB07,


NRCB40 manifested highly virulent response. In contrast, 28 (70%) isolates were

118

moderate in virulence and only 2 (5%) isolates viz. NRCB16 and NRCB27 exhibited

low virulence (Table 4.21). Three fruits each of C. annuum var. grossum and C.

annuum cv. Madrid were pin-pricked and inoculated with B. cinerea (1×106

conidia/mL). Inoculated fruits developed soft, irregular, grayish-brown lesions

(Huang & Sung, 2017).

All 36 isolates of A. alternata produced typical symptoms on artificially

inoculated bell pepper fruit after 5 days. These symptoms included grayish-black

lesions covered with black spores. The decayed fruit becomes water-soaked, soft and

shriveled (Figure 4.65). The 6 (22.22%) isolates manifested high virulence. In

contrast, 24 (66.66%) isolates were moderately virulent and 4 (11.11%) isolates viz.

ASA7, ASA15, ASA23 and ASA30 showed low virulence (Table 4.22).

The varying pathogenic behavior of F. equiseti isolates was observed on

artificially inoculated young bell pepper seedlings after 10 days. Typical Fusarium

root rot symptoms include leaf chlorosis, wilting and leaf dropping (Figure 4.66).

Infected plants had light to dark brown discolored and rotted roots. Light to dark

brown vascular discoloration of internal portion of stem, resembled those observed in

the field. The 7 (17.07%) isolates viz. FJH4, FJH12, FJH15, FJH16, FJH27, FJH33

and FJH37 were found to be highly virulent. In contrast, 26 (63.41%) isolates

exhibited moderate virulence. However, 9 (21.95%) isolates viz. FJH7, FJH9, FJH14,

FJH18, FJH20, FJH24, FJH25, FJH30 and FJH39 were low virulent (Table 4.23).

After 10 days, the young seedlings of bell pepper inoculated with Rhizoctonia

solani developed reddish-brown or black cankers on stem (Figure 4.67). The lesions

girdle the young stem with the progression of disease and plant tops collapsed. The 6

(10.71%) isolates viz. FJR01, FJR03, FJR04, FJR07, FJR09 and FJR14 were highly

virulent. However, 43 (76.78%) manifested moderate virulence and 7 (12.5%) isolates

were low virulent (Table 4.24).

The symptoms developed by Sclerotium rolfsii on artificial inoculated bell pepper

seedlings after 10 days include poor top growth and wilting of the leaves (Figure

4.68). Water-soaked lesions appeared on roots and lower stem part. White cottony

growth covered the infected root surface. The roots become rotted and plant

eventually died. Notably, 4 (8%) isolates viz. DGADY05, DGADY09, DGADY14

119

and DGADY15 exhibited highly virulent response. In contrast, 42 (84%) isolates

were moderately virulent and 4(8%) exhibited low virulence (Table 4.25).

The fungi re-isolated from artificially inoculated fruits/roots were identical in

morphology to the original isolates on PDA and fulfilling the Koch’s postulates. No

lesions developed in the healthy control fruits/roots inoculated with sterile distilled

water.

Figure 4.62: Symptoms of anthracnose caused by C. truncatum a. sunken, water-

soaked lesions with acervuli with rotting b. white to gray mycelia with small dot like

acervuli

Figure 4.63: Symptoms of Fusarium fruit rot a. white mycelial growth surrounded by

water-soaked, greenish lesions b. white mycelial growth surrounded by water-soaked,

light brown necrotic lesions

120

Figure 4.64: Symptoms of Botrytis cinerea a. water-soaked lesions b. grayish-brown

hyphae of B. cinerea covered with conidia and conidiophores

Figure 4.65: Symptoms of Alternaria alternata; water-soaked, grayish-black lesions,

rotted fruit

Figure 4.66: Fusarium root rot caused by F. equiseti; symptoms include leaf

chlorosis, wilting and leaf dropping

121

Table 4.19: Percent disease severity index of C. truncatum

Sr. No. Isolate DSI (%) Sr. No. Isolate DSI (%)

1 ACT5 100 24 ACT23 60

2 ACT11 100 25 ACT25 69.99

3 ACT13 100 26 ACT27 80

4 ACT24 83.33 27 ACT34 80

5 ACT32 80 28 ACT45 69.99

6 ACT43 83.33 29 ACT6 100

7 ACT44 66.66 30 ACT8 100

8 ACT2 100 31 ACT15 100

9 ACT9 100 32 ACT18 70

10 ACT10 100 33 ACT33 63.33

11 ACT20 69.99 34 ACT38 73.33

12 ACT21 46.66 35 ACT40 83.33

13 ACT26 56.66 36 ACT4 100

14 ACT29 40 37 ACT14 100

15 ACT30 76.66 38 ACT16 100

16 ACT35 63.33 39 ACT22 60

17 ACT37 73.33 40 ACT28 46.66

18 ACT41 63.33 41 ACT31 43.33

19 ACT42 60 42 ACT36 53.33

20 ACT7 100 43 ACT39 76.66

21 ACT12 100 44 ACT46 80

22 ACT17 100 45 ACT47 60

23 ACT19 83.33

122

Table 4.20: Percent disease severity index of Fusarium spp.


1 FICW1 80.00 21 FICW21 73.33

2 FICW2 60.00 22 FICW22 20.00

3 FICW3 93.33 23 FICW23 26.66

4 FICW4 46.66 24 FICW24 80.00

5 FICW5 100.00 25 FICW25 80.00

6 FICW6 60.00 26 FICW26 46.66

7 FICW7 93.33 27 FICW27 26.66

8 FICW8 100.00 28 FICW28 73.33

9 FICW9 60.00 29 FICW29 60.00

10 FICW10 100.00 30 FICW30 73.33

11 FICW11 100.00 31 FICW31 86.66

12 FICW12 100.00 32 FICW32 33.33

13 FICW13 40.00 33 FICW33 60.00

14 FICW14 46.66 34 FICW34 33.33

15 FICW15 100.00 35 FICW35 73.33

16 FICW16 100.00 36 FICW36 26.66

17 FICW17 100.00 37 FICW37 40.00

18 FICW18 20.00 38 FICW38 60.00

19 FICW19 46.66 39 FICW39 60.00

20 FICW20 33.33 40 FICW40 33.33

123

Table 4.21: Percent disease severity index of Botrytis cinerea


1 NRCB01 80.00 21 NRCB21 80.00

2 NRCB02 66.66 22 NRCB22 100.00

3 NRCB03 100.00 23 NRCB23 86.66

4 NRCB04 80.00 24 NRCB24 86.66

5 NRCB05 80.00 25 NRCB25 80.00

6 NRCB06 60.00 26 NRCB26 73.33

7 NRCB07 100.00 27 NRCB27 46.66

8 NRCB08 66.66 28 NRCB28 100.00

9 NRCB09 60.00 29 NRCB29 80.00

10 NRCB10 80.00 30 NRCB30 100.00

11 NRCB11 100.00 31 NRCB31 66.66

12 NRCB12 60.00 32 NRCB32 80.00

13 NRCB13 80.00 33 NRCB33 80.00

14 NRCB14 80.00 34 NRCB34 73.33

15 NRCB15 73.33 35 NRCB35 100.00

16 NRCB16 46.66 36 NRCB36 66.66

17 NRCB17 73.33 37 NRCB37 73.33

18 NRCB18 100.00 38 NRCB38 73.33

19 NRCB19 80.00 39 NRCB39 100.00

20 NRCB20 73.33 40 NRCB40 100.00

124

Table 4.22: Percent disease severity index of Alternaria alternata


1 ASA1 73.33 19 ASA19 100

2 ASA2 73.33 20 ASA20 60

3 ASA3 53.33 21 ASA21 60

4 ASA4 80 22 ASA22 80

5 ASA5 100 23 ASA23 46.66

6 ASA6 60 24 ASA24 80

7 ASA7 46.66 25 ASA25 100

8 ASA8 80 26 ASA26 80

9 ASA9 80 27 ASA27 60

10 ASA10 60 28 ASA28 100

11 ASA11 100 29 ASA29 80

12 ASA12 100 30 ASA30 46.66

13 ASA13 80 31 ASA31 86.66

14 ASA14 80 32 ASA32 100

15 ASA15 46.66 33 ASA33 80

16 ASA16 100 34 ASA34 60

17 ASA17 86.66 35 ASA35 66.66

18 ASA18 73.33 36 ASA36 73.33

125

Table 4.23: Percent disease severity index of Fusarium equiseti

Sr. No Isolate DSI (%) Sr. No Isolate DSI (%)

1 FJH1 66.67 22 FJH22 66.67

2 FJH2 60.00 23 FJH23 60.00

3 FJH3 73.33 24 FJH24 26.67

4 FJH4 100.00 25 FJH25 46.67

5 FJH5 80.00 26 FJH26 66.67

6 FJH6 73.33 27 FJH27 100.00

7 FJH7 46.67 28 FJH28 80.00

8 FJH8 60.00 29 FJH29 80.00

9 FJH9 33.33 30 FJH30 40.00

10 FJH10 80.00 31 FJH31 53.33

11 FJH11 73.33 32 FJH32 80.00

12 FJH12 100.00 33 FJH33 100.00

13 FJH13 73.33 34 FJH34 60.00

14 FJH14 40.00 35 FJH35 80.00

15 FJH15 100.00 36 FJH36 73.33

16 FJH16 100.00 37 FJH37 100.00

17 FJH17 86.67 38 FJH38 66.67

18 FJH18 46.67 39 FJH39 40.00

19 FJH19 73.33 40 FJH40 80.00

20 FJH20 33.33 41 FJH41 73.33

21 FJH21 80.00

126

Table 4.24: Percent disease severity index of Rhizoctonia solani


1 FJR01 100.00 29 FJR29 80.00

2 FJR02 73.33 30 FJR30 73.33

3 FJR03 100.00 31 FJR31 53.33

4 FJR04 100.00 32 FJR32 66.67

5 FJR05 80.00 33 FJR33 80.00

6 FJR06 73.33 34 FJR34 73.33

7 FJR07 100.00 35 FJR35 66.67

8 FJR08 53.33 36 FJR36 66.67

9 FJR09 100.00 37 FJR37 73.33

10 FJR10 73.33 38 FJR38 53.33

11 FJR11 66.67 39 FJR39 66.67

12 FJR12 53.33 40 FJR40 60.00

13 FJR13 60.00 41 FJR41 46.67

14 FJR14 100.00 42 FJR42 66.67

15 FJR15 46.67 43 FJR43 80.00

16 FJR16 80.00 44 FJR44 80.00

17 FJR17 73.33 45 FJR45 73.33

18 FJR18 86.67 46 FJR46 66.67

19 FJR19 80.00 47 FJR47 46.67

20 FJR20 46.67 48 FJR48 53.33

21 FJR21 73.33 49 FJR49 46.67

22 FJR22 80.00 50 FJR50 73.33

23 FJR23 80.00 51 FJR51 80.00

24 FJR24 73.33 52 FJR52 73.33

25 FJR25 66.67 53 FJR53 73.33

26 FJR26 53.33 54 FJR54 53.33

27 FJR27 60.00 55 FJR55 73.33

28 FJR28 46.67 56 FJR56 66.67

127

Table 4.25: Percent disease severity index of Sclerotium rolfsii


1 DGADY01 73.33 26 DGADY26 80.00

2 DGADY02 80.00 27 DGADY27 80.00

3 DGADY03 80.00 28 DGADY28 66.67

4 DGADY04 73.33 29 DGADY29 80.00

5 DGADY05 100.00 30 DGADY30 46.67

6 DGADY06 80.00 31 DGADY31 80.00

7 DGADY07 80.00 32 DGADY32 80.00

8 DGADY08 86.67 33 DGADY33 86.67

9 DGADY09 100.00 34 DGADY34 80.00

10 DGADY10 80.00 35 DGADY35 46.67

11 DGADY11 100.00 36 DGADY36 73.33

12 DGADY12 80.00 37 DGADY37 80.00

13 DGADY13 73.33 38 DGADY38 80.00

14 DGADY14 100.00 39 DGADY39 73.33

15 DGADY15 100.00 40 DGADY40 73.33

16 DGADY16 80.00 41 DGADY41 80.00

17 DGADY17 66.67 42 DGADY42 86.67

18 DGADY18 80.00 43 DGADY43 46.67

19 DGADY19 86.67 44 DGADY44 80.00

20 DGADY20 80.00 45 DGADY45 40.00

21 DGADY21 73.33 46 DGADY46 80.00

22 DGADY22 80.00 47 DGADY47 86.67

23 DGADY23 80.00 48 DGADY48 80.00

24 DGADY24 80.00 49 DGADY49 80.00

25 DGADY25 73.33 50 DGADY50 73.33

128

Figure 4.67: Root rot caused by R. solani; plant top collapsed, reddish-brown or

black cankers girdle the stem

Figure 4.68: Root rot caused by S. rolfsii; Poor top growth and wilting of the leaves

4.7 MOLECULAR CHARACTERIZATION

4.7.1 Molecular Characterization of Colletotrichum truncatum

The 15 most virulent isolates confirmed by pathogenicity testing were chosen for

multi-locus sequence analysis. All isolates showed 99-100% homology with already

submitted sequences of C. truncatum. A phylogram was generated based on the

combined sequences of six genes (ITS, ACT, GAPDH, CHS-1, HIS3 and TUB2)

(Appendix G). The reference sequences were downloaded from GenBank using

Monilochaetes infuscans (CBS 869.96) as an outgroup. There was a total of 1482

positions in the final dataset including alignment gaps were processed. The most

129

parsimonious tree length was 16350, the retention index was (0.331994), consistency

index was (0.267756), and the composite index was 0.088938 (0.088893) for all the

sites and parsimony informative sites. The phylogram showed that all the 15 bell

pepper anthracnose isolates grouped into monophyletic clade. The isolates of

Colletotrichum truncatum under study were further grouped into three sub-clades.

The isolate ACT6 showed low bootstrap support of <50% with reference isolate

CBP003 (isolated from Brassica parachinensis Bailey in China). Whereas, the rest of

14 isolates of this study showed 100% bootstrap support with reference isolate

LJTJ26 (isolated from pepper in Sichuan province, China). The isolates of C.

truncatum from this study and reference sequences from GenBank were placed into

single monophyletic group and the results were similar to other studies (Damm et al.,

2009). The first multilocus (using ITS, HIS4 and TUB2 sequences) molecular

phylogenetic analysis of Colletotrichum species consisting of C. acutatum aggregate

were published in 2002 (Talhinhas, Sreenivasaprasad, Neves-Martins, & Oliveira,

2002). A study on the same species cluster related with Rhododendron in Latvia and

Sweden were carried out by using ITS, TUB2 and mtSSU genes (Vinnere, Fatehi,

Wright, & Gerhardson, 2002). HMG-box segment of the mating-type genes MAT-1

was revealed to be a valuable evolutionary marker (Du, Schardl, Nuckles, &

Vaillancourt, 2005). From around this time, the multilocus phylogenetic analysis has

become the norm and the sequencing costs reduced (Cannon, Damm, Johnston, &

Weir, 2012).

4.7.2 Molecular Characterization of Fusarium spp.

The 6 virulent isolates of F. incarnatum and 4 virulent isolates of F. proliferatum

confirmed by pathogenicity testing were chosen for phylogenetic analysis. All isolates

showed 99-100% homology with already submitted sequences of GenBank. A

phylogram was generated using the sequences of TEF gene. The most parsimonious

tree length was 1378, the retention index was 0.877537, consistency index was

0.863910, and the composite index was 0.762273 (0.758113) for all the sites and

parsimony informative sites. The reference sequences were obtained from GenBank

with Fusarium concolor (NRRL 13459) as an outgroup. The isolates of F. incarnatum

under study were grouped into three clades. A total of 614 sites in the final dataset

were processed. The four isolates FICW7, FICW10, FICW11 and FICW16 in clade 1

130

clustering with Fusarium cf. incarnatum (MLST 1-c clone spt111) with 100%

bootstrap support. Isolate FICW5 in clade 3 clustering with Fusarium cf. incarnatum

(30-a DPGS-2011 strain FRC R10113) with 100% bootstrap support. However,

FICW17 isolate in clade 2 showed the bootstrap support of 51% with clade 1 (Figure

4.70).

Figure 4.69: Molecular phylogeny of C. truncatum, generated from a maximum

parsimony analysis tree obtained from the dataset containing the partial DNA

sequences of ITS, GAPDH, ACT, CHS-1, HIS3 and TUB2 genes.

131

Figure 4.70: Molecular phylogeny of F. incarnatum, generated from a maximum


sequences of EF1- α gene.

The isolates of F. proliferatum under study were grouped into two clades. A total

of 647 sites in the final dataset were carried out. The most parsimonious tree length

was 1920, the retention index was (0.761380), consistency index was (0.739540), and

the composite index was 0.563897 (0.563071) for all the sites and parsimony

informative sites. The isolate FICW15 in sister clade-I clustering with Fusarium

proliferatum (B2) with 100% bootstrap support. In sister clade-II, isolates viz. FICW8

and FICW12 showed 90% bootstrap support with clade-I. Isolate FICW3 in clade 2

clustering with Fusarium proliferatum (CBS 131574) showed 100% bootstrap support

(Figure 4.71).

132

Figure 4.71: Molecular phylogeny of F. proliferatum, generated from maximum

parsimony analysis tree inferred from the dataset containing the partial DNA

sequences of EF1- α gene.

The phylogenetic tree of the individual data sets of both Fusarium spp. were

found similar to the tree obtained from the concatenated alignment of F. incarnatum

and F. proliferatum. A total of 614 sites in the final dataset were processed. The most

parsimonious tree length was 2823, the retention index was (0.752469), consistency


sites and parsimony informative sites. All isolates of this study showed 100%

bootstrap support except isolate FICW17 with low bootstrap support (Figure 4.72).

133

Figure 4.72: Molecular phylogeny of F. incarnatum and F. proliferatum, generated

from a maximum parsimony analysis tree obtained from the dataset containing the

partial DNA sequences of EF1- α gene.

134

Internal transcribed spacer (ITS) region is unable to resolve Fusarium spp.

lineages (O’Donnell et al., 2013). Protein coding genes, for example translation

elongation factor (EF-1α), beta-tubulin (TUB), RNA polymerase II subunits (RPB1

and RPB2) have been recommended in general for Fusarium species confirmation

(Geiser et al., 2004). EF-1α gene, however consists of conserved exonic and variable

intronic sequences and is suitable for inferring deep phylogenies, capture more recent

evolutionary and speciation events (Stielow et al., 2015). The EF-1α gene sequence,

with similarity index of 99.4% is a suitable genetic marker for categorizing Fusarium

species (O’Donnell et al., 2015).

4.7.3 Molecular Characterization of Botrytis cinerea

All isolates of B. cinerea showed 99-100% homology with already submitted

sequences of GenBank. A phylogram was generated using the sequences of ITS gene.

The reference sequences were obtained from GenBank with Athelia rolfsii (SR-002)

as an outgroup. A total of 413 sites in the final dataset were processed. The most

parsimonious tree length was 1631, consistency index was (0.649599), the retention


sites and parsimony informative sites. The isolates of B. cinerea were grouped into

three clades. The clade I is subdivided into 2 sister clades. In sister clade I, isolate

NRCB28 and NRCB03 showed close resemblance and 100% bootstrap support with

B. cinerea (isolate KM63) and Botryotinia fuckeliana (isolate bbleafspot). Sister clade

II is further subdivided into 2 sub-clades. The isolate NRCB07 in sub-clade I showed

low bootstrap support (37%) with sub-clade II. Whereas, the isolate NRCB11 in sub-

clade II showed 100% resemblance with Botrytis cinerea isolate Mst9. The isolates

viz. NRCB22 and NRCB35 in clade 2 supported with 100% bootstrap value with B.

cinerea isolates (SCB7-5, BGM005 and BfHN1) (Figure 4.73).

A phylogram was generated using the sequences of partial G3PDH gene. The

reference sequences were obtained from GenBank with Sclerotinia sclerotiorum

(strain 484) as an outgroup. A total of 681 sites in the final dataset were processed.

The most parsimonious tree length was 2335, consistency index was (0.726134), the

retention index was (0.770373), and the composite index was 0.561201 (0.559394)

for all the sites and parsimony informative sites. The isolates of B. cinerea were

grouped into three clades. The clade 1 isolates viz. NRCB22 and NRCB40 showed

135

moderate bootstrap support (62%) with B. cinerea strain CHM137423 and isolate

NRCB39 shows 46% bootstrap support. The isolates in clade 2 viz. NRCB11,

NRCB30 and NRCB35 shows low bootstrap support (31%) with clade 1. The clade 3

is sub-divided into 2 sister clades. The isolate NRCB07 in sister-clade I showed 91%

bootstrap support with sister-clade II. Isolate NRCB28 in sister-clade II shows 100%

bootstrap support with isolates BCH02, BCH03 and BCH09 (Figure 4.74).

Figure 4.73: Molecular phylogeny of B. cinerea, generated from a maximum


sequences of ITS gene.

136

Figure 4.74: Molecular phylogeny of B. cinerea, generated from a maximum


sequences of partial G3PDH gene.

4.7.4 Molecular Characterization of Alternaria alternata

A phylogram was generated using the sequences of partial beta-tubulin gene. The

reference sequences were obtained from GenBank with Botrytis cinerea (F734) as an

outgroup. The most parsimonious tree length was 1827, the retention index was

(0.752868), consistency index was (0.609984) and the composite index was 0.459880

(0.459237) for all the sites and parsimony informative sites. The isolates of A.

alternata were grouped into three clades. All isolates of this study showed 98-100%

bootstrap support with the reference isolates from GenBank (Figure 4.75).

137

Figure 4.75: Molecular phylogeny of A. alternata, generated from a maximum


sequences of beta-tubulin gene.

4.7.5 Molecular Characterization of Fusarium equiseti

A phylogram was generated using the sequences of partial TEF gene (Figure

4.76). The reference sequences were obtained from GenBank with F. concolor (strain

NRRL 13495) as an outgroup. A total of 642 sites in the final dataset were processed.

The most parsimonious tree length was 1475, the retention index was (0.934120),

consistency index was (0.881831) and the composite index was 0.824559 (0.823736)

for all the sites and parsimony informative sites. The isolates of F. equiseti of this

study were grouped into three clades. The clade I isolates viz. FJH27, FJH33, FJH37

showed 100% bootstrap support with F. equiseti isolates. The clade II isolates viz.,

FJH12, FJH15 and FJH16 showed 81% bootstrap support with clade I isolates. The

isolate FJH04 in clade III depicted 100% bootstrap value with reference isolate CF21

(Accession no. KF514661).

138

Figure 4.76: Molecular phylogeny of F. equiseti, generated from a maximum


sequences of partial TEF gene.

4.7.6 Molecular Characterization of Rhizoctonia solani

All isolates of R. solani showed 99-100% homology with already submitted

sequences of GenBank. A phylogram was generated using the sequences of RS gene

(Figure 4.77). The reference sequences were obtained from GenBank with Athelia

rolfsii (SR-002) as an outgroup. A total of 557 sites in the final dataset were

processed. The most parsimonious tree with length was 2894. The retention index was

(0.613655), consistency index was (0.518839), and the composite index is 0.318490

(0.318388) for all sites and parsimony-informative sites. There were a total of 557

positions in the final dataset.

The isolates of R. solani were grouped into four clades. The clade 1 is sub-

divided into 2 sister clades. The isolate FJR09 in sister clade-I showed 100%

bootstrap support with R. solani isolate Capip2. In sister clade-II, isolate FJR04

139

showed moderate bootstrap support (72%) with Ceratobasidium sp. isolate Str111. In

clade 2, isolate FJR7 showed 100% bootstrap support with IQ49 isolate. Clade 3 is

sub-divided into 2 sister clades. In sister clade-I, isolate FJR03 showed 52% bootstrap

support. Whereas, isolate FJR14 in sister clade-II supported 100% bootstrap with

RS72. Isolate FJR01 in clade 4 showed low bootstrap support (27%).

Figure 4.77: Molecular phylogeny of R. solani, generated from a maximum


sequences of RS gene.

140

4.7.7 Molecular Characterization of Sclerotium rolfsii (Teleomorph: Athelia rolfsii)

A phylogram was generated using the partial sequences of LSU gene (Figure

4.78). The reference sequences were obtained from GenBank with C. gloeosporioides

(strain LC0555) as an outgroup. A total of 547 sites in the final dataset were

processed. The most parsimonious tree length was 3259, the retention index was

(0.557984), consistency index was (0.472052), and the composite index was 0.263668

(0.263397) for all the sites and parsimony informative sites. The isolates of A. rolfsii

were grouped into five clades. The clade I showed 100% bootstrap support with

reference sequences. The clade II isolate DGADY15 showed 98% support with clade

I isolate. The clade III isolate DGADY11 showed 65% bootstrap support with clade

IV isolates (99% bootstrap support). The isolates of clade V depicted 95% bootstrap

support with other clades.

Figure 4.78: Molecular phylogeny of A. rolfsii, generated from a maximum parsimony

analysis tree obtained from the dataset containing the partial DNA sequences of LSU

gene.

https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/teleomorphs

141

4.8 IN VITRO BIO-CONTROL

4.8.1 In Vitro Bio-Control using Natural Compounds

Statistically, significant inhibition in radial mycelial growth of highly virulent

isolate of C. truncatum (ACT12) was rendered by all concentrations of chitosan,

salicylic acid and calcium chloride, except the lowest concentration of CaCl2 (0.5%)

as compared to the control (P<0.05, Appendix H).

The maximum % RMGI (55.6%) was noted in 2.5% chitosan concentration

followed by 2% chitosan concentration (53.88%) which was however, statistically at

par with 2.5% concentration (Figure 4.79, 4.80). The ascending trend in % RMGI was

noticed with the increase in concentration of natural compounds. However, complete

inhibition of RMG of C. truncatum was not observed even at the maximum tested

concentrations of all natural compounds as compared to control. Salicylic acid

showed 53.3% RMGI with 2.5% concentration. Calcium chloride was found the least

effective (Figure 4.81, 4.82). However, the increase in concentration of CaCl2 up to

2.5% (Figure 3) showed a little inhibition in RMG (27.8%) when compared with

control.

Figure 4.79: Percent radial mycelial growth inhibition of C. truncatum after 7 days of

incubation at 25°C treated with chitosan, salicylic acid and calcium chloride. Means

showing the same letters are not significantly different according to the LSD

(P<0.05).

142

The highest percent inhibition of RMG by chitosan might be due to the fact that

chitosan interferes with negatively charged molecules of the fungi, causing leakage of

proteinaceous compounds and intracellular electrolytes (Leuba & Stossel, 1986).

Chitosan not only inhibits protein synthesis and mRNA (Hadwiger, 1999), but also

inhibits the fungal growth, spore formation and induce morphological changes in

fungi (Bautista Baños, Hernández López, & Bosquez Molina, 2004).

A study carried out by Muñoz, Moret, & Garcés (2009) showed that the radial

mycelial growth of Colletotrichum sp. was inhibited at 2% and 2.5% chitosan

concentration by 39.42%, and 63.16% respectively. Whereas at 1% and 1.5% chitosan

concentration RMGI was 14.96% and 24.95% respectively. Likewise, in another

study radial mycelial growth inhibition of C. capsici was 70% at the highest chitosan

concentration (2%) after 7 days incubation (Edirisinghe, Ali, Maqbool, & Alderson,

2014). The efficacy of chitosan has also been reported to inhibit the radial mycelial

growth of various other fungal pathogens including Colletotrichum gloeosporiodes, B.

cinerea, A. alternata, and R. stolonifera. Moreover, percent inhibition in RMG

increased as the concentration of chitosan increased (0.75–6.0 mg ml-1) (El Ghaouth,

Ponnampalam, Castaigne, & Arul, 1992).

The coating of chitosan has also been reported to reduce the lesion development

of Rhizopus stolonifer and Botrytis cinerea, increases shelf life and also delays the

rotting of inoculated cucumber, bell pepper and strawberry fruit (El Ghaouth, Arul,

Asselin, & Benhamou, 1992).

Figure 4.80: Radial mycelial growth of C. truncatum after 7 days of incubation at

25°C treated with chitosan (a) 0.5% (b) 1% (c) 1.5% (d) 2% (e) 2.5%

143


25°C treated with Salicylic acid (a) 0.5 % (b) 1% (c) 1.5 % (d) 2 % (e) 2.5 %


25°C treated with calcium chloride (a) 0.5% (b) 1% (c) 1.5% (d) 2% (e) 2.5%

4.8.2 In vitro Bio-control using Volatile Compounds

The effect of volatile compounds (VOCs) viz. trans-2-hexenal, 1-hexanol and 1-

octen-3-ol on radial mycelial growth of highly virulent isolates of C. truncatum

(ACT12) and F. equiseti (FJH15) after 7 days of incubation on PDA media are shown

in Figure 4.83 and 4.84. Statistically, significant inhibition in RMG was observed

against all tested volatiles and their efficacy increased with the increase in

concentrations (Appendix I and J). However, at 100 ppm, all volatiles completely

inhibited the radial mycelial growth of both pathogens viz. C. truncatum (Figure 4.85,

4.86, 4.87) and F. equiseti, (4.88, 4.89, 4.90).

144

The highest inhibition of RMG by trans-2-hexenal and 1-hexanol might be due

to the disruption of the cellular membrane, the increase of membrane permeability

and the leakage of cell components (Marino et al., 2001; Zhang et al., 2016).

Antifungal activity of 1-hexanol, trans-2-hexenal was reported by many researchers

against various fungi (Corbo, Lanciotti, Gardini, Sinigaglia, & Guerzoni, 2000; Cruz

et al., 2012; Gardini, Lanciotti, & Guerzoni, 2001; Myung, Hamilton-Kemp, &

Archbold, 2006; Neri, Mari, & Brigati, 2006). However, the efficacy of these

compounds against the pathogens of bell pepper including C. truncatum and F.

equiseti is being reported for the first time.

Figure 4.83: Percent radial mycelial growth inhibition of C. truncatum at four

concentrations of trans-2-hexenal, 1-hexanol and 1-octen-3-ol after 7 days. Means

showing the same letters are not different significantly according to the LSD

(P<0.05).

Figure 4.84: Percent radial mycelial growth inhibition of F. equiseti at four

concentrations of trans-2-hexenal, 1-hexanol and 1-octen-3-ol after 7 days. Means

showing the same letters are not different significantly according to the LSD

(P<0.05).

145


25°C treated with trans-2-hexenal (a) Control (b) 10 ppm (c) 50 ppm (d) 100 ppm


25°C treated with 1-hexanol (a) Control (b) 10 ppm (c) 50 ppm (d) 100 ppm


25°C treated with 1-octen-3-ol (a) Control (b) 10 ppm (c) 50 ppm (d) 100 ppm

146

Figure 4.88: Radial mycelial growth of F. equiseti after 7 days of incubation at 25°C

treated with trans-2-hexenal (a) Control (b) 10 ppm (c) 50 ppm (d) 100 ppm


treated with 1-hexanol (a) Control (b) 10 ppm (c) 50 ppm (d) 100 ppm


treated with 1-octen-3-ol (a) Control (b) 10 ppm (c) 50 ppm (d) 100 ppm

147

4.8.3 In vitro Bio-control using Antagonistic Fungi

The effect of antagonistic fungi, T. harzianum, T. viride and T. hamatum on radial

mycelial growth of Fusarium equiseti (isolate FJH15) after 7 days of incubation on

PDA are shown in Figure 4.91, 4.92. The most significant inhibition (P<0.05,

Appendix K) was observed in co-inoculated cultures of all Trichoderma species and

F. equiseti as compared to the control. Out of tested antagonist, T. harzianum showed

the maximum inhibition of 56.1% over control followed by T. viride and T. hamatum

with 53.5% and 48.7% mycelial growth respectively.

In vitro inhibition of radial mycelial growth of C. capsici (isolated from pepper)

has also been observed by Ekefan, Jama, & Gowen in 2009, when it was co-cultured

with T. harzianum. The colony diameter of C. capsici was significantly reduced (44-

48.71%) as compared to the control.

The enzymes like chitinases and β-1, 3 glucanases produced by Trichoderma play

a vital role in suppression of plant pathogen. These lytic enzymes break down chitin,

β-glucans and polysaccharides (cell wall structural components) that leads to the

leakage of protoplasmic substances through host’s cell wall. These contents are in

turn used by antagonist as food material.

Figure 4.91: Percent RMGI of antagonistic fungi

148

Figure 4.92: Colonies of F. equiseti confronted with antagonistic fungi after 7 days of

incubation at 25°C

149

SUMMARY

Bell pepper (Capsicum annuum L.) is an economic and popular crop in Pakistan.

Among various constraints fruit and root rot diseases cause significant yield losses.

No detailed studies prior to this work, with reference to disease documentation was

conducted in Pothohar plateau including Rawalpindi division (Attock, Chakwal,

Jhelum, Rawalpindi) and Islamabad. The study was aimed to assess prevalence and

incidence of fruit and root rot diseases, identification of pathogenic species employing

morphological as well as molecular tools and their pathogenic behavior. Further the in

vitro, eco-friendly management approaches were also explored against the most

prevalent fruit and root rot pathogen.

In the present study, a total of 8 greenhouses and 45 farmer’s fields/low plastic

tunnels of bell pepper were surveyed in 9 tehsils/territory during 2015-16 and 2016-17

for the assessment of percent disease prevalence, incidence and collection of diseased

samples. The same greenhouses/low plastic tunnels/open fields were surveyed at both

crop stages (seedling and maturity stage) and cropping years (2015-16 and 2016-17).

The survey and laboratory isolations revealed that four pathogens viz.

Colletotrichum, Fusarium, Botrytis and Alternaria were responsible to cause fruit rots

in bell pepper. In greenhouse cultivation, their prevalence was found 100%, however

Colletotrichum fruit rot was not observed in the greenhouse. The overall mean

incidence of Botrytis fruit rot was the maximum (15.1%) followed by Fusarium

(13.6%) and Alternaria fruit rot (9.7%) in greenhouse. All the locations surveyed in

open fields showed 100% disease prevalence of Colletotrichum, Fusarium and

Alternaria fruit rot. However, the mean prevalence of Botrytis fruit rot was 41.7%.

The mean incidence of Colletotrichum was the maximum (20.7%), followed by

Fusarium (12.0%), Alternaria (8.9%) and Botrytis fruit rot (6.7%).

Three pathogens viz. Fusarium, Rhizoctonia and Sclerotium were found

responsible for root rot. At seedling stage, the average mean disease prevalence was

found 100% for Fusarium root rot in all visited greenhouses. However, disease

prevalence for Rhizoctonia and Sclerotium root rot was 75% and 37.5% respectively.

The overall mean incidence of Rhizoctonia was the maximum (19.3%) followed by

Fusarium (15.6%) and Sclerotium (4.1%) root rot. In low plastic tunnels at seedling

150

stage, there was 100% disease prevalence for Rhizoctonia and Fusarium root rot.

However, disease prevalence of Sclerotium root rot was 77.8%. The overall incidence

of Fusarium root rot was the maximum (15.98%) followed by Rhizoctonia (14.1%)

and Sclerotium (7.38%). At maturity stage in greenhouse, the prevalence of Fusarium,

Rhizoctonia and Sclerotium root rot was 100%, 75% and 50% respectively. However,

the overall incidence of Fusarium was the maximum (9.25%) followed by

Rhizoctonia (6.22%) and Sclerotium (4.94%) root rot. In open fields, there was 100%

prevalence of Fusarium and Sclerotium root rot. However, prevalence for Rhizoctonia

root rot was 88.9%. The overall incidence of Sclerotium was the maximum (14.35%)

followed by Fusarium (8.3%) and Rhizoctonia (6.1%) root rot.

A total of 308 isolates were recovered from collected diseased samples. Out of

which 161 yielded from fruits viz. Colletotrichum truncatum (45 isolates), Fusarium

incarnatum (29 isolates), Fusarium proliferatum (11 isolates), Botrytis cinerea (40

isolates), Alternaria alternata (36 isolates). 147 isolates were recovered from root viz.

Fusarium equiseti (41 isolates), Rhizoctonia solani (56 isolates) and Sclerotium rolfsii

(50 isolates). Various morphological characters viz. colony color, reverse color,

texture, topography, margin of colony, hyphal characteristics, and resting structures

(sclerotia) were visually studied. The microscopic characters viz. spore color, shape,

size (length × width), number of septations, hyphal dimensions were noted, further

compared and confirmed with the fungal identification keys.

For pathogenicity test, widely planted yolo wonder variety was used. The species

of highly virulent isolates revealed during pathogenicity test were further confirmed

employing molecular tools. The multigene phylogenetic analysis using 6 genes

(internal transcribed spacer (ITS), actin (ACT), glyceraldehyde-3-phosphate

dehydrogenase (GAPDH), Chitin synthase1 (CHS-1), Histone3 (HIS3) and Beta-

tubulin (TUB2) confirmed the virulent isolates as Colletotrichum truncatum. In case

of highly virulent isolates of genus Fusarium nucleotide sequence of TEF gene

confirmed two species i.e. Fusarium incarnatum and Fusarium proliferatum causing

fruit rot. Whereas, Fusarium equiseti was identified as causal pathogen from isolates

belonging to root rot. For the confirmation of Botrytis specie G3PDH and ITS genes

were amplified, and the causal agent identified as Botrytis cinerea. Large subunit gene

(LSU) was used for confirmation of Sclerotium rolfsii, RS for Rhizoctonia solani and

151

beta tubulin (TUB1) for the confirmation of isolates of Alternaria alternata.

Phylogenetic analysis of all isolates revealed genetic homology with previously

reported sequences in GenBank. Molecular characterization of isolates were found in

cognizance with morphological data.

Further, the most prevalent pathogen from fruit (Colletotrichum truncatum) and

root (Fusarium equiseti) was selected for in vitro bio-control using natural substances,

volatile compounds and antagonistic fungi. The natural compound chitosan showed

55.55% radial mycelial growth inhibition (RMGI) at 2.5%, followed by salicylic acid

and calcium chloride with 53.33% and 27.77% RMGI. All the tested volatiles viz. 1-

hexanol, trans-2-hexenal and 1-octen-3-ol at 100 ppm completely inhibited the radial

mycelial growth. Out of the three Trichoderma species, Trichoderma harzianum was

found the most effective with the maximum percent RMGI of 56.1%, followed by

Trichoderma viride (53.5%) and Trichoderma hamatum (48.7%). These findings

revealed the ability of natural compounds, volatile compounds and antagonistic fungi

for in vitro bio-control and need to be used further tested in field conditions for the

management of most disastrous pathogen employing highly virulent isolates identified

in this study.

152

LITERATURE CITED

Abbasi, N. A., Ashraf, S., Ali, I., & Butt, S. J. (2015). Enhancing storage life of

bell pepper by UV-C irradiation and edible coatings. Pakistan Journal of

Agricultural Sciences, 52(2).

Ajith, P., & Lakshmidevi, N. (2010). Effect of volatile and non-volatile

compounds from Trichoderma spp. against Colletotrichum capsici incitant

of anthracnose on bell peppers. Nature and Science, 8(9), 265-269.

Akbudak, N., Tezcan, H., Akbudak, B., & Seniz, V. (2006). The effect of harpin

protein on plant growth parameters, leaf chlorophyll, leaf colour and

percentage rotten fruit of pepper plants inoculated with Botrytis cinerea.

Scientia Horticulturae, 109(2), 107-112.

Akram, A., Iqbal, S. M., Qureshi, R. A., & Rauf, C. A. (2008). Variability among

isolates of Sclerotium rolfsii associated with collar rot disease of chickpea in

Pakistan. Pakistan Journal of Botany, 40(1), 453.

Ali, A., Maqbool, M., Ramachandran, S., & Alderson, P. G. (2010). Gum arabic

as a novel edible coating for enhancing shelf-life and improving

postharvest quality of tomato (Solanum lycopersicum L.) fruit.

Postharvest Biology and Technology, 58(1), 42-47.

Almeida, A., Abdelnoor, R., Calvo, E., Tessnman, D., & Yorinori, J. (2001).

Genotypic diversity among Brazilian isolates of Sclerotium rolfsii. Journal of

Phytopathology, 149(9), 493-502.

Bailey, J., O'connell, R., Pring, R., & Nash, C. (1992). Infection strategies of

Colletotrichum species. Infection strategies of Colletotrichum species, 88-120.

Barkai-Golan, R. (2001). Postharvest diseases of fruits and vegetables:

development and control: Elsevier.

Basu, S. K., De, A. K., & De, A. (2003). Capsicum: historical and botanical

perspectives. Capsicum: The Genus Capsicum, 33, 1-15.

Bautista-Baños, S. (2014). Postharvest Decay: Control Strategies: Elsevier.

153

Bautista Baños, S., Hernández López, M., & Bosquez Molina, E. (2004). Growth

inhibition of selected fungi by chitosan and plant extracts. Revista Mexicana

De Fitopatología, 22(2).

Benhamou, N. (1996). Elicitor-induced plant defence pathways. Trends in Plant

Science, 1(7), 233-240.

Black, L., Green, S., Hartman, G., & Poulos, J. (1993). Pepper diseases: a field

guide (Fr): AVRDC.

Bolkan, H., & Ribeiro, W. (1985). Anastomosis groups and pathogenicity of

Rhizoctonia solani isolates from Brazil. Plant Disease, 69(7), 599-601.

Bosland, P., & Votava, E. (2003). Peppers: vegetable and spice capsicums. CAB

International: Oxford.

Buddemeyer, J., Pfähler, B., Petersen, J., & Märländer, B. (2004). Genetic variation in

susceptibility of maize to Rhizoctonia solani (AG 2-2IIIB)–symptoms and

damage under field conditions in Germany/Genetische Variation in der

Anfälligkeit von Mais gegenüber Rhizoctonia solani (AG 2-2IIIB)–Symptome

und Schäden im Feld in Deutschland. Zeitschrift für Pflanzenkrankheiten und

Pflanzenschutz/Journal of Plant Diseases and Protection, 521-533.

Camporota, P., Soulas, M. L., & Perrin, R. (2000). Identification and

characterization of Rhizoctonia solani using PCR/RFLP and a pine

bioassay.

Cannon, P., Damm, U., Johnston, P., & Weir, B. (2012). Colletotrichum–current

status and future directions. Studies in Mycology, 73, 181-213.

Cantu, D., Greve, L. C., Labavitch, J. M., & Powell, A. L. (2009). Characterization of

the cell wall of the ubiquitous plant pathogen Botrytis cinerea. Mycological

Research, 113(12), 1396-1403.

Carbone, I., & Kohn, L. M. (1999). A method for designing primer sets for

speciation studies in filamentous ascomycetes. Mycologia, 553-556.

Cerkauskas, R. F. (2017). Etiology and management of Fusarium crown and root

154

rot (Fusarium oxysporum) on greenhouse pepper in Ontario, Canada.

Canadian Journal of Plant Pathology, 39(2), 121-132.

Chellemi, D., Mitchell, D., Kannwischer-Mitchell, M., Rayside, P., & Rosskopf,

E. (2000). Pythium spp. associated with bell pepper production in Florida.

Plant Disease, 84(12), 1271-1274.

Choi, H.-W., Hong, S., Kim, W., & Lee, Y. (2011). First report of internal fruit

rot of sweet pepper in Korea caused by Fusarium lactis. Plant Disease,

95(11), 1476-1476.

Coakley, S. M., Scherm, H., & Chakraborty, S. (1999). Climate change and plant

disease management. Annual Review of Phytopathology, 37(1), 399-426.

Combet, E., Henderson, J., Eastwood, D. C., & Burton, K. S. (2006). Eight-

carbon volatiles in mushrooms and fungi: properties, analysis, and

biosynthesis. Mycoscience, 47(6), 317-326.

Corbo, M. R., Lanciotti, R., Gardini, F., Sinigaglia, M., & Guerzoni, M. E.

(2000). Effects of hexanal, trans-2-hexenal, and storage temperature on

shelf life of fresh sliced apples. Journal of Agricultural and Food

Chemistry, 48(6), 2401-2408.

Crous, P. W., Groenewald, J. Z., Risède, J.-M., Simoneau, P., & Hywel-Jones, N.

L. (2004). Calonectria species and their Cylindrocladium anamorphs:

species with sphaeropedunculate vesicles. Studies in Mycology, 50, 415-

430.

Cruz, A. F., Hamel, C., Yang, C., Matsubara, T., Gan, Y., Singh, A. K., Kuwada,

K., & Ishii, T. (2012). Phytochemicals to suppress Fusarium head blight

in wheat–chickpea rotation. Phytochemistry, 78, 72-80.

Damm, U., Woudenberg, J., Cannon, P., & Crous, P. (2009). Colletotrichum

species with curved conidia from herbaceous hosts. Fungal Diversity, 39,

45.

Dasgupta, B. (1981). Sporulation and relative virulence among isolates

155

of Colletotrichum capsici causing anthracnose of betelvine. Indian

Phytopathology, 32, 196-199.

Daughtrey, M., & Horst, P. (1990). Biology and management of diseases of

greenhouse florist crops. In 1991 Recommendations for the integrated

management of greenhouse florist crops. Part II. Management of pests and

crop growth. New York State College of Agriculture and Life Science, Cornell

Univ., Ithaca, NY, 14853.

de Cara, M., Pérez-Hernández, A., Aguilera-Lirola, A., & Gómez-Vázquez, J.

(2017). First Report of Wilting, Root Rot, and Stunting Caused by

Pythium aphanidermatum on Sweet Pepper (Capsicum annuum) in

Southeastern Spain. Plant Disease, 101(6), 1059-1059.

Dehpour, A., Alavi, S., & Majd, A. (2007). Light and scanning electron microscopy

studies on the penetration and infection processes of Alternaria alternata,

causing brown spot on Minneola tangelo in the West Mazandaran—Iran.

World Applied Sciences Journal, 2(1), 68-72.

De Lucca, A., Carter‐Wientjes, C., Boue, S. , & Bhatnagar, D. (2011). Volatile

trans‐2‐hexenal, a soybean aldehyde, inhibits Aspergillus flavus growth

and aflatoxin production in corn. Journal of Food Science, 76(6), M381-

M386.

Demirci, E., & Doken, M. (1995). Anastomosis groups of Rhizoctonia solani

Kuhn and binucleate Rhizoctonia isolates from various crops in Turkiye.

Journal of Turkish Phytopathology.

Dhall, R. (2013). Advances in edible coatings for fresh fruits and vegetables: a

review. Critical Reviews in Food Science and Nutrition, 53(5), 435-450.

Diao, Y., Fan, J., Wang, Z., & Liu, X. (2013). First report of Colletotrichum

boninense causing anthracnose on pepper in China. Plant Disease, 97(1),

138-138.

Dias, G. B., Gomes, V. M., Moraes, T. M., Zottich, U. P., Rabelo, G. R.,

Carvalho, A.O., Moulin, M., Goncalves, L. S. A., Rodrigues, R. & Da

156

Cunha, M. (2013). Characterization of Capsicum species using anatomical

and molecular data. Genetics and Molecular Research, 12, 6488-6501.

Domsch, K. H., Gams, W., & Anderson, T.-H. (1980). Compendium of soil

fungi. Volume 1: Academic Press (London) Ltd.

Droby, S., & Lichter, A. (2007). Post-harvest Botrytis infection: etiology,

development and management. Botrytis: Biology, Pathology and Control

(pp. 349-367): Springer.

Du, M., Schardl, C. L., Nuckles, E. M., & Vaillancourt, L. J. (2005). Using mating-

type gene sequences for improved phylogenetic resolution of Collectotrichum

species complexes. Mycologia, 97(3), 641-658.

Dutta, P., Tripathi, S., Mehrotra, G., & Dutta, J. (2009). Perspectives for

chitosan based antimicrobial films in food applications. Food Chemistry,

114(4), 1173-1182.

Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy

and high throughput. Nucleic Acids Research, 32(5), 1792-1797.

Edirisinghe, M., Ali, A., Maqbool, M., & Alderson, P. G. (2014). Chitosan controls

postharvest anthracnose in bell pepper by activating defense-related enzymes.

Journal of Food Science and Technology, 51(12), 4078-4083.

Edmunds, B. A., Gleason, M. L., & Wegulo, S. N. (2003). Resistance of hosta

cultivars to petiole rot caused by Sclerotium rolfsii var. delphinii.

HortTechnology, 13(2), 302-305.

Ekefan, E., Jama, A., & Gowen, S. (2009). Potential of Trichoderma harzianum

isolates in biocontrol of Colletotrichum capsici causing anthracnose of

Pepper (Capsicum spp.) in Nigeria. Journal of Applied Biosciences, 20,

1138-1145.

El Ghaouth, A., Arul, J., Grenier, J., & Asselin, A. (1992)a. Antifungal activity

of chitosan on two postharvest pathogens of strawberry fruits.


157

El Ghaouth, A., Arul, J., Asselin, A., & Benhamou, N. (1992)b. Antifungal activity of

chitosan on post-harvest pathogens: induction of morphological and

cytological alterations in Rhizopus stolonifer. Mycological Research, 96(9),

769-779.

El Ghaouth, A., Ponnampalam, R., Castaigne, F., & Arul, J. (1992). Chitosan coating

to extend the storage life of tomatoes. HortScience, 27(9), 1016-1018.

Elad, Y., Williamson, B., Tudzynski, P., & Delen, N. (2004). Botrytis: biology,

pathology and Control. Springer Science and Business Media.

Ellis, M., & Waller, J. (1974). Sclerotinia fuckeliana (conidial state: Botrytis cinerea).

CMI Descriptions of Pathogenic Fungi and Bacteria.

Elmer, P. A., & Michailides, T. J. (2007). Epidemiology of Botrytis cinerea in

orchard and vine crops. Botrytis: Biology, Pathology and Control (pp. 243-

272): Springer.

Fallik, E., Grinberg, S., Alkalai, S., Yekutieli, O., Wiseblum, A., Regev, R.,

Beres, H. & Bar-Lev, E. (1999). A unique rapid hot water treatment to

improve storage quality of sweet pepper. Postharvest Biology and

Technology, 15(1), 25-32.

Fallik, E., Grinberg, S., Lomaniec, E., Lurie, S., & Lalazar, A. (1993). Effect of

postharvest heat treatment of tomatoes on fruit ripening and decay caused

by Botrytis cinerea. Plant Disease.

Faoro, F., Maffi, D., Cantu, D., & Iriti, M. (2008). Chemical-induced resistance

against powdery mildew in barley: the effects of chitosan and

benzothiadiazole. Biocontrol, 53(2), 387-401.

Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the

bootstrap. Evolution, 39(4), 783-791.

Fletcher, J. (1994). Fusarium stem and fruit rot of sweet peppers in the

glasshouse. Plant Pathology, 43(1), 225-227.

Flieger, M., Kantorová, M., Benešová, T., Pažoutová, S., & Votruba, J. (2003).

158

Kinetics of soluble glucan production by Claviceps viridis. Folia

Microbiologica, 48(5), 633-638.

Frans, M., Aerts, R., Van Calenberge, B., Van Herck, L., & Ceusters, J. (2016).

Influence of floral morphology and fruit development on internal fruit rot

in bell pepper (Capsicum annuum). 3rd International Symposium on

Postharvest Pathology: Using Science to Increase Food Availability.

Frans, M., Aerts, R., Van Laethem, S., & Ceusters, J. (2017). Environmental effects

on growth and sporulation of Fusarium spp. causing internal fruit rot in bell

pepper. European Journal of Plant Pathology, 149(4), 875-883.

Gardini, F., Lanciotti, R., & Guerzoni, M. (2001). Effect of trans‐2‐hexenal on

the growth of Aspergillus flavus in relation to its concentration,

temperature and water activity. Letters in Applied Microbiology, 33(1),

50-55.

Garibaldi, A., Gilardi, G., Ortu, G., & Gullino, M. L. (2014). First Report of

Root Rot Caused by Pythium aphanidermatum on Bell Pepper (Capsicum

annuum L.) in Italy. Plant Disease, 98(6), 854-854.

Geiser, D. M., del Mar Jiménez-Gasco, M., Kang, S., Makalowska, I., Veeraraghavan,

N., Ward, T. J., Zhang, N., Kuldau, G. A. & O'donnell, K. (2004).

FUSARIUM-ID v. 1.0: a DNA sequence database for identifying Fusarium.

European Journal of Plant Pathology, 110(5-6), 473-479.

Gerlach, W., & Nirenberg, H. (1982). The genus Fusarium--a pictorial atlas.

Mitteilungen aus der Biologischen Bundesanstalt fur Land-und

Forstwirtschaft Berlin-Dahlem (209).

Gevens, A., Roberts, P., McGovern, R., & Kucharek, T. (2008). Vegetable

diseases caused by Phytophthora capsici in Florida. University of Florida,

Extension Digital Information Source SP159.

Gracia-Garza, J., & Fravel, D. (1998). Effect of relative humidity on sporulation of

Fusarium oxysporum in various formulations and effect of water on spore

movement through soil. Phytopathology, 88(6), 544-549.

159

Green, B. J., Mitakakis, T. Z., & Tovey, E. R. (2003). Allergen detection from

11 fungal species before and after germination. Journal of Allergy and

Clinical Immunology, 111(2), 285-289.

Grivell, A., & Jackson, J. (1969). Microbial culture preservation with silica gel.

Microbiology, 58(3), 423-425.

Grubben, G., & Denton, O. A. (2004). Plant resources of tropical Africa 2.

Vegetables. Plant Resources of Tropical Africa 2. Vegetables.

Guerber, J. C., Liu, B., Correll, J. C., & Johnston, P. R. (2003). Characterization

of diversity in Colletotrichum acutatum sensu lato by sequence analysis

of two gene introns, mtDNA and intron RFLPs, and mating compatibility.

Mycologia, 95(5), 872-895.

Hadwiger, L. A. (1999). Host-parasite interactions: elicitation of defense

responses in plants with chitosan. Exs, 87, 185-200.

Halfon-Meiri, A., & Rylski, I. (1983). Internal mold caused in sweet pepper by

Alternaria alternata: Fungal ingress. Phytopathology, 73(1), 67-70.

Hardenburg, R., Watada, A., & Wang, C. (1990). The commercial storage of

fruits, vegetables, florist and nursey stocks. Washington, DC. US

Department of Agriculture, Agriculture Handbook, 66 , 23-25.

Harp, T., Kuhn, P., Roberts, P. D., & Pernezny, K. L. (2014). Management and

cross-infectivity potential of Colletotrichum acutatum causing

anthracnose on bell pepper in Florida. Phytoparasitica, 42(1), 31-39.

Harp, T. L., Pernezny, K., Ivey, M. L. L., Miller, S. A., Kuhn, P. J ., & Datnoff,

L. (2008). The etiology of recent pepper anthracnose outbreaks in Florida.

Crop Protection, 27(10), 1380-1384.

Hausbeck, M. K., & Lamour, K. H. (2004). Phytophthora capsici on vegetable

crops: research progress and management challenges. Plant Disease,

88(12), 1292-1303.

Haware, M., Faris, D., & Gowda, C. (1992). Botrytis gray mold of chickpea: summary

160

proceedings of the BARI/ICRISAT Working Group Meeting to Discuss

Collaborative Research on Botrytis Gray Mold of Chickpea 4-8 Mar 1991

Joydebpur, Bangladesh. International Crops Research Institute for the Semi-

Arid Tropics.

Herrmann, A. (2010). The chemistry and biology of volatiles. Wiley Online

Library.

Horst, R. K. (2013). Westcott's plant disease handbook: Springer.

Hoa, T. (1994). Characterization and Pathogenicity of Rhizoctonia Solani Kuhn

Isolates from Different Rice Zones and Management of Sheath Blight of Rice.

IARI, Division of Mycology and Plant Pathology, New Delhi.

Huang, C., & Sung, I. (2017). First report of Botrytis cinerea causing postharvest fruit

decay of goat-horn sweet pepper in Taiwan. Journal of Plant Pathology,

99(2).

Hussain Shah, T. Y., Fahim, M., Hameed, S., & Haque, M. (2009). Prevalence,

occurrence and distribution of Chili veinal mottle virus in Pakistan.

Pakistan Journal of Botany, 41(2), 955-965.

Hwang, B. K., & Kim, C. H. (1995). Phytophthora blight of pepper and its

control in Korea. Plant Disease (USA).

Hyde, K. D., Cai, L., Cannon, P. F., Crouch, J. A., Crous, P.W., Damm, U.,

Goodwin, P. H., Chen, H., Johnston, P. R., Jones, E. B. G., & Liu, Z. Y.

(2009). Colletotrichum—names in current use. Fungal Diversity, 39(1),

147-182.

Jabeen, N., Javaid, A., Ahmed, E., & Sharif, A. (2014). Management of causal

organism of collar rot of bell pepper (Sclerotium rolfsii) by organic

solvents extracts of Datura metel fruit. Pakistan Journal of


Jarvis, W., Khosla, S., & Barrie, S. (1994). Fusarium stem and fruit rot of sweet

pepper in Ontario greenhouses. Canadian Plant Disease Survey, 74(2),

161

131-134.

Jarvis, W. R. (1992). Managing diseases in greenhouse crops (Vol. 288): APS Press

St. Paul.

Javaid, A., & Iqbal, D. (2014). Management of collar rot of bell pepper

(Capsicum annuum L.) by extracts and dry biomass of Coronopus

didymus shoot. Biological Agriculture & Horticulture, 30(3), 164-172.

Joffe, A., & Palti, J. (1972). Fusarium species of the Martiella section in Israel.

Journal of Phytopathology, 73(2), 123-148.

Jovicich, E. J., Cantliffe, D. J., & Vansickle, J. J. (2004). US imports of colored

bell peppers and the opportunity for greenhouse production of peppers in

Florida. VII International Symposium on Protected Cultivation in Mild

Winter Climates: Production, Pest Management and Global Competition.

(pp. 81-85).

Jovicich, E., VanSickle, J. J., Cantliffe, D. J., & Stoffella, P. J. (2005).

Greenhouse-grown colored peppers: a profitable alternative for vegetable

production in Florida. HortTechnology, 15(2), 355-369.

Kamal, M., & Tahir-ud-din, S. (1970). Studies on. Alternaria rot of chillies in

Pakistan and on the physiological behaviour of the causal organism. West

Pakistan Journal of Agricultural Research, 8(1), 38-49.

Kanto, T., Uematsu, S., Tsukamoto, T., Moriwaki, J., Yamagishi, N., Usami, T.,

& Sato, T. (2014). Anthracnose of sweet pepper caused by Colletotrichum

scovillei in Japan. Journal of General Plant Pathology, 80(1), 73-78.

Katoch, A., Prabhakar, C. S., & Sharma, P. N. (2016). Metageographic

population analysis of Colletotrichum truncatum associated with chili

fruit rot and other hosts using ITS region nucleotide sequences. Journal of

Plant Biochemistry and Biotechnology, 25(1), 64-72.

Kator, L., Hosea, Z., & Oche, O. (2015). Sclerotium rolfsii; causative organism

of southern blight, stem rot, white mold and sclerotia rot disease. Annals

162

of Biological Research, 6(11), 78-89.

Khaleeque, M., & Khan, S. (1991). Fungi associated with fruit-rot and die-back

diseases of chillies in Faisalabad. Pakistan Journal of Phytopathology,

3(1-2), 50-52.

Kharbanda, P., Yang, J., Howard, R., & Mirza, M. (2006). Internal fruit rot of

greenhouse peppers caused by Fusarium lactis-a new disease. The

Greenhouse Business, 5, 11-16.

Kim, K. D., Oh, B., & Yang, J. (1999). Differential Interactions of a

Colletotrichum gloeosporioides isolate with green and red pepper fruits.

Phytoparasitica, 27(2), 97-106.

Kline, L., & Wyenandt, C. (2014). Internal fruit rot and premature seed

germination of field grown colored peppers. Paper presented at the

Proceedings The 22nd international pepper conference. Vina Del Mar (p.

118).

Kookana, R. S., Baskaran, S., & Naidu, R. (1998). Pesticide fate and behaviour

in Australian soils in relation to contamination and management of soil

and water: a review. Soil Research, 36(5), 715-764.

Korpi, A., Järnberg, J., & Pasanen, A.-L. (2009). Microbial volatile organic

compounds. Critical Reviews in Toxicology, 39(2), 139-193.

Kwon, C.-S., & Lee, S.-G. (2002). Occurrence and ecological characteristics of

red pepper anthracnose. Research in Plant Disease, 8(2), 120-123.

Lamichhane, J. R., Dürr, C., Schwanck, A. A., Robin, M. H., Sarthou, J. P.,

Cellier, V., Messean, A. & Aubertot, J. N. (2017). Integrated management

of damping-off diseases. A review. Agronomy for Sustainable

Development, 37(2), 10.

Landis, T. (2013). Forest nursery pests: damping-off. For Nursery Notes, 2, 25-

32.

163

Le, C., Mendes, R., Kruijt, M., & Raaijmakers, J. (2012). Genetic and

phenotypic diversity of Sclerotium rolfsii in groundnut fields in central

Vietnam. Plant Disease, 96(3), 389-397.

Leslie, J. F., Summerell, B. A., & Bullock, S. (2006). The Fusarium laboratory

manual (Vol. 2): Wiley Online Library.

Le, T. D., McDonald, G., Scott, E. S., & Able, A. J. (2013). Infection pathway of

Botrytis cinerea in capsicum fruit (Capsicum annuum L.). Australasian

Plant Pathology, 42(4), 449-459.

Leuba, J., & Stossel, P. (1986). Chitosan and other polyamines: antifungal activity

and interaction with biological membranes. Chitin in Nature and Technology

(pp. 215-222): Springer.

Lewis Ivey, M. L., Nava-Diaz, C., & Miller, S. A. (2004). Identification and

management of Colletotrichum acutatum on immature bell peppers. Plant

Disease, 88(11), 1198-1204.

Liu, F., Tang, G., Zheng, X., Li, Y., Sun, X., Qi, X., Zhou, Y., Xu, J., Chen, H.,

Chang, X., & Zhang, S. (2016). Molecular and phenotypic characterization of

Colletotrichum species associated with anthracnose disease in peppers from

Sichuan Province, China. Scientific Reports, 6, 32761.

Liu, F., Wang, M., Damm, U., Crous, P. W., & Cai, L. (2016). Species boundaries in

plant pathogenic fungi: a Colletotrichum case study. BMC Evolutionary

Biology, 16(1), 81.

Lomas-Cano, T., Palmero-Llamas, D., De Cara, M., García-Rodríguez, C., Boix-

Ruiz, A., Camacho-Ferre, F., & Tello-Marquina, J. (2014). First report of

Fusarium oxysporum on sweet pepper seedlings in Almeria, Spain. Plant

Disease, 98(10), 1435-1435.

Maalekuu, K., Elkind, Y., Tuvia-Alkalai, S., Shalom, Y., & Fallik, E. (2003).

Quality evaluation of three sweet pepper cultivars after prolonged storage.

Advances in Horticultural Science, 187-191.

164

Madbouly, A. K., & Abdelbacki, A. M. (2017). Biocontrol of certain soilborne

diseases and promotion of growth of capsicum annuum using

biofungicides. Pakistan Journal of Botany, 49(1), 371-378.

Mahmood, M., & Sinha, B. (1990). Gray mold disease of bengal gram in Bihar. Final

Technical Bulletin, Tirhut College of Agriculture, Dholi, Bihar, India, 35.

Manoranjitham, S., Prakasam, V., Rajappan, K., & Amutha, G. (2000). Control

of chilli damping-off using bioagents. Journal of Mycology and Plant

Pathology, 30(2), 225-228.

Manrique, L. A. (1993). Greenhouse crops: A review. Journal of Plant Nutrition,

16(12), 2411-2477.

Marin, S., Magan, N., Serra, J., Ramos, A., Canela, R., & Sanchis, V. (1999).

Fumonisin B1 production and growth of Fusarium moniliforme and Fusarium

proliferatum on maize, wheat, and barley grain. Journal of Food Science,

64(5), 921-924.

Matsui, K. (2006). Green leaf volatiles: hydroperoxide lyase pathway of oxylipin

metabolism. Current Opinion in Plant Biology, 9(3), 274-280.

Mekwatanakarn, P., Kositratana, W., Phromraksa, T., & Zeigler, R. (1999). Sexually

fertile Magnaporthe grisea rice pathogens in Thailand. Plant Disease, 83(10),

939-943.

Mikhail, M. S., Sabet, K. K., Omar, M. R., Asran, A. A., & Kasem, K. K. (2010).

Current Rhizoctonia solani anastomosis groups in Egypt and their

pathogenic relation to cotton seedlings. African Journal of Microbiology

Research, 4(5), 386-395.

Miller, S., Rowe, R., & Riedel, R. (1996). Fusarium and Verticillium Wilts of

Tomato, Potato, Pepper, and Eggplant, Department of Plant Pathology,

The Ohio State University, Extention Factsheet: HYG-3122-96.

Moni, Z. R., Ali, M. A., Alam, M. S., Rahman, M. A., Bhuiyan, M. R., Mian, M. S.,

Ifekharuddaula, K. M., Latif, M. A., & Khan, M. A. I. (2016). Morphological

165

and genetical variability among Rhizoctonia solani isolates causing sheath

blight disease of rice. Rice Science, 23(1), 42-50.

Morath, S. U., Hung, R., & Bennett, J. W. (2012). Fungal volatile organic

compounds: a review with emphasis on their biotechnological potential.

Fungal Biology Reviews, 26(2-3), 73-83.

Moscone, E. A., Scaldaferro, M. A., Grabiele, M., Cecchini, N. M., Sánchez

García, Y., Jarret, R., Davina, J. R., Ducasse, D. A., Barboza, G. E., &

Ehrendorfer, F. (2006). The evolution of chili peppers (Capsicum-

Solanaceae): a cytogenetic perspective. Paper presented at the VI

International Solanaceae Conference: Genomics Meets Biodiversity,

745(137-170).

Moularat, S., Robine, E., Ramalho, O., & Oturan, M. A. (2008). Detection of

fungal development in a closed environment through the identification of

specific VOC: demonstration of a specific VOC fingerprint for fungal

development. Science of the Total Environment, 407(1), 139-146.

Muñoz, Z., Moret, A., & Garcés, S. (2009). Assessment of chitosan for inhibition of

Colletotrichum sp. on tomatoes and grapes. Crop Protection, 28(1), 36-40.

Muzzarelli, R., Aiba, S., Fujiwara, Y., Hideshima, T., Hwang, C., Kakizaki, M.,

Izume, M., Minoura, N., Rha, C., & Shouij, T. (1986). Filmogenic

Properties of Chitin/Chitosan'in Chitin in Nature and Technology: Ed

Plenum Press. United States: Blackwell.

Myung, K., Hamilton-Kemp, T. R., & Archbold, D. D. (2006). Biosynthesis of trans-

2-hexenal in response to wounding in strawberry fruit. Journal of Agricultural

and Food Chemistry, 54(4), 1442-1448.

Nadeem, M., Anjum, F. M., Khan, M. R., Saeed, M., & Riaz, A. (2011).

Antioxidant potential of bell pepper (Capsicum annum L.) a review.

Pakistan Journal of Food Science, 21(1-4), 45-51.

Naz, F., Rauf, C. A., Abbasi, N. A., Haque, I., & Ahmad, I. (2008). Influence of

inoculum levels of Rhizoctonia solani and susceptibility on new potato

166

germplasm. Pakistan Journal of Botany, 40(5), 2199-2209.

Nei, M., & Kumar, S. (2000). Molecular evolution and phylogenetics: Oxford

university press.

Nelson, P. E., Toussoun, T. A., & Marasas, W. (1983). Fusarium species: an

illustrated manual for identification.

Neri, F., Mari, M., & Brigati, S. (2006). Control of Penicillium expansum by plant

volatile compounds. Plant Pathology, 55(1), 100-105.

O'Donnell, K., & Cigelnik, E. (1997). Two divergent intragenomic rDNA ITS2

types within a monophyletic lineage of the fungus Fusarium are

nonorthologous. Molecular Phylogenetics and Evolution, 7(1), 103-116.

O'Donnell, K., Cigelnik, E., & Nirenberg, H. I. (1998). Molecular systematics

and phylogeography of the Gibberella fujikuroi species complex.

Mycologia, 90(3), 465-493.

O’Donnell, K., Rooney, A. P., Proctor, R. H., Brown, D. W., McCormick, S. P.,

Ward, T. J., Frandsen, R. J., Lysøe, E., Rehner, S. A., Aoki, T. & Robert, V.A.

(2013). Phylogenetic analyses of RPB1 and RPB2 support a middle

Cretaceous origin for a clade comprising all agriculturally and medically

important fusaria. Fungal Genetics and Biology, 52, 20-31.

O’Donnell, K., Ward, T. J., Robert, V. A., Crous, P. W., Geiser, D. M., & Kang, S.

(2015). DNA sequence-based identification of Fusarium: current status and

future directions. Phytoparasitica, 43(5), 583-595.

Okereke, V., & Wokocha, R. (2007). In vitro growth of four isolates of Sclerotium

rolfsii Sacc in the humid tropics. African Journal of Biotechnology, 6(16).

Pascual, C., Toda, T., Raymondo, A., & Hyakumachi, M. (2000). Characterization by

conventional techniques and PCR of Rhizoctonia solani isolates causing

banded leaf sheath blight in maize. Plant Pathology, 49(1), 108-118.

Perkins, D. D. (1962). Preservation of Neurospora stock cultures with anhydrous

silica gel. Canadian Journal of Microbiology, 8(4), 591-594.

167

Pernezny, K., Roberts, P., Murphy, J., & Goldberg, N. (2003). Compendium of

Pepper Diseases.(pp. 37). St. Paul, Minnedota: The American

Phytopathological Society.

Plog, B. A., Niland, J., & Quinlan, P. (1996). Fundamentals of industrial

hygiene: National Safety Council Ithaca, NY.

Punja, Z. K. (1985). The biology, ecology, and control of Sclerotium rolfsii. Annual

Review of Phytopathology, 23(1), 97-127.

Raeder, U., & Broda, P. (1985). Rapid preparation of DNA from filamentous

fungi. Letters in Applied Microbiology, 1(1), 17-20.

Rahimi, Z., Aboutalebi, A., & Zakerin, A. (2013). Comparison of different

medium for production of sweet pepper transplant. International Research

Journal of Applied and Basic Sciences, 4(2), 307-310.

Rahin, A., & Sharif, F. (1985). A study of pepper wilt in northern Iraq. Ecology

and Management of Soilborne Plant Pathogens, 59-62.

Ramdial, H., Hosein, F., & Rampersad, S. (2016). First report of Fusarium

incarnatum associated with fruit disease of bell peppers in Trinidad. Plant

Disease, 100(2), 526-526.

Ramdial, H., & Rampersad, S. (2010). First report of Fusarium solani causing

fruit rot of sweet pepper in Trinidad. Plant Disease, 94(11), 1375-1375.

Ramdial, H., & Rampersad, S. N. (2015). Characterization of Colletotrichum

spp. causing anthracnose of bell pepper (Capsicum annuum L.) in

Trinidad. Phytoparasitica, 43(1), 37-49.

Rashad, Y., Abdel-Fattah, G., Hafez, E., & El-Haddad, S. (2012). Diversity among

some Egyptian isolates of Rhizoctonia solani based on anastomosis grouping,

molecular identification and virulence on common bean. African Journal of

Microbiology Research, 6(37), 6661-6667.

Rekah, Y., Shtienberg, D., & Katan, J. (2000). Disease development following

infection of tomato and basil foliage by airborne conidia of the soilborne

168

pathogens Fusarium oxysporum f. sp. radicis-lycopersici and F. oxysporum f.

sp. basilici. Phytopathology, 90(12), 1322-1329.

Remesal, E., Lucena, C., Azpilicueta, A., Landa, B. B., & Navas-Cortés, J. A.

(2010). First report of southern blight of pepper caused by Sclerotium

rolfsii in Southern Spain. Plant Disease, 94(2), 280-280.

Ristaino, J. B., & Johnston, S. A. (1999). Ecologically based approaches to

management of Phytophthora blight on bell pepper. Plant Disease,

83(12), 1080-1089.

Ristaino, J. B., Larkin, R. P., & Campbell, C. L. (1993). Spatial and temporal

dynamics of Phytophthora epidemics in commercial bell pepper fields.


Roberts, P. (2001). Anthracnose caused by Colletotrichum sp. on pepper: University

of Florida Cooperative Extension Service, Institute of Food and Agricultural

Sciences, EDIS.

Roberts, P. D., Murphy, J. F., & Pernezny, K. (2003). Compendium of pepper

diseases: Minnesota, US: APS Press.

Rossi, V., Scandolara, A., & Battilani, P. (2009). Effect of environmental conditions

on spore production by Fusarium verticillioides, the causal agent of maize ear

rot. European Journal of Plant Pathology, 123(2), 159-169.

Roy, K., Killebrew, J., & Ratnayake, S. (1997). First report of Colletotrichum

capsici on bell pepper in Mississippi. Plant Disease, 81(6), 693-693.

Sahi, I. Y., & Khalid, A. (2007). In vitro biological control of Fusarium

oxysporum causing wilt in Capsicum annuum. Mycopath, 5, 85-88.

Samapundo, S., Devliehgere, F., De Meulenaer, B., & Debevere, J. (2005). Effect of

water activity and temperature on growth and the relationship between

fumonisin production and the radial growth of Fusarium verticillioides and

Fusarium proliferatum on corn. Journal of Food Protection, 68(5), 1054-

1059.

169

Scott, J., Gordon, T., Shaw, D., & Koike, S. (2010). Effect of temperature on severity

of Fusarium wilt of lettuce caused by Fusarium oxysporum f. sp. lactucae.

Plant Disease, 94(1), 13-17.

Scala, A., Allmann, S., Mirabella, R., Haring, M., & Schuurink, R. (2013). Green

leaf volatiles: a plant’s multifunctional weapon against herbivores and

pathogens. International Journal of Molecular Sciences, 14(9), 17781-

17811.

Seepersad, G., Iton, A., Paul, C., & Lawrence, J. (2013). Financial aspects of

greenhouse vegetables production systems in Jamaica and Trinidad & Tobago.

URL http://www. cardi. org/cfc-pa/files/downloads/2013/11/Publ-20-

Financial-Aspects-Greenhouses-Govind-S. pdf.

Sharma, G., & Shenoy, B. D. (2014). Colletotrichum fructicola and C. siamense

are involved in chilli anthracnose in India. Archives of Phytopathology

and Plant protection, 47(10), 1179-1194.

Shenoy, B. D., Jeewon, R., Lam, W. H., Bhat, D. J., Than, P. P., Taylor, P. W.,

& Hyde, K. D. (2007). Morpho-molecular characterisation and

epitypification of Colletotrichum capsici (Glomerellaceae,

Sordariomycetes), the causative agent of anthracnose in chilli. Fungal

Diversity, 27, 197-211.

Shin, H., Xu, T., Zhang, C., & Chen, Z. (2000). The comparative study of

capsicum anthracnose pathogens from Korea with that of China. Journal

of Zhejiang University (Agriculture and Life Sciences), 26(6), 629-634.

Shotorbani, N. Y., Jamei, R., & Heidari, R. (2013). Antioxidant activities of two

sweet pepper Capsicum annuum L. varieties phenolic extracts and the

effects of thermal treatment. Avicenna Journal of Phytomedicine, 3(1),

25.

Simmons, E. G. (1995). Alternaria themes and variations (112-144). Mycotaxon, 55,

55-163.

http://www/

170

Simmons, E. G. (2007). Alternaria: An Indentification Manual.

Simone, G., & Momol, M. (2000). Vegetable disease recognition and management.

Florida Green-house Vegetable Production Handbook, 3(2), 152-157.

Singh, G., & Kapoor, S. (1985). Role of incubation and photoperiod on the intensiy of

Botrytis gray mold of chickpea. International Chickpea Newsletter.

Smith, D., & Onions, A. H. (1983). A comparison of some preservation techniques for

fungi. Transactions of the British Mycological Society, 81(3), 535-540.

Sneh, B., Burpee, L., & Ogoshi, A. (1991). Identification of Rhizoctonia species: APS

press.

Snowdon, A. L. (1990). A colour atlas of post-harvest diseases and disorders of

fruits and vegetables. Volume 1: General introduction and fruits: Wolfe

Scientific Ltd.

Staats, M., van Baarlen, P., & van Kan, J. A. (2004). Molecular phylogeny of the

plant pathogenic genus Botrytis and the evolution of host specificity.

Molecular Biology and Evolution, 22(2), 333-346.

Stielow, J. B., Levesque, C. A., Seifert, K. A., Meyer, W., Iriny, L., Smits, D.,

Renfurm, R., Verkley, G.J.M., Groenewald, M., Chaduli, D. and Lomascolo,

A., (2015). One fungus, which genes? Development and assessment of

universal primers for potential secondary fungal DNA barcodes. Persoonia:

Molecular Phylogeny and Evolution of Fungi, 35, 242.

Stirling, G., Eden, L., & Ashley, M. (2004). Sudden wilt of capsicum in tropical

and subtropical Australia: a severe form of Pythium root rot exacerbated

by high soil temperatures. Australasian Plant Pathology, 33(3), 357-366.

Sutton, J. C., Sopher, C. R., Owen-Going, T. N., Liu, W., Grodzinski, B., Hall, J.

C., & Benchimol, R. L. (2006). Etiology and epidemiology of Pythium

root rot in hydroponic crops: current knowledge and perspectives. Summa

Phytopathologica, 32(4), 307-321.

Taheri, P., Gnanamanickam, S., & Höfte, M. (2007). Characterization, genetic

171

structure, and pathogenicity of Rhizoctonia spp. associated with rice sheath

diseases in India. Phytopathology, 97(3), 373-383.

Talhinhas, P., Sreenivasaprasad, S., Neves-Martins, J., & Oliveira, H. (2002). Genetic

and morphological characterization of Colletotrichum acutatum causing

anthracnose of lupins. Phytopathology, 92(9), 986-996.

Tariq, A., Naz, F., Rauf, C. A., & Irshad, G. (2015). Long term and least expensive

preservation methods for various fungal cultures. Pakistan Journal of


Tariq, A., Naz, F., Rauf, C., Irshad, G., Abbasi, N., & Khokhar, N. (2017). First

report of anthracnose caused by Colletotrichum truncatum on bell pepper

(Capsicum annuum) in Pakistan. Plant Disease, 101(4), 631-631.

Terry, L. A., & Joyce, D. C. (2004). Elicitors of induced disease resistance in

postharvest horticultural crops: a brief review. Postharvest Biology and

Technology, 32(1), 1-13.

Than, P. P., Prihastuti, H., Phoulivong, S., Taylor, P. W., & Hyde, K. D. (2008).

Chilli anthracnose disease caused by Colletotrichum species. Journal of

Zhejiang University Science, 9(10), 764.

Tiru, M., Muleta, D., Bercha, G., & Adugna, G. (2013). Antagonistic effect of

rhizobacteria against coffee wilt disease caused by Gibberella xylarioides.

Asian Journal of Plant Pathology, 7(3), 109-122.

Torres‐Calzada, C., Tapia‐Tussell, R., Higuera‐Ciapara, I., Huchin‐Poot, E.,

Martin‐Mex, R., Nexticapan‐Garcez, A., & Perez‐Brito, D. (2018).

Characterization of Colletotrichum truncatum from papaya, pepper and physic

nut based on phylogeny, morphology and pathogenicity. Plant Pathology,

67(4), 821-830.

Tripathi, H., & Rathi, Y. (1992). Epidemiology of botrytis gray mold of chickpea.

Botrytis gray mold of chickpea’.(Eds MP Haware, DG Faris, CLL Gowda), 8-

9.

172

Tripathi, P., & Dubey, N. (2004). Exploitation of natural products as an

alternative strategy to control postharvest fungal rotting of fruit and

vegetables. Postharvest Biology and Technology, 32(3), 235-245.

Tuncer, G., & Erdiller, G. (1990). The identification of Rhizoctonia solani Kühn

anastomosis groups isolated from potato and some other crops in Central

Anatolia. Journal of Turkish Phytopathology, 19(2), 89-93.

Utkhede, R., & Mathur, S. (2003). Fusarium fruit rot of greenhouse sweet

peppers in Canada. Plant Disease, 87(1), 100-100.

Utkhede, R., & Mathur, S. (2004). Internal fruit rot caused by Fusarium

subglutinans in greenhouse sweet peppers. Canadian Journal of Plant

Pathology, 26(3), 386-390.

van Schoonhoven, A. (1987). Standard system for the evaluation of bean

germplasm: CIAT.

Vásquez, L., Tlapal, B., Yáñez, M., Pérez, P., & Quintos, E. (2009). Etiology of

pepper wilt disease of'Chile de Agua'(Capsicum annuum L.) in Oaxaca,

México. Revista Fitotecnia Mexicana, 32(2), 127-134.

Vilgalys, R., & Hester, M. (1990). Rapid genetic identification and mapping of

enzymatically amplified ribosomal DNA from several Cryptococcus

species. Journal of Bacteriology, 172(8), 4238-4246.

Vinnere, O., Fatehi, J., Wright, S. A., & Gerhardson, B. (2002). The causal agent of

anthracnose of Rhododendron in Sweden and Latvia. Mycological Research,

106(1), 60-69.

Walsh, B. M., & Hoot, S. B. (2001). Phylogenetic relationships of Capsicum

(Solanaceae) using DNA sequences from two noncoding regions: the

chloroplast atpB-rbcL spacer region and nuclear waxy introns.

International Journal of Plant Sciences, 162(6), 1409-1418.

Webb, K. M., Brenner, T., & Jacobsen, B. J. (2015). Temperature effects on the

interactions of sugar beet with Fusarium yellows caused by Fusarium

173

oxysporum f. sp. betae. Canadian Journal of Plant Pathology, 37(3), 353-362.

Weir, B., Johnston, P., & Damm, U. (2012). The Colletotrichum gloeosporioides

species complex. Studies in Mycology, 73, 115-180.

Whipps, J. M., & Lumsden, R. D. (2001). Commercial use of fungi as plant

disease biological control agents: status and prospects. Fungal Biocontrol

Agents: Progress, Problems and Potential, 9-22.

White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct

sequencing of fungal ribosomal RNA genes for phylogenetics. PCR

protocols: a guide to methods and applications, 18(1), 315-322.

Williamson, B., Tudzynski, B., Tudzynski, P., & van Kan, J. A. (2007). Botrytis

cinerea: the cause of grey mould disease. Molecular Plant Pathology,

8(5), 561-580.

Windels, C. E., Burnes, P. M., & Kommedahl, T. (1988). Five-year preservation of

Fusarium species on silica gel and soil. Phytopathology, 78(1), 107-109.

Wood, W. F., & Fesler, M. (1986). Mushroom odors: student synthesis of the

odoriferous compounds of the matsutake mushroom. Journal of Chemical

Education, 63(1), 92.

Woody, M., & Chu, F. (1992). Toxicology of Alternaria mycotoxins. Alternaria:

Biology, Plant Diseases, and Metabolites, 409-434.

Xie, C., & Vallad, G. (2016). Integrated Management of Southern Blight in

Vegetable Production1. University of Florida IFAS Extension.

Yabuuchi, E., Kosako, Y., Yano, I., Hotta, H., & Nishiuchi, Y. (1995). Transfer

of Two Burkholderia and An Alcaligenes Species to Ralstonia Gen. Nov.

Proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973)

Comb. Nov., Ralstonia solanacearum (Smith 1896) Comb. Nov. and

Ralstonia eutropha (Davis 1969) Comb. Nov. Microbiology and

immunology, 39(11), 897-904.

Yang, J., Kharbanda, P., Howard, R., & Mirza, M. (2009). Identification and

174

pathogenicity of Fusarium lactis, causal agent of internal fruit rot of

greenhouse sweet pepper in Alberta. Canadian Journal of Plant Pathology,

31(1), 47-56.

Yang, Y., Cao, T., Yang, J., Howard, R. J., Kharbanda, P. D., & Strelkov, S. E.

(2010). Histopathology of internal fruit rot of sweet pepper caused by

Fusarium lactis. Canadian Journal of Plant Pathology, 32(1), 86-97.

Yoon, M. Y., Cha, B., & Kim, J. C. (2013). Recent trends in studies on botanical

fungicides in agriculture. The Plant Pathology Journal, 29(1), 1.

175

APPENDIX A

LOCATION WISE MEAN DISEASE INCIDENCE (%) OF FRUIT ROT DISEASES IN GREENHOUSES DURING FEBRUARY 2016 &

2017

Tehsil Location

Surveyed Fusarium FR DI (%) Botrytis FR DI (%) Alternaria FR DI (%)

2016 2017 Mean 2016 2017 Mean 2016 2017 Mean

Rawalpindi Adyala 9 13 11 14 10 12 11 9 10

Dhoke

Budhal 11 16 13.5 18 21 19.5 12 13 12.5

Taxila Taxila 10 14 12 15 16 15.5 9 11 10

Gujar

Khan Jatli 13 17 15 10 18 14 11 14 12.5

Chakwal Dab 14 24 19 0 0 0 0 0 0

Thoa Bahdar 16 19 17.5 10 14 12 14 18 16

Islamabad Chak

Shehzad 10 12 11 24 27 25.5 10 7 8.5

Rawat 9 11 10 22 23 22.5 6 10 8

Mean 13.63 15.13 9.69

176

APPENDIX B

LOCATION WISE MEAN DISEASE INCIDENCE (%) OF FRUIT ROT DISEASES IN OPEN FIELDS DURING MAY 2016 & 2017

Tehsil Location

Colletotrichum FR DI

(%) Fusarium FR DI (%) Botrytis FR DI (%) Alternaria FR DI (%)

2016 2017 Mean 2016 2017 Mean 2016 2017 Mean 2016 2017 Mean

Rawalpindi Adyala 21 18 19.5 13 11 12 12 13 12.5 8 9 8.5

Dhoke

Budhal 19 22 20.5 22 16 19 0 0 0 7 10 8.5

Chauntra 17 28 22.5 5 18 11.5 14 11 12.5 11 8 9.5

Chakri 16 25 20.5 14 17 15.5 0 0 0 10 5 7.5

Chak Beli

Khan 21 28 24.5 12 13 12.5 0 0 0 6 7 6.5

Taxila Taxila 15 16 15.5 9 8 8.5 15 13 14 10 11 10.5

Wah 12 14 13 12 0 6 0 0 0 8 6 7

Gujar

Khan Jatli 24 24 24 14 12 13 12 11 11.5 12 14 13

Sukho 22 21 21.5 13 10 11.5 0 0 0 9 10 9.5

Daultala 18 26 22 11 14 12.5 16 0 8 10 9 9.5

Chakwal Bhaun 42 35 38.5 11 13 12 10 12 11 8 10 9

Dhudial 28 27 27.5 12 19 15.5 0 0 0 6 6

Dab 33 28 30.5 14 15 14.5 0 0 0 11 10 10.5

177

Thoa

Bahdar 25 29 27 19 17 18 11 10 10.5 7 8 7.5

Kallar

Kahar Miani 20 13 16.5 11 13 12 16 0 8 10 8 9

Buchal

Kalan 17 19 18 8 10 9 0 0 0 11 9 10

Choa

Saiden

Shah

Dalelpur 14 16 15 13 9 11 0 0 0 13 10 11.5

Dulmial 18 12 15 11 6 8.5 12 8 10 9 8 8.5

Fateh Jang Bahter 22 13 17.5 8 16 12 12 14 13 7 8 7.5

Hasan

Abdal 16 19 17.5 9 11 10 14 11 12.5 5 6 5.5

Jhelum Sohawa 29 32 30.5 12 10 11 0 0 0 7 10 8.5

Domeli 21 23 22 15 14 14.5 8 10 9 12 13 12.5

Islamabad Chak

Shehzad 0 0 0 8 10 9 17 16 16.5 6 9 7.5

Rawat 17 20 18.5 9 11 10 13 12 12.5 11 10 10.5

Mean 20.73 12.04 6.73 8.92

178

APPENDIX C

LOCATION WISE MEAN DISEASE INCIDENCE (%) OF ROOT ROT DISEASES AT SEEDLING STAGE IN GREENHOUSES DURING

NOVEMBER 2015 & 2016

Tehsil Location

Surveyed

Fusarium root rot

DI (%)

Rhizoctonia root rot

DI (%)

Sclerotium root rot

DI (%)

2015 2016 Mean 2015 2016 Mean 2015 2016 Mean

Rawalpindi

Adyala 14 10 12 21 13 17 0 0 0

Dhoke Budhal 17 13 15 20 24 22 9 11 10

Taxila Taxila 8 10 9 30 26 28 0 0 0

Gujar Khan Jatli 19 15 17 0 0 0 15 9 12

Chakwal Dab 16 22 19 0 0 0 14 16 15

Thoa Bahdar 26 22 24 17 19 18 0 0 0

Islamabad Chak Shehzad 10 16 13 40 36 38 0 0 0

Rawat 19 13 16 28 34 31 0 0 0

Mean 15.63 19.25 4.63

179

APPENDIX D

LOCATION WISE MEAN DISEASE INCIDENCE (%) OF ROOT ROT DISEASES AT SEEDLING STAGE IN LOW PLASTIC TUNNELS

DURING FEBRUARY 2016 & 2017

Tehsil Location Fusarium RR DI (%) Rhizoctonia RR DI (%) Sclerotium RR DI (%)

2016 2017 Mean 2016 2017 Mean 2016 2017 Mean


Dhoke Budhal 22 16 19 19 25 22 16 10 13

Chauntra 12 16 14 16 22 19 0 0 0

Chakri 11 17 14 26 24 25 0 0 0

Chak Beli

Khan 15 11 13 0 0 0 11 9

10

Taxila Taxila 10 14 12 16 24 20 0 0 0

Wah 16 10 13 15 19 17 0 0 0

Gujar Khan Jatli 23 19 21 0 0 0 12 16 14

Sukho 10 14 12 17 13 15 0 0 0

Daultala 19 17 18 9 15 12 0 0 0

Chakwal Bhaun 13 20 16.5 0 0 0 21 15 18

Dhudial 21 17 19 15 11 13 17 13 15

180

Dab 19 15 17 14 16 15 8 18 13

Thoa Bahdar 18 23 20.5 20 14 17 14 18 16

Kallar Kahar Miani 17 13 15 9 13 11 12 20 16

Buchal Kalan 8 14 11 0 0 0 16 12 14

Choa Saidan

Shah Dalelpur 20 12 16 13 17 15 0 0

0

Dulmial 16 24 20 15 12 13.5 0 0 0

Attock Fateh Jang 20 12 16 16 22 19 13 11 12

Hasan Abdal 14 12 13 24 20 22 - 0 0

Jhelum Sohawa 16 22 19 14 20 17 10 16 13

Domeli 16 16 16 16 10 13 0 0 0


Rawat 18 15 16.5 26 22 24 9 15 12

Mean 15.98 14.1 7.38

181

APPENDIX E

LOCATION WISE MEAN DISEASE INCIDENCE (%) OF ROOT ROT DISEASES AT MATURITY STAGE IN GREENHOUSES DURING

FEBRUARY 2016 & 2017

Tehsil Location

Surveyed

Fusarium root rot

DI (%)

Rhizoctonia root rot

DI (%)

Sclerotium root rot

DI (%)

2015 2016 Mean 2015 2016 Mean 2015 2016 Mean

Rawalpindi

Adyala 9 12 10.5 8 4 6 2 3 2.5

Dhoke Budhal 13 15 14 4 6.5 5.25 8 12 10

Taxila Taxila 0 4 2 11 9 10 0 0 0

Gujar Khan Jatli 11 7 9 0 0 0 11 13 12

Chakwal Dab 10 14 12 0 0 0 12 18 15

Thoa Bahdar 11 8 9.5 7 6 6.5 0 0 0


Rawat 6 12 9 16 10 13 0 0 0

Mean 9.25 6.22 4.94

182

APPENDIX F

LOCATION WISE MEAN DISEASE INCIDENCE (%) OF ROOT ROT DISEASES AT MATURITY STAGE IN OPEN FIELDS DURING

MAY 2016 & 2017

Tehsil Location

Fusarium RR DI (%) Rhizoctonia RR DI (%) Sclerotium RR DI (%)

2016 2017 Mean 2016 2017 Mean 2016 2017 Mean


Dhoke Budhal 9 17 13 15 9 12 0 0 0

Chauntra 0 0 0 6 14 10 22 30 26

Chakri 13 19 16 0 0 0 0 0 0

Chak Beli Khan 0 0 0 5 9 7 0 0 0

Taxila Taxila 14 8 11 9 14 11.5 16 18 17

Wah 0 0 0 0 0 0 0 0 0

Gujar Khan Jatli 8 8 8 0 0 0 26 30 28

Sukho 0 0 0 12 6 9 0 0 0

Daultala 13 12 12.5 10 14 12 26 24 25

Chakwal Bhaun 8 18 13 0 0 0 28 35 31.5

Dhudial 11 19 15 6 10 8 21 29 25

183

Dab 0 0 0 9 11 10 26 38 32

Thoa Bahdar 12 12 12 11 13 12 17 21 19

Kallar Kahar Miani 13 9 11 0 0 0 20 14 17

Buchal Kalan 0 0 0 0 0 0 0 0 0

Choa Saidan

Shah Dalelpur 7 13 10 0 0 0 11 19 15

Dulmial 16 10 13 6 16 11 0 0 0

Attock Fateh Jang 11 17 14 12 12 12 20 12 16

Hasan Abdal 7 15 11 0 0 0 11 15 13

Jhelum Sohawa 12 12 12 7 11 9 22 32 27

Domeli 0 0 0 0 0 0 21 15 18


Rawat 19 11 15 7 15 11 11 17 14

Mean 8.31 6.15 14.35

184

APPENDIX G

STRAINS OF COLLETOTRICHUM SP. USED IN THE STUDY

Isolate Host Location GenBank accession numbers

ITS ACT GAPDH CHS1 HIS3 TUB2

ACT2 Capsicum annuum Pakistan KU051396 MF682496 MF682511 MF687718 MF693367 MF693382

ACT4 Capsicum annuum Pakistan KU051398 MF682497 MF682512 MF687719 MF693368 MF693383

ACT5 Capsicum annuum Pakistan MF417551 MF682498 MF682513 MF687720 MF693369 MF693384













XTJ03 Cynanchum paniculatum China KF515691 KF488585 KF975662 KF975666 KF714505

CBP003 Brassica parachinensis China KF040966 KF164834 KF188535 KT778593 KT778596 KF419405

WC38 Chili pepper China KJ482242 KJ482182 KJ482212 KJ482197 KJ482227 KJ482167

LJTJ26 Capsicum sp. China KP748217 KP823767 KP823796 KP823845

CBS:260.85 Crotalaria spectabilis USA GU227875 GU227973 GU228267 GU228365 GU228071 GU228169

CBS:125328 Capsicum annuum Mexico GU227885 GU227983 GU228277 GU228375 GU228081 GU228179

OCC98 Capsicum annuum India KP743406 KP743357 KP743259 KP743308 KP743529

XY01 Proteaceae China KC293579 KC293619 KC293739 KC293659

CAUT1 Chilli pepper China KP145608 KP145540 KP145506 KP145574 KP145642

CAUG2 Capsicum sp. China KP145417 KP145361 KP145389 KP145333 KP145305 KP145445

CAUA1 Capsicum sp. China KP145208 KP145112 KP145144 KP145272 KP145176 KP145240

CTM36 Psophocarpus tetragonolobus Malaysia JX971159 JX975391 KC109614 KC109574 KC109534 KC109494

185

APPENDIX H

ANOVA TABLE FOR THE DATA REGARDING IN VITRO BIO-CONTROL

USING NATURAL COMPOUNDS (Figure 4.73)

Source DF SS MS F P

V002 17 319.507 18.7945 779 0.0000

Error 90 2.170 0.0241

Total 107 321.677

Grand Mean 6.7722 CV 2.29

APPENDIX I


USING VOLATILE COMPOUNDS AGAINST C. truncatum (Figure 4.83)

Source DF SS MS F P

V002 11 748.897 68.0816 7683 0.0000

Error 60 0.532 0.0089

Total 71 749.429


APPENDIX J


USING VOLATILE COMPOUNDS AGAINST F. equiseti (Figure 4.84)

Source DF SS MS F P

V001 11 749.130 68.1028 5534 0.0000

Error 60 0.738 0.0123

Total 71 749.869


APPENDIX K


USING ANTAGONISTIC FUNGI (Figure 4.91)

Source DF SS MS F P

V002 3 619.547 206.516 148 0.0000

Error 20 27.984 1.399

Total 23 647.531


Aliya Tariq_Plant Pathology_2020 arid rwp prr.pdf - Pakistan ...

Documents