Alcohol Stimulates Activation of Snail, Epidermal Growth Factor Receptor Signaling, and Biomarkers of EpithelialâMesenchymal Transition in Colon and Breast Cancer Cells

Alcohol Stimulates Activation of Snail, Epidermal Growth

Factor Receptor Signaling, and Biomarkers of

Epithelial–Mesenchymal Transition in Colon and Breast

Cancer Cells

Christopher B. Forsyth, Yueming Tang, Maliha Shaikh, Lijuan Zhang, and Ali Keshavarzian

Background: Alcohol consumption is associated with the risk of progressive cancers includingcolon and breast cancer. The mechanisms for the alcohol-induced aggressive behavior of theseepithelial cancer cells have not been fully identified. Epithelial–mesenchymal transition (EMT) is adevelopmental program recently shown to play a role in cancer progression and metastases. Wehypothesized that alcohol might promote cancer progression by inducing EMT in cancer cells andtested this hypothesis by assessing alcohol-stimulated changes in phenotypic markers of EMT aswell as the EMT transcription factor Snail and its related cell signaling.

Methods: Colon and breast cancer cell lines and a normal intestinal epithelial cell line weretested as well as colonic mucosal biopsy samples from alcoholic subjects. Cells were treated withalcohol and assessed for EMT-related changes using immunofluorescent microscopy, western blot-ting, reporter assays, RT-PCR, and knockdown of Snail with siRNA.

Results: We show alcohol upregulated the signature EMT phenotypic marker vimentin as wellas matrix metalloprotease (MMP)-2, MMP-7, and MMP-9 and cell migration in colon and breastcancer cells—all characteristics of EMT. Alcohol also stimulated nuclear localization of Snailphosphorylated at Ser246, transcription from a Snail reporter plasmid, and Snail mRNA expres-sion by RT-PCR. Snail siRNA knockdown prevented alcohol-stimulated vimentin expression. Invivo, Snail expression was significantly elevated in colonic mucosal biopsies from alcoholics. Also,we found alcohol stimulated activation of epidermal growth factor receptor (EGFR) signalingand an EGFR inhibitor blocked alcohol-induced cell migration and Snail mRNA expression.

Conclusions: Collectively, our data support a novel mechanism for alcohol promoting cancerprogression through stimulating the EMT program in cancer cells via an EGFR-Snail mediatedpathway. This study reveals new pathways for alcohol-mediated promotion of cancer that couldbe targeted for therapy or prevention of alcohol-related cancers.

Key Words: Snail, Epithelial–Mesenchymal Transition, Epidermal Growth Factor Receptor,Alcohol, Cancer.

A LCOHOL (ETHANOL) CONSUMPTION is a riskfactor for development as well as progression of many

cancers (Boffetta and Hashibe, 2006; Seitz and Stickel, 2007).Chronic alcohol consumption is estimated to be directlyresponsible for about 4% of all cancers worldwide (Boffettaand Hashibe, 2006). Cancers promoted by alcohol includecancers of the upper aerodigestive tract (oropharynx, larynx,esophagus), liver, breast, colon, and rectum (Boffetta and

Hashibe, 2006; Seitz and Stickel, 2007). The mechanismsunderlying alcohol promotion of these cancers are not certain.However, several distinct alcohol-induced cancer promotingmechanisms have been postulated. These include alcoholmutagenic effects, changes in retinoic acid, folate, or estrogenmetabolism, and oxidative stress (Seitz and Stickel, 2007).But, none has been shown to fully explain the mechanism ofalcohol-induced aggressive behavior of cancer cells thatultimately results in metastasis, cancer occurrence, and pooroutcome.One cellular pathway involved in cancer progression that

has received much recent attention is epithelial–mesenchymaltransition (EMT) (Hugo et al., 2007; Thiery, 2002). EMT isa cellular program important during normal development(Nieto, 2002). However, recent studies have shown its impor-tance in cancer progression and metastases (Hugo et al.,2007; Thiery and Sleeman, 2006; Turley et al., 2008). DuringEMT, epithelial cells lose tight junctions and acquire a more

From the Department of Internal Medicine, Section of Gastro-enterology, Rush University Medical Center, Chicago, Illinois.

Received for publication March 10, 2009; accepted July 27, 2009.Reprint requests: Ali Keshavarzian, MD, Director, Division of

Digestive Diseases, Rush University Medical Center, 1725 W. Harri-son, Suite 206, Chicago, IL 60612; Fax: 312-563-3883; E-mail:[email protected]

Copyright � 2009 by the Research Society on Alcoholism.

DOI: 10.1111/j.1530-0277.2009.01061.x

Alcoholism: Clinical and Experimental Research Vol. 34, No. 1January 2010

Alcohol Clin Exp Res, Vol 34, No 1, 2010: pp 19–31 19

migratory and invasive (mesenchymal) phenotype. Thesechanges include downregulation of junctional proteins includ-ing E-cadherin and expression of mesenchymal proteins likevimentin. In addition cells express matrix metalloprotease(MMP) enzymes that dissolve the extracellular matrix andpromote cell migration and cancer cell invasion and meta-stases (Egeblad and Werb, 2002; Thiery and Sleeman, 2006).One key transcription factor regulating EMT is Snail (Nieto,2002). Others include Snail2, ZEB1 ⁄2, and Twist withWNT ⁄b-catenin signaling also being a critical component ofEMT (Peinado et al., 2007; Thiery and Sleeman, 2006).Signaling through several growth factor receptors includingthe epidermal growth factor receptor (EGFR) can induceEMT and Snail expression (Ackland et al., 2003; Peinadoet al., 2007).Because of the important role of EMT in cancer progres-

sion, we hypothesized that alcohol abuse may worsen the out-come of epithelial-derived cancers such as colon and breastcancer, by stimulating EMT in cancer cells and thus promot-ing cancer progression and metastases. The aim of our studywas to test our hypothesis by determining if alcohol, at rele-vant in vivo levels, stimulates key phenotypic and functionalsignatures of EMT associated with cancer progression in colonand breast cancer cell lines as well as in a nontransformed(normal) intestinal epithelial cell line. We also sought to inves-tigate the signaling mechanism of alcohol-induced promotionof EMT. To this end, we determined the effects of alcohol onactivation and mRNA expression of the key EMT Snail tran-scription factor as well as upstream signaling pathways relatedto EGFR signaling that might be turning on Snail and EMT.Also, in order to determine the potential relevance of ourin vitro findings, we measured Snail mRNA expression in sig-moid colonmucosal samples from alcoholic subjects.

MATERIALS AND METHODS

Reagents

Alcohol (ethanol) solutions were made daily (AAPER Alcoholand Chemical Co., Shelbyville, KY). TACE inhibitor: TAPI-2(TNF-a Protease Inhibitor-2) (Chemicon, Temecula, CA). EGFRinhibitor: AG1478 (Calbiochem, San Diego, CA). All EGFR,MAPK (ERK1 and ERK2), and Histone H3 Abs were from CellSignaling Technology (CST) (Danvers, MA). ERK1 ⁄2 (MEK1)inhibitor: PD98059 (Calbiochem). b-actin, MMP-2, MMP-7, andMMP-9 Abs: Sigma-Aldrich (St Louis, MO) and MMP-7 positivecontrol (Chemicon). Phospho-Snail Ser246 Ab: Abcam (Cambridge,MA), and total Snail Ab: CST. TNF-a: R&D Systems (Minneapolis,MN). Vimentin mouse Ab: Santa Cruz Biotechnology (Santa Cruz,CA) and secondary Abs were anti-mouse Alexa fluor 488 and anti-rabbit Alexa fluor 594 (Invitrogen, Carlsbad, CA).

Cell Culture

Caco-2 cells (ATCC #CRL2101, human colorectal adenocarci-noma); MCF-7 (ATCC #HTB-22) human breast adenocarcinoma;MDA-MB-231 (ATCC #HTB-26) human breast adenocarcinoma;and IEC-6 (ATCC #CRL-1592) rat normal intestine epithelium weregrown in 6-well plates (Corning, Corning, NY). Cells were cultured at37�C ⁄5%CO2 in DMEM ⁄10% fetal bovine serummedia with 5 mM

penicillin-streptomycin. Caco-2 only: 0.01 mg ⁄ml human transferrin.MCF-7 only: 0.1 mg ⁄ml insulin (Invitrogen).

Treatment of Cells With Alcohol

Cells were stimulated once with alcohol (at the indicated concen-trations) at the start of each time course experiment or once each day(with fresh media) for the 4-day studies. Alcohol concentrations inmedia were determined with the alcohol testing kit (Pointe Scientific,Canton, MI). For example in the long-term (4-day) studies, we foundthat after addition of alcohol each day alcohol concentration declinedfrom 0.2% (43 mM) over 24 hours to reach undetectable (zero) con-centration. Thus, in order to expose the cells to alcohol during the 4-day experiments, we change media each morning and added freshmedia with alcohol every day during the 4-day experiments. This par-adigm models cellular alcohol exposure through alcohol in the bloodcirculation during daily and regular drinking by alcoholics. Nuclearextracts were prepared using a nuclear extraction kit (Pierce Biotech-nology, Rockford, IL). Signaling experiments were terminated byremoval of media and addition of PBS for scrapping, SDS ⁄RIPAbuffer for whole cell lysates, or nuclear extract kit buffer.

Immunofluorescent Staining and Analysis of Cells

Cells grown on glass coverslips in complete medium in 6-wellplates were treated with alcohol (0.2% [43 mM]) for the indicatedtimes in 3 separate experiments. Cells were then washed with PBS,fixed ⁄permeabilized with paraformaldhyde ⁄ triton x-100, and stainedwith primary and fluorescent secondary Abs as described (Forsythet al., 2007). For the TACE ⁄ZO-1 images (Fig. 6C) (20 · 1 lMz-stacks for 3D) were taken. All images were taken using a ZeissAxiovert 100 microscope with Axiovision software (Carl Zeiss Inc.,Thornwood, NY) using an oil immersion 40· objective as described(Forsyth et al., 2007). The plane of focus selected was the one thatrevealed the greatest overall clarity for any given image. Quantitativeanalysis of immunofluorescent staining for vimentin (Fig. 1) was per-formed with Image J software (NIH) using blinded selection andanalysis to prevent bias. Three separate images from 3 separateexperiments were analyzed by determining immunofluorescent inten-sity in 5 areas from each of the 3 images (thus N = 15) for each con-dition. Background values were subtracted using images for cellstreated only with secondary antibodies. Means were compared forcontrol and alcohol-treated cells for each cell type by t-test usingSPSS (SPSS, Inc., Chicago, IL) with p £ 0.05 being significant.

Cell Migration Assay

Cell migration assays were performed for 24 hours as previouslydescribed (Forsyth et al., 2001). 1 · 105 cells (MDA-MB-231) inserum-free media (± alcohol ± inhibitors) were added to the upperwell of PET membrane transwells (12 well ⁄8 lM pore; Falcon, Bec-ton Dickinson, Franklin Lakes, NJ). TNF-a (100 ng ⁄ml) was thenadded to the lower well. For some wells ethanol (E, 0.2%, 43 mM)was added before adding cells ± specific inhibitors of the EGFR(AG1478, 500 lM); TACE (TAPI-2, 20 lM); or ERK1 ⁄2 (MEK)(PD98059, 30 lM). Assay was stopped by removing cells from theupper well with a cotton swab and inserts fixed and stained with crys-tal violet to visualize cells. Data are mean ± SE cells per high powerfield (40· objective) from 5 fields per insert for duplicate wells in arepresentative from 3 experiments.

Human Subjects and Sigmoid Mucosal Samples

Endoscopic Pinch sigmoid mucosal biopsies were obtained from 4healthy and 4 alcoholic male subjects. These samples were randomlyselected from our IRB approved tissue repository. Alcoholic subjectswere recruited as part of our ongoing project studying the effects of

20 FORSYTH ET AL.

chronic alcohol consumption on intestinal function. All alcoholicsubjects fulfilled NIAAA criteria for at-risk drinking and alcoholabuse or dependence (O’connor and Schottenfeld, 1998) and DSM-IV criteria for alcoholism (Ball et al., 1997). This included a recentdrinking history (regular and heavy EtOH consumption for a

minimum of 3 months prior to enrollment). These 4 alcoholics wereactively drinking for the last 10 years and their last drink was 7 to10 days prior to the endoscopic procedure. However, blood alcohollevel was undetectable at the time of the procedure. A history of alco-hol consumption was assessed by a validated NIAAA-endorsed

A

B

C

D

Fig. 1. Alcohol stimulates upregulation of the signature EMT mesenchymal marker protein vimentin in breast and colon cancer cells and in normal intesti-nal epithelial cells. The human cell lines Caco-2 (colon cancer) (A) and MDA-MB-231 (B), and MCF-7 (C) (both breast cancer) as well as the rat normalintestinal epithelial cell line IEC-6 (D) were grown on glass coverslips in 6-well plates in complete medium. Treated cells were stimulated with alcohol (0.2%,43 mM) for 4 days and then Control (A, no alcohol) and alcohol-treated (B) cells were fixed and stained with Ab to vimentin and Alexa fluor 488 (green) fluo-rescent secondary Ab. Images (40· oil immersion) are representative from duplicate wells in 3 experiments. Arrows note increased cytoplasmic vimentinstaining. Scale bar is 20 lm.

ALCOHOL STIMULATES SNAIL AND EMT IN CANCER CELLS 21

assessment instrument—The Lifetime Drinking History (Skinner andSheu, 1982). Control subjects were otherwise healthy individuals withno known liver disease, who did not fulfill any of the exclusion crite-ria, and who were willing to participate in the study. None of thecontrols had ever been a daily or heavy drinker.Subjects recruited were excluded if they reported gastrointestinal

diseases (except for hiatal hernia or hemorrhoids), clinically detect-able ascites or severe edema, evidence of ongoing infection, majordepression or anxiety requiring therapy, clinically significant lung orheart disease, or regular use of NSAIDs. All subjects had normalliver function tests and had no clinical evidence of liver disease.Sigmoid biopsy samples were taken during an unprepped

sigmoidoscopy and mucosal samples were snap frozen in liquid nitro-gen, transferred to the laboratory and stored in )80�C freezer. Theprocedure was performed after a Rush IRB approved informed,written consent.

Western Blotting Analysis

Western blotting and densitometry analysis with Image J software(NIH) was performed with cell lysates equalized for protein or cellculture supernatants (conditioned media) equalized for total proteinand cell number as previously described (Forsyth et al., 2002, 2007).To our knowledge there is no loading control marker for serum-freecell culture conditioned media for Fig. 2, all other western blottingdata was normalized to densitometry values for the loadingcontrols.

Isolation of RNA and RT-PCR

Isolation of cell total RNA, reverse transcription, and real timePCR was carried out as previously described (Forsyth et al., 2007).Primers for PCR were: Beta actin (157 bp): F:GCCAGGTCCA-GACGCAGG;R:TGCTATCCAGGCTGTGCTA; Snail F:(142bp):ACCCCACATCCTTCTCACTG; R:TACAAAAACCCACG-CAGACA; MMP-7(138 bp) F:GAGTGCCAGATGTTGCAGAA,R:AAATGCAGGGGGATCTCTTT. Snail and MMP-7 Ct datawere normalized to beta-actin and then to Snail or MMP-7 mRNAexpression in the control to arrive at the fold expression value.

SiRNA Snail Inhibition Studies

Smartpool short inhibitory RNA (siRNA) for human Snail(Snail1, SNAI1) was purchased from Dharmacon (Dharmacon Inc.,Lafayette, CO). Caco-2 cells grown to 60% confluence in 6-wellplates were transfected with 100 nM Snail siRNA or control siRNA(Santa Cruz Biotechnology), using Lipofectamine (Invitrogen) andOptimem (Invitrogen) media (Forsyth et al., 2007). At 2 days postsiRNA transfection cells were treated with alcohol (0.2%, 43 mM)for 4 additional days and then tested for expression of Snail andvimentin proteins by western blotting. Blot shown is representativefrom 3 experiments while densitometry data are means ± SE fromall 3 experiments.

Snail and E-cadherin Reporter Assays

Caco-2 colon cancer cells grown in 96-well plates were transfectedwith 100 ng ⁄well of Snail reporter plasmid (gift of A.G. de Herreros)(Barbera et al., 2004) or CDH1::LUC E-cadherin reporter (gift of L.Larue) (Julien et al., 2007). Values were read 8 hours after initialstimulation with 0.2% (43 mM) alcohol for the Snail reporter andafter 24 and 48 hours for the E-cadherin reporter. Cells were co-transfected with 1 ng SV40 renilla luciferase plasmid (Promega,Madison, WI) and developed using the Stop and Glow kit (Pro-mega), read on a Lumioskan Ascent plate reader (Thermo Labsys-tems, Waltham, MA), and data normalized to renilla values tocontrol for transfection efficiency.

Data Analysis

Results are expressed as means ± SE. Differences among multiplemeans compared to control were determined by ANOVA followedby Dunnett post hoc test. Differences between 2 groups [control vs.one experimental group] were assessed using Student’s t-test. Signifi-cance for all tests was defined as p £ 0.05. All statistical analyses wereperformed using SPSS.

RESULTS

Alcohol Stimulates Expression of the EMT SignatureMesenchymal Marker Protein Vimentin in Breast andColon Cancer Cells and Normal Intestinal Epithelial Cells

We hypothesized that alcohol is promoting cancer progres-sion by stimulating EMT in cancer cells. The most widelyvalidated signature biomarker of EMT is the mesenchymalprotein vimentin (De Wever et al., 2008). Caco-2 (coloncancer), MCF-7 and MDA-MB-231 (breast cancer), andIEC-6 (nontransformed, normal intestinal) cells grown onglass coverslips were stimulated with 0.2% (43 mM) alcoholcontaining media or media alone for 4 days. As seen inFig. 1A–D, alcohol stimulated the expression of vimentin innormal intestinal IEC-6 cells as well as both the colon cancerand breast cancer cells. Mean Image J densitometry fluores-cence values for the 4 cell types were: Caco-2 control(64 ± 9) and alcohol treated (119 ± 14); MCF-7 control(62 ± 13) and alcohol treated (211 ± 15); MDA-MB-231control (101 ± 12) and alcohol treated (196 ± 12); and IEC-6 control (81 ± 4) and alcohol treated (157 ± 6). Thus, theuntreated Caco-2, MCF-7, and IEC-6 cells showed lowvimentin expression. However, the MDA-MB-231 cells didshow higher basal expression of vimentin. High basal expres-sion of vimentin in the MDA-MB-231 cells was also notedby others (Nagaraja et al., 2006). Nonetheless, alcoholstimulated a significant increase in vimentin staining in all4 cell types (Fig. 1A–D; p £ 0.05; control vs. alcohol treatedt-tests).

Alcohol Stimulates Production of EMT CharacteristicMMP-2, MMP-7, and MMP-9

Three MMPs especially characteristic of the EMT prote-ome are MMP-2, MMP-7, and MMP-9 (De Wever et al.,2008; Thiery, 2002; Turley et al., 2008). MMPs are secreted asinactive proenzymes that require activation or cleavage byother MMPs to become active (Egeblad and Werb, 2002).The lower molecular weight form is the activated form foreach MMP shown (MMP-9:92 ⁄88 kd; MMP-7:28 ⁄18 kd;MMP-2:72 ⁄63 kd). Equal numbers of Caco-2, MDA-MB-231, and IEC-6 cells (1 · 106 ⁄well) were stimulated with alco-hol in serum free media (24 hours, 1 ml) and the levels ofMMP-2 andMMP-9 (upper sections) andMMP-7 (lower sec-tions) were determined in 50 ll aliquots of conditioned mediaby western blotting as described (Forsyth et al., 2002).As seen in Fig. 2A–C, alcohol robustly and significantly

22 FORSYTH ET AL.

stimulated the production of all 3 MMPs over 24 hours byboth transformed, cancer cell lines (colon cancer and breastcancer cells) and the nontransformed (‘‘normal’’) intestinalcell line IEC-6. Fold increases for Caco-2, MDA-MB-231,and IEC-6 (respectively) were: MMP-2: 3,6,2; MMP-7:10,8,6; and MMP-9: 8,8, and 5 fold (p £ 0.05 for all MMPsvs. control, t-tests). We also assessed Caco-2 cell MMP-7expression with ethanol at varying concentrations (0.01%

[2 mM]; 0.05% [11 mM]; 0.075% [16 mM]; 0.1% [22 mM];0.2% [43 mM]; 1.0% [217 mM]; 2.0% [434 mM]) for24 hours (Fig. 2D). As shown in Fig. 2D, ethanol stimulateda dose dependent significant increase in MMP-7 secretioncompared to control (p £ 0.05, AVOVA with post hocDunnett test). Remarkably, the peak MMP-7 detected in con-ditioned media was with alcohol at physiological concentra-tions (0.1% [22 mM] and 0.2% [43 mM]). RT-PCR analysis

A B

C

D

Fig. 2. Alcohol stimulates production of MMP-2, MMP-7, and MMP-9 characteristic for EMT. (A–C) The cell lines Caco-2, MDA-MB-231, and IEC-6 (all1 · 106 cells ⁄ well) were cultured in 6-well plates and made serum free for 24 hours before stimulation overnight (24 hours) with alcohol (0.2%, 43 mM) in1 ml of serum free media. Media was removed and 50 ll ⁄ lane from control (no alcohol) and alcohol-treated cells was loaded onto SDS–PAGE gelsand MMP proteins were determined by western blot with Abs to MMP-2, MMP-9, and MMP-7 (lower). (D) Caco-2 cells were treated as above for 24 hourswith differing doses of alcohol (0.1% [22 mM], 2% [434 mM]) and MMP-7 measured by western blot as above. Far right ‘‘+C’’ lane is positive control forMMP-7 (densitometry histogram: ProMMP-7 = black, activated MMP-7 = grey). All blots are representative of 3 experiments. *p £ 0.05 for all figures versuscontrol.

ALCOHOL STIMULATES SNAIL AND EMT IN CANCER CELLS 23

of MMP-7 mRNA expression revealed an 8-fold increase for0.1% (22 mM) ethanol (not shown).

Alcohol Stimulates Phosphorylation of Snail at Ser246 andSnail Localization to the Nucleus

We next sought to determine a mechanism whereby alcoholmight be turning on the EMT program. The most studiedtranscription factor regulating EMT is Snail. One recent studyshowed that PAK1 phosphorylates (activates) Snail at Ser246

resulting in Snail localization to the nucleus and is requiredfor Snail-mediated promotion of EMT (Yang et al., 2005).To determine whether alcohol promotes EMT through Snail,we performed a time course experiment in which cells werestimulated with alcohol (30 minutes, 1, 2, 4, 6 hours) andnuclear extracts were tested by western blotting with an Abspecific for Snail Ser246. Cytoplasmic extracts were negative(not shown). As seen in Fig. 3A–D, alcohol stimulatedsignificant (p £ 0.05, ANOVA with post hoc Dunnett test)

time-dependent nuclear localization of Snail phosphorylatedat Ser246 in Caco-2 cells, MDA-MB-231, MCF-7, and IEC-6cells.

Alcohol Stimulates Increased mRNA Expression From aSnail Reporter and Decreased mRNA Expression From anE-cadherin Reporter

We sought to determine if alcohol also stimulates mRNAexpression of Snail. We first assessed the ability of alcohol tostimulate mRNA expression from a Snail reporter plasmid.Caco-2 cells were transfected with a PGL3 luciferase reportercontaining the Snail promoter (gift of A.G.Herreros) (Barberaet al., 2004). As seen in Fig. 4A, after 8 hours alcohol stimu-lated a 2-fold increase in Snail promoter activity compared tocontrol (no alcohol) cells (p £ 0.05, t-test). Because Snail isknown to repress E-cadherin mRNA expression we also deter-mined the effect of alcohol on an E-cadherin reporter (gift ofL. Larue) (Julien et al., 2007). Recent studies show E-cadherin

A B

CD

Fig. 3. Alcohol stimulates phosphorylation of the EMT transcription factor Snail at Ser246 and its localization to the nucleus. (A–D) Equal cell numbers ofCaco-2, MDA-MB-231, MCF-7, and IEC-6 cells were stimulated with alcohol (0.2% [43 mM]) and nuclear extracts prepared after 30 minutes, 1, 2, 4, and6 hours. Aliquots equalized for protein were analyzed by western blot with Ab to Snail p-Ser246 and Histone H3 to measure loading. Blots are representativefrom 4 experiments while the densitometry data shown represents the means of all 4 experiments for each cell type, so some bars are slightly different fromthe blots shown.

24 FORSYTH ET AL.

mRNA expression is suppressed at 24 to 48 hours duringEMT (Billottet et al., 2008), so we assessed the effects of alco-hol on E-cadherin reporter activity at 24 and 48 hours afteralcohol stimulation. Figure 4A shows that alcohol stimulationresulted in significant inhibition of E-cadherin reporter activityat 24 ⁄48 hours (50% ⁄48%; p £ 0.05, t-test) consistent withactivation of Snail nuclear activity by alcohol.

Alcohol Induces mRNA and Protein Expression of Snail inColon and Breast Cancer Cells

We used qRT-PCR to assess Snail mRNA expressiondirectly in Caco-2 colon cancer and MDA-MB-231 breastcancer cells stimulated for 24 hours with alcohol. As seen inFig. 4B,C (upper sections), for Caco-2 cells the values for foldincrease in Snail mRNA expression were 0.1–7.5%, 0.2–8.5%, and 1–11.6% fold. To identify possible mechanismsstimulating Snail mRNA expression Caco-2 cells were alsotreated with an EGFR inhibitor AG1478 + 1% alcoholwhich blocked stimulation by 75% (2.8 fold vs. 11.6 fold).For MDA-MB-231 cells alcohol stimulated Snail mRNAexpression by 0.2–5.4% and 1–8.2%. Total Snail protein incells stimulated under the same conditions (lower sections 4Band 4C) were: Caco-2: 0.1–4.8%, 0.2–3.5%, 1.0–4.1%, and1.0%+ EGFR inhibitor 0.8 (inhibited 80%) and for MDA-MB-231: 0.2–7.8%, 1.0–8.5% (p £ 0.05 for all increases andthe EGFR inhibition, ANOVA with Dunnett post hoc test).

Snail mRNA Expression is Significantly Elevated in theColonic Mucosa of Heavy Drinkers

To investigate the potential relevance of our in vitro find-ings in vivo, we sought to determine Snail mRNA expressionin the colonic mucosa of chronic (active) heavy alcohol drink-ers. We used qRT-PCR to assess Snail mRNA expressionusing RNA prepared from intestinal biopsies from normal vs.alcoholic subjects. As shown in Fig. 4D, Snail mRNA expres-sion was significantly higher (83% higher) in colonic biopsiesfrom chronic heavy drinkers (NIAAA criteria) as comparedto controls (N = 4 ⁄group, p £ 0.05, t-test).

A

B

D

C

Fig. 4. (A) Alcohol stimulates increased mRNA expression from a Snailreporter plasmid and repressed mRNA expression from an E-cadherinreporter. Caco-2 cells in complete medium in 96-well plates were transfectedwith 100 ng ⁄ well of the Snail-PGL3 reporter plasmid containing the humanSnail promoter ()869 ⁄ +59) or the CDH1::LUC E-cadherin reporter()308 ⁄ +21) as well as a control renilla luciferase plasmid (1 ng ⁄ well). Cellsmade serum free for 24 hours were stimulated with alcohol (0.2% [43 mM])for 8 hours for the Snail reporter data or for 24 and 48 hours for the E-cadherin data. Firefly luciferase values were determined and normalized torenilla luciferase values to control for transfection efficiency. Data (% Con-trol) are means of duplicate wells from 3 experiments (N = 6). (B,C) Alcoholstimulates mRNA expression of Snail and Snail protein expression in colonand breast cancer cells. Caco-2 colon cancer and MDA-MB-231 breastcancer cells grown in 6-well plates in complete medium were made serumfree for 24 hours and then stimulated for 24 hours with alcohol (0.1%[22 mM], 0.2% [43 mM], or 1% [217 mM]). RNA was prepared and SnailmRNA expression normalized to b-actin by qRT-PCR analysis. Data aremeans from a representative of 3 experiments (upper sections). In additioncell lysates from matched wells were analyzed by western blot for total Snailprotein with a representative blot shown from 3 experiments (lower sec-tions). (D) Snail mRNA expression is significantly elevated in the colonicmucosa of heavy drinkers. Pinch sigmoid mucosal biopsies were obtainedat 20 to 25 cm from the anus during sigmoidoscopy procedure(N = 4 ⁄ group). Controls were healthy subjects who had never been a dailyor heavy drinker. Alcoholic subjects were selected based on NIAAA andDSM-IV criteria. RNA was prepared and Snail mRNA expression deter-mined by qRT-PCR and data are expressed relative to b-actin.

ALCOHOL STIMULATES SNAIL AND EMT IN CANCER CELLS 25

Snail Knockdown with siRNA Inhibits Alcohol-StimulatedVimentin Expression

We investigated whether knockdown of Snail expressionwith siRNA would prevent alcohol-stimulated EMT (vimen-tin expression). Caco-2 cells were treated with alcohol (0.2%,43 mM) for 4 days. Some cells were pretreated (48 hours)with an irrelevant siRNA control or siRNA (100 nM final)specific for Snail as described (Forsyth et al., 2007). Westernblots were used to assess Snail and vimentin protein expres-sion. As seen in Fig. 5, treatment with alcohol caused anincrease in vimentin expression in media treated as well ascontrol siRNA treated cells (lanes 2&3). However, Snailknockdown (48% mean knockdown) with specific siRNAprevented alcohol-induced vimentin expression (lane 4;p £ 0.05 vs. siRNA control, t-test). Note that these data arefor total Snail only to assess knockdown. Our previous data(Fig. 3A–D) show alcohol stimulates nuclear localization ofSer246-phosphorylated Snail.

Alcohol Stimulates Transactivation of EGFR Signaling

We attempted to identify upstream signaling mechanismsfor alcohol activating PAK1 phosphorylation of Snail andSnail mRNA expression. We have previously shown oxidativestress activates EGFR signaling in Caco-2 cells (Forsythet al., 2007). EGFR signaling can regulate EMT and cancer

as well as PAK1 mediated phosphorylation of Snail and stim-ulation of Snail mRNA expression via ERK1 ⁄2 signaling(Barbera et al., 2004; Yang et al., 2005). In Fig. 6, the datashow alcohol (0.2%, 43 mM) stimulates phosphorylation 5-to 10-fold of the EGFR and downstream ERK1 ⁄2 in bothcolon cancer (Fig. 6A) and breast cancer (Fig. 6B) cells. Alco-hol-induced EGFR and ERK1 ⁄2 activation was significantlyblocked by an EGFR inhibitor, AG1478 (500 nM, 85% inhi-bition), or inhibition of the metalloprotease tumor necrosisfactor converting enzyme-TACE (ADAM17) (TAPI-2,20 lM; 85% inhibition). This supports the requirement forTACE-EGFR transactivation by alcohol for EGFR andERK1 ⁄2 activation as we have shown for oxidative stress(Forsyth et al., 2007).To further investigate a role for TACE in alcohol-mediated

EGFR transactivation, we used 3D microscopy of deconvo-luted z-stack images (20 · 1 lm) of Caco-2 or MDA-MB-231cells to identify changes in TACE location in the cells(Fig. 6Ca–d). Translocation of TACE to the apical surfacefrom a perinuclear location is associated with EGFR transac-tivation and cleavage of EGFR proligands including TGF-a(Blobel, 2002; Forsyth et al., 2007). Although TACE inhibi-tors block EGFR activation at the 10-minute timepoint, weobserved maximum translocation (surface staining) of TACEafter 30 minutes. Therefore, we show data for 30 minutes inFig. 6C in which alcohol clearly stimulates translocation ofTACE to the apical (Caco-2) or outer (MDA-MB-231) cell

Fig. 5. SiRNA knockdown of Snail prevents alcohol-induced vimentin expression. Caco-2 cells were treated with either media alone (lane 1), EtOH alone(lane 2), EtOH with control (scrambled) siRNA (lane 3), or EtOH with siRNA specific for Snail (lane 4). After 48 hours, cells were then treated with alcohol for4 days as in Fig. 1 and then vimentin and total Snail proteins were determined by western blot. Blot is a representative from 3 experiments; histogram showssummarized data from all 3 experiments.

26 FORSYTH ET AL.

A

C

D

B

Fig. 6 (A,B) Alcohol stimulates transactivation of the EGFR and ERK1 ⁄ 2 signaling. Caco-2 and MDA-MB-231 cells made serum free for 24 hours werestimulated with alcohol (0.2%, 43 mM) for 10 minutes for p-EGFR and 30 minutes for the p-ERK1 ⁄ 2 analysis. Some cells were preincubated with an inhibi-tor of the EGFR (AG1478, 500 lM) or TACE (TAPI-2, 20 lM). Western blots of cell lysates were developed with antibody to phospho-EGFRTyr1068 orphospho-ERK1 ⁄ 2 for Caco-2 cells (A) and for MDA-MB-231 cells (B). Blots were stripped and reprobed with Ab to total EGFR or ERK1 ⁄ 2 to show equalloading. Blots are representative of 3 experiments. (C) Alcohol stimulates translocation of TACE to the cell surface in colon and breast cancer cells. Caco-2and MDA-MB-231 cells grown on glass coverslips were stimulated with alcohol (0.2%, 43 mM) for 30 minutes. Cells were then fixed and permeabilized andstained with Ab to TACE or ZO-1 and then fluorescent secondary Abs to TACE (red) or ZO-1 (green). 20 · 1 lm z-stack images were taken (40· oil immer-sion) and deconvoluted with Zeiss Axiovision software to yield the 3D images shown. Images are representative from 3 experiments. Bars = 20 lm. (D)Alcohol stimulates EGFR-dependent migration of breast cancer cells. MDA-MB-231 breast cancer cells in serum free medium (5 · 105 cells ⁄ well) wereadded to the upper well of 12-well ⁄ 8 lm format PET transwells. Then 100 ng ⁄ ml TNF-a (T) was placed in the bottom well and migration measured after24 hours. For some wells ethanol (E, 0.2%, 43 mM) was added before adding cells ± specific inhibitors of the EGFR (AG1478, 500 lM); TACE (TAPI-2,20 lM); or ERK1 ⁄ 2 (MEK) (PD98059, 30 lM). Data are means of cells per hpf (40·) from duplicate wells of a representative of 3 experiments (*p £ 0.05 forlane 2 vs. lane1, lane 3 vs. lane 2, and lanes 4, 5, 6 vs. lane 3).

ALCOHOL STIMULATES SNAIL AND EMT IN CANCER CELLS 27

surface further supporting a specific role for TACE in alcoholtransactivation of the EGFR.

Alcohol Stimulates EGFR-Mediated Migration of CancerCells

One hallmark of Snail expression and EMT is increased cellmigration ⁄ invasion (Nieto, 2002; Thiery, 2002). We wished toassess whether ethanol stimulated migration of cancer cells.We used MDA-MB-231 breast cancer cells because our datashow alcohol stimulates MMPs and Snail activation andexpression in these cells (see above). As shown in Fig. 6D,cells stimulated with TNF-a alone showed a significant 2.6-fold migration versus control (p £ 0.05, ANOVA with Dun-nett post hoc test). Alcohol stimulated an additional 3-foldincrease in migration through inserts together with TNF-a(100 ng ⁄ml). This migration was blocked by inhibitors ofeither the EGFR (AG1478, 500 nM, 83%inhibition), orTACE (TAPI-2, 20 lM, 82% inhibition), or ERK1 ⁄2(PD98059, 30 lM, 88% inhibition) (p £ 0.05, ANOVA withDunnett post hoc test).

DISCUSSION

In the current study, we provide evidence that alcoholinduces EMT in cancer cells and this alcohol effect is medi-ated through Snail activation. EMT is an active focus of cur-rent cancer research with a large body of in vitro, animal, andpatient evidence strongly supporting a key role for EMT incancer progression and metastases (Hugo et al., 2007; Thiery,2002; Thiery and Sleeman, 2006; Turley et al., 2008;Weinberg,2008). In addition to breast and colon cancer, evidencesupports a role for EMT in oral, nasopharyngeal, esophageal,gastric, rectal, cervical, ovarian, thyroid, pancreatic, andprostate cancer to name only a partial list (Hugo et al., 2007;Natalwala et al., 2008; Turley et al., 2008). Recent animalexperiments demonstrated direct in vivo evidence for EMT inbreast cancer progression (Trimboli et al., 2008). In coloncancer, it has been shown that EMT (vimentin) is associatedwith early adenoma progression in the APCMin mouse model(Chen et al., 2008). We now, for the first time, providecompelling evidence to support our hypothesis that alcoholpromotes breast and colon cancer migration by stimulatingthe EMT program in cancer cells.Several prior studies with alcohol in different cell types are

relevant to our findings. Two studies describe EMT changesby alcohol treatment in an immortalized keratinocyte cell line(9 weeks alcohol treatment) (Chamulitrat et al., 2003) or abreast epithelial cell line (7 days of alcohol treatment)(Robson et al., 2006). Specific mechanisms for EMT were notinvestigated in either study. In other studies alcohol wasfound to stimulate cell migration of breast cancer cells(Ke et al., 2006) and endothelial cells (Morrow et al., 2008).Alcohol has also been shown to both activate and inhibitTACE-mediated processing of TNF-a (Zhao et al., 2003,2004) and to inhibit EGFR signaling or enhance ErbB2 cell

migration (Ma et al., 2003, 2005).Thus, although limited intheir investigation of possible mechanisms, these previousstudies support our hypothesis for induction of EMT charac-teristics by alcohol stimulation.In the present study, we investigated the effects of alcohol

in breast and colon cancer cell lines because both of these can-cers are promoted by alcohol use. Our data show that alcoholstimulates expression of the signature mesenchymal proteinvimentin in breast and colon cancer cells. We also show thatSnail knockdown inhibits this alcohol-induced vimentinexpression in Caco-2 cells. Epithelial cells express cytokeratinintermediate filaments, while these filaments are composed ofvimentin in mesenchymal cells. (De Wever et al., 2008).Vimentin is the most widely used and well validated signaturephenotypic marker of EMT (De Wever et al., 2008; Turleyet al., 2008). Vimentin expression has been identified inseveral studies of breast, colon, and other cancers as beingassociated with increased invasiveness and poor prognosis(De Wever et al., 2008).Our data for both breast and colon cancer cells shows that

alcohol stimulates nuclear localization and phosphorylationof Snail at Ser246, probably by PAK1(Yang et al., 2005). Inaddition we show alcohol stimulates mRNA expression froma Snail reporter plasmid and Snail mRNA expression in colonand breast cancer cell lines. Snail has been called a master reg-ulator of EMT (Peinado et al., 2007). A hierarchical model oftranscriptional regulation of EMT involves other key tran-scription factors that have been identified including Snail2,ZEB1 ⁄2, and Twist but places Snail at the top of this hierar-chy (Peinado et al., 2007). Overexpression of Snail alone issufficient to induce EMT in cell lines in vitro (Cano et al.,2000; Julien et al., 2007) and recently to generate possible can-cer stem cells (Mani et al., 2008). In transgenic mice, chronicSnail activation results in multiple epithelial and mesenchymaltumors (Perez-Mancera et al., 2005). In another mousemodel, Snail expression determined breast cancer invasivenessand recurrence (Moody et al., 2005). Overexpression of Snailhas also been shown to correlate closely with invasiveness andrecurrence of breast and colon cancer as well as other cancersin patient studies (Blanco et al., 2002; Natalwala et al., 2008;Roy et al., 2005). We now show, for the first time, that alco-hol also promotes EMT in cancer cells through activation ofSnail. We propose that Snail-mediated promotion of EMT inepithelial cancer cells by alcohol may be one mechanism foralcohol promotion of cancer progression and poor outcomeof colon and breast cancers in alcoholics.Relevant to our MMP data, Snail has been shown to

directly stimulate MMP-2 and MMP-9 expression (Jordaet al., 2005; Yokoyama et al., 2003). Knockdown of Snail ina mouse tumor model resulted in fewer tumors at least in partdue to reduced MMP-9 (Olmeda et al., 2007). MMP-3 orMMP-9 can also further promote EMT via Snail (Radiskyet al., 2005). In addition, MMP-7 is a target of b-catenin ⁄TCFsignaling which is another pathway important in EMT alsotied to Snail (Brabletz et al., 1999; Peinado et al., 2007).Increased Snail activity can stimulate b-catenin indirectly by

28 FORSYTH ET AL.

repressing E-cadherin or directly by interacting with b-catenin(Stemmer et al., 2008). Our data supports a mechanism inwhich alcohol stimulation of activated Snail nuclear localiza-tion as well as increased Snail mRNA expression results inpromoting EMT and cancer progression by increasing expres-sion of vimentin as well as MMP-2, MMP-7, and MMP-9 incancer cells.Experiments in the APCMin mouse model of colon cancer

also support our hypothesis for alcohol promoting cancerprogression through stimulation of Snail and EMT. Snail isoverexpressed in human colon cancer (Roy et al., 2005) andadenoma formation in APCMin mice is inhibited by Snailknockdown (Roy et al., 2004). Significantly, adenoma forma-tion in these mice is enhanced by drinking alcohol (Roy et al.,2002) and recently this same adenoma formation in APCMin

mice was shown to occur by an EMT-dependent mechanismwith early expression of vimentin (Chen et al., 2008).Our data suggest that alcohol stimulation of EGFR sig-

naling may promote activation of Snail and EMT. Abnor-malities in EGFR signaling or expression are associated withmany human cancers (Hynes, 2007). Several different cellsignaling pathways have been shown to stimulate inductionof EMT including signaling by receptor tyrosine kinases suchas the EGFR (Peinado et al., 2007; Thiery and Sleeman,2006). Chronic stimulation with EGF can result in activationof Snail and EMT (Ackland et al., 2003; Peinado et al.,2007). Blocking EGFR signaling inhibits alcohol-stimulatedSnail mRNA expression in our study and Snail mediatedcolon cancer metastases in mice (Mann et al., 2006). EMT incervical cancer also correlates with EGFR and Snail overex-pression (Lee et al., 2008). Our data suggest alcohol activatesEGFR signaling through TACE-mediated transactivation.TACE-mediated EGFR transactivation promotes EMT-mediated cancer progression in breast epithelial cells (Kennyand Bissell, 2007). Our data also show alcohol-stimulatedERK1 ⁄2 activation through the EGFR. Overexpression ofERK1 ⁄2 also promotes EMT and promoter analysis of Snailreveals a key stimulatory role for ERK1 ⁄2 (Barbera et al.,2004; Schramek et al., 2003). In addition, our data show thatalcohol stimulates phosphorylation ⁄activation of Snail atSer246 probably by PAK1 (Yang et al., 2005). EGFR signal-ing has also been shown to activate PAK1 (Kumar et al.,2006). In further support of a role for EGFR-EMT signalingin our model, an EGFR inhibitor also inhibited alcoholstimulated cell migration in our study. Therefore data fromothers as well as our own data support a role for alcohol-stimulation of EGFR signaling in activation of Snail nuclearlocalization and mRNA expression and subsequent promo-tion of EMT.It should also be noted that several epidemiological studies

suggest that alcohol abuse not only promotes cancer progres-sion and metastasis, it may also increase the risk of certaincancers like squamous epithelial cancer of esophagus, headand neck cancer and also breast and colon cancer (Seitz andStickel, 2007). Furthermore, several experimental studies sug-gested that Snail and EMT are not only involved in cancer

progression but also in cancer initiation (Hugo et al., 2007;Thiery, 2002; Thiery and Sleeman, 2006; Turley et al., 2008;Weinberg, 2008). For example, overexpression of Snail intransgenic mice results in multiple tumor types and EMTitself is associated with increased genomic instability which inturn could contribute to cancer initiation as well as cancerprogression (Radisky et al., 2005). Our findings in normal,nontransformed intestinal cells that alcohol promotes EMTin noncancer cells support the notion that alcohol-inducedstimulation of EMT pathway in normal epithelial cells maybe a mechanism for increased risk of cancers in alcoholics.Further studies are needed to confirm our findings in differentnoncancer cell lines and primary epithelial cells.In summary, collectively our data present evidence for a

novel pathway for alcohol promotion of cancer progressionthrough induction of the EMT gene program in cancer cells.To our knowledge these data are the first to show that alcoholactivates and increases mRNA expression of the key EMTtranscription factor Snail or to show EGFR transactivationand induction of MMPs by alcohol in epithelial cells.Together with the vimentin, E-cadherin reporter, and cellmigration (a surrogate marker for metastasis) data our studystrongly supports the hypothesis that alcohol induces theEMT program in cancer cells and promotes metastasis. Themechanisms for exactly how EMT promotes cancer progres-sion are currently being unraveled. Future studies will beneeded to identify the individual roles of EGFR, MMP, andSnail signaling in alcohol induction of EMT as well as thepossible roles for other EMT transcription factors. Identifica-tion of this novel mechanism for alcohol promotion of cancerprogression could open new avenues for prevention and treat-ment of alcohol-related cancers.

ACKNOWLEDGMENTS

We thank Lionel Larue and Antonio Garcia de Herrerosfor providing reagents. This study was supported in part byNIH funding through grant AA013745 (to A.K.).

CONFLICT OF INTEREST

None declared.

REFERENCES

Ackland ML, Newgreen DF, Fridman M, Waltham MC, Arvanitis A,

Minichiello J, Price JT, Thompson EW (2003) Epidermal growth factor-

induced epithelio-mesenchymal transition in human breast carcinoma cells.

Lab Invest 83:435–448.

Ball SA, Tennen H, Poling JC, Kranzler HR, Rounsaville BJ (1997) Personal-

ity, temperament, and character dimensions and the DSM-IV personality

disorders in substance abusers. J Abnorm Psychol 106:545–553.

Barbera MJ, Puig I, Dominguez D, Julien-Grille S, Guaita-Esteruelas S, Peiro

S, Baulida J, Franci C, Dedhar S, Larue L, De Herreros Garcia A (2004)

Regulation of Snail transcription during epithelial to mesenchymal transi-

tion of tumor cells. Oncogene 23:7345–7354.

Billottet C, TuefferdM, Gentien D, Rapinat A, Thiery JP, Broet P, Jouanneau

J (2008) Modulation of several waves of gene expression during FGF-1

ALCOHOL STIMULATES SNAIL AND EMT IN CANCER CELLS 29

induced epithelial-mesenchymal transition of carcinoma cells. J Cell Bio-

chem 104:826–839.

Blanco MJ, Moreno-Bueno G, Sarrio D, Locascio A, Cano A, Palacios J,

Nieto MA (2002) Correlation of Snail expression with histological grade

and lymph node status in breast carcinomas. Oncogene 21:3241–3246.

Blobel CP (2002) Functional and biochemical characterization of ADAMs

and their predicted role in protein ectodomain shedding. Inflamm Res

51:83–84.

Boffetta P, Hashibe M (2006) Alcohol and cancer. Lancet Oncol 7:149–156.

Brabletz T, Jung A, Dag S, Hlubek F, Kirchner T (1999) Beta-catenin regu-

lates the expression of the matrix metalloproteinase-7 in human colorectal

cancer. Am J Pathol 155:1033–1038.

Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, Barrio Del

MG, Portillo F, Nieto MA (2000) The transcription factor snail controls

epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat

Cell Biol 2:76–83.

Chamulitrat W, Schmidt R, Chunglok W, Kohl A, Tomakidi P (2003)

Epithelium and fibroblast-like phenotypes derived from HPV16 E6 ⁄E7-immortalized human gingival keratinocytes following chronic ethanol

treatment. Eur J Cell Biol 82:313–322.

Chen X, Halberg RB, Burch RP, Dove WF (2008) Intestinal adenomagenesis

involves core molecular signatures of the epithelial-mesenchymal transition.

J Mol Histol 39:283–294.

De Wever O, Pauwels P, Craene De B, Sabbah M, Emami S, Redeuilh G,

Gespach C, Bracke M, Berx G (2008) Molecular and pathological

signatures of epithelial-mesenchymal transitions at the cancer invasion front.

Histochem Cell Biol 130:481–494.

Egeblad M, Werb Z (2002) New functions for the matrix metalloproteinases

in cancer progression. Nat Rev Cancer 2:161–174.

Forsyth CB, Banan A, Farhadi A, Fields JZ, Tang Y, Shaikh M, Zhang LJ,

Engen PA, Keshavarzian A (2007) Regulation of oxidant-induced intestinal

permeability by metalloprotease-dependent epidermal growth factor recep-

tor signaling. J Pharmacol Exp Ther 321:84–97.

Forsyth CB, Pulai J, Loeser RF (2002) Fibronectin fragments and blocking

antibodies to alpha2beta1 and alpha5beta1 integrins stimulate mitogen-

activated protein kinase signaling and increase collagenase 3 (matrix

metalloproteinase 13) production by human articular chondrocytes.

Arthritis Rheum 46:2368–2376.

Forsyth CB, Solovjov DA, Ugarova TP, Plow EF (2001) Integrin alpha(M)-

beta(2)-mediated cell migration to fibrinogen and its recognition peptides.

J ExpMed 193:1123–1133.

Hugo H, Ackland ML, Blick T, Lawrence MG, Clements JA, Williams ED,

Thompson EW (2007) Epithelial–mesenchymal and mesenchymal–epithelial

transitions in carcinoma progression. J Cell Physiol 213:374–383.

Hynes NE (2007) Targeting ERBB receptors in cancer. Recent Results Cancer

Res 172:45–57.

JordaM,OlmedaD,VinyalsA,ValeroE,Cubillo E, LlorensA,CanoA, Fabra

A (2005) Upregulation of MMP-9 in MDCK epithelial cell line in response

to expression of the Snail transcription factor. J Cell Sci 118:3371–3385.

Julien S, Puig I, Caretti E, Bonaventure J, Nelles L, Roy Van F, Dargemont

C, Herreros De AG, Bellacosa A, Larue L (2007) Activation of NF-kappaB

by Akt upregulates Snail expression and induces epithelium mesenchyme

transition. Oncogene 26:7445–7456.

Ke Z, Lin H, Fan Z, Cai TQ, Kaplan RA, Ma C, Bower KA, Shi X, Luo J

(2006) MMP-2 mediates ethanol-induced invasion of mammary epithelial

cells over-expressing ErbB2. Int J Cancer 119:8–16.

Kenny PA, Bissell MJ (2007) Targeting TACE-dependent EGFR ligand shed-

ding in breast cancer. J Clin Invest 117:337–345.

Kumar R, Gururaj AE, Barnes CJ (2006) p21-activated kinases in cancer. Nat

Rev Cancer 6:459–471.

Lee MY, Chou CY, Tang MJ, Shen MR (2008) Epithelial-mesenchymal tran-

sition in cervical cancer: correlation with tumor progression, epidermal

growth factor receptor overexpression, and snail up-regulation. Clin Cancer

Res 14:4743–4750.

Ma C, Bower KA, Lin H, Chen G, Huang C, Shi X, Luo J (2005) The role of

epidermal growth factor receptor in ethanol-mediated inhibition of activator

protein-1 transactivation. Biochem Pharmacol 69:1785–1794.

Ma C, Lin H, Leonard SS, Shi X, Ye J, Luo J (2003) Overexpression of ErbB2

enhances ethanol-stimulated intracellular signaling and invasion of human

mammary epithelial and breast cancer cells in vitro. Oncogene 22:5281–

5290.

Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M,

Reinhard F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C,

Yang J, Weinberg RA (2008) The epithelial-mesenchymal transition gener-

ates cells with properties of stem cells. Cell 133:704–715.

Mann JR, Backlund MG, Buchanan FG, Daikoku T, Holla VR, Rosenberg

DW, Dey SK, Dubois RN (2006) Repression of prostaglandin dehydroge-

nase by epidermal growth factor and snail increases prostaglandin E2 and

promotes cancer progression. Cancer Res 66:6649–6656.

Moody SE, Perez D, Pan TC, Sarkisian CJ, Portocarrero CP, Sterner CJ,

Notorfrancesco KL, Cardiff RD, Chodosh LA (2005) The transcriptional

repressor Snail promotes mammary tumor recurrence. Cancer Cell 8:197–

209.

Morrow D, Cullen JP, Cahill PA, Redmond EM (2008) Ethanol stimulates

endothelial cell angiogenic activity via a Notch- and angiopoietin-1-depen-

dent pathway. Cardiovasc Res 79:313–321.

Nagaraja GM, Othman M, Fox BP, Alsaber R, Pellegrino CM, Zeng Y,

Khanna R, Tamburini P, Swaroop A, Kandpal RP (2006) Gene expression

signatures and biomarkers of noninvasive and invasive breast cancer cells:

comprehensive profiles by representational difference analysis, microarrays

and proteomics. Oncogene 25:2328–2338.

Natalwala A, Spychal R, Tselepis C (2008) Epithelial-mesenchymal transition

mediated tumourigenesis in the gastrointestinal tract. World J Gastroenterol

14:3792–3797.

Nieto MA (2002) The snail superfamily of zinc-finger transcription factors.

Nat RevMol Cell Biol 3:155–166.

O’connor PG, Schottenfeld RS (1998) Patients with alcohol problems. N Engl

J Med 338:592–602.

Olmeda D, Jorda M, Peinado H, Fabra A, Cano A (2007) Snail silencing

effectively suppresses tumour growth and invasiveness. Oncogene 26:1862–

1874.

Peinado H, Olmeda D, Cano A (2007) Snail, Zeb and bHLH factors in

tumour progression: an alliance against the epithelial phenotype? Nat Rev

Cancer 7:415–428.

Perez-Mancera PA, Perez-Caro M, Gonzalez-Herrero I, Flores T, Orfao A,

Herreros De AG, Gutierrez-Adan A, Pintado B, Sagrera A, Sanchez-

Martin M, Sanchez-Garcia I (2005) Cancer development induced by graded

expression of Snail in mice. HumMol Genet 14:3449–3461.

Radisky DC, Levy DD, Littlepage LE, Liu H, Nelson CM, Fata JE, Leake

D, Godden EL, Albertson DG, Nieto MA, Werb Z, Bissell MJ (2005)

Rac1b and reactive oxygen species mediate MMP-3-induced EMT and

genomic instability. Nature 436:123–127.

Robson EJ, Khaled WT, Abell K, Watson CJ (2006) Epithelial-to-mesenchy-

mal transition confers resistance to apoptosis in three murine mammary epi-

thelial cell lines. Differentiation 74:254–264.

Roy HK, Gulizia JM, Karolski WJ, Ratashak A, Sorrell MF, Tuma D

(2002) Ethanol promotes intestinal tumorigenesis in the MIN mouse.

Multiple intestinal neoplasia. Cancer Epidemiol Biomarkers Prev 11:

1499–1502.

Roy HK, Iversen P, Hart J, Liu Y, Koetsier JL, Kim Y, Kunte DP, Madugula

M, Backman V, Wali RK (2004) Down-regulation of SNAIL suppresses

MIN mouse tumorigenesis: modulation of apoptosis, proliferation, and

fractal dimension. Mol Cancer Ther 3:1159–1165.

Roy HK, Smyrk TC, Koetsier J, Victor TA, Wali RK (2005) The transcrip-

tional repressor SNAIL is overexpressed in human colon cancer. Dig Dis

Sci 50:42–46.

Schramek H, Feifel E, Marschitz I, Golochtchapova N, Gstraunthaler G,

Montesano R (2003) Loss of active MEK1-ERK1 ⁄ 2 restores epithelial phe-notype and morphogenesis in transdifferentiated MDCK cells. Am J Phys-

iol Cell Physiol 285:C652–C661.

Seitz HK, Stickel F (2007) Molecular mechanisms of alcohol-mediated carci-

nogenesis. Nat Rev Cancer 7:599–612.

Skinner HA, Sheu WJ (1982) Reliability of alcohol use indices. The Lifetime

Drinking History and the MAST. Stud Alcohol 43:1157–1170.

30 FORSYTH ET AL.

Stemmer V, Craene De B, Berx G, Behrens J (2008) Snail promotes Wnt tar-

get gene expression and interacts with beta-catenin. Oncogene 27:5075–

5080.

Thiery JP (2002) Epithelial-mesenchymal transitions in tumour progression.

Nat Rev Cancer 2:442–454.

Thiery JP, Sleeman JP (2006) Complex networks orchestrate epithelial-

mesenchymal transitions. Nat Rev Mol Cell Biol 7:131–142.

Trimboli AJ, Fukino K, Bruin De A, Wei G, Shen L, Tanner SM, Creasap N,

Rosol TJ, Robinson ML, Eng C, Ostrowski MC, Leone G (2008) Direct

evidence for epithelial-mesenchymal transitions in breast cancer. Cancer Res

68:937–945.

Turley EA, Veiseh M, Radisky DC, Bissell MJ (2008) Mechanisms of disease:

epithelial-mesenchymal transition–does cellular plasticity fuel neoplastic

progression? Nat Clin Pract Oncol 5:280–290.

Weinberg RA (2008) Mechanisms of malignant progression. Carcinogenesis

29:1092–1095.

Yang Z, Rayala S, Nguyen D, Vadlamudi RK, Chen S, Kumar R (2005)

Pak1 phosphorylation of snail, a master regulator of epithelial-to-

mesenchyme transition, modulates snail’s subcellular localization and

functions. Cancer Res 65:3179–3184.

Yokoyama K, Kamata N, Fujimoto R, Tsutsumi S, Tomonari M, Taki M,

Hosokawa H, Nagayama M (2003) Increased invasion and matrix metallo-

proteinase-2 expression by Snail-induced mesenchymal transition in squa-

mous cell carcinomas. Int J Oncol 22:891–898.

Zhao XJ, Marrero L, Song K, Oliver P, Chin SY, Simon H, Schurr JR, Zhang

Z, Thoppil D, Lee S, Nelson S, Kolls JK (2003) Acute alcohol inhibits

TNF-alpha processing in human monocytes by inhibiting TNF ⁄TNF-

alpha-converting enzyme interactions in the cell membrane. J Immunol

170:2923–2931.

Zhao XJ, Oliver P, Song K, Schurr J, Zhang Z, Kolls JK (2004) Chronic etha-

nol enhances ectodomain shedding in T cells and monocytes. Alcohol Clin

Exp Res 28:1399–1407.

ALCOHOL STIMULATES SNAIL AND EMT IN CANCER CELLS 31