Agricultural Agricultural Biotechnology Biotechnology Altering Genes in Plants to Altering Genes in Plants to Fight Pests and Improve Nutrition Fight Pests and Improve Nutrition
Dec 26, 2015
Agricultural BiotechnologyAgricultural Biotechnology
Altering Genes in Plants to Altering Genes in Plants to Fight Pests and Improve NutritionFight Pests and Improve Nutrition
Unique Methods for PlantsUnique Methods for Plants Entire plants can be cultivated from Entire plants can be cultivated from
a single non-reproductive cella single non-reproductive cell
Add gene
cell withcell withnew genenew gene
mass of mass of cells cells (callus)(callus)
new plantnew plant
Unique MethodsUnique Methods for Plants for Plants
RhizosecretionRhizosecretion
Transgenic plant Transgenic plant grown in water grown in water
Expression of Expression of gene in root cellsgene in root cells
Secretion of gene Secretion of gene product into product into surrounding surrounding mediummedium
Tools of Agricultural Tools of Agricultural BiotechnologyBiotechnology
Vectors Vectors
Ti plasmidTi plasmid(tumor inducing)(tumor inducing)
From a bacterium that From a bacterium that infects plantsinfects plants
Causes tumors Causes tumors
Used for dicots Used for dicots
VirusesViruses Specific for plant typesSpecific for plant types
Used for monocotsUsed for monocots
Ti PlasmidTi Plasmid
Tumor-inducing plasmid Tumor-inducing plasmid from bacteria that integrates from bacteria that integrates into plant DNAinto plant DNA
• Tumor-inducing genes Tumor-inducing genes removedremoved
• Insertion genes retainedInsertion genes retained
• Foreign genes positioned Foreign genes positioned after bacterial promoterafter bacterial promoter
• Antibiotic resistance gene Antibiotic resistance gene as markeras marker
Clarification PauseClarification Pause
• With a partner, identify differences With a partner, identify differences in biotechnological methods used in biotechnological methods used for plants and animals for plants and animals – items to consideritems to consider
• gene deliverygene delivery• transgenic organismstransgenic organisms• gene expressiongene expression• collection of the gene productcollection of the gene product
Plant ImprovementsPlant Improvements
Resistance Resistance to Peststo Pests
Bt Corn: ProducesBt Corn: Producesits own Pesticideits own Pesticide
Insect Insect pestspests
Gene for Bt toxin inserted into plantsGene for Bt toxin inserted into plants
Bt = Bt = Bacillus thuringiensisBacillus thuringiensisBt toxin = crystals that dissolve Bt toxin = crystals that dissolve connections between cells in insect gutconnections between cells in insect gut
Plant ImprovementsPlant ImprovementsResistance to PestsResistance to Pests
VirusesViruses •Ti plasmid carrying genes for viral Ti plasmid carrying genes for viral capsid proteins into tomato and capsid proteins into tomato and tobacco plants tobacco plants•Mechanism of protection against Mechanism of protection against viruses is unclear viruses is unclear
•Possibilities:Possibilities:
•viral protein blocks replication viral protein blocks replication
•viral proteins bind cellular viral proteins bind cellular receptorsreceptors
Plant ImprovementsPlant Improvements
Resistance to HerbicidesResistance to Herbicides
GlyphosateGlyphosate
(Roundup)(Roundup)
Insert gene for mutant EPSPS Insert gene for mutant EPSPS enzyme that is less sensitive to enzyme that is less sensitive to RoundupRoundup
EPSPS = enzyme needed to EPSPS = enzyme needed to synthesize amino acids essential synthesize amino acids essential for growthfor growth
Use of Ti plasmid to transfer Use of Ti plasmid to transfer genegene
Effects of Treatment with RoundupEffects of Treatment with Roundup
Roundup Ready SoybeansRoundup Ready Soybeans
Traditional SoybeansTraditional Soybeans
Plant ImprovementsPlant ImprovementsImproved Food QualityImproved Food Quality
Improved Improved Handling and Handling and StorageStorage
Flavr-Savr TomatoFlavr-Savr Tomato
Potato that Resists BruisingPotato that Resists Bruising
Flavr-Savr TomatoFlavr-Savr Tomatosoftens more slowly softens more slowly
after ripeningafter ripening
Plant ImprovementsPlant Improvements
Improved Food QualityImproved Food Quality
Flavr- SavrFlavr- Savr
TomatoTomato
•Interference with the production of the enzymeInterference with the production of the enzyme polygalacturonase (polyGal) by antisense polygalacturonase (polyGal) by antisense technology technology
•antisense sequence to polyGal mRNA is antisense sequence to polyGal mRNA is producedproduced
•antisense sequence binds to polyGal mRNA antisense sequence binds to polyGal mRNA and blocks production of the enzymeand blocks production of the enzyme
•Vector also contains antibiotic resistance to Vector also contains antibiotic resistance to kanamycin as marker kanamycin as marker
Antisense TechnologyAntisense TechnologyBlocks the expression of a gene by producing Blocks the expression of a gene by producing a product that combines with mRNA from the genea product that combines with mRNA from the gene
3’-TACGGTCGCCTG-5’3’-TACGGTCGCCTG-5’5’-ATGCCAGCGGAC-3’5’-ATGCCAGCGGAC-3’SenseSense
strandstrand
Original GeneOriginal GeneTemplateTemplate
Antisense construct Antisense construct
5’-ATGCCAGCGGAC-3’5’-ATGCCAGCGGAC-3’3’-TACGGTCGCCTG-5’3’-TACGGTCGCCTG-5’
AUGCCAGCGGACAUGCCAGCGGACmRNAmRNA
UACGGUCGCCUGUACGGUCGCCUG AntisenseAntisenseproductproduct
mRNA cannot be translated mRNA cannot be translated
5’-AUGCCAGCGGAC-3’5’-AUGCCAGCGGAC-3’mRNAmRNA
3’-UACGGUCGCCUG-5’3’-UACGGUCGCCUG-5’ AntisenseAntisenseproductproduct
Promoter Promoter
Plant ImprovementsPlant ImprovementsImproved Food QualityImproved Food Quality
Nutrient Nutrient Enhanced Enhanced FoodsFoods
Rice with beta-carotene and extra Rice with beta-carotene and extra iron iron
Improved Protein CornImproved Protein Corn
Improved Oil CanolaImproved Oil Canola
““Golden” riceGolden” rice
Plant ImprovementsPlant Improvements
Pharmaceutical Production in PlantsPharmaceutical Production in Plants
1.1. Soy and Corn seeds Soy and Corn seeds for production and for production and storage of protein storage of protein productsproducts
CytokinesCytokines
Blood Clotting FactorsBlood Clotting Factors
2.2. Transgenic vegetables Transgenic vegetables as vaccinesas vaccines
Vaccine against Vaccine against travelers diarrhea in travelers diarrhea in potatoespotatoes
3.3. Pharmaceutical Pharmaceutical delivery by delivery by RhizosecretionRhizosecretion
Tested with jellyfish Tested with jellyfish proteinprotein
Plant ImprovementsPlant ImprovementsTextile, paper and wood productsTextile, paper and wood products
1.1. Changes to facilitate Changes to facilitate manufacturingmanufacturing
Gene for biodegradable Gene for biodegradable plastic introduced into cottonplastic introduced into cotton
Bacteria producing blue dyeBacteria producing blue dye
2.2. Introduction of Introduction of herbicide resistance herbicide resistance
Roundup Ready CottonRoundup Ready Cotton
3.3. Resistance to pestsResistance to pests Bt cotton, Bt treesBt cotton, Bt trees
Applying Your KnowledgeApplying Your Knowledge
A.A. Which Which plantplant ha has a gene for an altered amino acid s a gene for an altered amino acid synthesis EPSPS enzymesynthesis EPSPS enzyme? ?
B.B. Which Which plant makes its own pesticideplant makes its own pesticide??
C.C. Which Which plant plant provides beta-caroprovides beta-carotene, a precursor tene, a precursor to Vitamin Ato Vitamin A? ?
1.1. Golden RiceGolden Rice2.2. Improved Oil CanolaImproved Oil Canola3.3. Roundup Ready SoybeansRoundup Ready Soybeans4.4. Bt cornBt corn5.5. Flavr-Savr TomatoFlavr-Savr Tomato
What Are the Concerns?What Are the Concerns?