Adenine, a hairpin ribozyme cofactor - high-pressure and competition studies

Adenine, a hairpin ribozyme cofactor – high-pressure andcompetition studiesMyriam Ztouti1,*, Hussein Kaddour1,*, Francisco Miralles1, Christophe Simian1, Jacques Vergne1,Guy Herve2 and Marie-Christine Maurel1

1 Acides Nucleiques et Biophotonique, FRE 3207 CNRS, Fonctions et Interactions des Acides Nucleiques, UPMC Universite Paris 06,

France

2 Laboratoire Proteines, Biochimie Structurale et Fonctionnelle, FRE 2852 CNRS, UPMC Universite Paris 06, France

An important issue in the problem of the origin of life

is whether or not an RNA world could have been

compatible with extreme primordial conditions. This

scenario of evolution postulates that an ancestral

molecular world is common to all present forms of life;

the functional properties of nucleic acids and proteins

as we see them today, especially catalytic properties,

would have been carried out by ribonucleic acids [1–6].

Catalytic RNAs, or ribozymes, are found nowadays in

the human genome [7], organelles of plants [8] and

lower eukaryotes, amphibians, prokaryotes, bacterio-

phages, and viroids and satellite viruses that infect

plants. A ribozyme also exists in hepatitis delta virus,

a serious human pathogen [9].

Additional ribozymes will certainly be found in the

future, and it is tempting to look for RNA cofactors

such as those found in protein enzymes [10]. Indeed,

RNA could increase its range of functionalities by

incorporating catalytic building blocks such as imidaz-

ole, thiol, and functional amino and carboxylate

groups [11–13]. Another way for RNA to increase its

chemical diversity would be to bind exogenous mole-

cules carrying reactive groups and handle them as

catalytic cofactors. We reported the isolation of new

RNA aptamers able to bind adenine in a novel mode

of purine recognition [14]. Adenine is a probable prebi-

otic analog of histidine. Its catalytic capabilities are

equivalent to those of histidine, because of the

Keywords

adenine; catalysis; hairpin ribozyme; high

pressure; RNA

Correspondence

M.-C. Maurel, Acides Nucleiques et

Biophotonique (ANBioPhy), Universite Pierre

et Marie Curie, Tour 42–(42–43)–5eme etage,

4 place Jussieu, 75252 Paris Cedex 05,

France

Fax: +33 1 44 27 99 16

Tel: +33 1 44 27 40 21

E-mail: [email protected]

*These authors contributed equally to this

work

(Received 28 November 2008, revised 29

January 2009, accepted 25 February 2009)

doi:10.1111/j.1742-4658.2009.06983.x

The RNA world hypothesis assumes that life arose from ancestral RNA

molecules, which stored genetic information and catalyzed chemical reac-

tions. Although RNA catalysis was believed to be restricted to phosphate

chemistry, it is now established that the RNA has much wider catalytic

capacities. In this respect, we devised, in a previous study, two hairpin

ribozymes (adenine-dependent hairpin ribozyme 1 and adenine-dependent

hairpin ribozyme 2) that require adenine as cofactor for their reversible

self-cleavage. We have now used high hydrostatic pressure to investigate

the role of adenine in the catalytic activity of adenine-dependent hairpin

ribozyme 1. High-pressure studies are of interest because they make it pos-

sible to determine the volume changes associated with the reactions, which

in turn reflect the conformational modifications and changes in hydration

involved in the catalytic mechanism. They are also relevant in the context

of piezophilic organisms, as well as in relation to the extreme conditions

that prevailed at the origin of life. Our results indicate that the catalytic

process involves a transition state whose formation is accompanied by a

positive activation volume and release of water molecules. In addition,

competition experiments with adenine analogs strongly suggest that exo-

genous adenine replaces the adenine present at the catalytic site of the

wild-type hairpin ribozyme.

Abbreviation

ADHR1, adenine-dependent hairpin ribozyme 1.

FEBS Journal (2009) ª 2009 The Authors Journal compilation ª 2009 FEBS 1

presence of the imidazole moiety [15]. In this respect,

we produced two adenine-dependent hairpin ribozymes

[adenine-dependent hairpin ribozyme 1 (ADHR1) and

adenine-dependent hairpin ribozyme 2] that require

adenine as a catalytic cofactor for their reversible self-

cleavage [16]. Figure 1 shows the structure of the mod-

ified ADHR1 used here. These hairpin ribozymes use

different catalytic strategies with respect to wild-type

hairpin ribozyme, by using exogenous adenine as a

cofactor for catalysis. These hairpin ribozymes are of

great interest with respect to the primitive RNA world

hypothesis. Adenine is synthesized in significant

amounts in experiments aimed at mimicking the prebi-

otic conditions [17]. It can be considered as a prebiotic

analog of histidine, and could have been used by ribo-

zymes of the RNA world in the same way as present-

day enzymes use histidine.

The hairpin ribozyme is a small RNA molecule that

catalyzes the reversible cleavage of a phosphodiester

bond [18]. The cleavage reaction proceeds via nucleo-

philic attack of a 2¢-OH group on an adjacent phos-

phorus atom, resulting in a 2¢,3¢-cyclic phosphate and

a 5¢-hydroxyl terminus [19]. The catalytic mechanisms

of the hairpin ribozyme are not entirely understood.

Nevertheless, it has been concluded that an important

conformational transition of the molecule is necessary

to allow the formation of the active site [20]. The mini-

mal catalytic form of the hairpin ribozyme is com-

posed of two adjacent helix–loop–helix domains, A

and B (Fig. 1). The hairpin ribozyme can form an

extended conformation (undocked state) or a bent con-

formation (docked state). In the docked state, loops A

and B come into close contact, forming the active site

[21,22]. Most of the nucleotides in loops A and B are

essential for catalysis [23]. Among them, adenine 38

has been identified as a key residue [24–28]. Structural

and mechanistic studies have shown that divalent

cations stabilize the hairpin ribozyme in its docked

conformation, but do not participate directly in cataly-

sis [29,30]. Indeed, hairpin ribozymes remain func-

tional in reactions without divalent cations [29,31],

excluding a catalytic requirement for metal-bound

water or direct metal coordination to ribose or phos-

phate oxygen atoms, and no metal ions have been

found in the active site [25].

In a previous study, the effects of hydrostatic pres-

sure on the catalytic activity of the minimal hairpin

ribozyme were studied [32]. Several factors led us to

use this methodology: First, pressure makes it possible

to determine the thermodynamic constants of the reac-

tion and the volume changes associated with it, allow-

ing evaluation of the conformational modifications

involved in the catalytic mechanism. Pressure revers-

ibly modifies hydrophobic and ionic interactions, thus

altering the solvation of the macromolecules. As a con-

sequence, pressure modifies the equilibrium constant of

a reaction if it is accompanied by a significant volume

change (DV). It can also modify the kinetics of reac-

tions that involve a significant activation volume

(DV „ ). Therefore, DV and DV „ can be directly esti-

mated by analyzing the variation of the reaction equi-

librium and rate constants as a function of pressure.

Second, the existence of contemporary life in extreme

conditions, such as the volcanic deep-sea vents, provid-

ing habitats for living cellular and viral species,

encouraged us to focus on the activity and persistence

of RNA under extreme conditions of hydrostatic

pressure, osmotic pressure, and temperature [32,33].

Fig. 1. Wild-type and adenine-dependent hairpin ribozyme struc-

tures. (A) Minimal wild-type self-cleaving hairpin ribozyme. (B)

ADHR1. Both ribozymes contain four helices and two loops. The

cleavage site in each hairpin ribozyme is indicated by an arrow.

Nucleotides differing between the two hairpin ribozymes are indi-

cated by black dots. 3¢-Extensions and 5¢-extensions added for

hybridization with replication primers are shown in light type.

Adenine-dependent ribozyme under pressure M. Ztouti et al.

2 FEBS Journal (2009) ª 2009 The Authors Journal compilation ª 2009 FEBS

Finally, the study of RNA under high hydrostatic

pressure could help in the evaluation of the relevance

of the RNA world hypothesis, in particular in the con-

text of the extreme conditions of early life. In this

regard, it is now proposed that life could have origi-

nated around the deep-sea vents [34], although this is

still a matter of controversy [35–37]. The high pressure

in these environments could have enhanced some prim-

itive reactions whose DV and DV „ would have been

unfavorable. Compensatory effects between tempera-

ture and pressure could have facilitated adaptation to

these environments. The rich chemistry, temperature

and high pressure prevailing around the deep-sea vents

offer a plausible environment for the emergence of life

[35].

High hydrostatic pressures (up to 200 MPa) were

previously applied to the hairpin ribozyme, with the

knowledge that the covalent bonds in nucleic acids are

stable up to at least 1200 MPa, and are therefore not

affected. The results obtained from experiments using

hydrostatic and osmotic pressure showed that the cata-

lytic process involves a transition state whose forma-

tion is accompanied by a positive DV „ of

34 ± 5 mLÆmol)1, associated with a release of 78 ± 4

water molecules per RNA molecule [32]. These results

agree with the conclusion that the hairpin ribozyme

must undergo an important conformational change

that brings loops A and B into close contact.

In the present work, and in order to obtain more

information on the mechanism by which adenine

restores the catalytic activity of ADHR1, we examined

the influence of hydrostatic pressure (up to 150 MPa)

on this hairpin ribozyme (Fig. 1B). Our results indicate

that, as in the case of the wild-type hairpin ribozyme,

the catalytic process involves a transition state whose

formation is accompanied by an apparent positive

DV „ and a release of water molecules. Unexpectedly,

this apparent DV „ is not significantly reduced when

ADHR1 is preincubated in the presence of Mg2+. In

addition, competition experiments strongly suggest that

adenine binds to ADHR1 at the site where the adenine

of the wild-type ribozyme is present in the docked

conformation.

Results

Self-cleavage activity of ADHR1 requires both

adenine and Mg2+

ADHR1 was obtained using the in vitro systematic

evolution of ligands by exponential enrichment proce-

dure, as described previously and summarized in

Experimental procedures. Its self-cleavage activity is

strictly dependent on adenine. However, its catalytic

activity also requires Mg2+, as does that of the wild-

type hairpin ribozyme. The respective roles of adenine

and Mg2+ remain to be elucidated. Figure 2 shows

that a 10 min preincubation of ADHR1 with either

adenine or MgCl2 before the addition of the comple-

mentary cofactor to the reaction mixture had no signif-

icant effect on the kinetics of the self-cleavage

reaction, although a very small increase in the reaction

rate was observed when the two cofactors were added

together. This indicates that both adenine and Mg2+

must be present for the reaction to occur, and that the

order of addition of the two cofactors does not signifi-

cantly influence the reaction rate.

Lack of influence of ADHR1 concentration on the

rate of the ADHR1 cleavage reaction

Before analyzing the effects of pressure on the self-

cleavage reaction of ADHR1, it was verified that the

kinetics of this reaction are independent of hairpin

ribozyme concentration, as expected from a unimo-

lecular intramolecular reaction without trans-reaction

between two hairpin ribozyme molecules. For this

purpose, the kinetics of the self-cleavage reaction

0

10

20

30

40

50

60

70

80

0 50 100 150 200

Cle

avag

e (%

)

Time (min)

Fig. 2. The self-cleavage kinetics of ADHR1 are independent of the

order of addition of the cofactors adenine and Mg2+. The kinetics

of self-cleavage of ADHR1 were analyzed after 10 min of preincu-

bation with either adenine (d) or MgCl2 (h) before starting the

reaction by adding the complementary cofactor. These kinetics are

not significantly different from those obtained when the two

cofactors are added simultaneously (e). The curves were obtained

by fitting the results to the expected exponential kinetics

(Experimental procedures).

M. Ztouti et al. Adenine-dependent ribozyme under pressure


were determined at atmospheric pressure with hairpin

ribozyme concentrations from 0.5 to 1.5 lm. The

results obtained (Fig. 3) indicated that the cleavage

rate of ADHR1 was indeed independent of its con-

centration over the range analyzed, as expected for

an exponential equilibration. The following experi-

ments were performed using 0.5 lm hairpin

ribozyme.

Effects of hydrostatic pressure on the rate of the

ADHR1 self-cleavage reaction

To determine whether the self-cleavage activity of

ADHR1 is altered by pressure, as is the case for the

wild-type hairpin ribozyme [32], the amounts of

ADHR1 cleaved after 1 h of incubation in the pres-

ence of 6 mm Mg2+ and 6 mm adenine at various

pressures up to 150 MPa were determined. Figure 4

shows that the amounts decreased regularly, indicating

that pressure had an important negative effect on the

rate of the reaction. This effect could result from a

modification of the catalytic constant of the reaction,

or of its equilibrium constant, or both. To distinguish

between these possibilities, the kinetics of the reaction

were followed at pressures ranging from 0.1 to

200 MPa over 6 h. The percentages of cleavage were

determined (see Experimental procedures), and each

curve was fitted to an exponential so as to extract the

values of the rate constant and of the apparent equilib-

rium. However, it is well established that Mg2+

induces the docking of loops A and B for the struc-

tural organization of the catalytic site, and in the case

of the wild-type hairpin ribozyme, it was hypothesized

that the apparent DV „ measured corresponds to both

the volume change associated with the docking process

and the strict DV „ of activation related to the forma-

tion of the transition state. Upon addition of Mg2+

alone, ADHR1 might condense into the closed confor-

mation, even in the absence of adenine, which is then

required for the reaction to occur. To answer this

question, two different sets of experiments were con-

ducted. In the first, ADHR1 was preincubated for

10 min with MgCl2 before addition of adenine and

application of pressure. In the second, ADHR1 was

preincubated with adenine for 10 min before addition

of MgCl2 and application of pressure. The results

obtained are shown in Figs 5 and 6.

The fit of the kinetic data to the exponential equa-

tion (Figs 5A and 6A) made it possible to estimate the

rate (kobs) at each pressure analyzed. This rate con-

stant clearly decreased with increasing hydrostatic

pressure, and the logarithm of this constant was then

plotted as a function of pressure. For both sets of

experiments, a linear decrease of the logarithm of the

kobs with increasing pressure was observed (Figs 5B

0

10

20

30

40

50

60

70

80

0 50 100 150 200 250 300 350 400

Cle

avag

e (%

)

Time (min)

Fig. 3. Effect of the concentration of ADHR1 on the kinetics of the

self-cleavage reaction. Kinetics of the ADHR1 self-cleavage reaction

at atmospheric pressure and ribozyme concentrations of: d,

0.5 lM; +, 1 lM; e, 1.5 lM.

0

5

10

15

20

25

30

35

0 25 50 75 100 125 150

Cle

avag

e (%

)

Pressure (MPa)

Fig. 4. Effect of hydrostatic pressure on the self-cleavage activity.

The fraction of cleaved ADHR1 after 1 h of incubation under

increasing pressure (up to 150 MPa) is shown as function of the

pressure applied. ADHR1 (0.5 lM) was incubated in the presence

of 6 mM Mg2+ and 6 mM adenine, as described in Experimental

procedures.



and 6B). Such a variation is characteristic of reactions

involving a positive apparent DV „ that can be calcu-

lated from the slope of the graphs. This gives activa-

tion volumes of 26 ± 1.7 mLÆmol)1 for the first set of

experiments (ADHR1 preincubated with MgCl2) and

23 ± 2 mLÆmol)1 for the second set of experiments

(ADHR1 preincubated with adenine). These values

were very close to and slightly lower than that

obtained in the case of the wild-type hairpin ribozyme

(34 ± 5 mLÆmol)1).

The values of the equilibrium constant Keq provided

by the fit of the experimental data to an exponential

process also showed a linear decrease in the logarithm

of Keq with increasing pressure (Figs 5C and 6C).

From the slope of these graphs, DV values of

16 ± 1.8 mLÆmol)1 and 14 ± 1 mLÆmol)1 were calcu-

lated for the first and second set of experiments,

respectively. These values were not significantly differ-

ent from that obtained in the case of the wild-type

hairpin ribozyme (17 ± 4.5 mLÆmol)1).

Reversibility of the effects of hydrostatic pressure

The decrease in the equilibrium constant reported

above could result from some irreversible alterations

of the RNA molecule. To check this possibility, we

investigated the reversibility of the decrease of hairpin

ribozyme activity observed at 150 MPa. The reaction

was followed at this pressure for 3 h, the reaction mix-

ture was then instantly brought back to atmospheric

pressure, and the reaction was allowed to proceed for

a further 3 h. The percentage of cleaved hairpin ribo-

zyme was then plotted as a function of time. Figure 7

shows that, as soon as the reaction mixture was

returned to atmospheric pressure, the reaction reached

the rate observed at atmospheric pressure. Thus, the

negative effects of pressures up to 150 MPa on the

hairpin ribozyme activity were fully reversible. How-

ever, the reaction rate appeared to be slightly higher

than that of the control at atmospheric pressure, sug-

gesting that preincubation at elevated pressure had a

small favorable effect on the rate of the reaction. In

0

10

20

30

40

50

60

70

80

0 50 100 150 200 250 300 350 400

–6.5

–6

–5.5

–5

–4.5

0 20 40 60 80 100 120 140 160

ΔV# = 26 ± 1 mL·mol–1

–2

–1.5

–1

–0.5

0

0 20 40 60 80 100 120 140 160

ΔV = 16 ± 1 mL·mol–1

Time (min)

Pressure (MPa)

Pressure (MPa)

Cle

avag

e (%

)In

kob

sIn

Keq

A

B

C

Fig. 5. Cleavage kinetics at various hydrostatic pressures of

ADHR1 preincubated with MgCl2. (A) Cleavage kinetics are shown

for the reaction conducted at atmospheric pressure (d), 25 MPa

(h), 50 MPa (e), 75 MPa (·), 100 MPa (+), and 125 MPa (D). In

these experiments, ADHR1 was brought to the indicated pressures

after 10 min of preincubation with Mg2+, followed by the addition

of adenine. (B) Logarithm of the observed cleavage rate (kobs) as a

function of pressure. (C) Logarithm of the calculated equilibrium

constant (Keq) as a function of pressure. Keq was obtained from the

exponential fit of the results (Experimental procedures) and corre-

sponds to the cleaved ⁄ uncleaved RNA concentration ratio.



any case, the negative effects of high pressures (up to

150 MPa) on the hairpin ribozyme activity were fully

reversible.

Change in equilibrium upon pressure variation

The kinetics of the self-cleavage reaction under pres-

sure reported above show a decrease of the apparent

equilibrium constant of this reaction, corresponding to

a positive DV. This variation of the apparent equilib-

rium constant could result either from inactivation of

the hairpin ribozyme under pressure (something that is

unlikely on the basis of the results presented in the

preceding section) or from re-equilibration of the reac-

tion on the basis of the DV, the pressure increasing the

rate of the ligation reaction. To test these possibilities,

the cleavage reaction was followed at atmospheric

pressure for 3 h, the pressure was then raised to

0

10

20

30

40

50

60

70

80

0 50 100 150 200 250 300 350 400

–6.5

–6

–5.5

–5

–4.5

0 20 40 60 80 100 120 140 160

–2

–1.5

–1

–0.5

0

0 20 40 60 80 100 120 140 160

Time (min)

Pressure (MPa)

Cle

avag

e (%

)In

kob

sIn

Keq

ΔV≠ = 23 ± 2 mL·mol–1

ΔV = 14 ± 1mL·mol–1

Pressure (MPa)

A

B

C

Fig. 6. Cleavage kinetics at various hydrostatic pressures of

ADHR1 preincubated with adenine. (A) Cleavage kinetics are shown

for the reaction conducted at atmospheric pressure (d), 25 MPa

(h), 50 MPa (e), 75 MPa (·), 100 MPa (+), 125 MPa (D), and

150 MPa (r). In these experiments, ADHR1 was brought to the

indicated pressures after 10 min of preincubation with adenine, fol-

lowed by the addition of Mg2+. (B) Logarithm of the observed

cleavage rate (kobs) as a function of pressure. (C) Logarithm of the

calculated equilibrium constant (Keq) as a function of pressure. Keq

was obtained from the exponential fit of the results (Experimental

procedures), and corresponds to the cleaved ⁄ uncleaved RNA

concentration ratio.

0

10

20

30

40

50

60

70

80

0 50 100 150 200 250 300 350 400

Cle

avag

e (%

)

Time (min)

Fig. 7. Reversibility of the effects of hydrostatic pressure on the

catalytic activity of ADHR1. Cleavage kinetics are shown for the

reaction at atmospheric pressure (d) and at 150 MPa (h). After 3 h

of reaction under pressure, the reaction mixture was quickly

brought to atmospheric pressure, and the reaction was followed for

a further 3 h (e).



150 MPa, and the reaction was followed for another

3 h (data not shown). A decrease in the equilibrium

was observed, indicating that the ligation reaction pro-

ceeded under pressure for the system to reach a new

value of the equilibrium constant dictated by the DVof the reaction. However, the low extent of this pro-

cess (about 20%), the existence of unexplained small

oscillations upon application of the pressure and the

rapid hydrolysis of the cyclic phosphate at the 2¢–3¢-end of the cleaved hairpin ribozyme [38] precluded

study of the DV values associated with the ligation

reaction.

Influence of hydrostatic pressure on the Mg2+

dependence of the ADHR1 self-cleavage reaction

The catalytic activity of ADHR1 is Mg2+-dependent.

Thus, the decrease in the rate constant of the self-

cleavage reaction under pressure could result from a

conformational change affecting the affinity of the

hairpin ribozyme for Mg2+. To test this possibility,

the Mg2+ saturation curves of ADHR1 were deter-

mined at atmospheric pressure (Fig. 8A) and at

75 MPa (Fig. 8B), in the presence of Mg2+ concentra-

tions ranging from 1 to 20 mm. It appears that these

saturation curves are sigmoidal-like in the case of the

wild-type hairpin ribozyme (Fig. 8C). Consequently,

the curves were fitted to the Hill equation. This yielded

Mg2+ half-saturation concentrations of 10.7 ± 2

and 12.6 ± 2 mm, respectively, for the self-cleavage

reaction at atmospheric pressure and at 75 MPa. The

corresponding Hill coefficients were 1.8 ± 0.3 and

1.9 ± 0.4 respectively. These results indicate that the

binding of the Mg2+ was not significantly altered by

pressure, either qualitatively or quantitatively.

Influence of hydrostatic pressure on the adenine

dependence of the ADHR1 self-cleavage reaction

As described above, ADHR1 was selected on the basis

of the strict dependence of its self-cleavage activity on

0

10

20

30

40

50

60

70

80

0 20 40 60 80 100

0

10

20

30

40

50

60

70

80

0 20 40 60 80 100

Atmospheric pressure

75 MPa pressure

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0 10 15 20 25

Vi (

pico

mol

e·m

in–1

)

Time (min)

Cle

avag

e (%

)

Time (min)

Cle

avag

e (%

)

Mgcl2 (mM)5

A

B

C

Fig. 8. Influence of Mg2+ concentration on the cleavage kinetics of

ADHR1 under pressure. (A, B) The cleavage kinetics of ADHR1

were analyzed in the presence of increasing concentrations of

MgCl2 at atmospheric pressure (A) and at 75 MPa (B) in the pres-

ence of 6 mM adenine. The MgCl2 concentrations were: 3 mM (·),

6 mM (h), 9 mM (s), 12 mM (n), 16 mM (+), and 20 mM (r). (C)

The graphically determined initial rates of these reactions [atmo-

spheric pressure (d) and 75 MPa (h)] were plotted as a function of

MgCl2 concentration. The data were fitted to the Hill equation to

determine the Mg2+ half-saturation concentration and to evaluate

the cooperativity of the binding of Mg2+ to ADHR1.



adenine. Therefore, the decrease in the reaction rate

observed under pressure could result from a decrease

in the affinity of ADHR1 for adenine. To examine

this possibility, the adenine saturation curve was

determined at atmospheric pressure and at 75 MPa.

Figure 9A shows the variation of the reaction rate as a

function of adenine concentration under these two

conditions. The double reciprocal plots of these results

(Fig. 9B) show that, although the reaction rate was

nearly sixfold lower at 75 MPa than at atmospheric

pressure, there was no significant difference in the

affinity of the hairpin ribozyme for adenine between

these two experimental conditions (3.8 ± 1 and

5.6 ± 2 mm respectively). Similar results were

obtained when these experiments were conducted at

higher pressures (data not shown). Thus, the decrease

in the rate constant observed under pressure did not

result from a decrease in the affinity of the hairpin

ribozyme for adenine.

Influence of osmotic pressure on the ADHR1

self-cleavage reaction

The positive apparent activation volume detected in

the hydrostatic pressure experiments indicates that the

self-cleavage reaction involves a compaction, which

should be accompanied by a decrease in the solvation

of the molecule. To investigate this prediction, the

effect of osmotic pressure on the kinetics of the self-

cleavage reaction was examined. The ADHR1 cleavage

rate was measured in the presence of increasing con-

centrations of poly(ethylene glycol) 400, the agent used

to increase the osmotic pressure in the solvent phase of

the incubation mixture [39]. The results presented in

Fig. 10A show that increasing concentrations of

poly(ethylene glycol) 400 up to 10% increased the

ADHR1 cleavage rate, confirming the release of water

molecules during the reaction. From the variation of

the reaction rate as a function of osmotic pressure

(Fig. 10B), it can be calculated [39] that the formation

of the transition state (probably including the domain

closure) involved the release of 100 ± 18 water mole-

cules per hairpin ribozyme molecule.

Competition experiments

Previous work showed that the specificity of adenine in

restoring the catalytic activity of ADHR1 is rather

loose [16], and that some adenine analogs, such as

6-methyladenine, purine, and even imidazole, can also

confer activity to this modified hairpin ribozyme,

although with slightly lower efficiency. Similarly, it

was shown that 2,6-diaminopurine, isocytosine and

3-methyladenine could restore the activity of an inac-

tive form of the hairpin ribozyme in which the essen-

tial adenine 38 was deleted or replaced by an abasic

analog [27]. It was observed that 2,6-diaminopurine

was significantly more efficient than adenine in restor-

ing the catalytic activity. In an attempt to obtain addi-

tional information about the binding of adenine and

some of its analogs to ADHR1, competition experi-

ments were performed. ADHR1 was incubated in the

presence of 6 mm Mg2+ and in the presence of adenine

or one of its analogs, either alone or in combination in

I/V

i (pi

com

ole·

min

–1)

A

B

Fig. 9. Influence of adenine concentration on the cleavage kinetics

of ADHR1 under pressure. The effect of adenine concentrations on

the rate of the self-cleavage reaction of ADHR1 was analyzed at

atmospheric pressure (d) and under a pressure of 75 MPa (h) in

the presence of 6 mM Mg2+. (A) The rates are shown here as a

function of adenine concentration. (B) The Lineweaver–Burke plot

was used to estimate the apparent Kd values of adenine in the

reaction at atmospheric pressure and at 75 MPa. These are,

respectively. 3.8 ± 1 and 5.6 ± 2 mM.



various proportions. It appeared that isocytosine did

not reactivate ADHR1 (Fig. 11A), although it effi-

ciently inhibited the cleavage reaction promoted by

adenine. The Dixon plot obtained with the use of three

adenine concentrations yielded a value of 38 ± 5 mm

for the dissociation constant (Ki) of isocytosine

(Fig. 11B). 3-Methyladenine did not either restore the

activity of ADHR1 (Fig. 11C), but it also inhibited the

adenine-dependent reaction, with a Ki of 5 ± 2 mm

(Fig. 11D). The Dixon plots also show the competitive

nature of the inhibition by these two nucleobases

(Fig. 11B,D). Regarding 2,6-diaminopurine, Fig. 12

shows that this adenine analog was about 30% more

efficient than adenine in restoring the activity of

ADHR1, and that the reactivation by these two com-

pounds was not additive. When these two activators

are added together in various proportions, the rate of

the reaction lies between those observed in the pres-

ence of either adenine or 2,6-diaminopurine alone, as

predicted for a mechanism in which two activators

bind competitively at the same site [40]. Taken

together, these results indicate that adenine and its

analogs bind competitively to the same site(s). The lin-

earity of the Dixon plots suggests, in addition, that

this site is unique.

Discussion

ADHR1 was obtained by a selection procedure aimed

at identifying hairpin ribozymes whose catalytic activ-

ity depends on exogenous adenine. In the present

work, hydrostatic and osmotic pressures were used to

analyze the catalytic mechanism of ADHR1 and com-

pare it with that of the minimal wild-type hairpin ribo-

zyme from which it was produced, in an attempt to

obtain some information about the mechanism of reac-

tivation of this modified hairpin ribozyme by adenine.

This methodology allowed us previously to show that

the reaction of the wild-type hairpin ribozyme involves

an apparent DV „ of 34 ± 5 mLÆmol)1, which was

interpreted as resulting from both the docking of

loops A and B and the formation of the transition

state [32]. Consistent with this interpretation, osmotic

pressure experiments showed that this process is

accompanied by the release of 78 ± 4 water molecules

per mole of RNA.

Apparent volume of activation (DV „ )

To investigate the self-cleavage mechanism of ADHR1,

two sets of experiments were conducted under hydro-

static pressure. In the first set, ADHR1 was preincu-

bated with MgCl2 before addition of adenine and the

application of pressure. In the second set, ADHR1

was preincubated with adenine, before addition of

MgCl2 and the application of pressure. In both cases,

the analysis of the kinetics of the self-cleavage reaction

indicates that, as in the case of the wild-type hairpin

ribozyme, the reaction involves an apparent positive

DV „ . Hence, the order of addition of adenine and

MgCl2 has no apparent effect on the docking of the

modified hairpin ribozyme. Indeed, the DV „ values

0

5

10

15

20

25

30

35

40

0 10 15 20 25 30 35 40

1.5 × 10–14

2 × 10–14

2.5 × 10–14

3 × 10–14

3.5 × 10–14

4 × 10–14

1 3 5 7 9

KT

ln (

kII/k

o ) (d

yne.

cm)

Slope = ΔVw

Time (min)

Cle

avag

e (%

)

Posm (× 106) (dynes·cm–2)

5

2 4 6 8

A

B

Fig. 10. Effect of osmotic pressure on the self-cleavage reaction.

(A) Cleavage kinetics are shown for increasing concentrations of

poly(ethylene glycol) 400 (v ⁄ v): 0% (d), 2.5% (h), 5% (e), 7.5%

(·), and 10% (+). (B) The number of water molecules released dur-

ing the self-cleavage reaction was calculated from the slope of the

variation of KT ln (kP ⁄ kO) as a function of osmotic pressure. kP and

kO are, respectively, the observed rate constants of the reaction

under osmotic stress and standard conditions, K the Boltzmann

constant, and T the absolute temperature [39].



calculated from these kinetic experiments are very

similar (DV „ = 26 ± 2 mLÆmol)1 and DV „ = 23 ±

2 mLÆmol)1 for the first and second sets of experi-

ments, respectively).

The fact that preincubation of ADHR1 with Mg2+

does not decrease the apparent DV „ of the reaction

was rather unexpected. As, in the case of the wild-type

hairpin ribozyme, this DV „ was interpreted as corre-

sponding to both the docking process and the forma-

tion of the transition state, one could expect that

preincubation of ADHR1 with Mg2+ would have pro-

moted docking and that, consequently, the reaction

then initiated by the addition of adenine would have

presented a significantly lower DV „ . Such is not the

case, and several explanations can be proposed. In

spite of its rather high value, the DV „ might corre-

spond only to the formation of the transition state of

the cleavage reaction. This would imply that, in the

experiments performed with the wild-type ribozyme

and ADHR1, this domain closure would be completed

during the 1 min lag-time between the addition of

MgCl2 and the application of pressure. Alternatively,

the docking process in ADHR1 could require the

0

2

4

6

8

10

–60 –40 –20 20 40 600

5

10

15

20

25

30

35

40

0 10 20 30 40 50 60 70

0

5

10

15

20

25

30

0

5

10

15

20

25

30

35

40

0

–60 –40 –20 20 40 6000 10 20 30 40 50 60 70

Time (min)

Time (min)

Isocytosine (mM)

3-methyladenine (mM)

Cle

avag

e (%

)C

leav

age

(%)

I/V

i (pi

com

ole·

min

)–1

I/V

i (pi

com

ole·

min

)–1

A B

C D Fig. 11. Competition experiments with the

adenine analogs isocytosine and 3-methylad-

enine. (A) The kinetics of the self-cleavage

of ADHR1 were determined in the presence

of increasing concentrations of isocytosine

[0 mM (d), 1 mM (s), 5 mM (e), 20 mM (·),

50 mM (h)], in the presence of 6 mM ade-

nine. A control experiment was performed

in the presence of isocytosine alone ( ). (C)

Identical experiments for 3-methyladenine,

with control in the presence of 6 mM

3-methyladenine alone ( ). (B, D) Dixon

plots of the competition experiments

between adenine and isocytosine or

3-methyladenine: d, 3 mM adenine; r,

6 mM adenine; s, 10 mM adenine.

0

10

20

30

40

50

60

0 2010 30 40 50 60 70Time (min)

Cle

avag

e (%

)

Fig. 12. Competition experiments between adenine and 2,6-diamin-

opurine. The kinetics of self-cleavage of ADHR1 were determined in

the presence of increasing concentrations of 2,6-diaminopurine:

0 mM (d), 1 mM (s), and 5 mM (e). The adenine concentration was

kept at 6 mM. The kinetics of self-cleavage of ADHR1 were also

determined at 6 mM 2,6-diaminopurine in the absence of adenine ( ).



simultaneous presence of both Mg2+ and adenine. In

this respect, it is interesting to note that some indica-

tions exist that the requirement for Mg2+ lies within

two ranges of concentration, the micromolar and mil-

imolar ranges [30].The need for both Mg2+ and ade-

nine for the docking to occur might require only one

of these Mg2+-binding processes. The DV „ values

obtained in both sets of experiments are also close to

that obtained in the case of the wild-type hairpin ribo-

zyme (DV „ = 34 ± 5 mLÆmol)1). This suggests that

there are no major differences in the amplitude of the

molecular rearrangements required for the activation

of ADHR1 as compared with the wild-type hairpin

ribozyme. However, on the basis of the osmotic pres-

sure experiments, about 100 ± 18 water molecules are

expelled during the ADHR1 self-cleavage reaction, a

value that is slightly higher than the 78 ± 4 water

molecules calculated in the case of the self-cleavage

reaction of the wild-type hairpin ribozyme. The extrap-

olation of the progress curves to equilibrium, calcu-

lated from the fit of these curves to an exponential

process, suggests that cleavage is also accompanied, in

both sets of experiments, by a positive DV. Indeed, DVvalues of 16 ± 2 and 14 ± 1 mLÆmol)1 were obtained

for the first and second experimental conditions,

respectively. This suggests that at the end of the reac-

tion, the hairpin ribozyme remains significantly less

solvated than the uncleaved molecule. A similar result

(DV = 17 ± 4 mLÆmol)1) was obtained for the wild-

type hairpin ribozyme. Therefore, in both ADHR1

and wild-type hairpin ribozymes, once self-cleavage is

accomplished, the molecule remains slightly less

hydrated than the uncleaved hairpin ribozyme [32].

The rate constant of self-cleavage of the hairpin ribo-

zyme subjected to high hydrostatic pressures is com-

pletely recovered upon returning to atmospheric

pressure, indicating that the effects of pressure are

fully reversible, as was previously observed with the

wild-type hairpin ribozyme. Thus, hydrostatic pres-

sures up to 200 MPa do not damage the hairpin ribo-

zyme. This observation is consistent with other studies

showing that nucleic acids, and in particular RNA,

can withstand very high pressures [41–43]. This prop-

erty has been attributed to the base-paired double-heli-

cal topology of the molecule [44]. The decrease in the

rate constant of the self-cleavage reaction could have

resulted from a pressure-induced conformational

change that would affect binding of Mg2+ or adenine.

However, our results concerning the dependence of

self-cleavage of ADHR1 under hydrostatic pressure on

the Mg2+ and adenine concentrations clearly indicate

that neither the binding of Mg2+ nor that of adenine

is altered by pressure.

Exogenous adenine requirement

As mentioned above, the active site of the hairpin

ribozyme is formed by the interaction of loops A and

B. Three active site nucleobases located near the reac-

tive phosphodiester, G8, A9, and A38, appear to be

directly involved in the catalytic chemistry. In particu-

lar, structural analysis has shown that A38 contri-

butes to the architecture of the active site through an

array of stacking and hydrogen-bonding interactions

[25,26,45,46]. Functional groups of A38 and part of

the G+1 binding pocket form a tertiary interaction

that is responsible for aligning the reactive phosphodi-

ester in the active site. A38 stacks above the essential

G+1, and N7 of G+1 accepts a hydrogen bond from

the 2¢-OH of A38. N7 of A38 also forms a hydrogen

bond with the (C6) NH2 of A24. Each of these inter-

actions is likely to contribute to catalysis by fixing

the reactive phosphodiester in the geometry needed

for in-line attack. The proximity of the functional

groups of A38 to the reactive phosphodiester also

makes this nucleobase a good candidate for participa-

tion in the catalysis. Recent studies have focused on

the role of A38 in the formation of the reaction site.

Abasic substitution of A38 strongly reduces cleavage

and ligation activity [27]. In addition, exogenous nu-

cleobases such isocytosine, 3-methyladenine and 2,6-

diaminopurine, which share the amidine group of ade-

nine, restore the activity to abasic ribozyme variants

lacking A38. Detailed analysis of the pH dependence

of hairpin ribozymes variants with covalent substitu-

tions indicates that the optimal cleavage and ligation

reactions depend on the protonation state of A38

[27]. Moreover, a recent study has analyzed the crys-

tallographic structure of several hairpin ribozyme

variants at A38 position [47]. The structural effects of

the replacement of A38 by 2,6-diaminopurine, 2-ami-

nopurine, cytosine and guanine were analyzed. For

each variant, two substrate modifications were used

to mimic the precatalytic state and the conformation

of a reaction intermediate. The results revealed the

importance of the N1 and N6 groups of A38 in the

establishment of proper electrostatic interactions at

the catalytic site. The precatalytic structures of the

substitutions impairing the catalytic activity of the

hairpin ribozyme (AP38, Cyt38, and G38) showed the

greatest deviation at the scissile phosphate bond,

owing to differences in hydrogen bonding with vari-

ant functional groups (A38, DAP38). In addition, the

structures of the reaction intermediates of the non-

functional substitution were associated with non-

native conformations of the local fold (Gua38), as

well as syn to anti-base alterations for Cyt38 and



Gua38. In such cases, the imino moiety faced away

from the O5¢ leaving group.

Interestingly, in ADHR1, the nucleotides involved in

the formation of the active site A10, G8 and A9 are

conserved, but A38 has been replaced by G38, which

lacks the amine group. Moreover, previous studies had

shown that, in addition to adenine, some adenine ana-

logs could restore the catalytic activity of ADHR1,

showing that the specificity of adenine in reactivating

ADHR1 is rather loose [16]. The competition experi-

ments reported here show that, among the adenine

analogs tested, some can rescue the catalytic activity of

ADHR1, as does adenine, whereas some are only com-

petitive inhibitors of adenine. It appears that 2,6-diam-

inopurine is more efficient than adenine at restoring

the activity of ADHR1. The behavior of all these

nucleobases shows a general pattern of competition for

their binding with low affinity (all in the millimolar

range) to the same site(s), whether or not they reacti-

vate ADHR1. The linearity of the Dixon plots suggests

that this site is unique. Similarly, it has been shown

that some inactive forms of the hairpin ribozyme in

which A38 was either deleted or replaced by abasic

nucleotides can be reactivated by adenine analogs such

as isocytosine, 3-methyladenine and 2,6-diaminopurine

when these analogs are either added to the cleavage

incubation medium or covalently incorporated in the

modified hairpin ribozyme in place of A38 [27]. Taken

together, these results suggest that the site at which all

these nucleobases bind competitively is the site where

A38 is normally present in the structure of the docked

conformation of the hairpin ribozyme, either restoring

activity or inhibiting this activity restored by adenine.

In this regard, it is interesting to note that externally

added adenine has no influence on the catalytic activity

of the wild-type hairpin ribozyme (unpublished result

from this laboratory). The results reported here might

be of significance regarding the adenine dependence of

riboswitches [10].

In the experiments reported here, 2,6-diaminopurine

appeared to be more efficient than adenine in restoring

the activity of ADHR1. In this regard, it is interesting

to note that the same difference was observed when

2,6-diaminopurine or adenine were covalently inserted

in position 38 in the hairpin ribozyme [27], suggesting

that the modes of action of these two nucleobases are

similar, whether they are inserted in the structure of

the hairpin ribozyme or externally added.

A recent study by Nam et al. [48] has highlighted

the importance of electrostatic interactions in the cata-

lytic site of the hairpin ribozyme, suggesting that rate

enhancement can be realized through nonspecific

electrostatic interactions in the solvated hairpin ribo-

zyme active site. The authors concluded that ‘in the

absence of a protonated A38 the ribozyme can exploit

an alternative reaction path that involves specific

hydrogen bonding interactions with active site nucleo-

bases to achieve catalysis’. In our case, this could

involve the externally added adenine or 2,6-diaminopu-

rine and, possibly, water molecules [49].

These properties and the plasticity of these small

RNA molecules, especially at the level of their

catalytic sites, might be of significance regarding the

conditions that prevailed in the supposed ‘RNA world’

or in an early stage of the development of life, when

small RNA would have played a major role. Popula-

tions of small RNA could have interacted randomly

with small metabolites of all kinds (including adenine

and analogs), although with low specificity and poor

affinity, but some of these transient complexes could

have acquired feeble catalytic properties. Strict specific-

ity and high affinity most probably then emerged pro-

gressively during evolution in the progressive transition

from chemical to biological catalysis.

Experimental procedures

Materials

DNA primers were provided by Proligo (Evry, France).

Taq DNA polymerase and PCR buffer were obtained from

Invitrogen (Carlsbad, CA, USA), and dNTPs from Pro-

mega (Madison, WI, USA). T7 RNA polymerase, rNTPs

and transcription buffer were obtained from Fermentas

(St Leon-Rot, Germany).

RNA preparation

The sequence of primer P1 (promoter primer) is 5¢-TAATA

CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and

that of primer P2 (reverse primer) is 5¢-CCTCCGAA

ACAGGACTGTCAGGGGGTACCAG-3¢. The 85-nucleo-

tide template used as the minus strand in the synthesis of

ADHR1 was obtained by the systematic evolution of

ligands by exponential enrichment method [16]. In brief,

selection was started by introducing randomized substitu-

tions of nucleotides located in regions previously identified

as essential for the self-cleavage catalytic activity of the

hairpin ribozyme. The selection procedure was designed to

identify inactive hairpin ribozymes whose catalytic activity

could be rescued by free exogenous adenine. Its entire

sequence is 5¢-CCTCCGAAACAGGACTGTCAGGGGG

TACCAGGTAATGCATCACAACGTTTTCACGGTTGA

TTCTCTGTTTCAGCGTACCC-3¢. The two primer bind-

ing regions are located in the 5¢-terminus and 3¢-terminus.

A 4 mL PCR reaction with each primer (P1 and P2)

at 1.5 lm, 6 nm template and 100 units of Taq DNA



polymerase in appropriate buffer was performed as follows:

2 min at 94 �C, 20 cycles of 30 s at 94 �C, 30 s at 56 �C,and 1 min at 72 �C, and 7 min at 72 �C. The dsDNA pool

was ethanol precipitated and dissolved in water for in vitro

transcription. The reaction mixture (8 mL) contained 2 mm

each rNTP, 0.15 lm DNA and 4800 units of T7 RNA

polymerase in the transcription buffer (Fermentas). After

overnight incubation at 37 �C, treatment with DNase1

(2 unitsÆlg)1 of DNA), and deproteinization, the full-length

uncleaved hairpin ribozyme was purified by 10% denatur-

ing PAGE, ethanol precipitated, and resuspended in

distilled water at a concentration of 25 lm, yielding approx-

imately 11 nmol of RNA.

RNA cleavage reaction

RNA (25 lm) in cleavage buffer (50 mm Tris ⁄HCl,

pH 7.5, and 0.1 mm EDTA) was subjected to denaturation

and renaturation steps (heated to 90 �C for 1 min, and

then slowly cooled, at 3 �CÆmin)1, to 23 �C). The solutions

were completed with two cleavage buffers, one containing

6 mm MgCl2 and the second 6 mm adenine, at final con-

centrations such that RNA reached a final concentration

of 0.5 lm. The reaction started at room temperature, when

MgCl2 and adenine were added to the mixture. Two con-

ditions for starting the reaction were used. The first condi-

tion consisted of incubation of RNA in the cleavage

buffer containing adenine, the reaction being started by

addition of MgCl2 to the mixture. The second condition

was incubation of RNA in cleavage buffer containing

MgCl2, the reaction being started by addition of adenine

to the mixture. For the Mg2+ dependence of the cleavage

reaction under hydrostatic pressure, RNA was incubated

in the cleavage buffer with adenine, and the reaction

was started by addition of the second buffer containing

MgCl2 at a concentrations ranging from 3 to 20 mm.

When needed, various hydrostatic pressures were applied.

Aliquots were removed from the mixtures at various times,

and the reaction was stopped by adding one volume of

loading solution (7 m urea, 50 mm EDTA, pH 7.5, 0.01%

xylene cyanol).

Analysis of the products of the self-cleavage

reaction

After each cleavage reaction, ice-stored aliquots (80 lLcontaining 0.55 lg of RNA) were analyzed by denaturing

10% PAGE and ethidium bromide staining. RNA frag-

ments were revealed by UV transillumination, and scanned.

The relative light intensities of the fragments were quanti-

fied using an image analyzer (imagej). The percentages of

cleavage were plotted as a function of time for each condi-

tion, subtracting the t0 values so that all plots start at 0,

unless otherwise specified. Using the software kaleida-

graph, the kinetics toward equilibrium were fitted to the

exponential equation x ¼ xeqð1� e�kobstÞ, where xeq is the

fraction of cleaved RNA at equilibrium, x the fraction of

cleaved RNA at time t, and kobs the observed cleavage rate

constant. Keq was taken as the cleaved ⁄uncleaved RNA

concentration ratio. The error bars applied to the rate

constant values were calculated on the basis of three

quantitative scans made on each of three independent

electrophoretic analyses.

Kinetics of the cleavage reaction under

hydrostatic pressure

The influence of hydrostatic pressure was investigated by

subjecting the reaction mixtures outlined above to constant

hydrostatic pressures ranging from 0.1 to 150 MPa, using

previously described apparatus that allows the removal of

samples from the incubation chamber while the pressure is

kept constant [50]. Aliquots were removed at various times

(0–360 min), quenched, ice-stored, and analyzed as described

below. For technical reasons, it takes 1–2 min to fill the

incubation chamber and apply the desired pressure. Conse-

quently, for the determination of the rate constants, the frac-

tion of hairpin ribozyme cleaved before applying pressure

was subtracted from all cleavage values so as to visualize

only the catalytic activity occurring under pressure. How-

ever, to estimate the equilibrium constants, the fraction of

RNA cleaved during this lag period and before the addi-

tion of MgCl2 (during preparation and storage) was

taken into account. The DV „ was calculated from the

equation k = A exp)(PDV „ ⁄RT), where k is the rate con-

stant of the reaction, R is universal gas constant

(8.314 cm3ÆMPaÆK)1Æmol)1) (1 MPa = 10 bar = 10.13 atm),

T the temperature (K), and P the pressure (MPa) [51]. Error

bars were calculated on the basis of experimental variations

and using the margin of error given by the software for

the fits.

Kinetics of the self-cleavage reaction under

osmotic pressure

The influence of osmotic pressure was investigated by add-

ing an osmotic pressure agent to the cleavage medium,

poly(ethylene glycol) 400, as previously described [32]. This

agent was added at concentrations ranging from 0% to

10% (v ⁄ v). Aliquots were removed and quenched at various

times (0–40 min), ice-stored, and analyzed as described

below. The number of water molecules released upon hair-

pin ribozyme cleavage was calculated using the equation

dKT ln(kP ⁄ kO) ⁄ dPosm = DVw = DNw (30 A3), where kP

is the observed cleavage rate constant (kobs) at osmotic

pressure P, kO the kobs in the absence of added solute, K

the Boltzmann constant, and T the temperature (K). DVw is

the change in volume, 30 A3 the molecular volume of

water, and DNw the linked change in the number of associ-

ated water molecules [39].



Influence of pressure on the adenine and Mg2+

saturation curves

The influence of pressure on the binding of adenine and

Mg2+ to ADHR1 was investigated by analyzing the

self-cleavage reaction of the hairpin ribozyme at several

concentrations of adenine and MgCl2, either at atmospheric

pressure or under a hydrostatic pressure of 75 MPa. The

percentage of cleavage for each experimental condition was

then plotted as a function of time, and the kinetics were fit-

ted to the exponential equation described above, allowing

the estimation of the initial rates of the reaction. In the case

of Mg2+, the initial rates were plotted as a function of the

cofactor concentration, and the data were fitted to the Hill

equation, log(v ⁄Vm)v) = log K + nH log (s), where v is

the reaction rate, Vm the maximal velocity, K the apparent

binding constant, nH the Hill coefficient, and (s) the Mg2+

concentration. In the case of adenine, the apparent Kd was

obtained from a double reciprocal plot.

Acknowledgements

This work was supported by grants from two specific

CNRS programs: GDR exobiologie and PID ‘Origines

des Planetes et de la Vie’. The authors are indebted

to A.-L. Haenni for reading and improving this

manuscript.

References

1 Woese CR (1965) On the evolution of the genetic code.

Proc Natl Acad Sci USA 54, 1546–1552.

2 Crick FH (1968) The origin of the genetic code. J Mol

Biol 38, 367–379.

3 Joyce GF (2002) The antiquity of RNA-based evolu-

tion. Nature 418, 214–221.

4 Orgel LE (1968) Evolution of the genetic apparatus.

J Mol Biol 38, 381–393.

5 Gilbert W (1986) The RNA world. Nature 319, 618.

6 Gesteland RF, Cech TR & Atkins JF (1999) In The

RNA World. Cold Spring Harbor Laboratory Press,

New York, NY.

7 Salehi-Ashtiani K, Luptak A, Litovchick A & Szostak

JW (2006) A genomewide search for ribozymes reveals

an HDV-like sequence in the human CPEB3 gene. Sci-

ence 313, 1788–1792.

8 Przybilski R, Graf S, Lescoute A, Nellen W, Westhof

E, Steger G & Hammann G (2005) Functional hammer-

head ribozymes naturally encoded in the genome of

Arabidopsis thaliana. Plant Cell 17, 1877–1885.

9 Taylor JM (1999) Replication of human hepatitis delta

virus: influence of studies on subviral plant pathogens.

Adv Virus Res 54, 45–60.

10 Cochrane JC & Strobel SA (2008) Riboswitches effec-

tors as protein enzyme cofactors. RNA 14, 993–1002.

11 Maurel MC (1992) RNA in evolution. J Evol Biol 5,

173–188.

12 Maurel MC & Haenni AL (2005) The RNA world:

hypothesis, facts and experimental results. In Lectures

in Astrobiology (Barbier B, Gargaud M, Martin H &

Reisse J, eds), pp. 557–581. Springer-Verlag, Berlin.

13 Kun A, Maurel MC, Santos M & Szathmary E (2005)

Fitness landscapes, error thresholds, and cofactors in

aptamer evolution. In The Aptamer Handbook (Kluss-

mann S, ed.), pp. 54–92. Wiley-VHC Verlag GmbH &

Co, Weinheim.

14 Meli M, Vergne J, Decout JL & Maurel MC (2002)

Adenine–aptamer complexes: a bipartite RNA site that

binds the adenine nucleic base. J Biol Chem 277, 2104–

2111.

15 Maurel MC & Ninio J (1987) Catalysis by a prebiotic

nucleotide analog of histidine. Biochimie 69, 551–553.

16 Meli M, Vergne J & Maurel MC (2003) In vitro selec-

tion of adenine-dependent hairpin ribozymes. J Biol

Chem 278, 9835–9842.

17 Oro J (1961) Mechanism of synthesis of adenine from

hydrogen cyanide under possible primitive earth condi-

tions. Nature 191, 1193–1194.

18 Walter NG & Burke JM (1998) The hairpin ribozyme:

structure, assembly and catalysis. Curr Opin Chem Biol

2, 24–30.

19 Fedor MJ (2002) The catalytic mechanism of the hair-

pin ribozyme. Biochem Soc Trans 30, 1109–1115.

20 Zhuang X, Kim H, Pereira MJ, Babcock HP, Walter

NG & Chu S (2002) Correlating structural dynamics

and function in single ribozyme molecules. Science 296,

1473–1476.

21 Feldstein PA & Bruening G (1993) Catalytically active

geometry in the reversible circularization of ‘mini-

monomer’ RNAs derived from the complementary

strand of tobacco ringspot virus satellite RNA. Nucleic

Acids Res 21, 1991–1998.

22 Komatsu Y, Kanzaki I, Koizumi M & Ohtsuka E

(1995) Construction of new hairpin ribozymes

with replaced domains. Nucleic Acids Symp Ser 34,

223–224.

23 Siwkowski A, Shippy R & Hampel A (1997) Analysis

of hairpin ribozyme base mutations in loops 2 and 4

and their effects on cis-cleavage in vitro. Biochemistry

36, 3930–3940.

24 Siwkowski A, DeYoung MB, Anderson P & Hampel A

(1997) Mutagenesis and modeling of the hairpin ribo-

zyme family. Methods Mol Biol 74, 357–363.

25 Rupert PB & Ferre-D’Amare AR (2001) Crystal

structure of a hairpin ribozyme–inhibitor complex

with implications for catalysis. Nature 410, 780–

786.

26 Rupert PB, Massey AP, Sigurdsson STh & Ferre-

D’Amre AR (2002) Transition state stabilization by a

catalytic RNA. Science 298, 1421–1424.



27 Kuzmin YI, Da Costa CP, Cottrell JW & Fedor MJ

(2005) Role of an active site adenine in hairpin ribo-

zyme catalysis. J Mol Biol 349, 989–1010.

28 Siwkowski A, Humphrey M, De-Young MB & Hampel

A (1998) Screening for important base identities in the

hairpin ribozyme by in vitro selection for cleavage. Bio-

Techniques 24, 278–284.

29 Hampel A, DeYoung MB, Galasinski S & Siwkowski A

(1997) Design of the hairpin ribozyme for targeting spe-

cific RNA sequences. Methods Mol Biol 74, 171–177.

30 Wilson TJ & Lilley DM (2002) Metal ion binding and

the folding of the hairpin ribozyme. RNA 8, 587–600.

31 DeYoung MB, Siwkowski A & Hampel A (1997) Deter-

mination of catalytic parameters for hairpin ribozymes.

Methods Mol Biol 74, 209–220.

32 Tobe S, Heams T, Vergne J, Herve G & Maurel MC

(2005) The catalytic mechanism of hairpin ribozyme

studied by hydrostatic pressure. Nucleic Acids Res 33,

2557–2564.

33 Vergne J, Cognet JA, Szathmary E & Maurel MC (2006)

In vitro selection of halo-thermophilic RNA reveals two

families of resistant RNA. Gene 371, 182–193.

34 Nisbet EG & Sleep NH (2001) The habitat and nature

of early life. Nature 409, 1083–1091.

35 Orgel LE (2004) Prebiotic chemistry and the origin of

the RNA world. Crit Rev Biochem Mol Biol 39, 99–

123.

36 Bada JL & Lazcano A (2002) Origin of life – some like

it hot, but not the first biomolecules. Science 296, 1982–

1983.

37 Kawamura K (2004) Behavior of RNA under hydro-

thermal conditions and the origins of life. Int J Astrobi-

ol 3, 301–309.

38 Zhao ZY, McLeod A, Harusawa S, Araki L, Yamagu-

chi M, Kurihara T & Lilley DM (2005) Nucleobase

participation in ribozyme catalysis. J Am Chem Soc

127, 5026–5027.

39 Parsegian VA, Rand RP & Rau DC (1995) Macromole-

cules and water: probing with osmotic stress. Methods

Enzymol 259, 43–94.

40 Dixon M & Webb EC (1964) Enzyme kinetics. In

Enzymes (Green LA, ed.), pp. 84–87. Longmans, Green

and Co Ltd, London.

41 Macgregor RB (2002) The interactions of nucleic acids

at elevated hydrostatic pressure. Biochim Biophys Acta

1595, 266–276.

42 Giel-Pietraszuk M & Barciszewski J (2005) A nature of

conformational changes of yeast tRNA(Phe). High

hydrostatic pressure effects. Int J Biol Macromol 37,

109–114.

43 Fedoruk-Wyszomirska A, Wyszko E, Giel-Pietraszuk

M, Barciszewska MZ & Barciszewski J (2007) High

hydrostatic pressure approach proves RNA catalytic

activity without magnesium. Int J Biol Macromol 41,

30–35.

44 Girard E, Prange T, Dhaussy AC, Migianu-Griffoni E,

Lecouvey M, Chervin JC, Mezouar M, Kahn R &

Fourme R (2007) Adaptation of the base-paired dou-

ble-helix molecular architecture to extreme pressure.

Nucleic Acids Res 35, 4800–4808.

45 Rupert PB & Ferre-D’Amare AR (2004) Crystallization

of the hairpin ribozyme: illustrative protocols. Methods

Mol Biol 252, 303–311.

46 Salter J, Krucinska J, Alam S, Grum-Tokars V &

Wedekind JE (2006) Water in the active site of an

all-RNA hairpin ribozyme and effects of Gua8 base

variants on the geometry of phosphoryl transfer.

Biochemistry 45, 686–700.

47 MacElrevey C, Salter JD, Krucinska J & Wedekind JE

(2008) Structural effects of nucleobase variations at key

active site residue Ade38 in the hairpin ribozyme. RNA

14, 1600–1616.

48 Nam K, Gao J & York DM (2008) Electrostatic inter-

actions in the hairpin ribozyme account for the majority

of the rate acceleration without chemical participation

by nucleobases. RNA 14, 1501–1507.

49 Walter NG (2007) Ribozyme catalysis revisited: is water

involved? Mol Cell 28, 923–929.

50 Hui Bon Hoa GH, Hamel G, Else A, Weill G & Herve

G (1990) A reactor permitting injection and sampling

for steady state studies of enzymatic reactions at high

pressure: tests with aspartate transcarbamylase. Anal

Biochem 187, 258–261.

51 Heremans K (1982) High pressure effects on proteins

and other biomolecules. Annu Rev Biophys Bioeng 11,

1–21.



Adenine, a hairpin ribozyme cofactor - high-pressure and competition studies

Documents