Adam10 haploinsufficiency causes freckle-like macules in Hairless mice

Subscribe to PCMR and stay up-to-date with the only journal committed to publishing basic research in melanoma and pigment cell biology

As a member of the IFPCS or the SMR you automatically get online access to PCMR. Sign up as a member today at www.ifpcs.org or at www.societymelanomaresarch.org

If you wish to order reprints of this article, please see the guidelines here

Email alErtsReceive free email alerts and stay up-to-date on what is published in Pigment Cell & Melanoma Research – click here

the official journal of

intErnational FEdEration oF PigmEnt CEll soCiEtiEs · soCiEty For mElanoma rEsEarCh

PIgMent Cell & MelAnoMAResearch

to take out a personal subscription, please click hereMore information about Pigment Cell & Melanoma Research at www.pigment.org

Adam10 haploinsufficiency causes freckle-like macules in Hairless mice

grace tharmarajah, laura Faas, Karina reiss, Paul saftig,

antony young and Catherine d. Van raamsdonk

submit your next paper to PCmr online at http://mc.manuscriptcentral.com/pcmr

doi: 10.1111/j.1755-148X.2011.01032.xVolume 25, issue 5, Pages 555-565

http://offprint.cosprinters.com/

http://www.pigment.org/ealerts.asp

http://ordering.onlinelibrary.wiley.com/subs.asp?ref=1755-148X

Adam10 haploinsufficiency causes freckle-like maculesin Hairless miceGrace Tharmarajah1, Laura Faas2, Karina Reiss3, Paul Saftig4, Antony Young5 andCatherine D. Van Raamsdonk1

1 Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada 2 Department ofBiology, University of York, Heslington, York, UK 3 Department of Dermatology, Christian-Albrecht University, Kiel,Germany 4 Biochemical Institute, Christian-Albrecht University, Kiel, Germany 5 St John's Institute ofDermatology, Division of Genetics and Molecular Medicine, King's College School of Medicine, King's CollegeLondon, Guy's Hospital, London, UK

CORRESPONDENCE Catherine D. Van Raamsdonk, e-mail: [email protected]

KEYWORDS Adam10 ⁄ Pied ⁄ Hairless ⁄ melanocytes ⁄pigmentation ⁄ freckles ⁄ Cd44

PUBLICATION DATA Received 10 August 2011,revised and accepted for publication 26 June 2012published online 26 July 2012

doi: 10.1111/j.1755-148X.2012.01032.x

Summary

The Hairless nuclear receptor co-repressor is required for hair follicle regeneration during the hair cycle.

The classical HairlessHr ⁄ HairlessHr mouse mutant loses all hair between 2 and 3 weeks of age. As the mice

age, their trunk skin develops epidermal pigmentation, a feature of human skin which is not found in

normal haired mice. In this report, we present a new, dominant mouse mutation, Pied, which arose within

a colony of HairlessHr ⁄ HairlessHr mice and causes freckle-like macules on the skin. The Pied macules

require HairlessHr homozygosity to form and are composed of localized clusters of epidermal melanocytes.

Through linkage analysis, we find that the Pied mutation is a 1914 base pair loss-of-function deletion in

the Adam10 zinc metalloprotease gene. The pathways that specifically maintain long-term pigmentation

patterns in adults are not well understood. We have identified Adam10 as an inhibitor of melanocyte

expansion in adult skin.

Introduction

Mammalian skin is pigmented by melanocytes that pro-

duce melanins. Melanocytes that are located in hair folli-

cles determine hair color, while those outside of hair

follicles in the epidermis and dermis determine skin

color. Melanocytes in the epidermis transfer pigment

containing organelles, called melanosomes, to surround-

ing keratinocytes. Abnormalities in melanocytes cause

pigmentary defects, such as albinism, vitiligo, and skin

hyperpigmentation.

The mouse trunk is densely populated with hair folli-

cles and lacks visible skin pigmentation. Melanocytes

are only occasionally observed in the interfollicular epi-

dermis and dermis (Hirobe, 1984). During development,

melanoblasts, immature melanocytes, reach individual

hair follicles by migrating first through the dermis and

then through the epidermis, collecting around and enter-

ing newly developing hair follicles beginning at E16.5

(Hirobe, 1984; Mayer, 1973; Yoshida et al., 1996). The

mechanism that restricts melanocyte growth in the

adult interfollicular trunk skin is unknown. However,

Significance

We have studied a new mouse mutant with age-related freckling, called Pied, and found that it is caused

by a deletion in the metalloprotease gene, Adam10. Our work has identified Adam10 as a regulator of

melanocyte progenitor cells in adult skin. As a membrane-linked metalloprotease, Adam10 likely sheds or

cleaves a cell surface molecule that regulates the attachment and ⁄ or proliferation of melanocytes in the

epidermis. It is possible that inhibition of Adam10 and Hairless might enhance repigmentation of human

skin in cases where it has been lost in adulthood.

ª 2012 John Wiley & Sons A/S 555

Pigment Cell Melanoma Res. 25; 555–565 ORIGINAL ARTICLE

pigmented trunk epidermis can be artificially produced

by expressing KitL, the ligand for the tyrosine kinase

receptor, C-kit, in the epidermis by way of the Cytokera-

tin 14 promoter (Kunisada et al., 1998). Melanocytes

normally persist in mouse tail, ear, and foot skin, possi-

bly because of the reduced density of hair follicles.

To remain in optimum condition, hair is continuously

grown and shed (Stenn et al., 1998). The hair cycle con-

sists of three phases: catagen, telogen, and anagen

(Paus and Cotsarelis, 1999). In catagen, the lower por-

tion of the hair follicle is deliberately destroyed by apop-

tosis (Botchkareva et al., 2006; Plikus and Chuong,

2008). During telogen, mesenchymal dermal papilla cells

at the base of the hair follicle signal to cells in the bulge

region of the permanent portion of the hair follicle,

where skin stem cells are located (Cotsarelis et al.,

1990). This triggers anagen, the regeneration of the

lower portion of the hair follicle, and the formation of a

new hair. In mice, there is a coordinate regulation of the

timing of the cycle among hair follicles, such that cycles

begin as waves moving across the body (Plikus and

Chuong, 2008). Melanocyte stem cells also reside in the

hair follicle bulge region (Nishimura et al., 2002). At the

start of each new cycle, melanocyte stem cells prolifer-

ate and populate the base of the hair follicle to contrib-

ute pigment to the keratinocytes of the newly growing

hair.

Hairless (Hr) is a retroviral insertion mutation in the

Hairless gene, which encodes a nuclear receptor co-

repressor (Potter et al., 2001; Stoye et al., 1988). Hair-

lessHr ⁄ HairlessHr mice undergo apparently normal hair

follicle development and grow a coat in their first

2 weeks (Sumner, 1924). Between 2 and 3 weeks of

age, beginning at the head and progressing toward the

tail, HairlessHr ⁄ HairlessHr mice become bald, possibly

through excessive apoptosis during catagen. Abnormal

remnants of the upper portion of the hair follicles, called

utricles, remain in the epidermis in HairlessHr ⁄ HairlessHr

mice (Panteleyev et al., 1999). HairlessHr ⁄ HairlessHr

mice also develop dermal cysts, which share some fea-

tures of sebaceous glands (Bernerd et al., 1996; Mann,

1971; Zarach et al., 2004).

The Hairless protein is transiently expressed in

keratinocytes of the outer root sheath, including the

bulge region, during telogen (Beaudoin et al., 2005;

Panteleyev et al., 2000). It has been postulated that

Hairless downregulates the expression of Soggy and

Wise, two negative regulators of Wnt signaling

(Beaudoin et al., 2005). Because Wnt signaling can ini-

tiate hair regrowth in mouse models (Lo Celso et al.,

2004; Van Mater et al., 2003), it is possible that Hair-

less plays a role in triggering anagen via a transient

de-repression of Wnt.

A number of groups have used HairlessHr ⁄ HairlessHr

mice to study the effects of UV radiation and various

carcinogens on trunk skin pigmentation (Epstein and

Epstein, 1963; Faas et al., 2008; Naganumaa et al.,

2001; Sato and Kawada, 1972). These studies have sug-

gested that the loss of the Hairless gene somehow per-

mits melanocyte survival and ⁄ or proliferation in the

trunk skin. In this article, we describe a new, spontane-

ous mouse mutation, Pied, that produces freckle-like

macules in the skin of HairlessHr ⁄ HairlessHr mice.

Results

Pied mutant mice have freckle-like macules

In a colony of inbred HRA ⁄ Skh HairlessHr ⁄ HairlessHr

mice maintained at Kings College London, we discov-

ered an animal with light brown, freckle-like spots, or

macules, on the trunk (Figure 1A). We bred this mouse

to HRA ⁄ Skh HairlessHr ⁄ HairlessHr animals without ma-

cules and found that the macules are heritable and that

they appear on the skin beginning at approximately

20 weeks of age. This mutant line of mice was named

Pied. At 5 months of age, the macules appear small and

discrete and randomly scattered (Figure 1D). Upon clo-

ser inspection, the macules have a striated appearance

(Figure 1B). The striation is the key feature that distin-

guishes Pied macules from other trunk pigmentation in

HairlessHr ⁄ HairlessHr mice.

To map the location of the Pied mutation, we crossed

5-month-old HairlessHr ⁄ HairlessHr mice with macules to

Castaneous mates. We then backcrossed each of the

F1 offspring to a HairlessHr ⁄ + mouse, produced by

crossing HRA ⁄ Skh HairlessHr ⁄ HairlessHr mice to + ⁄ +(C3HeB ⁄ FeJ) inbred mice. In 53% of the backcross

cages that were set up, HairlessHr ⁄ HairlessHr mapping

progeny with macules were produced. We selected 10

of the HairlessHr ⁄ HairlessHr mapping progeny with ma-

cules for a genome scan to look for SSLP markers with

a decreased frequency of the Castaneous allele. A defi-

ciency was found at markers on chromosome 14,

where the Hairless gene is located, as well as at mark-

ers on chromosome 9. By analyzing more densely

spaced SSLP markers on chromosome 9 in 128 more

HairlessHr ⁄ HairlessHr mapping progeny with macules,

we narrowed the Pied physical interval to 6.6 megabas-

es, close to D9Mit259 (Figure 1E). None of the 138

mapping progeny with macules inherited the castaneous

allele at both CVR4 and D9Mit123, indicating that there

is no phenocopy of the macule phenotype in wild-type

animals.

We next intercrossed HairlessHr ⁄ +; Pied ⁄ + F1 animals

that gave rise to progeny with macules in the mapping

cross. Of 48 progeny, we recovered no animals that

were solely HRA ⁄ Skh throughout the interval that flanks

Pied (CVR4-D9Mit123) (expected number = 12,

P < 0.0001, chi-square test). This shows that homozy-

gosity of Pied is lethal prior to weaning and confirms

that the macule phenotype of Pied is dominant.

We then used the Pied flanking markers to genotype

HairlessHr ⁄ HairlessHr progeny from the mapping cross

that did not develop macules. We determined that the

Tharmarajah et al.

556 ª 2012 John Wiley & Sons A/S

penetrance of the macule phenotype in HairlessHr ⁄ Hair-

lessHr; Pied ⁄ + animals is �80% at 5 months of age.

A deletion within the metalloprotease, Adam10,

causes Pied

According to the Ensembl mouse genome database,

there are 47 genes in the interval flanked by the mark-

ers CVR4 and D9Mit123 (Figure 1E). Three of the genes

in the interval are known to be embryonic lethal:

Adam10 (Hartmann et al., 2002), Tcf12 (Zhuang et al.,

1996), and Nedd4 (Fouladkou et al., 2008). We decided

to characterize the Pied homozygous phenotype to nar-

row down potential candidate genes. We intercrossed

HairlessHr ⁄ +; Pied ⁄ + F1 animals and dissected pregnant

females at E9.5. Embryonic membranes were used to

genotype the embryos using the flanking markers,

CVR4 and D9Mit123. At E9.5, we recovered several

Pied ⁄ Pied homozygotes (Figure 1F). We noted that the

Pied ⁄ Pied embryos have the following features: they

are small, their caudal regions are truncated, their som-

ites are not clearly delineated, their neural tubes are

irregularly shaped, their branchial arches are small, their

hearts are still linear, their pericardial sacs are enlarged,

and their telencephalons are small. In short, their phe-

notype closely matches the previously reported pheno-

type of E9.5 Adam10 knockout mice (Hartmann et al.,

2002).

We attempted to PCR amplify each of the 16 exons

of Adam10 in Pied ⁄ Pied DNA from E9.5-dissected

embryos. We successfully amplified all exons except

exon 11. Suspecting a deletion, we analyzed the region

around exon 11 with additional primer pairs to narrow

the non-amplifiable region and then designed pairs to

span the hypothesized deletion. One set produced a

Pied-specific product. Upon sequencing this PCR prod-

uct, we determined that there is a deletion of 1914

bases in Pied DNA, which removes all of exon 11 of

Adam10 (Figure 2A). Unexpectedly, we found a 50 base

pair sequence inserted in between the two Pied dele-

tion break points, as compared to HRA ⁄ Skh DNA (Fig-

ure 2B). The inserted sequence shows homology to

mouse L1 Line elements. Interestingly, the Pied proxi-

A B

C D

E F

Figure 1. Pied causes skin

hyperpigmentation and maps to

chromosome 9. (A) Appearance of

HairlessHr ⁄ HairlessHr; Pied ⁄ + mouse at

6 months of age. (B) Enlargement

showing striations within the macules of a

HairlessHr ⁄ HairlessHr; Pied ⁄ + mouse at

6 months of age. (C, D) Comparison of 6-

month-old HairlessHr ⁄ HairlessHr; + ⁄ + (C)

and HairlessHr ⁄ HairlessHr; Pied ⁄ + (D) trunk

skin. An example of a macule is indicated

with an arrow in D. (E) A map of the

6.6 megabase physical interval of Pied on

chromosome 9, flanked by the markers,

CVR4 and D9Mit123. For each marker, the

recombination fraction is shown above the

line and the position in megabases

according to Ensembl assembly NCBI

m37 is shown below. (F) Appearance of

Pied ⁄ Pied homozygous embryos at day

9.5. Pied ⁄ Pied embryos show abnormal

features also found in Adam10

homozygous knockout embryos: (1) small

size, (2) truncated caudal region, (3)

somites not clearly delineated, (4) irregular

neural tube, (5) small branchial arch, (6)

linear heart, (7) enlarged pericardial sac,

(8) small telencephalon.

Adam10 is mutated in Pied mice


mal break point occurs within a 173 base pair Line-type

repetitive element. The 50 base pair insertion suggests

that either a retroviral insertion ⁄ removal event caused

the Pied deletion (Mine et al., 2007) or that an L1 ele-

ment was used to repair a double-strand break at the

Adam10 locus (Mager et al., 1985).

The spanning PCR assay was subsequently used to

genotype for Pied in all animals of the colony. To

determine whether the mutation in Adam10 is a null,

we performed a test cross between Adam10Pied ⁄ + mice

and heterozygous Adam10 knockout mice,

Adam10tm1Psa ⁄ + (Hartmann et al., 2002) (Figure 2C).

We dissected the resulting embryos at E9.5. All of the

Adam10Pied ⁄ Adam10tm1Psa embryos exhibited small

size, caudal truncation, reduced somite development,

irregular neural tubes, small branchial arches, linear

hearts, enlarged pericardial sacs, and small telencepha-

lons, phenotypes identical to those observed previously

in Adam10Pied ⁄ Adam10Pied embryos (Figure 1F) and

Adam10tm1Psa ⁄ Adam10tm1Psa embryos (Hartmann et al.,

2002).

In addition, we crossed Adam10tm1Psa ⁄ + animals to

HRA ⁄ Skh HairlessHr ⁄ HairlessHr mice and then

backcrossed the resulting HairlessHr ⁄ +; Adam10tm1Psa ⁄ +

A

B

C

E F

G

D

Figure 2. Haploinsufficiency of Adam10 causes Pied (A) Vertical lines indicate the break points that remove 1914 base pairs of the Adam10

locus in the Pied allele. (B) Sequences flanking the Pied deletion are black and underlined, and the 50 base pair novel sequence inserted

between the break points is red. (C) The outcome of a test cross between Adam10tm1Psa ⁄ + and Adam10Pied ⁄ + mice. Obs., Observed, Exp.,

Expected, N, Number. (D) Examples of E9.5 embryos from the test cross in C. All 9 of the Adam10tm1Psa ⁄ Adam10Pied E9.5 embryos exhibited

the following features: (1) small size, (2) truncated caudal region, (3) somites not clearly delineated, (4) irregular neural tube, (5) small branchial

arch, (6) linear heart, (7) enlarged pericardial sac, (8) small telencephalon. (E) Comparison of HairlessHr ⁄ HairlessHr; + ⁄ + (left) and

HairlessHr ⁄ HairlessHr; Adam10tm1Psa ⁄ + (right) animals at 5 months of age. The HairlessHr ⁄ HairlessHr; Adam10tm1Psa ⁄ + mouse exhibits striated

macules, one of which is indicated with a black arrow. (F) By RT-PCR, Adam10 is expressed in neonatal mouse trunk skin and in cultured

mouse melanocytes (melan-a cells). Controls include the ubiquitously expressed glyceraldehydes-3 phosphate dehydrogenase (Gapdh), the

melanocyte specific, dopachrome tautomerase (Dct), and the keratinocyte specific, cytokeratin 5 (Keratin 5). (G) The Pied mutation is

predicted to delete amino acids 455–505 of the Adam10 protein, comprising half of the disintegrin domain. s, signal sequence; tm,

transmembrane domain.

Tharmarajah et al.


animals to HairlessHr ⁄ HairlessHr; + ⁄ +. We aged the

progeny for 6 months and observed that the

HairlessHr ⁄ HairlessHr; Adam10tm1Psa ⁄ + mice developed

macules (Figure 2E). These macules exhibited the same

unique striations as those on HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ + mice. We quantitated the density of the

macules in HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + and

HairlessHr ⁄ HairlessHr; Adam10tm1Psa ⁄ + animals at

5 months of age and found no significant difference

between the two groups (8.5 ± 3 versus 8.0 ± 5 ma-

cules ⁄ cm2, respectively). From this data, we conclude

that haploinsufficiency of Adam10 causes macules in

HairlessHr ⁄ HairlessHr mice.

Adam10 encodes a disintegrin and metalloprotease

(ADAM) family member (Hartmann et al., 2002). Adams

are zinc-binding metalloproteases that are membrane

bound and have a large number of potential cleavage

targets (Klein and Bischoff, 2010). Using RT-PCR, we

found that Adam10 is expressed in whole neonatal

mouse skin, as well as in an immortalized mouse

melanocyte cell line, melan-a (Bennett et al., 1987)

(Figure 2F).

The deletion of exon 11 in the Adam10Pied allele is

predicted to eliminate amino acids 455 to 505, which

comprise half of the cysteine-rich disintegrin domain

(from 458 to 552) (Figure 2G). The disintegrin domain,

present in all Adam family members, is named after

its ability to bind to integrin receptors; however, the

disintegrin domain of Adam10 lacks aspartic acid resi-

dues and a Rx6DEVF sequence that are thought to

mediate interactions (Seals and Courtneidge, 2003).

Previously it was shown that deletion of the disintegrin

domain does not abrogate alpha-secretase activity of

Adam10 in vitro (Fahrenholz et al., 2000). Splicing from

exon 10 to exon 12, detected by RT-PCR (data not

shown), would cause a frameshift in the mRNA, result-

ing in the replacement of the remaining disintegrin

domain, the transmembrane domain, and the cytoplas-

mic tail with 95 aberrant amino acids, before a stop

codon is encountered. However, non-sense-mediated

mRNA decay probably would prevent the production of

such a protein.

Macules are produced by localized clusters

of melanocytes

To characterize the macule phenotype, we first per-

formed histological analysis of skin of HairlessHr ⁄ Hair-

lessHr; + ⁄ + and HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ +littermates at 6 months of age. We sectioned trunk

skin, noting the location of macules, and counterstained

the sections with hematoxylin and eosin. In both the

HairlessHr ⁄ HairlessHr; + ⁄ + and HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ + mice, most of the epidermis was unpig-

mented (Figure 3A,B). Melanin in the epidermis was

observed in some sections of HairlessHr ⁄ HairlessHr; + ⁄ +mouse skin, as expected (Naganumaa et al., 2001). In

the macules of HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + ani-

mals, heavier concentrations of melanin were observed

mainly at the junction between the dermis and the epi-

dermis, where melanocytes typically reside (Figure 3C).

Thus, microscopically, the macules are associated with

areas of increased melanin deposition.

We next addressed whether the hyperpigmentation

of HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + skin is the result

of an increased number of melanocytes. We crossed

HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + mice to a melano-

cyte reporter line, Dct-LacZ, which expresses the mar-

ker, beta-galactosidase, in melanocytes beginning at

E10 of development (Mackenzie et al., 1997). We sacri-

ficed animals at 16 days, 3 months, and 5 months of

age, split the dermis from the epidermis using sodium

bromide and incubated the epidermal sheets in X-gal

overnight to stain melanocytes blue. At P16, there

was no difference between HairlessHr ⁄ HairlessHr; + ⁄ +and HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + animals (Fig-

ure 3D, E). At 3 months of age, we observed small

groups of LacZ-positive cells in HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ + skin, but not in HairlessHr ⁄ HairlessHr; + ⁄ +skin (Figure 3F,G). At 5 months of age, these groups of

LacZ-positive cells were larger and were accompanied

by melanin deposition in the surrounding epidermis

(Figure 3I,N).

We noticed that utricles in HairlessHr ⁄ HairlessHr skin

are arranged in parallel rows and that the melanocytes

of the macules are restricted to the intervening aisles

between the rows (Figure 3I,K). This might explain why

the macules appear striated by gross examination

(Figure 1B). We also found that the utricles of

HairlessHr ⁄ HairlessHr; + ⁄ + and HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ + animals exhibit LacZ staining (Fig-

ure 3H,I). In control HairlessHr ⁄ HairlessHr; + ⁄ + and Hair-

lessHr ⁄ HairlessHr; Adam10Pied ⁄ + mice that do not carry

Dct-LacZ, we also observed blue staining in the utricles,

indicating that it is non-specific (Figure 3L,M).

We quantitated melanocyte density in 5-month-old

HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ +; Dct-LacZ ⁄ + and

HairlessHr ⁄ HairlessHr; + ⁄ +; Dct-LacZ ⁄ + trunk epidermis

(Figure 3O). Even in the areas of the epidermis with no

obvious macule, there was a 9-fold increase in melano-

cyte density in HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ +mu-

tants as compared to HairlessHr ⁄ HairlessHr; + ⁄ +(P < 0.013, student’s t-test). We conclude that Adam10

haploinsufficiency increases melanocyte numbers in

HairlessHr ⁄ HairlessHr skin.

Adam10 haploinsufficiency affects select

melanocytes in the skin

We next addressed whether the basic skin color of the

tail is increased by Adam10 haploinsufficency. We dis-

sected and split the skin from the tails of HairlessHr ⁄HairlessHr; + ⁄ + and HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ +3-week-old animals to examine pigmentation of the

epidermis. There was no significant difference in the

average pixel intensity of group photographed HairlessHr ⁄



HairlessHr; + ⁄ + epidermis as compared to HairlessHr ⁄HairlessHr; Adam10Pied ⁄ + epidermis (116 ± 2.9 versus

118 ± 2.9, respectively) (Figure 4A).

In an older cohort of HairlessHr ⁄ HairlessHr; + ⁄ + and

HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + animals, we discov-

ered that macules also form on the less hairy glabrous

skin (tail, ears, and feet) of HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ + animals, beginning at around 10 months

of age (Figure 4B–D). The basic color of the skin around

the macules appears unchanged in the HairlessHr ⁄HairlessHr; Adam10Pied ⁄ + animals. The macules on the

HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + glabrous skin do

not have the striated appearance of the trunk macules,

possibly because the density of utricles is less in the

glabrous skin. Altogether, these observations suggest

that Adam10 haploinsufficiency causes localized expan-

sions of select melanocytes in the skin of Hair-

lessHr ⁄ HairlessHr mice.

AD E

F G

H I

J K

L M

N

B

C

O

Figure 3. Adam10 haploinsufficiency causes localized clusters of melanocytes. (A–C) Hematoxylin and eosin stained trunk sections from

HairlessHr ⁄ HairlessHr; + ⁄ + and HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + non-macule skin (A and B) and HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ +macule skin (C) at 6 months of age. The dermal–epidermal boundary is indicated by a black dotted line. Melanin deposition at the dermal–

epidermal junction in a macule is indicated with a white dotted circle. ep, epidermis; der, dermis. (D–M) X-gal staining (D–I, L, M) or unstained

control (J–K) epidermal sheets from HairlessHr ⁄ HairlessHr; + ⁄ + (left column) and HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + (right column) trunk

epidermis at the indicated ages. Examples of interfollicular LacZ-positive melanocytes (blue) are indicated with black arrows. Asterisks label

example utricles. In G and I, localized clusters of melanocytes are indicated with a dotted white circle. In K, the size and shape of melanin

deposition within the macule is shown. In L and M, mice that lack the Dct-LacZ transgene show that X-gal positive staining of utricles is non-

specific. (N) Enlargement of LacZ-positive cells within a macule in HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + epidermis, showing dark X-gal positive

staining in the melanocytes and melanin deposition in surrounding cells. (O) Quantitation of the number of interfollicular LacZ-positive cells in

epidermal sheets from Dct-LacZ ⁄ +; HairlessHr ⁄ HairlessHr; + ⁄ + and Dct-LacZ ⁄ +; HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + mice at 5 months of age.

Scale bars: (A–C) 25 lM, (D–M) 200 lM, (N) 25 lM.

Tharmarajah et al.


Requirement for Hairless and CD44 in the macule

phenotype

To determine whether the HairlessHr mutation is

required for the expression of the Adam10Pied pheno-

type, we plucked the hair from the trunks of 6-month-

old HairlessHr ⁄ +; + ⁄ + and HairlessHr ⁄ +; Adam10Pied ⁄ +animals. In 5 HairlessHr ⁄ +; Adam10Pied ⁄ + mice, there

were no macules observed on the trunk (Figure 5A,B).

This suggests that the trunk macule phenotype of

Adam10Pied requires HairlessHr homozygosity.

To further test this, we crossed Adam10Pied ⁄ + animals

to Krt14-KitL ⁄ + transgenic mice, which express the mela-

nocyte growth factor, Kit ligand (i.e., SCF, Steel), in the

epidermis and exhibit light trunk skin pigmentation. We

aged Krt14-KitL ⁄ +; + ⁄ + and Krt14-KitL ⁄ +; Adam10Pied ⁄ +mice for 5 months, plucked the hair from the trunk, and

found no increase in pigmentation in Krt14-KitL ⁄ +;

Adam10Pied ⁄ + mice compared with Krt14-KitL ⁄ +; + ⁄ +(Figure 5C). This suggests that simply providing melano-

cytes in the epidermis is not enough for Adam10 haploin-

sufficiency to cause hyperpigmentation and that there

probably is specificity between Adam10 and Hairless.

In humans, one of the targets of the ADAM10 metal-

loprotease is the cell surface protein, CD44 (Anderegg

et al., 2009). CD44 is a receptor for hyaluronic acid

(HA), a component of the extracellular matrix (Nagano

and Saya, 2004). Hyaluronic acid stimulates melanoma

cells to proliferate in vitro (Ahrens et al., 2001).

ADAM10 knockdown in cultured melanoma cells

increases their proliferation in response to HA, and this

effect is prevented by simultaneous knockdown of

CD44 (Anderegg et al., 2009).

We hypothesized that a decrease in Adam10 protein

levels might cause macules by reducing Cd44 shedding

on melanocytes. To test this, we obtained a previously

described mouse knockout allele of Cd44, Cd44tm1Hbg

A

B

C D

Figure 4. Basic skin color is unaffected by Adam10

haploinsufficiency. (A) Tail epidermis from three

HairlessHr ⁄ HairlessHr; + ⁄ + (top) and three HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ + (bottom) mice at 3 weeks of age. There is no

significant difference in tail skin pigmentation. (B–D) Macules on

the ear (B) and foot (D) skin of HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ +mice at 10 months of age. The basic ear skin color is

unaffected in B. Examples of macules in B and D are

indicated with arrows.

A

C

D E

B

Figure 5. Adam10 haploinsufficiency requires Hairless to cause

hyperpigmentation (A, B) Depilated trunk skin from 6-month-old

HairlessHr ⁄ HairlessHr; + ⁄ + (A) and HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ + (B) animals has no macules. (C) Comparison of

Krt14-KitL ⁄ +; + ⁄ + (left) versus Krt14-KitL ⁄ +; Adam10Pied ⁄ + (right)

depilated 5-month-old trunk skin shows no obvious difference in

pigmentation. Examples of skin pigmentation are indicated with

white arrows. (D, E) 10-month-old HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ +; Cd44tm1Hbg ⁄ Cd44tm1Hbg animals develop macules

on the trunk (D) and the tail (E), while HairlessHr ⁄ HairlessHr; + ⁄ +;

Cd44tm1Hbg ⁄ Cd44tm1Hbg animals do not. An example macule is

indicated with a white arrow in D and E.



(Protin et al., 1999) and crossed it to Adam10Pied ani-

mals. HairlessHr ⁄ HairlessHr; Adam10Pied ⁄ +; Cd44tm1Hbg ⁄Cd44tm1Hbg and HairlessHr ⁄ HairlessHr; + ⁄ +; Cd44tm1Hbg ⁄Cd44tm1Hbg mice were aged for 10 months and

examined. Macules were evident on the trunk (Fig-

ure 5D) and tails (Figure 5E) of HairlessHr ⁄ HairlessHr;

Adam10Pied ⁄ +; Cd44tm1Hbg ⁄ Cd44tm1Hbg mice, but not of

the HairlessHr ⁄ HairlessHr; + ⁄ +; Cd44tm1Hbg ⁄ Cd44tm1Hbg

animals. Thus, Adam10 haploinsufficiency increases

melanocyte numbers through a Cd44-independent

mechanism.

Discussion

Adam10 is a ubiquitously expressed gene with many

potential cleavage targets and has roles in cellular prolif-

eration, adhesion, migration, and cell signaling (Chantry

and Glynn, 1990; Mochizuki and Okada, 2007; Seals and

Courtneidge, 2003). Adam10 is membrane bound and

can release cleavage products both intracellularly and to

the extracellular space. For example, Adam10 cleaves

ligand-activated Notch receptors, causing the Notch

intracellular domain (NICD) to translocate to the nucleus

and regulate gene expression (Hartmann et al., 2002;

Lieber et al., 2002). Adam10 is also an alpha-secretase

for the amyloid precursor protein (APP), which is impli-

cated in the formation of plaques in Alzheimer’s disease

(Postina et al., 2004).

We have found that haploinsufficiency of Adam10

causes flat, freckle-like macules on HairlessHr ⁄ Hair-

lessHr mice, beginning on the trunk at 5 months of age

and on the glabrous skin at 10 months of age. The ma-

cules are comprised of localized clusters of melano-

cytes that are able to transfer pigment to surrounding

keratinocytes. It appears that the macules grow slowly,

which could explain why there is a latency for the

visible phenotype. The basic skin color of the glabrous

skin around the macules is unaffected. This sug-

gests that Adam10 haploinsufficiency only acts on

certain melanocytes, either through a stochastic

process or through localized differences in the skin

microenvironment.

The macules require loss of the Hairless receptor co-

repressor to form. Supplying interfollicular melanocytes

by way of the Krt14-KitL transgene is not sufficient

to induce Adam10-mediated skin hyperpigmentation in

the presence of the Hairless protein. This suggests

that Adam10 and Hairless might act within a shared

pathway.

Role of Hairless and Adam10 in pigmentation

Mouse trunk skin is normally unpigmented. Melano-

cytes migrate through the epidermis to reach hair folli-

cles, but do not persist in the interfollicular epidermis in

adults (Hirobe, 1984; Mayer, 1973; Yoshida et al., 1996).

Expression of Kit ligand in the epidermis by way of the

Keratin 14 promoter causes trunk skin hyperpigmenta-

tion (Kunisada et al., 1998). Postnatal treatment with an

antibody against the C-kit receptor in these mice

eliminates all melanocytes except the C-kit-independent

melanocyte stem cells in the hair follicle bulge (Nishim-

ura et al., 2002). Once antibody treatment is ceased,

melanocytes can be observed leaving hair follicles and

repigmenting the skin, beginning with small concentric

circles, which then expand (Nishimura et al., 2002).

Thus, transgenic Kit ligand may provide a path on

which melanocytes can ectopically migrate out of

hair follicles and also supports their growth in the

interfollicular skin.

In this study, we report that the trunk pigmentation in

HairlessHr ⁄ HairlessHr animals is associated with Dct-

LacZ-positive cells in the skin. Therefore, one role of the

Hairless protein is to restrict the presence of melano-

cytes in the trunk skin to hair follicles. Dct-LacZ-positive

cells are present at P16 and could either be lingering

migratory melanoblasts (Hirobe, 1984) or melanocytes

previously localized to hair follicles. A conditional Hair-

less allele could address this.

The expression of the Hairless protein in hair follicles

fluctuates with the hair cycle (Beaudoin et al., 2005).

Anagen hair follicles do not express Hairless. When hair

follicles enter catagen, Hairless can be detected in the

outer root sheath, including the bulge region, and in Ker-

atin-14-negative bulb cells, but not in the dermal papilla.

Hairless protein is maintained in this pattern until the

next anagen. Hairless RNA was detected in the supra-

basal cell layers of the epidermis, the hair follicle infun-

dibulum, the hair follicle matrix, and the inner root

sheath (Panteleyev et al., 2000). Furthermore, Hairless

RNA expression was detected in a microarray analysis

of primary human melanocytes and melanoma cell lines

(Ryu et al., 2007).

It has been postulated that Hairless downregulates

the expression of Soggy and Wise, two negative regu-

lators of Wnt signaling in hair follicles (Beaudoin et al.,

2005). Similarly, a Dickkopfs-related Wnt inhibitor was

identified in a screen for genes upregulated in Hair-

lessHr ⁄ HairlessHr skin (Yamaguchi et al., 2008; Zarach

et al., 2004). Because Wnt signaling can initiate hair

regrowth in mouse models (Lo Celso et al., 2004; Van

Mater et al., 2003), it is possible that Hairless plays a

role in triggering anagen via a transient de-repression

of Wnt. Wnt signaling also coordinates the activation

of epithelial and melanocyte stem cells during hair

regeneration (Rabbani et al., 2011). However, as a

direct effect, inhibition of Wnt signaling would be

expected to decrease melanocyte proliferation ⁄ growth,

not increase it. Interestingly, inhibition of Wnt signaling

was shown to downregulate Adam10 expression in

primary cortical neurons (Wan et al., 2012). Inhibited

Wnt signaling in HairlessHr ⁄ HairlessHr mice might

therefore result in decreased Adam10 expression,

which might exaggerate the effects of Adam10 hap-

loinsufficiency.

Tharmarajah et al.


In Hairless mutant mice, the utricle appears to be

composed of an enlarged and widened infundibulum,

the uppermost portion of the hair follicle that is con-

nected to the epidermis (Zarach et al., 2004). The utri-

cles also express Keratin 10, which is normally only

expressed in the interfollicular epidermis (Zarach et al.,

2004). Thus, the utricle might ‘bridge’ the hair follicle

with the interfollicular epidermis.

Like Hairless, Adam10 also plays a critical role in

keratinocytes. Using Keratin 14-cre, the effects of

Adam10 loss after E9.5 were studied using a conditional

Adam10 knockout allele (Weber et al., 2011). Keratin

14-cre ⁄ +; Adam10tm2Psa ⁄ Adam10tm2Psa homozygous

knockout mice die soon after birth because of a skin

barrier defect in the spinous layer. Sebaceous glands

are not visible in the skin. Knockout beginning at P21

causes hair follicles to be replaced with cysts, through

disturbed differentiation. There were no obvious

changes in skin pigmentation reported following

Adam10 knockout in keratinocytes.

Lethality at E9.5 is likely due to a failure of notch sig-

naling in Adam10 homozygous mutant embryos (Hart-

mann et al., 2002). The Notch signaling pathway is also

required for maintaining melanocyte stem cells in the

hair follicle bulge region (Aubin-Houzelstein et al., 2008).

Mutations in Notch receptors or ligands cause a loss of

melanocytes (premature hair graying), the opposite

effect of the Pied mutation, which is to increase mela-

nocyte numbers in the skin (Moriyama et al., 2006;

Schouwey et al., 2007). Therefore, it does not seem

likely that Adam10Pied causes macules through

decreased production of NICD.

Interestingly, Adam10 also act as a sheddase for

Delta proteins, which serve as Notch ligands (Muraguchi

et al., 2007). Shedding of ligand from the cell membrane

reduces Notch receptor activation, and we hypothesized

that decreased Adam10 activity might actually increase

Notch signaling. However, expressing the NICD in mela-

nocytes on a HairlessHr ⁄ HairlessHr background did not

cause macules to form (C. Van Raamsdonk, personal

observation).

In the future, tissue-specific Adam10 haploinsufficien-

cy could be made on a HairlessHr ⁄ HairlessHr background

to determine whether Adam10 acts cell autonomously

in melanocytes or keratinocytes to cause macules. Simi-

larly, tissue-specific knockouts of the Hairless gene

could address whether Hairless is required in the outer

root sheath, the suprabasal layer, or melanocytes to per-

mit hyperpigmentation. These findings could help nar-

row down the search for the target of Adam10 cleavage

that mediates macule formation and clarify the role of

Hairless in regulating melanocytes.

The hair follicle serves as a reservoir for melanocytes

in the skin because it supplies a niche for melanocyte

stem cells in the outer root sheath bulge (Nishimura

et al., 2002). Repigmentation of human skin from hair

follicle melanocytes has been described in a few cases

of vitiligo, a complex disease in which epidermal mela-

nocytes are destroyed (Cui et al., 1991). Our results

indicate that Hairless and Adam10 might be useful tar-

gets with which to stimulate the expansion of melano-

cytes in the adult epidermis.

Methods

Mouse strains and genotypingPied arose spontaneously on the HRA ⁄ Skh genetic background,

which is homozygous for HairlessHr (Stoye et al., 1988; Sumner,

1924). Krt14-KitL transgenic mice (Tg(Krt14-KitL)4XTG2Bjl ⁄ J),

Adam10Tm1Psa (Hartmann et al., 2002) and Cd44tm1Hbg (Protin et al.,

1999) knockout mice were maintained on a C57Bl ⁄ 6J background,

and Dct-LacZ transgenic mice (Tg(Dct-LacZ)A12Jkn), a gift of Ian

Jackson (Mackenzie et al., 1997; Takemoto et al., 2006), were

maintained on a C3HeB ⁄ FeJ background. Ear notch sample DNA

was purified using columns (Qiagen DNeasy) and amplified

using PCR (Qiagen, Hilden, Germany). The reaction conditions

were 0.25 mM each dNTPs, 1 U Hotstar Taq (Qiagen), 1· Hotstar

Taq buffer (Qiagen), and 0.5 lM each primer. PCR consisted

of 35 cycles of 95� (30 s), 58� (1 min), and 72� (1 min). The

following primers were used for genotyping: Adam10Pied2L, 5¢-GGGAACTTTCGGGATAGCAT, Adam10Pied2R, 5¢-TTAGTGTTTTCC

CCCACAGC, Hairless mutant L, 5¢-GGGTCTCCTCAGATTGATTGAC,

Hairless mutant R, 5¢-CCATGGCCAGATTTAACACA, Hairless wild

type L, 5¢-CAGGGAGAAAACAGGTGAGG, Hairless wild type R, 5¢-ACTTGCTGTTGAGGGTCCAG, Cd44 wild type L, 5¢-TTCAACCCA-

GAGGCATCC, Cd44 wild type R, 5¢-GGCGACTAGATCCCTCCGTT,

Cd44 mutant L, 5¢-CTTGGGTGGAGAGGCTATTC, Cd44 mutant R,

5¢-AGGTGAGATGACAGGAGATC, Dct-LacZ DRp (Takemoto et al.,

2006), 5¢-CATTCATCGTCTCTCAGGAAT, Dct-LacZ LFp, 5¢-CAG-

GACACGGCTTGTCATCAT, Dct-LacZ LRp, 5¢-CCACACAGACACC-

TACCACATGCGT, Adam10 knockout neo kiel 3, 5¢-GTTG

TCACTGAAGCGGGAAGGGACTGGCTG, Adam10 knockout neo kiel

4, 5¢-GCGAACAGTTCGGCTGGCGCGAGCCCCTGA.

Positional cloning of PiedHairlessHr ⁄ HairlessHr; Adam10Pied ⁄ + animals were crossed to Cas-

t ⁄ EiJ (Jackson Laboratories) and backcrossed to HairlessHr ⁄ + ani-

mals, which were produced by crossing HRA ⁄ Skh mice to

C3HeB ⁄ FeJ (Jackson Laboratories, Bar Harbor, ME, USA). Ten Hair-

lessHr ⁄ HairlessHr; Adam10Pied ⁄ + progeny with macules were

selected for a genome scan using SSLP makers spaced every 30 cM,

and subsequently, 138 total mapping progeny were typed with 18

additional SSLP markers in the region showing linkage on chromo-

some 9. Marker sequences are available upon request. For sequenc-

ing, PCRs were purified using columns and then used as templates

for sequencing reactions using Big Dye (ABI), which were performed

in both directions.

Reverse transcription-PCRWe isolated total RNA from cultured melan-a mouse immortalized

melanocytes (Bennett et al., 1987) and neonatal trunk skin dis-

sected from C3HeB ⁄ FeJ mice using Rneasy (Qiagen). 350 ng of

RNA was reverse transcribed and amplified using One Step RT-

PCR (Life Technologies, Carlsbad, CA, USA). Primers spanning

introns were used as follows: Adam10L, 5¢-TGAAGGATTAT

CTTACAATGTGGA, Adam10R, 5¢-AAAGGGAAGTGTCCCTCTTCA,

Krt5L, 5¢-ACCTTCGAAACACCAAGCAC, Krt5R, 5¢-TCCTCCAG

CTCTGTCAGCTT, DCT-L, 5¢-AGCAGACGGAACACTGGACT, DCT-R,

5¢-GCATCTGTGGAAGGGTTGTT, Gapdh-L, 5¢-AACTTTGGCATTGTG-

GAAGG, Gapdh-R, 5¢-ATGTAGGCCATGAGGTCCAC.



HistologyTrunk skin from 6-month-old animals was removed, fixed in 4%

paraformaldehyde, and embedded in paraffin. Eight-micron sec-

tions were cut, stained with hematoxylin and eosin, and exam-

ined by light microscopy. To assess the number of melanocytes

in the epidermis of Dct-LacZ transgenic mice, we dissected trunk

skin and adhered it epidermis-side down on a glass slide with

vacuum grease. The samples were incubated in 2 M sodium bro-

mide for 1 h at 37 Celsius. The dermis was peeled away, and the

epidermis was rinsed in PBS and stained for 16 h at 25�C in buf-

fer containing 100 mM sodium phosphate (pH 7.3), 2 mM MgCl2,

0.01% sodium deoxycholate, 0.02% NP-40, 5 mM potassium fer-

ricyanide, 5 mM potassium ferrocyanide, 1 mg ⁄ ml 5-bromo-4-

chloro-3-indolyl-b-D-galactopyranoside (X-gal), and 2.5% dimethyl-

formamide. Epidermal sheets were photographed using stereomi-

croscopy, and areas were calculated using IMAGE J (National

Institutes of Health, Bethesda, MD, USA). For tail scale

pigmentation, pieces of 3-week-old tail skin were removed,

adhered epidermis-side down to a glass slide with vacuum

grease, and incubated in 2 M sodium bromide for 2 h at 37�C.

The dermis was removed, the epidermis was photographed, and

the pixel intensity of each tail skin sample was determined using

Image J. For all histological examinations, at least three individu-

als of each genotype were examined.

Statistical analysisError bars represent the standard error of the mean. P values were

calculated using Student’s t-test (melanocyte density, tail scale

analysis) or chi-square analysis (embryonic lethality).

Acknowledgements

We thank Dr. Dorothy Bennet for melan-a cells (Bennett et al.,

1987). Funding for this research was provided by a Canadian

Cancer Society grant to Dr. Van Raamsdonk (019055). Paul Saftig

was supported through a grant from the Deutsche Forschungs-

gemeinschaft (DFG, SFB877-A3) and the Interuniversity Attraction

Poles Program IUAP P6 ⁄ 58 of the Belgian Federal Science Policy

Office.

References

Ahrens, T., Assmann, V., Fieber, C., Termeer, C., Herrlich, P., Hof-

mann, M., and Simon, J.C. (2001). CD44 is the principal mediator

of hyaluronic-acid-induced melanoma cell proliferation. J. Invest.

Dermatol. 116, 93–101.

Anderegg, U., Eichenberg, T., Parthaune, T. et al. (2009). ADAM10

is the constitutive functional sheddase of CD44 in human mela-

noma cells. J. Invest. Dermatol. 129, 1471–1482.

Aubin-Houzelstein, G., Djian-Zaouche, J., Bernex, F., Gadin, S., Del-

mas, V., Larue, L., and Panthier, J.J. (2008). Melanoblasts’ proper

location and timed differentiation depend on Notch ⁄ RBP-J signal-

ing in postnatal hair follicles. J. Invest. Dermatol. 128, 2686–2695.

Beaudoin 3rd, G.M., Sisk, J.M., Coulombe, P.A., and Thompson,

C.C. (2005). Hairless triggers reactivation of hair growth by pro-

moting Wnt signaling. Proc. Natl Acad. Sci. USA 102, 14653–

14658.

Bennett, D.C., Cooper, P.J., and Hart, I.R. (1987). A line of non-

tumorigenic mouse melanocytes, syngeneic with the B16 mela-

noma and requiring a tumour promoter for growth. Int. J. Cancer

39, 414–418.

Bernerd, F., Schweizer, J., and Demarchez, M. (1996). Dermal

cysts of the rhino mouse develop into unopened sebaceous

glands. Arch. Dermatol. Res. 288, 586–595.

Botchkareva, N.V., Ahluwalia, G., and Shander, D. (2006). Apopto-

sis in the hair follicle. J. Invest. Dermatol. 126, 258–264.

Chantry, A., and Glynn, P. (1990). A novel metalloproteinase origi-

nally isolated from brain myelin membranes is present in many

tissues. Biochem. J. 268, 245–248.

Cotsarelis, G., Sun, T.T., and Lavker, R.M. (1990). Label-retaining

cells reside in the bulge area of pilosebaceous unit: implications

for follicular stem cells, hair cycle, and skin carcinogenesis. Cell

61, 1329–1337.

Cui, J., Shen, L.Y., and Wang, G.C. (1991). Role of hair follicles

in the repigmentation of vitiligo. J. Invest. Dermatol. 97, 410–

416.

Epstein, J.H., and Epstein, W.L. (1963). A study of tumor types

produced by ultraviolet light in hairless and hairy mice. J. Invest.

Dermatol. 41, 463–473.

Faas, L., Venkatasamy, R., Hider, R.C., Young, A.R., and Sou-

myanath, A. (2008). In vivo evaluation of piperine and syn-

thetic analogues as potential treatments for vitiligo using a

sparsely pigmented mouse model. Br. J. Dermatol. 158, 941–

950.

Fahrenholz, F., Gilbert, S., Kojro, E., Lammich, S., and Postina, R.

(2000). Alpha-secretase activity of the disintegrin metalloprotease

ADAM 10. Influences of domain structure. Ann. N. Y. Acad. Sci.

920, 215–222.

Fouladkou, F., Landry, T., Kawabe, H., Neeb, A., Lu, C.,

Brose, N., Stambolic, V., and Rotin, D. (2008). The ubiquitin

ligase Nedd4-1 is dispensable for the regulation of PTEN

stability and localization. Proc. Natl Acad. Sci. USA 105,

8585–8590.

Hartmann, D., De Strooper, B., Serneels, L. et al. (2002). The disin-

tegrin ⁄ metalloprotease ADAM 10 is essential for Notch signalling

but not for alpha-secretase activity in fibroblasts. Hum. Mol.

Genet. 11, 2615–2624.

Hirobe, T. (1984). Histochemical survey of the distribution of the

epidermal melanoblasts and melanocytes in the mouse during

fetal and postnatal periods. Anat. Rec. 208, 589–594.

Klein, T., and Bischoff, R. (2010). Active metalloproteases of the a

disintegrin and metalloprotease (ADAM) family: biological func-

tion and structure. J. Proteome Res. 10, 17–33.

Kunisada, T., Yoshida, H., Yamazaki, H., Miyamoto, A., Hemmi, H.,

Nishimura, E., Shultz, L.D., Nishikawa, S., and Hayashi, S.

(1998). Transgene expression of steel factor in the basal layer of

epidermis promotes survival, proliferation, differentiation and

migration of melanocyte precursors. Development 125, 2915–

2923.

Lieber, T., Kidd, S., and Young, M.W. (2002). kuzbanian-mediated

cleavage of Drosophila Notch. Genes Dev. 16, 209–221.

Lo Celso, C., Prowse, D.M., and Watt, F.M. (2004). Transient acti-

vation of beta-catenin signalling in adult mouse epidermis is suffi-

cient to induce new hair follicles but continuous activation is

required to maintain hair follicle tumours. Development 131,

1787–1799.

Mackenzie, M.A., Jordan, S.A., Budd, P.S., and Jackson, I.J.

(1997). Activation of the receptor tyrosine kinase Kit is required

for the proliferation of melanoblasts in the mouse embryo. Dev.

Biol. 192, 99–107.

Mager, D.L., Henthorn, P.S., and Smithies, O. (1985). A Chinese G

gamma + (A gamma delta beta) zero thalassemia deletion: com-

parison to other deletions in the human beta-globin gene cluster

and sequence analysis of the breakpoints. Nucleic Acids Res. 13,

6559–6575.

Mann, S.J. (1971). Hair loss and cyst formation in hairless and rhino

mutant mice. Anat. Rec. 170, 485–499.

Mayer, T.C. (1973). The migratory pathway of neural crest cells into

the skin of mouse embryos. Dev. Biol. 34, 39–46.

Tharmarajah et al.


Mine, M., Chen, J.M., Brivet, M. et al. (2007). A large genomic

deletion in the PDHX gene caused by the retrotranspositional

insertion of a full-length LINE-1 element. Hum. Mutat. 28, 137–

142.

Mochizuki, S., and Okada, Y. (2007). ADAMs in cancer cell prolifer-

ation and progression. Cancer Sci. 98, 621–628.

Moriyama, M., Osawa, M., Mak, S.S. et al. (2006). Notch sig-

naling via Hes1 transcription factor maintains survival of mel-

anoblasts and melanocyte stem cells. J. Cell Biol. 173, 333–

339.

Muraguchi, T., Takegami, Y., Ohtsuka, T. et al. (2007). RECK modu-

lates Notch signaling during cortical neurogenesis by regulating

ADAM10 activity. Nat. Neurosci. 10, 838–845.

Nagano, O., and Saya, H. (2004). Mechanism and biological signifi-

cance of CD44 cleavage. Cancer Sci. 95, 930–935.

Naganumaa, M., Yagi, E., and Fukuda, M. (2001). Delayed induction

of pigmented spots on UVB-irradiated hairless mice. J. Dermatol.

Sci. 25, 29–35.

Nishimura, E.K., Jordan, S.A., Oshima, H., Yoshida, H., Osawa,

M., Moriyama, M., Jackson, I.J., Barrandon, Y., Miyachi, Y.,

and Nishikawa, S. (2002). Dominant role of the niche in

melanocyte stem-cell fate determination. Nature 416, 854–

860.

Panteleyev, A.A., Botchkareva, N.V., Sundberg, J.P., Christiano,

A.M., and Paus, R. (1999). The role of the hairless (hr) gene in

the regulation of hair follicle catagen transformation. Am. J.

Pathol. 155, 159–171.

Panteleyev, A.A., Paus, R., and Christiano, A.M. (2000). Patterns of

hairless (hr) gene expression in mouse hair follicle morphogene-

sis and cycling. Am. J. Pathol. 157, 1071–1079.

Paus, R., and Cotsarelis, G. (1999). The biology of hair follicles. N.

Engl. J. Med. 341, 491–497.

Plikus, M.V., and Chuong, C.M. (2008). Complex hair cycle domain

patterns and regenerative hair waves in living rodents. J. Invest.

Dermatol. 128, 1071–1080.

Postina, R., Schroeder, A., Dewachter, I. et al. (2004). A disintegrin-

metalloproteinase prevents amyloid plaque formation and

hippocampal defects in an Alzheimer disease mouse model.

J. Clin. Invest. 113, 1456–1464.

Potter, G.B., Beaudoin 3rd, G.M., Derenzo, C.L., Zarach, J.M.,

Chen, S.H., and Thompson, C.C. (2001). The hairless gene

mutated in congenital hair loss disorders encodes a novel nuclear

receptor corepressor. Genes Dev. 15, 2687–2701.

Protin, U., Schweighoffer, T., Jochum, W., and Hilberg, F. (1999).

CD44-deficient mice develop normally with changes in subpopu-

lations and recirculation of lymphocyte subsets. J. Immunol. 163,

4917–4923.

Rabbani, P., Takeo, M., Chou, W., Myung, P., Bosenberg, M., Chin,

L., Taketo, M.M., and Ito, M. (2011). Coordinated activation of

Wnt in epithelial and melanocyte stem cells initiates pigmented

hair regeneration. Cell 145, 941–955.

Ryu, B., Kim, D.S., Deluca, A.M., and Alani, R.M. (2007). Com-

prehensive expression profiling of tumor cell lines identifies

molecular signatures of melanoma progression. PLoS ONE 2,

e594.

Sato, T., and Kawada, A. (1972). Mitotic activity of hairless

mouse epidermal melanocytes: its role in the increase of mela-

nocytes during ultraviolet radiation. J. Invest. Dermatol. 58,

392–395.

Schouwey, K., Delmas, V., Larue, L., Zimber-Strobl, U., Strobl, L.J.,

Radtke, F., and Beermann, F. (2007). Notch1 and Notch2

receptors influence progressive hair graying in a dose-dependent

manner. Dev. Dyn. 236, 282–289.

Seals, D.F., and Courtneidge, S.A. (2003). The ADAMs family of

metalloproteases: multidomain proteins with multiple functions.

Genes Dev. 17, 7–30.

Stenn, K., Parimoo, S., and Prouty, S. (1998). Growth of the

hair follicle: a cycling and regenerating biological system. In

Molecular Basis of Epithelial Appendage Morphogenesis, C.,

Chuong, ed. (Austin, TX: RG Landes Company), 111–130.

Stoye, J.P., Fenner, S., Greenoak, G.E., Moran, C., and Coffin, J.M.

(1988). Role of endogenous retroviruses as mutagens: the

hairless mutation of mice. Cell 54, 383–391.

Sumner, F. (1924). Hairless mice. J. Hered. 15, 475–481.

Takemoto, Y., Keighren, M., Jackson, I.J., and Yamamoto, H.

(2006). Genomic localization of a Dct-LacZ transgene locus: a

simple assay for transgene status. Pigment Cell Res. 19,

644–645.

Van Mater, D., Kolligs, F.T., Dlugosz, A.A., and Fearon, E.R. (2003).

Transient activation of beta -catenin signaling in cutaneous kerati-

nocytes is sufficient to trigger the active growth phase of the

hair cycle in mice. Genes Dev. 17, 1219–1224.

Wan, X.Z., Li, B., Li, Y.C., Yang, X.L., Zhang, W., Zhong, L., and

Tang, S.J. (2012). Activation of NMDA receptors upregulates a

disintegrin and metalloproteinase 10 via a Wnt ⁄ MAPK signaling

pathway. J. Neurosci. 32, 3910–3916.

Weber, S., Niessen, M.T., Prox, J. et al. (2011). The disinte-

grin ⁄ metalloproteinase Adam10 is essential for epidermal

integrity and Notch-mediated signaling. Development 138, 495–

505.

Yamaguchi, Y., Passeron, T., Hoashi, T. et al. (2008). Dickkopf 1

(DKK1) regulates skin pigmentation and thickness by affecting

Wnt ⁄ beta-catenin signaling in keratinocytes. FASEB J. 22, 1009–

1020.

Yoshida, H., Kunisada, T., Kusakabe, M., Nishikawa, S., and Nishik-

awa, S.I. (1996). Distinct stages of melanocyte differentiation

revealed by anlaysis of nonuniform pigmentation patterns. Devel-

opment 122, 1207–1214.

Zarach, J.M., Beaudoin 3rd, G.M., Coulombe, P.A., and Thomp-

son, C.C. (2004). The co-repressor hairless has a role in epi-

thelial cell differentiation in the skin. Development 131, 4189–

4200.

Zhuang, Y., Cheng, P., and Weintraub, H. (1996). B-lymphocyte

development is regulated by the combined dosage of three basic

helix-loop-helix genes, E2A, E2-2, and HEB. Mol. Cell. Biol. 16,

2898–2905.



Adam10 haploinsufficiency causes freckle-like macules in Hairless mice

Documents