Accuracy of PCR targeting different markers for Staphylococcus aureus identification: a comparative study using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry

Accuracy of PCR targeting different markers for Staphylococcus aureus identification: a comparative study using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry as the gold standardBrief Communication
Staphylococcus is a ubiquitous microbial genus comprised of >40 different species colonizing humans and animals.4 Based on the capacity to produce the enzyme coagulase, these organisms are generally classified into 2 major groups: coag- ulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci (https://goo.gl/3nw55T).
Staphylococcus aureus is a typical CoPS and has been frequently associated with nosocomial infections in humans.22 Although reports have highlighted the increasing importance of CoNS species as opportunistic pathogens, S. aureus remains a major disease-causing agent in veterinary medicine.9 Furthermore, the increasing role of animals as sources of methicillin-resistant S. aureus (MRSA), poten- tially pathogenic to humans,23 reinforces the importance of accurately identifying S. aureus.
The isolation of Staphylococcus spp. normally does not represent a challenge for microbiologists, and the subsequent identification of S. aureus is traditionally performed by means of Gram staining, microscopy, and catalase and coag- ulase tests. Although this is a standard procedure in routine veterinary testing,18,24 confirmatory tests are still needed to exclude CoPS strains other than S. aureus, especially in situ- ations where species identification is required. In such cases, phenotypic tests such as carbohydrate fermentation patterns
are performed. However, strain variation related to the capac- ity to metabolize certain sugars has been identified as a cause of misidentification.24,26 Moreover, the identification of Staphylococcus isolates using fermentation-based reactions is expensive, laborious, and time-consuming.26
Among the many microbial identification systems avail- able, matrix-assisted laser desorption/ionization time-of- flight (MALDI-TOF) mass spectrometry has been accepted as a reference identification system in clinical microbiology that provides accurate and very rapid results at a low cost per sample.3 However, the high cost of the equipment12,21 has
732370 VDIXXX10.1177/1040638717732370S. aureus identification by PCR and MALDI-TOFSaraiva et al. research-article2017
Departments of Animal Sciences (Saraiva, De Leon, Santos, Oliveira) and Veterinary Sciences (Stipp), College of Agricultural Sciences, Federal University of Paraiba, Areia, Paraíba, Brazil; Institute of Veterinary Medicine, Federal Rural University of Rio de Janeiro, Seropédica, Rio de Janeiro, Brazil (Souza); Department of Pharmaceutical Sciences, College of Health Sciences, Federal University of Paraiba, João Pessoa, Paraíba, Brazil (Santos Filho); Veterinary Public Health and Biotechnology Global Consortium, The Ohio State University, Columbus, OH (Gebreyes, Oliveira).
1Corresponding author: Celso J. Oliveira, Department of Animal Sciences, Agricultural Sciences Center, Federal University of Paraíba, 58397-000, Areia, PB, Brasil. [email protected]
Accuracy of PCR targeting different markers for Staphylococcus aureus identification: a comparative study using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry as the gold standard
Mauro M. Saraiva, Candice M. De Leon, Silvana C. Santos, Danilo T. Stipp, Miliane M. Souza, Lauro Santos Filho, Wondwossen A. Gebreyes, Celso J. Oliveira1
Abstract. Staphylococcus aureus is considered a major pathogen in veterinary and human medicine, and the emergence of multidrug-resistant strains, such as livestock-associated methicillin-resistant S. aureus, means that reliable, inexpensive, and fast methods are required to identify S. aureus obtained from animal sources. We tested the accuracy of a PCR targeting the genes femA, nuc, and coa in identifying S. aureus from animals. A total of 157 Staphylococcus spp. isolates were examined by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry; 18 different Staphylococcus species were identified. Of 68 S. aureus isolates, the genes femA, nuc, and coa were found in 61, 53, and 32 isolates, respectively. Considering MALDI-TOF as the gold standard, the PCR assays targeting all 3 genes showed 100% specificity; the sensitivity values were 89.7, 77.9, and 47.0% for femA, nuc, and coa, respectively. Sensitivity was 100% when femA and nuc markers were targeted simultaneously. These results confirm PCR as an accurate method to identify S. aureus species from animal sources and strongly suggest the simultaneous use of primers targeting femA and nuc genes.
Key words: coa; femA; MALDI-TOF; molecular identification; nuc.
S. aureus identification by PCR and MALDI-TOF 253
been a factor, limiting the use of this technology in veteri- nary diagnostic laboratories.
Alternatively, PCR has been extensively used and recom- mended as a reliable approach in the identification of Staphy- lococcus species.6,10,17,19,20 Using MALDI-TOF as the gold standard for identification of S. aureus from animal sources, we therefore investigated the accuracy of PCR using 3 differ- ent targets: the thermonuclease gene (nuc), the aminoacyl transferase FemA gene (femA), and the coagulase gene (coa).
A total of 157 Staphylococcus spp. isolates, including CoPS (n = 74) and CoNS (n = 83), were randomly selected from the microbiologic bank of the Laboratory for Food Safety at the College of Agricultural Sciences of the Federal University of Paraiba (Brazil). The isolates originated from cows (n = 5), goats (n = 100), horses (n = 13), pigs (n = 38), and a bird (n = 1), and were cultured by means of conven- tional microbiologic procedures using mannitol salt agar and Columbia blood agar base supplemented with 5% sheep blood. Presumptive isolates were subjected to staining, and tests for catalase, oxidase, and coagulase, according to refer- ence procedures.18
A MALDI-TOF system (Vitek MS, bioMérieux, Mercy l’Etoile, France) was used as the gold standard in our inves- tigation. The identification was performed at the Department of Clinical and Toxicological Sciences, University of São Paulo (Brazil). Briefly, isolates were streaked onto trypticase soy agar (TSA) for 24 h at 37°C and 3–5 colonies transferred to 1 of the 48 wells of the standard steel plate. The samples were covered by the matrix solution of α-cyano-4- hydroxycinnamic acid and dried at room temperature. The prepared plates were placed into the equipment, and the mass spectrum was analyzed and compared with the on-board database.
For PCR analysis, DNA was extracted by a crude lysate method,2 with some modifications. Briefly, 3–5 colonies were resuspended in 100 µL of purified water, frozen for 10 min, and immediately boiled at 100°C for 10 min. Afterwards, samples were centrifuged (12,902 × g, 4°C, 3 min), and the supernatant (~85 µL) was carefully pipetted and transferred to a new DNase-free tube and stored at 4°C until use (within 1 wk). The master mix was prepared in a 25-µL volume using 1 U of Taq DNA polymerase (LGC Biotechnology, Middlesex,
England), 2 mM MgCl 2 , 200 µM of each dNTPs (Thermo
Fisher Scientific, Waltham, MA), 10 pmol of each oligonu- cleotide primer, and 2 µL of DNA template. The oligonucle- otide primer sequences targeting the S. aureus–specific genes femA, nuc, and coa, and the respective cycling conditions used for S. aureus identification are shown in Table 1. The sequences were analyzed using Primer Blast (https://goo. gl/2DLYDn), and homology with S. aureus only was con- firmed.
The PCR assays targeting the genes femA and nuc were performed simultaneously in a duplex PCR assay. A refer- ence S. aureus strain (USA 400) harboring the 3 genes, kindly provided by the Infectious Diseases Molecular Epide- miology Laboratory of The Ohio State University, was used as control in all PCR assays. Amplification products were electrophoresed in 2% agarose gel, stained (GelRed, Bio- tium, Hayward, CA), visualized under ultraviolet light, and documented (Gel Logic 212 PRO v.5.0, Carestream Health, Rochester, NY).
The correlation among the PCR assays targeting the genes femA, nuc, and coa was determined by the Cohen kappa index of concordance using interpretation criteria (Supple- mentary Table 1) that have been established previously.13 The sensitivity and specificity values for S. aureus identifica- tion by PCR were calculated based on presence of femA, nuc, and coa, and using MALDI-TOF as the reference stan- dard.
Of the 74 CoPS isolates, 68 were identified as S. aureus by MALDI-TOF. The other 6 CoPS were identified as S. hyicus (2), S. intermedius (2), and S. pseudintermedius (2). Among the 83 CoNS isolates, the following species were identified: S. caprae (21), S. chromogenes (13), S. sciuri (12), S. epidermidis (8), S. simulans (7), S. cohnii subsp. coh- nii (6), S. warneri (5), S. pasteuri (2), S. xylosus (2), S. sap- rophyticus (2), S. capitis (2), S. lentus (1), S. lugdunensis (1), and S. haemolyticus (1). Detailed information about the iso- lates investigated in our study is shown in Supplementary Table 2.
Among the S. aureus isolates, 61 of 68 (90%) were posi- tive for femA and 53 (78%) were positive for nuc. However, only 32 (47%) S. aureus isolates were positive for coa. No Staphylococcus species other than S. aureus (as identified by
Table 1. Primers and cycling conditions used in the identification of Staphylococcus aureus.
Gene Amplicon size (bp) Oligonucleotide primer sequences (5’–3’) Cycling conditions* Reference
femA 132 F: AAAAAAGCACATAACAAGCG 2 16 R: GATAAAGAAGAAACCAGCAG nuc 279 F: GCGATTGATGGTGATACGGTT 2 5 R: AGCCAAGCCTTGACGAACTAAAGC coa Variable F: ATAGAGATGCTGGTACAGG 1 10 R: GCTTCCGATTGTTCGATGC
* Condition 1 = 94°C for 4 min, then 94°C for 1 min, 60°C for 1 min, 72°C for 1 min for 30 cycles, and 72°C for 5 min. Condition 2 = 94°C for 5 min, then 94°C for 40 s, 58°C for 40 s, 72°C for 1 min for 10 cycles, then 94°C for 1 min, 50°C for 1 min, 72°C for 2 min for 25 cycles, and 72°C for 10 min.
Saraiva et al.254
MALDI-TOF) harbored any of the 3 genes, indicating PCR assays targeting those markers were highly specific (100%).
Based on the targeted genes, 6 different patterns were detected among the isolates (Table 2). The nuc-femA-coa combination was the most frequent (44%) pattern; femA-coa and nuc-coa patterns were each detected in just 1 (1.5%) iso- late (Table 2). According to the Cohen kappa coefficient (p < 0.001), a moderate (54.5%) agreement was observed between femA-coa; substantial agreements (64%, 62%, and 70%) were observed between nuc-coa, nuc-femA-coa, and nuc- femA, respectively (Supplementary Table 3). The PCR tar- geting femA and nuc genes had sensitivity values of 90% and 78%, respectively; the sensitivity of the PCR detecting coa was only 47%. When more than 1 marker was used, and a positive in either marker regarded as confirmed identifica- tion, the PCR targeting femA and nuc showed 100% sensitiv- ity, but only 91.2% and 79.4% when targeting femA and coa and nuc and coa, respectively (Table 3).
The high frequency of femA in S. aureus isolates is in accordance with previous studies showing that the occur- rence of this gene varies from 72.5% to 100% in S. aureus.11,15 The gene nuc has been shown to be S. aureus specific20 and has been reported to occur in all S. aureus isolates.5,14 Although the frequency of nuc among S. aureus in our study was high, some isolates were not positive for the gene, sug- gesting that misidentification by PCR could be related to
deletions or mutations occurring in the gene, as previously reported.8
The low frequency of coa among S. aureus in our study was unexpected. Coagulase production is regulated by this gene in S. aureus.16 The gene is associated with the capacity of the pathogen to coagulate fibrin and therefore plays a key role in the pathogenesis of the agent by conferring protec- tion against host immune defense mechanisms and in bio- film production.26 Using the same primers as in our study, a high frequency of coa gene in bovine S. aureus was reported in a 2014 study.6 After excluding potential bias in the PCR assay by exhaustively testing different DNA extraction methods, master mix, and cycling conditions, we suggest that the low frequency of this gene might be associated with coa gene polymorphisms. Polymorphisms of the coa gene have been reported in S. aureus from different sources and animal species.1,7
The results of our investigation confirm the high speci- ficity of PCR targeting femA, nuc, and coa and support the use of femA and nuc as a means to identify S. aureus spe- cies. These findings are of importance for clinical veterinary diagnostic laboratories, where PCR techniques have been extensively used, particularly with the continued reduction in the associated operating costs of the assay.25 The precise identification of S. aureus is of key importance for the appropriate monitoring of strains resistant to antimicrobial
Table 2. Genotypic patterns of 68 Staphylococcus aureus isolates based on detection of the femA, nuc, and coa genes.
Genotypic pattern femA nuc coa No. of isolates and relative frequency
1 + + + 30 (44) 2 + + − 16 (24) 3 + – − 14 (21) 4 − + − 6 (8.8) 5 + − + 1 (1.5) 6 – + + 1 (1.5) Total 68 (100)
+ = positive; – = negative. Numbers in parentheses are percentages.
Table 3. Sensitivity and specificity values for Staphylococcus aureus identification by PCR based on the detection of the genes femA, nuc, and coa and using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry as the reference method. The panel used for this study comprised 157 isolates including S. aureus (n = 68) and coagulase-positive and -negative species other than S. aureus (n = 89).
Targeted gene(s) in the PCR Sensitivity (%) Specificity (%) Positive predictive
value (%) Negative predictive
value (%)
femA 90 100 100 93 nuc 78 100 100 86 coa 47 100 100 71 femA-nuc 100 100 100 100 femA-coa 91 100 100 94 nuc-coa 79 100 100 86 femA-nuc-coa 100 100 100 100
S. aureus identification by PCR and MALDI-TOF 255
agents, especially in the context of the emergence of MRSA in livestock and companion animals that are potentially pathogenic to humans.
Acknowledgments
We thank Prof. Jorge L M Sampaio from the Department of Clini- cal and Toxicological Sciences, College of Pharmaceutical Sci- ences, University of São Paulo, for kindly providing identification of isolates by means of MALDI-TOF.
Declaration of conflicting interests
The author declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding
Our study was supported by the National Council for Scientific and Technological Development (CNPq) and the Coordination for the Improvement of Higher Education Personnel (CAPES).
References
1. Aarestrup FM, et al. Prevalence of coagulase gene polymor- phism in Staphylococcus aureus isolates causing bovine masti- tis. Can J Vet Res 1995;59:124–128.
2. Adwan K. Fast DNA isolation and PCR protocols for detec- tion of methicillin-resistant staphylococci. Folia Microbiol 2013;59:5–8.
3. Alatoom AA, et al. Comparison of direct colony method ver- sus extraction method for identification of gram-positive cocci by use of Bruker Biotyper matrix-assisted laser desorption ionization–time of flight mass spectrometry. J Clin Microbiol 2011;49:2868–2873.
4. Barun M, et al. Evolution and taxonomy of Staphylococci. In: Crossley KB, et al., eds. Staphylococci in human disease. 2nd ed. Chichester, UK: Wiley, 2009:31–64.
5. Brakstad OG, et al. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol 1992;30:1654–1660.
6. da Motta CC, et al. Verification of molecular characterization of coagulase positive Staphylococcus from bovine mastitis with matrix-assisted laser desorption ionization, time-of-flight mass spectrometry (MALDI-TOF MS) mass spectrometry. Afr J Microbiol Res 2014;8:3861–3866.
7. da Silva ER, et al. Coagulase gene polymorphism of Staphylococcus aureus isolated from goat mastitis in Brazilian dairy herds. Lett Appl Microbiol 2006;42:30–34.
8. Giannouli S, et al. Detection of mutations in the FemXAB protein family in oxacillin-susceptible mecA-positive Staphylococcus aureus clinical isolates. J Antimicrob Chemother 2010;65:626–633.
9. Hermans K, et al. Staphylococcus In: Gyles CL, et al., eds. Pathogenesis of Bacterial Infections in Animals. 4th ed. Hoboken, NJ: Wiley-Blackwell, 2010:75–90.
10. Jousson O, et al. Genotypic versus phenotypic identification of staphylococcal species of canine origin with special reference to Staphylococcus schleiferi subsp. coagulans. Vet Microbiol 2007;123:238–244.
11. Kobayashi N, et al. Detection of mecA, femA, and femB genes in clinical strains of staphylococci using polymerase chain reaction. Epidemiol Infect 1994;113:259–266.
12. Lagacé-Wiens PRS, et al. Identification of blood culture iso- lates directly from positive blood cultures by use of matrix- assisted laser desorption ionization–time of flight mass spectrometry and a commercial extraction system: analysis of performance, cost, and turnaround time. J Clin Microbiol 2012;50:3324–3328.
13. Landis JR, Koch GG. An application of hierarchical kappa- type statistics in the assessment of majority agreement among multiple observers. Biometrics 1977;33:363–374.
14. Madison BM, Baselski VS. Rapid identification of Staphylococcus aureus in blood cultures by thermonuclease testing. J Clin Microbiol 1983;18:722–724.
15. Mehrotra M, et al. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol 2000;38:1032–1035.
16. Moreillon P, et al. Role of Staphylococcus aureus coagulase and clumping factor in pathogenesis of experimental endocar- ditis. Infect Immun 1995;63:4738–4743.
17. Pérez-Roth E, et al. Multiplex PCR for simultaneous identifica- tion of Staphylococcus aureus and detection of methicillin and mupirocin resistance. J Clin Microbiol 2001;39:4037–4041.
18. Quinn PJ, et al. Staphylococcus species. In: Quinn PJ, ed. Clinical Veterinary Microbiology. 1st ed. London, England: Mosby-Year, 1994:118–126.
19. Sakai H, et al. Simultaneous detection of Staphylococcus aureus and coagulase-negative Staphylococci in positive blood cultures by real-time PCR with two fluorescence resonance energy transfer probe sets. J Clin Microbiol 2004;42:5739– 5744.
20. Sasaki T, et al. Multiplex-PCR method for species identifi- cation of coagulase-positive staphylococci. J Clin Microbiol 2010;48:765–769.
21. Seng P, et al. MALDI-TOF-mass spectrometry applications in clinical microbiology. Future Microbiol 2010;5:1733–1754.
22. Simor AE, Loeb M. Epidemiology of healthcare-associated Staphylococcus aureus Infections. In: Crossley KB, et al., eds. Staphylococci in Human Disease. 2nd ed. Chichester, UK: Wiley, 2009:290–309.
23. Van der Mee-Marquet NL, et al. Emergence of a novel subpopulation of CC398 Staphylococcus aureus infecting animals is a serious hazard for humans. Front Microbiol 2014;5:1–9.
24. Winn WC Jr, et al. Coccus: gram-positive. In: Koneman EW, ed. Color Atlas and Textbook of Diagnostic Microbiology. 6th ed. Philadelphia, PA: Lippincott Williams & Wilkins 2006:414–415.