ABCB5 Identifies a Therapy-Refractory Tumor Cell Population in Colorectal Cancer Patients

$Page 1: ABCB5 Identifies a Therapy-Refractory Tumor Cell Population in Colorectal Cancer Patients$

2011;71:5307-5316. Published OnlineFirst June 7, 2011.Cancer Res Brian J. Wilson, Tobias Schatton, Qian Zhan, et al. Colorectal Cancer PatientsABCB5 Identifies a Therapy-Refractory Tumor Cell Population in

Updated Version 10.1158/0008-5472.CAN-11-0221doi:

Access the most recent version of this article at:

MaterialSupplementary

http://cancerres.aacrjournals.org/content/suppl/2011/06/07/0008-5472.CAN-11-0221.DC1.htmlAccess the most recent supplemental material at:

Cited Articles http://cancerres.aacrjournals.org/content/71/15/5307.full.html#ref-list-1

This article cites 39 articles, 14 of which you can access for free at:

Citing Articles http://cancerres.aacrjournals.org/content/71/15/5307.full.html#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

[email protected] atTo order reprints of this article or to subscribe to the journal, contact the AACR Publications

[email protected]

To request permission to re-use all or part of this article, contact the AACR Publications Department at

American Association for Cancer Research Copyright © 2011 on August 1, 2012cancerres.aacrjournals.orgDownloaded from

Published OnlineFirst June 7, 2011; DOI:10.1158/0008-5472.CAN-11-0221

http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-11-0221

http://cancerres.aacrjournals.org/content/suppl/2011/06/07/0008-5472.CAN-11-0221.DC1.html

http://cancerres.aacrjournals.org/content/71/15/5307.full.html#ref-list-1

http://cancerres.aacrjournals.org/content/71/15/5307.full.html#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]

http://cancerres.aacrjournals.org/

http://www.aacr.org/

Tumor and Stem Cell Biology

ABCB5 Identifies a Therapy-Refractory Tumor CellPopulation in Colorectal Cancer Patients

Brian J. Wilson1,2, Tobias Schatton1,2, Qian Zhan3, Martin Gasser9, Jie Ma1,2, Karim R. Saab1,2,Robin Schanche3, Ana-Maria Waaga-Gasser9, Jason S. Gold4,6, Qin Huang7, George F. Murphy3,Markus H. Frank1,2, and Natasha Y. Frank1,5,8

AbstractIdentification and reversal of treatment resistance mechanisms of clinically refractory tumor cells is

critical for successful cancer therapy. Here we show that ATP-binding cassette member B5 (ABCB5) identifiestherapy-refractory tumor cells in colorectal cancer patients following fluorouracil (5-FU)–based chemor-adiation therapy and provide evidence for a functional role of ABCB5 in colorectal cancer 5-FU resistance.Examination of human colon and colorectal cancer specimens revealed ABCB5 to be expressed only on rarecells within healthy intestinal tissue, whereas clinical colorectal cancers exhibited substantially increasedlevels of ABCB5 expression. Analysis of successive, patient-matched biopsy specimens obtained prior toand following neoadjuvant 5-FU–based chemoradiation therapy in a series of colorectal cancer patientsrevealed markedly enhanced abundance of ABCB5-positive tumor cells when residual disease was detected.Consistent with this finding, the ABCB5-expressing tumor cell population was also treatment refractory andexhibited resistance to 5-FU–induced apoptosis in a colorectal cancer xenograft model of 5-FU monotherapy.Mechanistically, short hairpin RNA–mediated ABCB5 knockdown significantly inhibited tumorigenic xeno-graft growth and sensitized colorectal cancer cells to 5-FU–induced cell killing. Our results identify ABCB5as a novel molecular marker of therapy-refractory tumor cells in colorectal cancer patients and point to aneed for consistent eradication of ABCB5-positive resistant tumor cell populations for more effectivecolorectal cancer therapy. Cancer Res; 71(15); 5307–16. �2011 AACR.

Introduction

Colorectal cancer is a leading cause of cancer-relatedmortality. It arises from the accumulation of genetic muta-tions in normal epithelium, leading to the development ofadenomas with eventual neoplastic transformation intoinvasive, metastatic carcinomas (1). Despite significant pro-gress in early detection and treatment of colorectal cancer, ahigh proportion of patients with surgically resectable tumors

eventually succumb to metastatic disease originating fromresidual microscopic malignancy, not evident at the timeof surgery (1, 2). Adjuvant therapeutic modalities such asradiotherapy and chemotherapy are designed to target resi-dual tumor cells; however, their success is currently limitedby the existence of therapy-resistant cancer cell populations(2–4).

Fluorouracil (5-FU) is one of the main chemotherapeuticagents for colorectal cancer. In patients with advanced color-ectal cancer, treatment with 5-FU reduces tumor size byapproximately 50 % and prolongsmedian survival by 5months(5). Identification and targeting of 5-FU–resistant populationsmight, therefore, be expected to lead to further improvementsin advanced colorectal cancer survival.

Recent studies have revealed heterogeneity of humancolorectal cancers with regard to molecular markers thatidentify highly tumorigenic and potentially therapy-resistantcancer subpopulations, including CD133, ESAhighCD44þ,CD166, ALDH1, and WNT (6–10). For example, in vitrotreatment of human HT-29 colorectal cancer cells with highdoses of 5-FU resulted in significant enrichment of CD133þ

colorectal cancer subpopulations (11) and CD133þ color-ectal cancer cells can be sensitized to 5-FU- or oxaliplatin-mediated cell killing by using an anti–IL-4 neutralizingantibody (12) or specific gene silencing of the aurora-Akinase (13). In addition, CD133-overexpressing tumors were

Authors' Affiliations: 1Transplantation Research Center, Children's Hos-pital Boston, Harvard Medical School; Departments of 2Dermatology,3Pathology and 4Surgery; 5Division of Genetics, Brigham & Women'sHospital, Harvard Medical School; 6Surgical Service; Departments of7Pathology and 8Medicine, VA Boston Healthcare System, Boston,Massachusetts; and 9Department of Surgery, University of W€urzburg,W€urzburg, Germany

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

B.J. Wilson and T. Schatton contributed equally to this work.

Corresponding Author:Markus H. Frank, Transplantation Research Cen-ter, Children's Hospital Boston, 300 Longwood Avenue, Boston, MA02115. Phone: 1-617-919-2993; Fax: 1-617-730-0129; E-mail: [email protected] or Natasha Y. Frank, Department of Medi-cine, VA Boston Healthcare System, 1400 VFW Parkway, Boston, MA02132; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-11-0221

�2011 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 5307





found to be more resistant to 5-FU–based chemotherapyand CD133 expression was associated with poor prognosis ina recent study of 501 cases of human colorectal cancer (14).Although additional studies are required to further delineatewhether all heterogeneously expressed colorectal cancermarkers (6–10, 15) identify hierarchical tumor organization,as posited by the cancer stem cell model (16), and whilemore work is necessary to define their specific relationships,the data to date suggest preferential survival of CD133þ

colorectal cancer cells following chemotherapy and under-line the importance of identifying and, ultimately, targetingall possible resistance mechanisms of these aggressivetumor subpopulations (2, 3).

We have recently cloned and characterized ABCB5 [ATP-binding cassette, sub-family B (MDR/TAP), member 5; refs.17–22], a chemoresistance gene in human melanomas (18, 23,24) and hepatocellular carcinomas (25) preferentiallyexpressed on CD133þ tumor cells (18, 25), which correlateswith clinical tumor progression in these malignancies accord-ing to results from several laboratories (19, 25–27) and servesas a major independent biomarker of tumor recurrence andpoor survival in human hepatocellular carcinoma patients(25). Our previous analysis of mRNA expression across diversephysiologic and malignant human tissues showed that ABCB5is also expressed in human colorectal cancer (18). Therefore,we hypothesized that ABCB5 might identify therapy-refrac-tory tumor populations in patients with colorectal cancer andthat ABCB5, similar to its role in melanoma (23), mightcontribute to 5-FU resistance in this malignancy. Our resultsidentify ABCB5 overexpression in clinical colorectal cancerscompared with healthy controls and show that ABCB5 markstherapy-refractory tumor subpopulations following neo-adjuvant 5-FU–based chemoradiation treatment in colorectalcancer patients. Mechanistically, utilization of a colorectalcancer xenotransplantation model reveals resistance ofABCB5þ tumor subpopulations to 5-FU–induced apoptosis.Moreover, stable short hairpin RNA (shRNA)-mediated ABCB5knockdown in human colorectal cancer cells enhances 5-FU–mediated cell killing.

Materials and Methods

Clinical colorectal cancer specimensClinical colorectal tumor specimens were obtained from

patients according to human subjects research protocolsapproved by institutional IRBs at the VA Boston HealthcareSystem and the University of W€urzburg Medical School.Baseline ABCB5 expression was examined in tumors ofdiverse stages resected from 15 patients not subjected topreoperative treatment (Supplementary Table S1). In addi-tion, patient-matched biopsy specimens derived from 7rectal cancer patients prior to and following neoadjuvanttreatment with chemoradiation (bolus 5-FU treatment andlong-course 40–52 Gy total dose radiotherapy) and subse-quent curative surgical resection were included in the study(Supplementary Table S2) for analysis of ABCB5 expressionin pretreatment tumor biopsies and posttreatment surgi-cally resected tumors.

Colorectal cancer cells and culture methodsAuthenticated human colorectal cancer cell lines (HT-29

and SW480) were obtained from American Type CultureCollection and were cultured and passaged for fewer than6 months in RPMI 1640 medium (Lonza Bio-Whittaker)supplemented with 10% (v/v) FBS (Invitrogen GIBCO) and1% (v/v) penicillin/streptomycin (Lonza Bio-Whittaker).COLO205, HCT-116, HCT-15, HT-29, HCC-2998, KM12, andSW620 mRNA specimens were provided by the NCI/NIHDevelopmental Therapeutics Program.

AntibodiesThe anti-ABCB5 monoclonal antibody (mAb) 3C2-1D12

(17–19), commercially available from AbD Serotec, was usedfor flow cytometric and immunohistochemical analyses.Unconjugated MOPC-31C mouse isotype control mAb waspurchased from BD Pharmingen and APC-conjugated second-ary Ab from eBioscience. For Western blots, the followingpolyclonal Abs (pAbs) were used: rabbit anti-human ABCB5(Abgent), rabbit anti-human a-Tubulin (Abcam), and horse-radish peroxidase (HRP)-conjugated donkey anti-rabbit IgG(Jackson Immunoresearch). The following Abs were used forimmunohistochemistry or immunofluorescence staining: Rab-bit anti-CD133 (Abcam), alkaline phosphatase horse anti-mouse or goat anti-rabbit IgG, peroxidase goat anti-rabbitIgG, Alexa Fluor 594 donkey anti-rabbit IgG, and Alexa Fluor488 donkey anti-mouse IgG (Invitrogen).

Histopathology and immunohistochemistryFor single-label immunohistochemistry, 5-mm sections

were deparaffinized in xylene 2 � 10 minutes, followed with2 � 100% ethanol, 95% and 75% ethanol, 3 � dH2O, 2 minutesfor each. Subsequently, sections were placed in 1� targetretrieval solution (Dako) and boiled in a Pascal pressurechamber (Dako) at 125�C for 30 seconds, 90�C for 10 secondsand were then allowed to cool to room temperature. Immu-nohistochemistry was done as described previously (19, 22).Briefly, the sections were incubated with primary Ab at 4�Covernight. After washing out unbound primary Ab with TBS-0.05% tween 20 (TBST), the tissue sections were incubatedwith peroxidase-conjugated or alkaline phosphatase (AP)-conjugated secondary Ab at room temperature for 30 minutes,then washed with TBST 3� 5 minutes. Immunoreactivity wasdetected by using NovaRED peroxidase substrate or AP redsubstrate (Vector Laboratories). For double-label immunohis-tochemistry, sections were deparaffinized and heat-inducedantigen retrieval with Target Retrieval Solution (Dako) wasused. Sections were incubated with ABCB5 mAb and CD133mAb at 4�C overnight and then with peroxidase-conjugatedhorse anti-rabbit Ab (Vector) and AP-conjugated horse anti-mouse Ab at room temperature for 30 minutes. CD133 stain-ing was detected with NovaRED peroxidase substrate andABCB5 staining was detected with AP red substrate (VectorLaboratories). For double-label immunofluorescence, sectionswere deparaffinized and heat-induced antigen retrieval withTarget Retrieval Solution (Dako) was used. Slides wereblocked for 30 minutes with serum, incubated with ABCB5mAb and CD133 mAb at 4�C overnight and then incubated

Wilson et al.

Cancer Res; 71(15) August 1, 2011 Cancer Research5308





with the appropriate secondary Abs in the dark for 1 hour.After washing out secondary Ab, slides were then coverslippedwith ProLong Gold Anti-Fade with DAPI (40,6-diamidino-2-phenylindole; Invitrogen). Sections were analyzed with aBX51/BX52 microscope (Olympus America Inc.). Imageswere captured by using the CytoVision 3.6 software (AppliedImaging). For quantitative analysis of ABCB5 expression,ImageJ software (http:/rsbweb.nih.gov/ij/), which calculatespercentage pixel area, coupled with the Color Deconvolutionplug-in (http://www.dentistry.bham.ac.uk/landinig/software/cdeconv/cdeconv.html), was used to quantify the percentageof tissue that showed immunoreactivity for ABCB5 in micro-scopically acquired JPEG images of normal colon, clinicalcolorectal cancers, and 5-FU–treated cancer xenografts. Mea-surements of ABCB5 expression in normal colon were done inclinically and histologically uninvolved portions of surgicalspecimens of the same group of colorectal cancer patients(Supplementary Table S1). ABCB5 staining intensity in fullthickness colonic wall specimens was hereby evaluated inhistologically selected areas representing only colonic epithe-lium to avoid inclusion of nonepithelial stromal, submucosaand muscular elements. In each case, ImageJ analysis softwarewas used to quantify the pixel intensity of the selected areasas described previously (28).

Terminal deoxynucleotidyl transferase–mediated dUTPnick end labeling/ABCB5 costainingThe ApopTag TdT Enzyme Kit (Chemicon International)

was used for terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) staining. Afterdeparaffinization and antigen retrieval, the colorectal cancersections were incubated with TdT enzyme mixture with77 mL ApopTag reaction buffer þ 33 mL ApopTag TdTEnzyme (33 mL dH2O instead of TdT enzyme was used as anegative control) at 37�C for 1 hour and then washed withdH2O and PBS once for each assay. The sections wereincubated with ABCB5 mAb at 4�C overnight and then withperoxidase-conjugated sheep anti-DIG Ab (Roche) andAP-conjugated horse anti-mouse Ab at room temperaturefor 30 minutes. TUNEL staining was detected with NovaREDperoxidase substrate (Vector) and ABCB5 staining wasdetected with AP NBT/BCIP.

Flow cytometryCells were harvested by using Versene (Invitrogen) as

described (17, 18) and dissociated HT-29 and SW480 cellcultures were passed through a 40-mm nylon mesh to excludecell aggregates followed by trypan blue examination for cellviability, as described previously (29, 30). Single cell suspen-sions used for flow cytometry consistently showed more than99% cell viability (trypan blue exclusion) and absence of celldetritus or cell clusters. Analysis of ABCB5 expression in HT-29 and SW480 colon cancer cells was done by single-color flowcytometry as described previously (18, 19). Briefly, 1� 106 cellswere incubated for 30 minutes at 4�C with APC-conjugatedanti-ABCB5 mAb or APC-conjugated isotype control mAb(10 mg/mL), and single-color flow cytometry was subsequentlycarried out on ungated cells with acquisition of fluorescence

emission at the FL4 (APC) spectrum on a Becton DickinsonFACScan (Becton Dickinson). The positive gates were set at adetection threshold of 0.1% of cells in control mAb-stainedsamples.

Real-time quantitative reverse transcription-PCRTotal RNA was prepared from all 7 of the NCI-60 colorectal

cancer cell cultures maintained at the National Cancer Insti-tute and real-time quantitative reverse transcription-PCR(qRT-PCR) was done as described previously (18). The primersfor ABCB5 [Homo sapiens ATP-binding cassette, sub-family B(MDR/TAP), member 5 (ABCB5), transcript variant 2, mRNANCBI Reference Sequence: NM_178559.5] detection were 50-CACAAAAGGCCATTCAGGCT-30 (forward) and 50-GCTGAG-GAATCCACCCAATCT-30 (reverse) and the primers for b-actinwere 50-CCTGGCACCCAGCACAAT-30 and 50-GCCGATCCA-CACGGAGTACT-30 (18). Relative gene expression was mea-sured with the GeneAmp 7000 Sequence Detection System(Applied Biosystems) and ABCB5 expression was assessed bythe ratio of the expression level in the sample against meanexpression in all samples as described previously (18).

Full ABCB5 mRNA open reading frame identification inHT-29 and SW480 colorectal cancer cells

RNA was prepared by using RNeasy Mini Kit (Qiagen) andreverse-transcribed by using the Advantage RT-for-PCR Kit(Clontech) according to the manufacturers’ instructions.cDNA was then subjected to PCR amplification of the fullABCB5 open reading frame (ORF; transcript variant 2, mRNANCBI Reference Sequence: NM_178559.5) as previouslydescribed for human melanocytes (17). For sequencing reac-tions, the PCR product was then used as a template for nestedPCR of 3 overlapping fragments encompassing the ORF.

N-terminal: Forward (ATGGTGGATGAGAATGACATCAGA-GCTTT), reverse (GAATTAAATAGGCTCCAAATCGAAACCCT);

Middle: Forward (AATGACTGGATTTGCCAACAAAGATAA-GC), reverse (TTCTCAGGGAGACCTTCAATAAAAGAATG);

C-terminal: Forward (AAATAG CAATCGTTCCTCAAGAGC-CTGTG), reverse (TCACTGCACTGACTGTGCATTCACTAACT).

The full ORF sequences of ABCB5 (transcript variant 2,mRNA NCBI Reference Sequence: NM_178559.5) expressed bythe human HT-29 and SW480 colorectal cancer cell lines weresubmitted to the GenBank database under the followingaccession numbers: GU437216 for HT-29, and GU437217 forSW480.

AnimalsNonobese diabetic/severe combined immunodeficient mice

(NOD/SCID) and NOD/SCID interleukin-2 (IL-2) Rg�/� micewere purchased from the Jackson Laboratory. The humancolorectal cancer to NOD/SCID mouse xenotransplantationmodel was used to dissect colorectal cancer drug resistance,because it represents an established model system (6, 7).NOD/SCID IL-2Rg�/� (NSG) mice, which have a higher tumortake for some cancers because of more profound host immunesuppression (22), were selected as the model of choice toassess intrinsic molecular function of ABCB5, independent ofpotential tumor microenvironmental interactions (22). Mice

A Therapy-Refractory Tumor Population in Colorectal Cancer

www.aacrjournals.org Cancer Res; 71(15) August 1, 2011 5309





were maintained in accordance with the institutional guide-lines of Children's Hospital Boston and Harvard MedicalSchool and experiments were done according to approvedexperimental protocols.

Human colorectal cancer xenotransplantation and 5-FUtreatment

HT-29 or SW480 human colorectal cancer cells (1 � 106

each) were injected s.c. into the right flanks of recipient NOD/SCID mice. Tumor formation was assayed weekly and tumorvolumes were calculated as described previously (19). At5 weeks (HT-29) or 9 weeks (SW480) posttumor cell inocula-tion, mice were randomized into 5-FU (Teva) or vehiclecontrol treatment groups with similar tumor volumes. 5-FUwas administered by daily intraperitoneal injection for 5consecutive days, as described (31, 32), at 50 mg/kg bodyweight, and control animals were given PBS at equal volumes.Tumor xenografts were harvested 1 day following adminis-tration of the final treatment dose, and frozen or paraffin-embedded colon cancer sections were prepared for subse-quent immunohistochemical analysis. In additional experi-ments, HT-29 or SW480 human colorectal cancer cells, or theircorresponding stable ABCB5 shRNA knockdown or vectorcontrol variants (1 � 106 cells/mouse, respectively) wereinjected s.c. into the right flanks of recipient NOD/SCID IL-2Rg�/� mice. Tumorigenic growth of untreated HT-29 orSW480 human colorectal cancer cells or their correspondingstable ABCB5 shRNA knockdown or vector control variantswere assayed weekly as a time course, at least up to theendpoint of 7 weeks, unless excessive tumor size or diseasestate required protocol-stipulated euthanasia earlier, by deter-mination of tumor volume as described previously (19).

Generation of stable ABCB5 knockdown colorectalcancer cell variants

Generation of stable HT-29-pSUPER-Retro-Puro-ABCB5,SW480-pSUPER-Retro-Puro-ABCB5, or their respective emptyvector cell variants was accomplished by transfection of plas-mids with FuGENE 6 Transfection Reagent followed by pur-omycin selection (1 mg/mL and 2 mg/mL, respectively). TheABCB5 shRNA target sequence GCTGGAAAGATAGCAACT-GAA was as previously described (24). Knockdown was con-firmed by RT-PCR amplification by using ABCB5-specificprimers and 35 cycles of amplification and comparison relativeto glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RT-PCR amplification from the corresponding samples, with 28cycles of amplification. The primers were as follows: ABCB5:Forward (GCGAGCAAAGGTCGGACTACAATCGTGG), reverse(CCCAGAACCACAAAAGGCCATTCAGGC); GAPDH: Forward(ACCACAGTCCATGCCATCAC), reverse (TCCACCACCCTG-TTGCTGTA). Confirmation of ABCB5 knockdown at the pro-tein level was done by utilizing an immunoprecipitation (IP)-Western blot by using a rabbit anti-ABCB5 pAb. Briefly, 1 mg(HT-29) or 4 mg (SW480) total cell lysate and their respectiveknockdown lysates were sonicated and precleared beforeincubation with 2 mg ABCB5 Ab with protein G agarose for3 hours at 4�C. IPs were then washed 4� before SDS-PAGE andWestern blot. The buffer used for lysis and IP was 50 mmol/L

Tris pH 7.5, 1% NP-40, 0.1% SDS, 150mmol/L NaCl, 0.5 mmol/LEDTA, 1mmol/LDTT, 1� complete protease inhibitor cocktail(Roche). A tubulinWestern blot was used as a control for lysateconcentrations.

MTT cell growth and cytotoxicity assaysIn vitro growth kinetics of HT-29 or SW480 human color-

ectal cancer cells or their corresponding stable ABCB5 shRNAknockdown or vector control variants were assayed by usingthe MTT cell proliferation assay as described previously (18).To determine the effect of ABCB5 gene knockdown on 5-FU–induced cell killing, cells were seeded in 96-well dishes andexposed to a range of 5-FU concentrations (0.5–100 nmol/L)and the dose response of cell viability was measured after7 days of drug treatment by using a TACS MTT Cell Prolifera-tion Assay Kit (Trevigen) according to the manufacturer'sprotocol, as previously described for doxorubicin in humanmelanoma cells (18).

Statistical analysisStatistical differences between expression levels of markers,

between surviving cell fractions, or between tumor volumeswere determined by using the nonparametric Mann–Whitneytest, with 2-sided P values of P < 0.05 considered significant.Pearson correlation coefficients were calculated for assess-ment of ABCB5 expression–drug potency relationships. Thedual criteria of P < 0.05 and r > 0.3 were used to identifysignificant negative correlations as described previously (18).

Results

ABCB5 is expressed only on rare cells in healthy colonicmucosa but markedly increased in human colorectalcancer

In healthy human colon, we found ABCB5 to be expressedonly on rare, distinct cells residing preferentially at or near thebase of colonic crypts (Fig. 1A), which also contain CD133-positive cells (Fig. 1A). Furthermore, ABCB5-positive cryptcells coexpressed CD133, a candidate marker of intestinalstem cells (33, 34) and this cell population represented asubset of the CD133-expressing component (Fig. 1B). Inter-estingly, ABCB5 and CD133 were expressed on opposite polesof individual cells, in keeping with the phenomenon of apico-basal polarity attributed to normal columnar epithelialcells (35). In clinical human colorectal cancer specimens,ABCB5 could also be detected to coexpress CD133, a markerof 5-FU–resistant tumor populations in colorectal cancer(14, 36) and a candidate marker of more aggressive colorectalcancer cells according to some reports (7, 8), in the sametumor regions and on the same cancer cells (Fig. 1C). Intrigu-ingly, ABCB5 was expressed at higher levels in lesser differ-entiated areas of human colorectal cancer specimenscompared with better differentiated areas (Fig. 1D, left panels),based on conventional histopathologic evaluation of thecorrelative architecture and cytology of individual patientsamples (37), similar to previous observations in malignantmelanoma in which ABCB5 expression was found to correlatewith more advanced stages of disease (19, 26). Aggregate

Wilson et al.






quantitative analysis of all tissue specimens examined (Sup-plementary Table S1) showed marked ABCB5 overexpressionin colorectal cancer specimens compared with normal colonicmucosa (ABCB5 positivity 15.39% � 4.06% vs. 0.66% � 0.24%of cells, respectively; mean � SEM, P ¼ 0.0016; Fig. 1D, rightpanel). These results provide initial evidence that the che-moresistance mediator ABCB5 is overexpressed in humancolorectal cancer.

ABCB5þ colorectal cancer cells exhibit increasedresistance to 5-FU therapyOn the basis of previously shown functions of ABCB5 as a

chemoresistance mediator in human melanoma (18, 23, 24)and hepatocellular carcinoma (25), and on the here-identifiedpreferential coexpression of ABCB5 with CD133, a marker of 5-FU–resistant tumor populations in colorectal cancer (14, 36),we investigated ABCB5 expression prior to and followingstandard 5-FU–based neoadjuvant chemoradiation therapyin a series of human rectal cancer patients (SupplementaryTable S2). Analysis of matched diagnostic rectal cancer biopsyspecimens in a series of patients who underwent neoadjuvanttreatment prior to curative surgical tumor resection revealedABCB5 positivity in only 5.7% � 4.6% of rectal cancer cells

(mean � SEM) in pretreatment specimens (Fig. 2A and B),whereas posttreatment specimens showed markedlyincreased levels of ABCB5 expression (P < 0.01), with 32.3%� 8.8% of cancer cells staining positively for ABCB5(Fig. 2A and B). Posttreatment rectal cancer specimens alsorevealed preferential coexpression of ABCB5 with CD133, inthe same tumor regions and on the same cancer cells (Fig. 2C).These findings show that ABCB5þ rectal cancer cells aremore resistant to neoadjuvant chemoradiation therapy invol-ving 5-FU.

To further dissect a potential role of ABCB5 in colorectalcancer 5-FU resistance, we examined ABCB5 expression and5-FU treatment response of ABCB5þ cancer cell populationsin an established in vivo model system utilizing NOD/SCIDmurine recipients of human colorectal cancer xenografts(6, 7). First, we found that ABCB5 expression levels correlatedsignificantly with colorectal cancer resistance to 5-FU (Pear-son correlation r ¼ 0.531, P ¼ 0.019; Fig. 3A) when ABCB5mRNA expression was determined by qRT-PCR analyses in7 colorectal cancer lines from the NCI-60 panel used by theNational Cancer Institute for drug screening and comparedwith the respective 5-FU GI50 values available from theNCI Developmental Therapeutics Program (18). SW480 and

Figure 1. ABCB5 expression in physiologic colon and colorectal cancer. A, representative immunohistochemical analysis of ABCB5 protein expression(AP, red, left 2 panels) or CD133 expression (third panel) in physiologic human colon tissue compared with isotype control staining (right). Arrows demarcatecells expressing ABCB5 and CD133 in sections of full-length crypts from the luminal surface of the colon to the crypt bases bordered by underlyingconnective tissue. B, representative ABCB5/CD133 coexpression in human colon crypt cells showing basilar staining for ABCB5 (AP, red) and apical stainingfor CD133 (HRP, brown) in both a cross and lateral section.







HT-29 cells were selected for further study on the basis oftheir well-characterized in vivo tumorigenic potential andwere found to express the principal ABCB5 mRNA isoformfirst identified in human malignant melanoma (ref. 17; NCBIReference Sequence: NP_848654.3), as determined by RT-PCRamplification, cloning, and sequencing of the correspondingcomplete 2,784-bp cDNA ORF (deposited to the GenBankdatabase under accession numbers GU437217 andGU437216, respectively; Fig. 3B, left panel). ABCB5 proteinexpression by SW480 and HT-29 cells was shown by flowcytometry (Fig. 3B, right panels) and IP and Western blotting(Fig. 4A), with 20.1% of SW480 and 4.9% of HT-29 colorectalcancer cells found to express ABCB5 (Fig. 3B, right panels). Invivo, quantitative immunohistochemical expression analysesof HT-29 or SW480 tumor xenograft specimens resected from5-FU–treated or vehicle control–treated NOD/SCID recipientmice showed that 38.8% � 5.8% of cancer cells in tumors of5-FU–treated xenograft recipients expressed ABCB5, a signif-icantly increased proportion compared with 18.4% � 3.6%ABCB5 positivity in tumors derived from vehicle control–treated xenograft recipients (mean � SEM, P ¼ 0.011;Fig. 3C and D). ABCB5/TUNEL double staining of tumor

specimens derived from 5-FU–treated xenograft recipientsrevealed enhanced resistance to 5-FU–induced apoptotic cellkilling of ABCB5þ cells (predominantly TUNEL-negative)compared with ABCB5� cells (predominantly TUNEL posi-tive) following systemic 5-FU therapy (Fig. 3C). In aggregate,these results reveal increased therapeutic resistance ofABCB5þ colorectal cancer cells, compared with ABCB5�

tumor populations, to 5-FU treatment.

ABCB5 mediates 5-FU resistance in human colorectalcancer cells

The findings of increased resistance of ABCB5þ colorectalcancer cells to 5-FU therapy suggested that ABCB5 mightfunctionally contribute to 5-FU resistance in this malignancy,similar to the role of a related ABCB5 isoform (NCBI ReferenceSequence: NM_001163942.1) in human melanoma (23). Toexplore the potential role of ABCB5 as a 5-FU resistancemediator in colorectal cancer, we generated stable ABCB5shRNA knockdown (ABCB5-KD) or pSUPER vector controlvariants for both SW480 and HT-29 colorectal cancer cells.Significant ABCB5 knockdown was shown for both HT-29 andSW480 cells (Fig. 4A) at both the mRNA level by using RT-PCR

Figure 1. (Continued ) C, representative immunofluorescence analysis of ABCB5 (green) and CD133 (red) coexpression in a clinical human colon cancerspecimen. The central lumen in the far-right panel (labeled A) is defined at its periphery by apical membrane reactivity for CD133 (labeled B), with associatedunderlying foci of ABCB5 reactivity (labeled C). D, Left: Immunohistochemical analysis of ABCB5 (AP, red) protein expression in well-differentiatedversus poorly differentiated tumor areas of a representative clinical colon cancer. Right: ABCB5 protein expression (% positive cells, mean � SEM) inphysiologic colon (n ¼ 9) versus clinical colon cancer specimens (n ¼ 29), as determined by quantitative image analysis of ABCB5 immunohistochemistry.

Wilson et al.






and real-time PCR (HT-29: 64% knockdown and SW480: 65%knockdown) and at the protein level by using IP-Western blotanalysis (Fig. 4A). First, in vitro and in vivo growth character-ization of ABCB5 knockdown variants versus controlsrevealed that in vitro proliferation was not significantly dif-ferent for HT-29ABCB5-KD versus HT-29control or SW480ABCB5-KD

versus SW480control cells (Fig. 4B), even upon long-term, 3-week in vitro culture (culture doubling time HT-29ABCB5-KD vs.HT-29control: 18.7 � 1.8 hours vs. 17.9 � 1.4 hours, mean � SD,NS; culture doubling time SW480ABCB5-KD vs. SW480control: 17.9� 0.8 hours vs. 18.0 � 0.2 hours, mean � SD, NS). In contrast,in vivo tumorigenic growth resulting from xenotransplanta-tion of HT-29ABCB5-KD or SW480ABCB5-KD cells was significantlyinhibited compared with that resulting from xenotransplanta-tion of HT-29control or SW480control cells, respectively (HT-29ABCB5-KD vs. HT-29control at 7 weeks: 336 � 52 mm3 vs. 1,150� 269 mm3, 71% inhibition, P ¼ 0.0163; SW480ABCB5-KD vs.SW480control at 5 weeks: 429 � 23 mm3 vs. 983 � 108 mm3,66% inhibition, P¼ 0.001; Fig. 4C), pointing to a functional roleof ABCB5 in tumorigenic growth. Next, on the basis ofidentical growth characteristics of untreated control andABCB5-KD colorectal cancer cells in vitro, we subjectedABCB5-KD or control cells to 5-FU–induced cell killing as adose response to increasing 5-FU concentrations in 1-weekdrug exposure assays, followed by cell viability measurementsto assess relative cell death, using an MTT assay (18). ABCB5knockdown significantly reversed the 5-FU resistance of bothHT-29 and SW480 colorectal cancer cells (Fig. 4D), resulting insignificant enhancement of cell killing at 5-FU concentrationsas low as 0.5 nmol/L in HT-29 cells, and at all 5-FU concen-trations greater than 5 nmol/L in both HT-29 and SW480 cells,with significant reductions of the LD50 for both HT-29

ABCB5-KD

vs. HT-29control cells (LD50 2.6 nmol/L vs. 12 nmol/L, respec-

tively, 4.6-fold sensitization, P < 0.0001) and SW480ABCB5-KD

vs. SW480control cells (LD50 2.6 nmol/L vs. 22 nmol/L, respec-tively, 8.5-fold sensitization, P < 0.0001). These results showthat ABCB5 mediates 5-FU resistance in human colorectalcancer cells.

Discussion

In this study, on the basis of our previous identification ofABCB5 mRNA expression in human colorectal cancer (18), wecarried out an in-depth analysis of ABCB5 expression andfunction involving healthy human colon specimens from 9distinct individuals, colorectal cancer specimens from 23patients, and 8 established colorectal cancer cell lines.

First, we found ABCB5 expression to be restricted to rarecells within the healthy human colon but detected markedoverexpression in human colorectal cancer. These resultsidentify ABCB5 expression in clinical human colorectal cancerand parallel findings in melanoma and hepatocellular carci-noma of absent or rare ABCB5 expression in the respectivenonmalignant tissues, but overexpression in the correspondingmalignancies (19, 25–27). Intriguingly, we found ABCB5 to becoexpressedwith CD133 on the same individual cells in healthycolon and in human colorectal cancer, also resembling pre-vious findings of coexpression of these molecular markers inhuman skin and malignant melanoma (17–19) and hepatocel-lular carcinoma (25). Because CD133 represents a candidateintestinal stem cell marker (34) and potential marker of color-ectal cancer stem cells (7, 8), and because colorectal cancerscan originate from physiologic intestinal stem cells (34, 38)includingCD133þ colonic crypt populations (34), ABCB5mightprovide a novel molecular link between the physiologic colonicstem cell niche and the cell-of-origin for colon cancer.

Figure 2. Response of ABCB5expression to 5-FU treatment inhuman patients. A, ABCB5expression in matched, patient-identical rectal cancer specimensbefore and after 5-FU treatment.ABCB5 immunohistochemistry(AP, red) pre- and post–5-FUtreatment is shown for 3representative patients. B,quantitative ABCB5 proteinexpression analysis (% positivecells, mean � SEM) in patient-matched rectal cancer specimensobtained before and after 5-FUchemotherapy (n ¼ 7,respectively). C, representativeimmunofluorescence analysis ofABCB5 (green) and CD133 (red)coexpression in a clinical rectalcancer specimen after 5-FUchemotherapy.







Second, our results reveal that ABCB5þ malignant subpo-pulations are resistant to 5-FU–based chemoradiation therapyin rectal cancer patients, thereby establishing ABCB5 as anovel molecular marker of clinically therapy-refractory color-ectal cancer cells. The preferential coexpression of CD133 by5-FU–resistant ABCB5þ cancer cells is consistent with pre-vious findings that documented increased CD133 expressionamong 5-FU–resistant colorectal cancer cell subsets in vitro(11), and clinical findings of increased resistance of CD133þ

colorectal tumors to 5-FU–based chemotherapy in humanpatients (14). In addition, our results show that ABCB5þ

malignant subpopulations are also resistant to clinical radia-tion therapy. Importantly, although a functional role in cancertherapeutic resistance has not been attributed to date toCD133, ABCB5 isoforms have been shown to confer resistance

to multiple chemotherapeutic agents in malignant melanomaand hepatocellular carcinoma (18, 23–25). Our findings there-fore establish a novel link between biomarkers of therapeuticresistance and a molecular drug resistance mechanism inclinical colorectal cancer.

Finally, the observed expression of the drug resistancemediator ABCB5 by 5-FU–refractory colorectal cancer cellpopulations suggested a potential functional role of ABCB5as a mediator of 5-FU resistance in colorectal cancer. Emer-gence of 5-FU resistance is a major impediment to successfulcolorectal cancer therapy, but the various potential mechan-isms of 5-FU resistance in thismalignancy, particularly ofmoreaggressive and resistant CD133þ cancer subpopulations thatcorrelate with recurrence and poor prognosis (14, 36, 39), havenot been fully explored. Our results provide initial evidence for

Figure 3. Response of ABCB5 expression to 5-FU treatment in human colorectal cancer xenografts. A, correlation between ABCB5 expression and5-FU resistance in human NCI-60 colon cancer cell lines: (1) COLO205, (2) HCT-116, (3) HCT-15, (4) HT-29, (5) HCC-2998, (6) KM12, and (7) SW620. B, Left:RT-PCR expression analysis of full-length ABCB5 mRNA (NM_178559) in human SW480 and HT-29 colon cancer cell lines. The human melanoma cellline G3361 was used as a positive control. Right: Flow cytometric determination of ABCB5 protein expression in SW480 and HT-29 cells. Bottompanels depict isotype control-stained cells. C, ABCB5 expression in human colorectal cancer xenografts in response to 5-FU treatment. Panels depict (fromleft to right) representative ABCB5 staining (HRP, brown; nuclei are counterstained with DAPI, blue) or ABCB5 (AP, blue)/TUNEL (HRP, brown) costaining ofSW480 (top rows) and HT-29 (bottom rows) colon cancer xenografts dissected from vehicle control- versus 5-FU–treated animals. D, quantitativeABCB5 protein expression analysis in colon cancer xenografts (% positive cells, mean � SEM) dissected from vehicle control (n ¼ 13) versus 5-FU–treatedspecimens (n ¼ 18).

Wilson et al.






a functional contribution of ABCB5 to 5-FU resistance inhuman colorectal cancer, because stable shRNA-mediatedABCB5 knockdown significantly sensitized human colorectalcancer cells to 5-FU–induced cell killing. Thus, therapy-refrac-tory colorectal cancer cells that might cause tumor recurrencepossess a protective mechanism, ABCB5, potentially intrinsicto CD133þ populations from which the tumor arises (7, 8, 34).This function parallels the roles of additional ABC transportersin cancer drug resistance, including of ABCB1 and ABCG2,which afford protection to normal stem cells and cancer cellsubsets in the correspondingmalignancies in other tissues (40).Our results therefore suggest a novel molecular link betweenclinical drug resistance and potential tumor-initiating cells inhuman colorectal cancer.In aggregate, our results identify ABCB5 as a novel mole-

cular marker of therapy-refractory tumor cell population incolorectal cancer patients and point to a need for consistenteradication of ABCB5-positive resistant tumor cell popula-tions for more effective colorectal cancer therapy. ABCB5-targeted resistance reversal or ABCB5-positive cancer cell

ablation might therefore represent novel, clinically relevantstrategies to ultimately enhance tumor eradication in color-ectal cancer patients, to produce more durable clinicalresponses than those obtained by therapeutic strategiesdirected predominantly at the bulk population of tumorcells.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Grant Support

This work was supported by funds provided by the NIH/NCI (grants1RO1CA113796 and 1R01CA138231 to M.H. Frank) and the U.S. Departmentof Veterans Affairs (BLR&D VA CDA-2 Award to J.S. Gold and BLR&D VA MeritAward 10688354 to N.Y. Frank).

The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received January 19, 2011; revised May 11, 2011; accepted June 1, 2011;published OnlineFirst June 7, 2011.

References1. Markowitz SD, Bertagnolli MM. Molecular origins of cancer:

Molecular basis of colorectal cancer. N Engl J Med 2009;361:2449–60.

2. Wilson BJ, Schatton T, Frank MH, Frank NY. Colorectal cancer stemcells: biology and therapeutic implications. Curr Colorectal CancerRep 2011;7:128–35.

ABCB51.2

1.0

0.8

0.6

0.4

0.2

0

1,6001,4001,2001,000

800600400200

0

1.0

1.0

0.1

0.1

0.01

0.01

0.001

1.4

1.2

1.0

0.8

0.6

0.4

0.2

0

1 2 2 0 0.5 5 50 1003 34 45 56 7Day Week [5-FU (nmol/L)]

1 2 2 0 0.5 5 50203 34 45 5 6 76 7Day Week [5-FU (nmol/L)]

HT-29

SW480

Growth in vitroA B C D

Tumor growth

Tumor growth 5-FU cytotoxicity

5-FU cytotoxicity

Growth in vitro

VectorABCB5-KD

VectorABCB5-KD

VectorABCB5-KD

VectorABCB5-KD

VectorABCB5-KD

*P < 0.05

*P < 0.05

*P < 0.05

*P < 0.05***P < 0.0001

***P < 0.0001α-Tubulin

RT-ABCB5

RT-GAPDH

ABCB5

α-Tubulin

RT-ABCB5

RT-GAPDH

Vec

tor

AB

CB

5-K

D

Vec

tor

AB

CB

5-K

D

MT

T O

D59

5 (a

rbita

ry u

nits

)

Tum

or v

olum

e (m

m3 )

1,200

1,000

800

600

400

200

0

Tum

or v

olum

e (m

m3 )

Sur

vivi

ng c

ell f

ract

ion

Sur

vivi

ng c

ell f

ract

ion

MT

T O

D59

5 (a

rbita

ry u

nits

)

VectorABCB5-KD

Figure 4. Inhibition of tumorigenic growth and 5-FU resistance reversal of human colorectal cancer cells by ABCB5 knockdown (KD). A, stable HT-29(top) or SW480 (bottom) ABCB5-KD cells or vector controls were generated by using shRNA gene silencing. Confirmation of ABCB5-KD at mRNA (bottomrows, determined by exon–exon RT-PCR), and protein levels (top rows, determined byWestern blotting), using GAPDH and a-tubulin as controls, respectively.B, analysis of in vitro growth kinetics of stable HT29ABCB5 KD (red line) versus HT-29control (blue line) cells (top), or SW480ABCB5 KD (red line) versus SW480control

(blue line) cells (bottom). C, in vivo tumor growth kinetics of stable HT29ABCB5 KD (red line) versus HT-29control (blue line) xenografts (top), or SW480ABCB5 KD

(red line) versus SW480control (blue line) xenografts (bottom). D, 5-FU–dependent cell killing for HT-29control (blue line) versus HT29ABCB5 KD cells (redline; top) and SW480control (blue line) versus SW480ABCB5 KD (red line) cells (bottom) as determined by using the MTT assay. Illustrated are surviving cellfractions as a function of 5-FU concentration (nmol/L) for n ¼ 6 replicate samples, respectively (*, P < 0.05; ***, P < 0.0001).







3. Frank NY, Schatton T, Frank MH. The therapeutic promise of thecancer stem cell concept. J Clin Invest 2010;120:41–50.

4. Zhou BB, Zhang H, Damelin M, Geles KG, Grindley JC, Dirks PB.Tumour-initiating cells: challenges and opportunities for anticancerdrug discovery. Nat Rev Drug Discov 2009;8:806–23.

5. Thirion P, Michiels S, Pignon JP, Buyse M, Braud AC, Carlson RW,et al. Modulation of fluorouracil by leucovorin in patients withadvanced colorectal cancer: an updated meta-analysis. J Clin Oncol2004;22:3766–75.

6. Dalerba P, Dylla SJ, Park IK, Liu R, Wang X, Cho RW, et al. Phenotypiccharacterization of human colorectal cancer stem cells. Proc NatlAcad Sci U S A 2007;104:10158–63.

7. O’Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cellcapable of initiating tumour growth in immunodeficient mice. Nature2007;445:106–10.

8. Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, PeschleC, et al. Identification and expansion of human colon-cancer-initiatingcells. Nature 2007;445:111–15.

9. Huang EH, Hynes MJ, Zhang T, Ginestier C, Dontu G, Appelman H,et al. Aldehyde dehydrogenase 1 is a marker for normal and malignanthuman colonic stem cells (SC) and tracks SC overpopulation duringcolon tumorigenesis. Cancer Res 2009;69:3382–89.

10. Vermeulen L, De Sousa EMF, van der Heijden M, Cameron K, de JongJH, Borovski T, et al. Wnt activity defines colon cancer stem cells andis regulated by the microenvironment. Nat Cell Biol 2010;12:468–76.

11. Dallas NA, Xia L, Fan F, Gray MJ, Gaur P, van Buren G 2nd, et al.Chemoresistant colorectal cancer cells, the cancer stem cell pheno-type, and increased sensitivity to insulin-like growth factor-I receptorinhibition. Cancer Res 2009;69:1951–57.

12. Todaro M, Alea MP, Di Stefano AB, Cammareri P, Vermeulen L, IovinoF, et al. Colon cancer stem cells dictate tumor growth and resist celldeath by production of interleukin-4. Cell Stem Cell 2007;1:389–02.

13. Cammareri P, Scopelliti A, Todaro M, Eterno V, Francescangeli F,Moyer MP, et al. Aurora-a is essential for the tumorigenic capacity andchemoresistance of colorectal cancer stem cells. Cancer Res 2010;70:4655–65.

14. Ong CW, Kim LG, Kong HH, Low LY, Iacopetta B, Soong R, et al.CD133 expression predicts for non-response to chemotherapy incolorectal cancer. Mod Pathol 2010;23:450–57.

15. Shmelkov SV, Butler JM, Hooper AT, Hormigo A, Kushner J, Milde T,et al. CD133 expression is not restricted to stem cells, and bothCD133þ and CD133- metastatic colon cancer cells initiate tumors. JClin Invest 2008;118:2111–20.

16. Reya T, Morrison SJ, ClarkeMF,Weissman IL. Stem cells, cancer, andcancer stem cells. Nature 2001;414:105–11.

17. Frank NY, Pendse SS, Lapchak PH, Margaryan A, Shlain D, Doeing C,et al. Regulation of progenitor cell fusion by ABCB5 P-glycoprotein, anovel human ATP-binding cassette transporter. J Biol Chem 2003;278:47156–65.

18. Frank NY, Margaryan A, Huang Y, Schatton T, Waaga-Gasser AM,Gasser M, et al. ABCB5-mediated doxorubicin transport and che-moresistance in human malignant melanoma. Cancer Res 2005;65:4320–33.

19. Schatton T, Murphy GF, Frank NY, Yamaura K, Waaga-Gasser AM,Gasser M, et al. Identification of cells initiating human melanomas.Nature 2008;451:345–49.

20. Schatton T, Schutte U, Frank NY, Zhan Q, Hoerning A, Robles SC,et al. Modulation of T-cell activation by malignant melanoma initiatingcells. Cancer Res 2010;70:697–08.

22. Frank NY, Schatton T, Kim S, Zhan Q,Wilson BJ, Ma J, et al. VEGFR-1expressed bymalignant melanoma initiating cells is required for tumorgrowth. Cancer Res 2011;71:1474–85.

21. Ma J, Lin JY, Alloo A, Wilson BJ, Schatton T, Zhan Q, et al. Isolation oftumorigenic circulating melanoma cells. Biochem Biophys Res Com-mun 2010;402:711–17.

23. Huang Y, Anderle P, Bussey KJ, Barbacioru C, Shankavaram U, Dai Z,et al. Membrane transporters and channels: role of the transportomein cancer chemosensitivity and chemoresistance. Cancer Res2004;64:4294–01.

24. Elliott AM, Al-Hajj MA. ABCB8 mediates doxorubicin resistance inmelanoma cells by protecting the mitochondrial genome. Mol CancerRes 2009;7:79–87.

25. Cheung ST, Cheung PF, Cheng CK, Wong NC, Fan ST. Granulin-epithelin precursor and ATP-dependent binding cassette (ABC)B5regulate liver cancer cell chemoresistance. Gastroenterology 2011;140:344–55.

26. Sharma BK, Manglik V, Elias EG. Immuno-expression of humanmelanoma stem cell markers in tissues at different stages of thedisease. J Surg Res 2010;163:e11–15.

27. Gazzaniga P, Cigna E, Panasiti V, Devirgiliis V, Bottoni U, VincenziB, et al. CD133 and ABCB5 as stem cell markers on sentinellymph node from melanoma patients. Eur J Surg Oncol 2010;36:1211–14.

28. Frank NY, Kho AT, Schatton T, Murphy GF, Molloy MJ, Zhan Q, et al.Regulation of myogenic progenitor proliferation in human fetalskeletal muscle by BMP4 and its antagonist Gremlin. J Cell Biol2006;175:99–10.

29. Civenni G, Walter A, Kobert N, Mihic-Probst D, Zipser M, Belloni B,et al. Human CD271-positive melanoma stem cells associated withmetastasis establish tumor heterogeneity and long-term growth.Cancer Res 2011;71:3098–109.

30. Frank MH, Pomer S. Interferon alpha2b differentially affects prolifera-tion of two human renal cell carcinoma cell lines differing in the P-glycoprotein-associated multidrug-resistant phenotype. J CancerRes Clin Oncol 1999;125:117–20.

31. Ciccolini J, Peillard L, Evrard A, Cuq P, Aubert C, Pelegrin A, et al.Enhanced antitumor activity of 5-fluorouracil in combination with 20-deoxyinosine in human colorectal cell lines and human colon tumorxenografts. Clin Cancer Res 2000;6:1529–35.

32. Jorgensen TJ, Tian H, Joseph IB, Menon K, Frost D. Chemosensitiza-tion and radiosensitization of human lung and colon cancers byantimitotic agent, ABT-751, in athymic murine xenograft models ofsubcutaneous tumor growth. Cancer Chemother Pharmacol 2007;59:725–32.

33. Snippert HJ, van Es JH, van den Born M, Begthel H, Stange DE,Barker N, et al. Prominin-1/CD133 marks stem cells and earlyprogenitors in mouse small intestine. Gastroenterology 2009;136:2187–94z.

34. Zhu L, Gibson P, Currle DS, Tong Y, Richardson RJ, Bayazitov IT, et al.Prominin 1 marks intestinal stem cells that are susceptible to neo-plastic transformation. Nature 2009;457:603–07.

35. Nelson WJ. Adaptation of core mechanisms to generate cell polarity.Nature 2003;422:766–74.

36. Saigusa S, Tanaka K, Toiyama Y, Yokoe T, Okugawa Y, Ioue Y, et al.Correlation of CD133, OCT4, and SOX2 in rectal cancer and theirassociation with distant recurrence after chemoradiotherapy. AnnSurg Oncol 2009;16:3488–98.

37. Kumar V, Abbas A, Fausto N, Aster J. The gastrointestinal tract.Robbins and Cotran pathologic basis of disease, professional 8thedition. Elsevier, Saunders, Philadelphia; 2010.

38. Barker N, Ridgway RA, van Es JH, van de Wetering M, Begthel H, vanden Born M, et al. Crypt stem cells as the cells-of-origin of intestinalcancer. Nature 2009;457:608–11.

39. Artells R, Moreno I, Diaz T, Martinez F, Gel B, Navarro A, et al.Tumour CD133 mRNA expression and clinical outcome in surgi-cally resected colorectal cancer patients. Eur J Cancer 2010;46:642–49.

40. Moitra K, Lou H, Dean M. Multidrug efflux pumps and cancer stemcells: insights into multidrug resistance and therapeutic development.Clin Pharmacol Ther 2011;89:491–502.

Wilson et al.






ABCB5 Identifies a Therapy-Refractory Tumor Cell Population in Colorectal Cancer Patients

Documents