-
A Tumorigenic Subpopulation with Stem Cell
Properties in Melanomas
Dong Fang,1Thiennga K. Nguyen,
1Kim Leishear,
1Rena Finko,
1Angela N. Kulp,
1Susan Hotz,
2
Patricia A. Van Belle,2Xiaowei Xu,
2David E. Elder,
2and Meenhard Herlyn
1
1Program of Molecular and Cellular Oncogenesis, The Wistar
Institute and 2Department of Pathology and Laboratory
Medicine,University of Pennsylvania School of Medicine,
Philadelphia, Pennsylvania
Abstract
Recent studies suggest that cancer can arise from a cancerstem
cell (CSC), a tumor-initiating cell that has propertiessimilar to
those of stem cells. CSCs have been identified inseveral
malignancies, including those of blood, brain, andbreast. Here, we
test whether stem cell–like populations existin human melanomas. In
f20% of the metastatic melanomascultured in growth medium suitable
for human embryonicstem cells, we found a subpopulation of cells
propagating asnonadherent spheres, whereas in standard medium,
adherentmonolayer cultures were established. Individual cells
frommelanoma spheres (melanoma spheroid cells) could differen-tiate
under appropriate conditions into multiple cell lineages,such as
melanocytic, adipocytic, osteocytic, and chondrocyticlineages,
which recapitulates the plasticity of neural crest stemcells.
Multipotent melanoma spheroid cells persisted afterserial cloning
in vitro and transplantation in vivo , indicatingtheir ability to
self-renew. Furthermore, they were moretumorigenic than adherent
cells when grafted to mice. Weidentified similar multipotent
spheroid cells in melanoma celllines and found that the stem cell
population was enriched ina CD20+ fraction of melanoma cells. Based
on these findings,we propose that melanomas can contain a
subpopulation ofstem cells that contribute to heterogeneity and
tumorigenesis.Targeting this population may lead to effective
treatments formelanomas. (Cancer Res 2005; 65(20): 9328-37)
Introduction
Due to their resistance to current therapies, melanomas remain
asignificant cause of mortality in Caucasians. Tumors consist
ofheterogeneous populations whose biological properties
remainpoorly characterized. Melanomas are believed to arise from
amature, differentiated melanocyte. However, mounting
evidencesuggests that cancer may in fact arise from a transformed
stem cell,which is able to self-renew, differentiate into diverse
progenies, anddrive continuous growth (1). Cancer stem cells (CSC)
have beenidentified in leukemias, and tumors of the breast and
brain by tumortype–specific cell surface markers often associated
with stem cells(2–5). Stem-like cells were also found in an
established glioma cellline by their inability to incorporate a
nuclear dye (6, 7). CSCs frombrain tumors could be isolated,
because they show in vitro growthcharacteristics similar to those
of neural stem cells, which proliferateas nonadherent cell
aggregates termed spheres or spheroids (8, 9).
Indirect evidence supports the presence of melanoma
stem-likecells. First, melanomas show phenotypic heterogeneity
bothin vivo and in vitro , suggesting an origin from a cell
withmultilineage differentiation abilities. Melanoma cells retain
theirmorphologic and biological plasticity despite repeated
cloning(10). Second, melanoma cells often express developmental
genes(11). Third, melanoma cells can differentiate into a wide
range ofcell lineages, including neural, mesenchymal, and
endothelial cells.They frequently exhibit characteristics of neural
lineages (12–14).Melanomas from aggressive lesions can develop
vessel-likestructures and share with endothelial cells many matrix
adhesionreceptors such as h3 integrin or the cell-cell adhesion
moleculesMCAM, which are important for invasion and metastasis
(15–17).They can also acquire characteristics of stromal
fibroblasts byconstricting collagen type I (18) and expressing
fibroblast-associated markers such as fibroblast activating protein
(19). Insome cases, melanoma lesions contain areas of adipogenic
orosteocartilaginous differentiation patterns (20–24).Given this
evidence, we asked whether melanomas contain a
tumorigenic stem cell–like population.
Materials and Methods
Primary culture, propagation, and separation of melanoma
cells.Metastatic melanomas were obtained in accordance with
consent
procedures approved by the Internal Review Boards of the
University of
Pennsylvania School of Medicine and The Wistar Institute. They
were
obtained within 1 to 2 hours after surgical removal. Tumors were
rinsed,trimmed to remove connective tissues, and subjected to
enzymatic
dissociation in 1 mg/mL collagenase IV (Invitrogen, Carlsbad,
CA) in
DMEM for 4 to 6 hours at 4jC. Single cells were washed with
HBSS,resuspended in culture medium, and plated onto noncoated
flasks.
For growing melanoma cells, we used two types of media: (a)
mouse
embryonic fibroblast (MEF)–conditioned human embryonic stem
cell
(hESC) medium (25, 26). Before use, we mixed MEF conditioned
with freshhESC medium at a 3:1 ratio and supplemented with basic
fibroblast growth
factor (bFGF) at 4 ng/mL. (b) Mel 2% melanoma growth medium,
which
was used to establish permanent melanoma cell lines (27). It
consisted of
MCDB 153 medium (Sigma, St. Louis, MO; 4 parts), L15 medium
(Invitrogen;1 part), 2% FCS, 5 Ag/mL insulin (Sigma), 15 Ag/mL
bovine pituitary extract(Cambrex, East Rutherford, NJ), 1.68 mmol/L
calcium chloride, and 5 ng/mL
epidermal growth factor (EGF, Sigma). Established melanoma cell
lines
WM115 and WM239A were cultured in Mel 2% medium without
pituitaryextract and EGF (27). EBV-transformed B-cell lines from
melanoma patients
were kindly provided by Dr. D. Herlyn of The Wistar Institute
and cultured
in RMPI 1640 with 10% FCS (28).To isolate melanoma cells from
heterogeneous primary cultures,
individual cells derived from mechanically or enzymatically
dissociated
primary spheres were cloned by limiting dilution assay in hESC
medium.
Although one cell showed limited potential for proliferation,
new spheroidcultures were regenerated from two single primary
cells. For subculture,
spheroid cells were dissociated and replated every 7 to 10 days
at a clonal
density of 1,000 cells/mL (29).
Requests for reprints: Meenhard Herlyn, The Wistar Institute,
3601 Spruce Street,Philadelphia, PA 19104. Phone: 215-898-3950;
Fax: 215-898-0980; E-mail: [email protected].
I2005 American Association for Cancer
Research.doi:10.1158/0008-5472.CAN-05-1343
Cancer Res 2005; 65: (20). October 15, 2005 9328
www.aacrjournals.org
Research Article
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
Evaluation of tumorigenicity and histologic staining.
Tumorigenicitywas determined by s.c. injecting single cells into
the right flank of severe
combined immunodeficient (SCID) mice at 1.7 � 106 cells per
mouse. Tocompare tumorigenicity of melanoma spheroid cells and
their adherent
counterparts with limiting amount of cells, mice were treated
with 200 Agcyclophosphamide monohybrate (Cytoxan, Sigma), which
further sup-
pressed the immune response. Four days later, 2 � 105 tumor
cells wereinjected. H&E, melanin, and hemosiderin staining were
done on 5-Amparaffin-embedded sections following standard
protocols.
Flow cytometry and fluorescence-activated cell sorting.
Adhesivecells were removed with 0.02% EDTA in HBSS. Cells were
washed,
suspended in buffer [0.1% bovine serum albumin (BSA), 0.1% NaN3
in
PBS], and incubated with primary antibodies for 60 minutes at
4jC withconstant agitation. Cells were washed twice with buffer
then incubated with
Alexa Fluor 488–conjugated goat anti-mouse secondary
antibodies
(Molecular Probes, Eugene, OR) for 60 minutes when unconjugated
primaryantibodies were used. Suspended spheroid cells were
dissociated mechan-
ically into single cells and stained. Approximately 5 � 103
cells wereanalyzed in an EPICS XL instrument (Beckman-Coulter,
Inc., Miami, FL).
Monoclonal antibodies (mAb) against CD3 (PE conjugated), CD4
(PE�),CD8 (PE�), CD20 (FITC�), MCAM, CD117, and CD26 were purchased
fromBD PharMingen (San Diego, CA). We purchased mAbs against
CD45
(PeliCluster, Amsterdam, The Netherlands), CD34 (PeliCluster),
CD133
(Miltenyi Biotech, Auburn, CA), CD31 (Dako, Carpinteria, CA),
neural celladhesion molecule (CD56/NCAM, NeoMarkers, Fremont, CA),
E-cadherin
(Zymed Laboratories, South San Francisco, CA), N-cadherin
(Sigma), von
Willebrand factor (vWF, NeoMarkers), vascular endothelial growth
factor-2(VEGFR2, Imclone, New York, NY), and growth-associated
phosphoprotein-
43 (GAP-43, Calbiochem, San Diego, CA). mAbs against the surface
markers
of hESCs, including stage-specific embryonic antigen (SSEA)-1,
SSEA-3,
SSEA-4, TRA-1-60, and TRA-1-81 (25), were obtained from where
they wereoriginally developed at The Wistar Institute. mAbs against
GD2, chondroitin
sulfate proteoglycan (CSPG), h3 integrin, EGF receptor (EGFR),
HLA-DR,and p70NGFR were described previously (30). Isotype-matched
mouse pure,
PE- or FITC-conjugated antibodies (BD PharMingen) were used as
controls.Fluorescence-activated cell sorting (FACS) was done on a
Cytomation
MoFlo cytometer (DakoCytomation, Fort Collins, CO).
FITC-conjugated
mAb against human CD20 was used for separation. For sorting
double-stained cells, a polyclonal antibody against human CD20
antigen (Neo-
Markers) was used to costain with mAb against MCAM or h3
integrin.Polyclonal antibodies were labeled by PE-conjugated goat
antibodies
against rabbit IgG (Sigma) and mAbs by FITC-conjugated rabbit
antibodiesagainst mouse IgG (Sigma).
Differentiation assays of melanoma spheroid cells.
Melanomaspheres were allowed to sediment, individual cells were
removed with the
supernatant. Spheres were dissociated into individual cells
before platingonto tissue culture-grade plastic coated with 10
ng/mL fibronectin at the
density of 2 � 103/cm2. Melanogenic differentiation medium,
which wasbased on melanocyte growth medium (31) and exclusively
differentiated
hESCs into melanocytic lineages,3 contains dexamethasone (0.05
Amol/L,Sigma), insulin-transferrin-selenium (ITS, 1�, Sigma),
linoleic acid-BSA(1 mg/mL, Sigma), low-glucose DMEM (30%, Life
Technologies, Rockville,
MD), MCDB 201 (20%, Sigma), L-ascorbic acid (10�4 mol/L,
Sigma),conditioned media of mouse L-Wnt3a cells (American Type
Culture
Collection, Manassas, VA, 50%), stem cell factor (100 ng/mL,
R&D System,
Minneapolis, MN), endothelin-3 (100 nmol/L, American Peptide,
Sunnyvale,
CA), cholera toxin (20 pmol/L, Sigma), the phorbol ester
12-O-tetradeca-noylphorbol-13-acetate (50 nmol/L, Sigma), and bFGF
(4 ng/mL). Differen-
tiation media for mesenchymal lineages were used as described
with
modifications (32). Osteogenesis medium consisted of 90% DMEM,
10%
FCS, 1� ITS (Sigma), 1 mg/mL LA-BSA (Sigma), 0.1 Amol/L
dexamethasone(Sigma), 0.05 mmol/L L-ascorbic acid-2-phosphate
(Sigma), and 10 mmol/L
h-glycerophosphate (Sigma). Alkaline phosphatase was detected
after14 days with the Vector Blue alkaline phosphatase substrate
kit III (Vector
Laboratories, Burlingame, CA). Adipogenic medium contained 90%
DMEM,10% horse serum (Invitrogen), 1� ITS, 1 mg/mL LA-BSA, 1 Amol/L
hydro-cortisone (Sigma), 0.5 mmol/L isobutylmethylxanthine (Sigma),
and
60 Amol/L indomethacin (Sigma) for 10 to 14 days. Accumulation
of lipidvacuoles was visualized by staining with Oil Red O (Sigma).
Chondrogenicmedium contained 90% DMEM, 10% FCS, 1� ITS, 1 mg/mL
LA-BSA,10 ng/mL transforming growth factor-h1 (R&D System), and
1 mmol/Lpyruvate (Sigma) for 10 to 14 days. Chondrogenic
differentiation was
assayed by expression of type II collagen. As controls,
undifferentiatedspheres were stained in suspension and then
centrifuged onto slides.
Immunocytochemical staining. Cells were fixed with 4%
paraformal-dehyde and stained with primary antibodies specific for
microphthalmia-
associated transcription factor (MITF, monoclonal, NeoMarkers),
sex-determining region Y (SRY)–related transcription factor SOX10
(polyclonal,
Abcam, Cambridge, MA), tyrosinase (TYR, monoclonal, Novocasta,
New-
castle upon Tyne, United Kingdom), anti-human nuclei
MAB1281(Chemicon, Temecula, CA), and type II collagen (monoclonal,
Chemicon).
Isotype-matched mouse antibodies or normal rabbit IgG were used
as
controls. After washings, primary antibody binding was detected
using the
corresponding Alexa Fluor 488–conjugated secondary antibodies
(Molecu-lar Probes). Staining was observed by fluorescence
microscopy.
RNA isolation, reverse transcription-PCR, and Western
blotting.RNA isolation, reverse transcription-PCR (RT-PCR), and
Western blot
analyses were done using primers and antibodies against
dopachrometautomerase (DCT/DCT), MITF/MITF, and TYR as described
(33, 34). TYR
primers were TGCCAACGATCCTATCTTCC (sense) and TGAGGAGTGG-
CTGCTTTTCT (antisense). A mAb against h-actin (Sigma) was used
as acontrol.
Statistical analysis. To assess the statistical significance of
differences, aone-sided Student’s t test was done. Ps
-
WM3523 cells established in Mel 2% medium were morehomogenously
positive for GD2 (78.40%), CSPG (96.80%), h3integrin (98.60%), MCAM
(98.40%), and p70NGFR (94.80%).Tumor-infiltrating B cells isolated
from melanoma lesions wereincluded as negative controls. Only a
small fraction of the B cellsexpressed typical melanoma markers
(Fig. 1B).Both WM3517 and WM3539 spheres were negative for
hemato-
poietic markers (data not shown), whereas WM3523
spherescontained hematopoietic cells. Very few of WM3523
primaryspheroid cells expressed CD3 (0.99%), CD4 (1.21%), and
CD8(1.04%), but a significant population of WM3523 spheroid
cellsexpressed CD45 (38.90%) and CD20 (41.70%; Fig. 1C). Whereas
Bcells uniformly expressed CD45 (99.80%) and CD20 (98.10%),adhesive
melanoma cells isolated from the same lesion werehomogeneously
negative for all hematopoietic markers tested (Fig.1C). These
results suggest that the WM3523 spheres containedboth melanoma and
hematopoietic cells.Sphere formation of melanoma cells isolated
from hetero-
geneous populations. To ensure the purity of cell
population,melanoma cells were clonally isolated from mixed
cultures asdescribed in Materials and Methods. All 14 clones of
WM3523 werepigmented and were able to produce proliferating
melanomaspheres (Fig. 2A). The spheres were grown for >8 months
bycontinuous passage. A minor population, ranging from 5% to
10%,grew adherent and subsequently differentiated into small,
ovalmelanocytic cells with short dendrites (data not shown),
whereasthe major population grew as melanoma spheres. Flow
cytometry
analyses of five clones showed that spheroid cells
homogeneouslyexpressed melanoma markers CSPG (95.30%), h3 integrin
(96.00%),and MCAM (97.50%; Fig. 2B). A significant fraction of
cellsexpressed E-cadherin (89.60%) but not N-cadherin
(2.54%).Hematopoietic markers CD3 (0.76%) and CD4 (0.90%)
remainednegative, with a small portion expressing CD8 (1.22%),
CD45(1.10%), and CD20 (3.34%; Fig. 2B). The CD20-positive
subpopula-tion coexpressed melanoma-associated MCAM and h3
integrinand was enriched by FACS (Fig. 2C-D). This indicates that a
sub-population of melanoma spheroid cells express the
hematopoieticmarker CD20.Self-renewal and melanocytic
differentiation of melanoma
spheroid cells. After separating WM3523 melanoma spheres
intosingle cells and reseeding at a clonal density of 1,000
cells/mL, theyremained in stem cell growth medium as individual
cells withoutaggregate formation for 5 hours (Fig. 3A, a). New
spheres developedfrom individual cells 4 days after seeding (Fig.
3A, b). Whendissociated spheroid cells were treated with melanocyte
differen-tiation medium, a large proportion of cells adhered to
flasksprecoated with fibronectin (Fig. 3A, c). Within 4 days,
theydifferentiated into melanocytic cells (Fig. 3A, d), whose
pelletsdisplayed increased pigmentation (Fig. 3A, e, right) when
comparedwith pellets from parental cells (Fig. 3A, e, left). The
capacity formelanocytic differentiation of melanoma spheroid cells
persisted inlong-term cultures for up to 8 months with no
significant decreasein efficiency. Melanoma spheroid cells in stem
cell growth mediummaintained their growth potential; whereas under
differentiation
Figure 1. Cells from metastatic melanoma lesionsform nonadherent
spheres under hESC cultureconditions. A, tumor cell suspension
frommelanoma lesion WM3523 before culture (a).Adherent cells (b)
and spheres (c ) obtained after2 weeks in Mel 2% and hESC
medium,respectively. Cell pellets from adherent cells(left ) with
pigmentation or from spheres (right )nonpigmented (d ). Bar, 100 Am
(a) and 200 Am(b and c ). Flow cytometry analysis forexpression of
melanoma-associated (B) andhematopoietic markers (C ) on spheroid
(top ) oradherent (middle ) cultures from lesion WM3523.B cells
were used as controls (bottom ). Solid lines,isotype-matched
control; shaded areas, specificmarker. Representative of three
independentexperiments.
Cancer Research
Cancer Res 2005; 65: (20). October 15, 2005 9330
www.aacrjournals.org
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
conditions, cell growth slowed dramatically and stopped after18
days (data not shown). Similarly, standard melanoma growthmedium,
Mel 2%, could differentiate melanoma spheroid cells intomelanocytic
cells but with lower efficiency (data not shown). Theseresults
suggest that melanoma spheroid cells can self-renew
anddifferentiate into a melanocytic phenotype.We then characterized
melanocytic differentiation by immunos-
taining, RT-PCR, and Western blotting. A fraction of
melanomaspheroid cells expressed melanocyte-specific MITF (52.8%)
andmelanogenic enzyme TYR (30.8%; Fig. 3B-C). After
differentiation,the populations expressing both melanocytic markers
increasedsignificantly. In contrast, adherent monolayer melanoma
culturesisolated in Mel 2% showed only marginal increases in MITF-
orTYR-expressing cells after differentiation (Fig. 3B-C). These
resultssuggest that melanoma spheroid cells contain a larger
populationof progenitor cells with differentiation potential for
melanocyticcells lineage than the adherent cells. RT-PCR and
Western blottingdetected expression of melanocyte-specific genes
MITF/MITF,TYR/TYR, and DCT/DCT. Significant increases in TYR
mRNA
and TYR protein levels were observed after melanocyte
differenti-ation (Fig. 3D). The DCT protein was undetectable in
undifferen-tiated and differentiated populations; however, its
transcriptionalexpression was greatly enhanced after
differentiation. Expressionof two phosphorylated MITF proteins (54
and 60 kDa) was in-creased after differentiation regardless of a
slight decrease in MITFmRNA. These results show increases in DCT
transcription andMITF and TYR proteins correlate with enhanced
pigmentation afterdifferentiation.Mesenchymal differentiation of
melanoma spheroid cells.
Melanocytes are derived from the neural crest during
embryonicdevelopment. The transient neural crest consists of
pluripotentstem cells that give rise to a wide array of lineages,
includingneurosecretory cells, peripheral neurons, glia, and the
cephalicmesenchyme (bone and cartilage; ref. 35). To determine
whetherWM3523 melanoma spheroid cells can differentiate similarly
toneural crest stem cells, we examined neural and
mesenchymaldifferentiation. The cells failed to differentiate into
neural lineagesin defined medium containing 60% DMEM, 40% MCDB 201,
0.05Amol/L dexamethasone, 1� ITS, 1 mg/mL LA-BSA, 10�4
mol/LL-ascorbic acid, and 100 ng/mL bFGF (ref. 36; data not shown).
Onthe other hand, WM3523 melanoma spheroid cells
readilydifferentiated into mesenchymal lineages with varying
efficiencies:adipogenic (31.0%), chondrogenic (18.6%), and
osteogenic (5.6%;Fig. 4A-B). Few or no undifferentiated melanoma
spheroid cellsstained for Oil Red O (5.6%), type II collagen
(1.6%), or alkalinephosphatase (0.0%). Adherent monolayer melanoma
cells estab-lished in Mel 2% showed significant potential for
adipogenesis only(4.0%; Fig. 4B). These results suggest that
multipotent stem cells areenriched in melanoma spheroid populations
isolated in stem cellgrowth medium.To verify the common origin of
melanocytic lineages and differ-
entiated mesenchymal cells, we double stained with
melanocyte-associated transcription factors MITF or SOX10 and
mesenchymalmarkers Oil Red O or alkaline phosphatase (Fig. 4C). In
adipogenicmedium, differentiated melanoma cells containing multiple
MITF-or SOX10-positive nuclei also displayed Oil Red O staining
(Fig. 4C).In osteogenic medium, differentiated melanoma cells
expressingalkaline phosphatase also exhibited diffuse MITF or
SOX10expression. These data indicate a common origin for
differentiatedmesenchymal cell lineages and melanocytic cells, and
thatmesenchymal differentiation is not due to contaminating
non-tumor stem cells.The percentage of differentiated mesenchymal
cell types varied
considerably among clones. Of six tested, clones 4, 6, and
11could differentiate into melanogenic, adipogenic,
chondrogenic,and osteogenic lineages. Other clones were either
tripotent(melanogenic, adipogenic, and chondrogenic lineages),
bipotent(melanogenic and adipogenic), or unipotent (melanogenic).
Themesenchymal differentiation capacity of melanoma spheroid
cellspersisted in long-term cultures up to 8 months, albeit
withdecreased efficiency (particularly in osteogenic
differentiation).Melanoma spheroid cell lines WM3517 and WM3539
showeddifferentiation capacity for the melanocytic lineage only
(data notshown).Multipotent melanoma spheroid cells derived from
estab-
lished melanoma cell lines. We explored whether a stem
cellpopulation could be isolated from long-established melanoma
celllines. A total of 18 cell lines were tested in stem cell
cultureconditions using hESC medium. Spheroid phenotypes developed
inWM115 and WM239A, a pair of primary and metastatic melanoma
Figure 2. Isolated melanoma cells form new spheres. A, single
cells fromWM3523 spheroid cultures re-formed spheres (left) and
spheres could becontinuously propagated after repeated
dissociations (right ). Bar, 200 Am.B, flow cytometry analyses show
that isolated WM3523 spheroid populationshomogeneously contain
cells expressing melanoma markers. C, flow cytometryanalysis of
WM3523 spheroid cells coexpressing both CD20 and MCAM(fraction 2).
A fraction of cells coexpressing CD20 and h3 integrin were
alsodetected (data not shown). D, identification of a fraction of
melanoma spheroidcells coexpressing CD20 and MCAM/ h3 integrin.
Representative of experimentsusing three independent clones (clones
4, 6, and 11). Bar, 50 Am.
A Stem Cell Population in Melanomas
www.aacrjournals.org 9331 Cancer Res 2005; 65: (20). October 15,
2005
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
cell lines derived from the same patient (37). When
adherentcultures of WM115 cells (Fig. 5A, a) were exposed to hESC
medium,spheres appeared after f7 days (Fig. 5A, b). These spheroid
cellsconsistently formed new spheres when separated into single
cells(Fig. 5A, c). Adipogenic, osteogenic, and chondrogenic
differenti-ation was extensively induced under appropriate
conditions inWM115 spheroid cells but not in the adherent
population (Fig. 5A,d-f and B). Similar differentiation capacities
were observed inWM239A spheroid cells established in stem cell
medium (data notshown).Flow cytometry analysis showed that,
although the majority of
hematopoietic and melanoma cell surface markers on WM115spheroid
cells retained expression levels similar to those of WM115adhesive
cells, a subpopulation of WM115 spheroid cells expressedthe
hematopoietic marker CD20 and showed reduced expression ofEGFR (a
marker for epithelial differentiation; Fig. 5C). Melanomacells
coexpressing MCAM or h3 integrin and CD20 were confirmedby FACS and
fluorescence microscopy (Fig. 5D-E). These datasuggest that a
multipotent stem cell population can be isolatedfrom established
melanoma cell lines and that this populationgrows and
differentiates similarly to fresh isolates. Moreover,
asubpopulation of melanoma spheroid cells derived from melanomacell
lines is also similar to freshly isolated cells in that
itcoexpresses the hematopoietic marker CD20.
Multipotent melanoma spheroid cells are capable offorming tumors
in vivo and self-renewing after transplanta-tion. We examined the
tumorigenic capacity of WM115 andWM3523 spheroid cells by s.c.
injection in SCID mice. All miceinjected with WM115 spheroid cells
(n = 5), or WM3523 spheroidcells (clone 4, n = 5; clone 6, n = 3)
developed tumors (Fig. 6A). Themajority of tumors were observed
between 28 and 40 days. Tumorsconsisted of large cells with
abundant eosinophilic cytoplasm, ovalto irregular nuclei, and
dominant nucleoli. Most tumors alsocontained giant tumor cells
(data not shown). Their melanocyticorigin was confirmed by positive
staining for melanin and not forhemosiderin (Fig. 6A ; data not
shown). These results suggest thatmelanoma spheroid cells isolated
in stem cell medium aretumorigenic.We then isolated and cultured
melanoma cells from tumors
grown in mice. Typical melanoma spheres were formed within 2to 3
weeks in stem cell medium (Fig. 6A). These tumor cellscould be
stained by a specific monoclonal antibody againsthuman nuclei,
confirming their human origin (data not shown).Melanogenic,
adipogenic, chondrogenic, and osteogenic differen-tiation of these
spheroid cells were observed under appropriatedifferentiation
conditions (data not shown). These results indicatethat a stem cell
population exists in melanomas after in vivotransplantation.
Therefore, a self-renewing stem cell population
Figure 3. Self-renewal and melanocyticdifferentiation of
melanoma spheroid cells.A, morphology of WM3523 melanomaspheroid
cells cultured in either hESC ormelanocyte differentiation medium.
Singlecells 5 hours after seeding in hESCmedium (a) and after 4
days beginning todevelop spheres (b). Single cells 5 hoursafter
having been cultured in melanocytedifferentiation medium begin
attaching tosubstrate (c ) and after 4 days developtypical
spindle-shaped morphology (d ).The cell pellet from
undifferentiated cells islightly pigmented (e, left ) and that
fromdifferentiated cultures is heavily pigmented(e, right). B,
immunocytochemistry ofmelanocytic markers MITF and TYR
inundifferentiated WM3523 melanomaspheroid cells (top, arrows )
anddifferentiated cells, four days after treatedwith melanocyte
differentiation medium(bottom, arrows ). Representative
oftriplicate experiments using threedependent clones (clones 4, 6,
and 11).C, percentage of MITF- and TYR-expressing cells in WM3523
spheroidand adherent populations prior to(open columns ) and after
(filled columns )melanocytic differentiation. Columns,mean from
three independent experimentsin duplicate using WM3523
melanomaspheroid clones (clones 4, 6, and 11);bars, FSEM. D, RT-PCR
and Western blotanalyses for MITF /MITF, DCT /DCT, andTYR /TYR
expression in undifferentiatedand differentiated melanoma
spheroidcells. We included 293 cells and epidermalmelanocytes as
negative and positivecontrols, respectively.
Representativeexperiment of three independentexperiments using
three WM3523 spheroidclones (clones 4, 6, and 11).
Cancer Research
Cancer Res 2005; 65: (20). October 15, 2005 9332
www.aacrjournals.org
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
persists not only in long-term cultures but also in
tumorstransplanted in vivo .To address whether multipotent melanoma
spheroid cells
differed in tumorigenicity from adherent monolayer
melanomacells, we implanted melanoma spheroid cells or
adherentmonolayer cells into Cytoxan-treated SCID mice at 2 � 105
cellsper mouse, an amount that usually does not induce tumors.
Afterf35 days, mice transplanted with spheroid cells had
developedpigmented tumors, whereas tumors were not observed in
miceinjected with adherent cells. When mice were sacrificed 70
daysafter injection, three animals in the spheroid group (n = 5)
hadsmall to large tumors compared with only one small tumor in
oneof the adherent groups (n = 5). Total tumor weight and
volumefrom the spheroid group were significantly larger than the
adherentgroup (Fig. 6B). This suggests that melanoma spheroid
cellsisolated in hESC culture conditions are more
tumorigenic.Multipotent stem cells are enriched in the CD20+
fraction of
melanoma spheres. We consistently observed CD20+ populationsin
WM3523 and WM115 melanoma spheroid cells but not in
thecorresponding adherent populations. Individual CD20+ tumor
cellscould be detected by immunohistochemistry in f20% ofmetastatic
melanoma lesions, supporting our in vitro observations
(data not shown). We did cell sorting to determine whether
thestem cell population was within CD20+ fractions. Both positive
andnegative fractions from WM3523 and WM115 proliferated
exten-sively after sorting. Their phenotypes were confirmed by
flowcytometry (data not shown). The CD20+ fractions of WM3523
cellsformed larger spheres compared with the CD20� fraction.
InWM115 cells, only the CD20+ fraction proliferated as
spheres,whereas the CD20� fraction remained as single cells (data
notshown). These data suggest that the stem cell population
mayreside within the CD20+ fraction.The CD20+ or CD20� fractions of
WM3523 and WM115 were
then subjected to differentiation. Whereas WM115 CD20�
fraction remained in suspension, the other three
populationsadhered to substrate, indicating their differentiation
potentials(data not shown). Although similar percentages showed
immu-noreactivity for MITF in both CD20+ and CD20� fractions
fromboth spheroid cell lines after melanocytic differentiation,
onlyCD20+ fractions showed substantial potential for
mesenchymaldifferentiation (Fig. 6C-D). These data confirm that
multipotentstem cells are enriched in the CD20+ fraction of
melanomaspheroid cells isolated from fresh tumor lesions and
establishedcell lines.
Figure 4. Mesenchymal differentiation of melanoma spheroidcells.
A, single WM3523 melanoma spheroid cells were treated inmedia for
adipogenic (left), chondrogenic (middle ), and osteogenic(right )
differentiation. We visualized lipid vacuole accumulation
inmelanoma cells, including a few multinucleated cells (arrows
),differentiated in adipogenic medium by Oil Red O staining
(red).Type II collagen (green, arrows ) and alkaline
phosphatase(blue, arrow ) were detected in cells treated with
chondrogenic andosteogenic medium, respectively. Undifferentiated
cells werestained as controls (bottom ). Bars, 50 Am. B,
differentiationefficiencies for melanoma spheroid and adherent
cells. Individualbars indicate percent positive cells in each
population. Columns,mean obtained from three clonal melanoma
spheroid cell lines(clones 4, 6, and 11) and five different
passages of adhesive cellsranging from 4 to 20; bars, FSEM. C,
differentiation of melanomaspheroid cells was induced in adipogenic
(1 and 3 ) and osteogenic(2 and 4) medium, respectively. After 10
days, cells wereimmunostained for melanocytic markers MITF or SOX10
(green ),and nuclear dye Hoechst 33258 (blue , adipogenesis only),
thendouble stained with Oil Red O or alkaline
phosphatase,respectively. MITF or SOX10 immunoreactive cells
displayedmarkers for mesenchymal lineages (i.e., Oil Red O and
alkalinephosphatase, arrows ), after differentiation. Bar, 50
Am.
A Stem Cell Population in Melanomas
www.aacrjournals.org 9333 Cancer Res 2005; 65: (20). October 15,
2005
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
Discussion
We report a subpopulation of melanoma cells with
characteristicsof primitive progenitors for melanocytes, neural
crest cells, that giverise to a broad range of cell types. When
cultured in medium usedfor hESCs, melanoma cells proliferated as
nonadherent spheres.When initially isolated from the lesion, the
spheres contained bothmelanoma and hematopoietic cells. After
cloning, a subpopulationof melanoma cells could be isolated that
maintained stem cellcharacteristics; they were able to self-renew
and differentiate intomelanogenic, adipogenic, chondrogenic, and
osteogenic lineages.These melanoma spheroid cells were also found
in establishedcell lines, suggesting that a subpopulation of
melanoma cells inlong-term culture can maintain stem cell
properties.Our studies reveal that melanoma lesions can contain
a
subpopulation with stem cell properties and a fraction of
moredifferentiated tumor cells. The adherent population
establishedin vitro under standard conditions displays spindle to
epithelioidmorphology. In general, these cells reflect the stage of
tumorprogression from which they were initially derived, and those
cells
from metastatic lesions are tumorigenic in mice (27). They
arecharacterized for their expression of melanoma-associated
anti-
gens such as MCAM or h3 integrin, which facilitate invasion
andmetastasis (16, 17). The second population, described for the
firsttime here, can differentiate and self-renew. This population
is
characterized by its ability to form spheres. Sphere formation
was
initially observed in cultured neural stem cells (38). Cells
within
neural spheres have stem cell properties that manifest as
self-renewal and multilineage differentiation potential (39).
Recently,
sphere formation was found when stem cells from a variety of
normal and tumor tissues were isolated (3, 5, 40, 41),
suggestingthat sphere formation may be a common growth
characteristic of
stem cells.It is not surprising that melanoma spheroid cells are
capable of
mesenchymal differentiation, because mesenchymal and
melano-cytic cells may originate from the same embryonic tissue,
theneural crest (35). Differentiation of human melanomas
intomesenchymal lineages has also been described in fat
andosteocartilaginous differentiation (20–24). Differentiating
cells were
Figure 5. A subpopulation with stem cell propertiesderived from
an established melanoma cell lineWM115. A, morphology of WM115
melanoma cell linefrom a primary lesion cultured in Mel 2% (a ).
Spheresformed 1 week after cultured in hESC medium (b )and
re-formed after single spheroid cells werere-seeded at a clonal
density(c). WM115 spheroid cellswere exposed to medium for either
adipogenic(d , Oil Red O), osteogenic (e, blue ,
alkalinephosphatase), or chondrogenic (f, green , type IIcollagen;
blue , Hoechst 33258) differentiationconditions. Bars, 200 Am (a
and b ), 100 Am (c ), 50 Am(d, e , and f ). B, quantification of
mesenchymaldifferentiation of adherent and spheroid WM115 cells.C,
flow cytometry analysis of WM115 spheroid andadherent monolayer
cells. D, flow cytometry analysisof WM115 spheroid cells revealed a
fraction of cellsexpressing both MCAM and CD20. E,
cellscoexpressing MCAM/h3 integrin and CD20 wereidentified by
fluorescence microscopy.
Cancer Research
Cancer Res 2005; 65: (20). October 15, 2005 9334
www.aacrjournals.org
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
often multinucleated, their cultures could not be maintained
forextended periods of time, and their differentiation was
irreversible.Furthermore, melanoma spheroid cells gave rise to
cells thatexpressed both melanocytic and mesenchymal markers. These
dataconfirmed that the mesenchymal progenitors are not derived
fromcontaminating normal mesenchymal stem cells but rather are
aproperty of the tumor itself.In sphere-forming melanoma cell
lines, WM3517 and WM3539,
spheroid cells were able to undergo only melanogenic
differenti-ation, suggesting they might arise from a cell at a
later stage ofdifferentiation, such as a lineage-committed
melanocyte precursorcell. Multipotent WM3523 melanoma spheroid
cells had a stablecapacity for self-renewal over prolonged culture
periods. Clones ofWM3523 spheroid cells showed differences in their
stability ofdifferentiation potential. Over time in culture, some
clones couldno longer differentiate into all four cell lineages but
only intothree, two, or one suggesting the control mechanisms for
eachdifferentiation lineage is unique.Neoplastic melanocytic cells
frequently exhibit characteristics
of other neural crest derivatives both in vitro and in vivo
.
Differentiation of melanoma cells into neural lineages has
beenwell shown (12–14); however, in this study, melanoma
spheroidcells failed to differentiate into neural lineages. The
differentiationmedium contains bFGF, which has been used to induce
neuraldifferentiation of hESCs and bone marrow–derived stem
cells(36, 42, 43). In this case, the plasticity of melanoma
spheroid cellswas limited.Multipotent melanoma spheroid cells
isolated from fresh tumors
persist in culture for a long time (8 months) when passaged
atclonal densities and as tumor xenografts. Similar
multipotentmelanoma spheroid cells can also be isolated from
established celllines. Importantly, multipotent melanoma spheroid
cells can beserially recloned from a minimum of two cells during 8
months inculture. We have provided evidence that this subpopulation
ofmelanoma cells is able to self-renew and meet other criteria
ofstem cells. Moreover, melanoma spheroid cells have
differentiationpotential similar to neural crest stem cells,
supporting the notionthat melanomas may arise from a transformed
melanocyte stemcell. Recent studies suggest that neural crest stem
cells persist inthe skin in adult animals and are capable of
differentiating into
Figure 6. Tumorigenic capacity of melanoma spheroidcells in vivo
and CD20-positive fraction harboringstem cell populations. A,
tumors developed in miceinjected with WM115 (top ) and WM3523
(bottom )melanoma spheroid cells, respectively. Tumorsshowed
typical melanoma morphology (H&E).Fontana-Masson staining
confirmed the presence ofvariable melanin pigment in tumors
(melanin). Spheroidcultures were then derived from mouse
tumors(cultured). B, tumorigenic capacity of WM3523spheroid (clone
4) and adherent cells were comparedas detailed in Materials and
Methods. Total tumorweight and volume from each group (open columns
,spheroid; filled columns , adherent). Columns, means;bars, FSEM.
C-D, CD20+ fractions in both WM115and WM3523 (clone 4) spheroid
cells retainedpotentials for adipogenic, chondrogenic,
andosteogenic differentiation, whereas their CD20�
fractions rarely differentiated into the above
lineages.Differentiated cells (arrows ). In
melanocyticdifferentiation, both nuclear (arrowheads ) and
diffuse(arrows ) MITF-positive cells were observed.
A Stem Cell Population in Melanomas
www.aacrjournals.org 9335 Cancer Res 2005; 65: (20). October 15,
2005
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
neurons, smooth muscle cells, Schwann cells, adipocytes,
andmelanocytes (41, 44, 45). Lineage-committed melanocyte stem
cellshave also been reported in mouse hair follicles (46). In
humans,equivalent stem cells have not yet been identified but
potentiallyexist in adult skin to maintain homeostasis and to
repair damageafter injury. These long-lived stem cells may
accumulate mutationsand become a candidate for transformation. With
its capacity forself-renewal, this subpopulation of transformed
stem cells maysubsequently initiate and sustain
malignancy.Increasing evidence supports this scenario. A link
between
epithelial cancer and bone marrow–derived cells (most
likelymesenchymal stem cells) has been shown in a mouse model
ofgastric cancer. Stem cells were recruited into gastric
glands,differentiated into gastric epithelial cells, and developed
intointraepithelial cancer (47). Moreover, mesenchymal stem
cellstransduced with the telomerase hTERT gene display
neoplasticpotential and contributes to mesenchymal tumor formation
(48).These results show that stem cells can be transformed
underappropriate conditions and give rise to malignancy.
Alternatively,a transformed, differentiated melanocyte may have
undergone adedifferentiation process and regained stem cell
properties such asself-renewal (1). Within neural crest
derivatives, dedifferentiation ofone lineage into a precursor pool
that then gives rise to otherlineages has been well shown (49, 50).
In addition, results fromchronic myelogenous leukemia indicate that
a lineage-restrictedprogenitor or mature cell can acquire stem cell
privileges afteroncogenic transformation (51, 52).The loss of
E-cadherin seems important for epithelial-
mesenchymal transitions, which facilitate morphogenesis
duringdevelopment and tumor progression (melanomas; refs. 53, 54).
Inthis study, the sustained expression of E-cadherin was observed
inboth WM3523 melanoma spheroid cells (89.60%) and its
adherentmelanoma counterparts (99.6%; data not shown). Only a
minorfraction of both spheroid and adherent populations of
WM115
express E-cadherin. These results suggest that E-cadherin
expres-sion is not critical for stem cell properties of melanoma
spheroidcells.We have discovered, however, that a small
subpopulation of
CD20+ melanoma cells harbors multipotent stem cells, as in
thecase of WM115 melanoma spheroid cells. WM3523 melanomaspheroid
cells could maintain sphere-forming capacity even amongthe CD20�
population; however, these negative cells had limitedcapacity to
undergo mesenchymal differentiation. Most interest-ingly, CD20 has
been identified by gene expression profiling as oneof the top 22
genes that define aggressive melanomas (55). Inmetastatic
melanomas, we have identified individual CD20+ tumorcells (data not
shown). Monoclonal antibodies against CD20 havebecome a standard
treatment for non-Hodgkin’s lymphoma (56).CD20 seems a potential
target for melanoma as well, although acorrelation between
differentiation ability and tumorigenicity isstill under
investigation by comparing CD20+ with CD20� fractions.In summary,
our studies clearly show the presence of a stem cell
population in melanomas. Like all stem cells, melanoma
spheroidcells are also capable of proliferation, differentiation,
and self-renewal. In addition, melanoma spheroid cells possess
highertumorigenicity. Understanding the highly tumorigenic, stem
cellorigin of melanomas has important implications for
efficienttherapy.
Acknowledgments
Received 4/19/2005; revised 7/13/2005; accepted 8/2/2005.Grant
support: NIH grants CA25874, CA80999, CA10815, and CA76674 and
Commonwealth Universal Research Enhancement Program,
Pennsylvania Departmentof Health.
The costs of publication of this article were defrayed in part
by the payment of pagecharges. This article must therefore be
hereby marked advertisement in accordancewith 18 U.S.C. Section
1734 solely to indicate this fact.
We thank James Hayden for support with photography pigmentation
of cell pellets,Gian Ascione for editorial assistance, and the
staff at the Flow Cytometry Facility fortheir analyses.
References1. Reya T, Morrison SJ, Clarke MF, Weissman IL.
Stemcells, cancer, and cancer stem cells. Nature
2001;414:105–11.
2. Bonnet D, Dick JE. Human acute myeloid leukemia isorganized
as a hierarchy that originates from a primitivehematopoietic cell.
Nat Med 1997;3:730–7.
3. Singh SK, Clarke ID, Terasaki M, et al. Identification ofa
cancer stem cell in human brain tumors. Cancer
Res2003;63:5821–8.
4. Al-Hajj M, Wicha MS, Benito-Hernandez A, MorrisonSJ, Clarke
MF. Prospective identification of tumorigenicbreast cancer cells.
Proc Natl Acad Sci U S A 2003;100:3983–8.
5. Singh SK, Hawkins C, Clarke ID, et al. Identification ofhuman
brain tumour initiating cells. Nature 2004;432:396–401.
6. Kondo T, Setoguchi T, Taga T. Persistence of a
smallsubpopulation of cancer stem-like cells in the C6 gliomacell
line. Proc Natl Acad Sci U S A 2004;101:781–6.
7. Setoguchi T, Taga T, Kondo T. Cancer stem cellspersist in
many cancer cell lines. Cell Cycle 2004;3:414–5.
8. Galli R, Binda E, Orfanelli U, et al. Isolation
andcharacterization of tumorigenic, stem-like neural pre-cursors
from human glioblastoma. Cancer Res 2004;64:7011–21.
9. Yuan X, Curtin J, Xiong Y, et al. Isolation of cancerstem
cells from adult glioblastoma multiforme. Onco-gene
2004;23:9392–400.
10. Kath R, Jambrosic JA, Holland L, Rodeck U, Herlyn
M.Development of invasive and growth factor-independent
cell variants from primary human melanomas. CancerRes
1991;51:2205–11.
11. Hendrix M, Seftor EA, Meltzer PS, et al. The stem
cellplasticity of aggressive melanoma tumor cells. In: S Sell.Stem
cells handbook. Totowa (NJ): Humana Press, Inc.;2003. p.
297–306.
12. Reed JA, Finnerty B, Albino AP. Divergent
cellulardifferentiation pathways during the invasive stage
ofcutaneous malignant melanoma progression. Am JPathol
1999;155:549–55.
13. Fang D, Hallman J, Sangha N, et al. Expression
ofmicrotubule-associated protein 2 in benign and malig-nant
melanocytes: implications for differentiation andprogression of
cutaneous melanoma. Am J Pathol 2001;158:2107–15.
14. Brocker EB, Magiera H, Herlyn M. Nerve growth andexpression
of receptors for nerve growth factor intumors of melanocyte origin.
J Invest Dermatol 1991;96:662–5.
15. Hendrix MJ, Seftor EA, Hess AR, Seftor RE. Vasculo-genic
mimicry and tumour-cell plasticity: lessons frommelanoma. Nat Rev
Cancer 2003;3:411–21.
16. Hsu MY, Shih DT, Meier FE, et al. Adenoviral genetransfer of
h3 integrin subunit induces conversion fromradial to vertical
growth phase in primary humanmelanoma. Am J Pathol
1998;153:1435–42.
17. Satyamoorthy K, Muyrers J, Meier F, Patel D,
HerlynM.Mel-CAM-specific genetic suppressor elements
inhibitmelanoma growth and invasion through loss of gapjunctional
communication. Oncogene 2001;20:4676–84.
18. Klein CE, Steinmayer T, Kaufmann D, Weber L,Brocker EB.
Identification of a melanoma progression
antigen as integrin VLA-2. J Invest Dermatol 1991;96:281–4.
19. HuberMA, Kraut N, Park JE, et al. Fibroblast
activationprotein: differential expression and serine
proteaseactivity in reactive stromal fibroblasts of melanocyticskin
tumors. J Invest Dermatol 2003;120:182–8.
20. Banerjee SS, Coyne JD, Menasce LP, Lobo CJ, HirschPJ.
Diagnostic lessons of mucosal melanoma withosteocartilaginous
differentiation. Histopathology 1998;33:255–60.
21. Cruz J, Reis-Filho JS, Lopes JM. Primary cutaneousmalignant
melanoma with lipoblast-like cells. ArchPathol Lab Med
2003;127:370–1.
22. Giele H, Hollowood K, Gibbons CL, Wilson DJ,Athanasou NA.
Subungual melanoma with osteocartila-ginous differentiation.
Skeletal Radiol 2003;32:724–7.
23. Hoorweg JJ, Loftus BM, Hilgers FJ. Osteoid and boneformation
in a nasal mucosal melanoma and itsmetastasis. Histopathology
1997;31:465–8.
24. Grunwald MH, Rothem A. Desmoplastic cartilagi-nous formation
in malignant melanoma. J Cutan Pathol1987;14:255.
25. Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al.Embryonic
stem cell lines derived from human blasto-cysts. Science
1998;282:1145–7.
26. Xu C, Inokuma MS, Denham J, et al. Feeder-freegrowth of
undifferentiated human embryonic stem cells.Nat Biotechnol
2001;19:971–4.
27. Hsu MY, Elder DE, Herlyn M. Melanoma: the Wistar(WM)
melanoma cell lines. In: Masters JRW, Palsson B,editors. Human cell
culture. London: Kluwer AcademicPublisher; 1999. p. 259–74.
Cancer Research
Cancer Res 2005; 65: (20). October 15, 2005 9336
www.aacrjournals.org
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
28. Somasundaram R, Swoboda R, Caputo L, et al. ACD4+,
HLA-DR7-restricted T-helper lymphocyte clonerecognizes an antigen
shared by human malignantmelanoma and glioma. Int J Cancer
2003;104:362–8.
29. Groszer M, Erickson R, Scripture-Adams DD, et al.Negative
regulation of neural stem/progenitor cellproliferation by the Pten
tumor suppressor genein vivo . Science 2001;294:2186–9.
30. Satyamoorthy K, DeJesus E, Linnenbach AJ, et al.Melanoma
cell lines from different stages of progressionand their biological
and molecular analyses. MelanomaRes 1997;7 Suppl 2:S35–42.
31. Hsu MY, Li L, Herlyn M. Cultivation of normal humanepidermal
melanocytes in the absence of phorbol esters.Methods Mol Med
2004;107:13–28.
32. Pittenger MF, Mackay AM, Beck SC, et al. Multi-lineage
potential of adult human mesenchymal stemcells. Science
1999;284:143–7.
33. Fang D, Setaluri V. Role of microphthalmia tran-scription
factor in regulation of melanocyte differenti-ation marker TRP-1.
Biochem Biophys Res Commun1999;256:657–63.
34. Fang D, Kute T, Setaluri V. Regulation of tyrosinase-related
protein-2 (TYRP2) in human melanocytes:relationship to growth and
morphology. Pigment CellRes 2001;14:132–9.
35. Le Douarin NM, Kalcheim C. The neural crest. In: LeDouarin
NM, Kalcheim C, editors. Cambridge (UK):Cambridge University Press;
1999.
36. Jiang Y, Jahagirdar BN, Reinhardt RL, et al. Pluri-potency
of mesenchymal stem cells derived from adultmarrow. Nature
2002;418:41–9.
37. Herlyn M, Balaban G, Bennicelli J, et al. Primarymelanoma
cells of the vertical growth phase: similar-
ities to metastatic cells. J Natl Cancer Inst 1985;74:283–9.
38. Weiss S, Reynolds BA, Vescovi AL, Morshead C, CraigCG, van
der Kooy D. Is there a neural stem cell in themammalian forebrain?
Trends Neurosci 1996;19:387–93.
39. Reynolds BA, Weiss S. Clonal and population
analysesdemonstrate that an EGF-responsive mammalian embry-onic CNS
precursor is a stem cell. Dev Biol 1996;175:1–13.
40. Dontu G, Abdallah WM, Foley JM, et al. In vitropropagation
and transcriptional profiling of humanmammary stem/progenitor
cells. Genes Dev 2003;17:1253–70.
41. Toma JG, Akhavan M, Fernandes KJ, et al. Isolation
ofmultipotent adult stem cells from the dermis ofmammalian skin.
Nat Cell Biol 2001;3:778–84.
42. Zhang SC, Wernig M, Duncan ID, Brustle O,Thomson JA. In
vitro differentiation of transplantableneural precursors from human
embryonic stem cells.Nat Biotechnol 2001;19:1129–33.
43. Reubinoff BE, Itsykson P, Turetsky T, et al.
Neuralprogenitors from human embryonic stem cells. NatBiotechnol
2001;19:1134–40.
44. Sieber-Blum M, Grim M, Hu YF, Szeder V. Pluripotentneural
crest stem cells in the adult hair follicle. Dev
Dyn2004;231:258–69.
45. Fernandes KJ, McKenzie IA, Mill P, et al. A dermalniche for
multipotent adult skin-derived precursor cells.Nat Cell Biol
2004;6:1082–93.
46. Nishimura EK, Jordan SA, Oshima H, et al. Dominantrole of
the niche in melanocyte stem-cell fate determi-nation. Nature
2002;416:854–60.
47. Houghton J, Stoicov C, Nomura S, et al. Gastriccancer
originating from bone marrow-derived cells.Science
2004;306:1568–71.
48. Serakinci N, Guldberg P, Burns JS, et al. Adult
humanmesenchymal stem cell as a target for
neoplastictransformation. Oncogene 2004;23:5095–8.
49. Dupin E, Glavieux C, Vaigot P, Le Douarin NM.Endothelin 3
induces the reversion of melanocytes toglia through a neural
crest-derived glial-melanocyticprogenitor. Proc Natl Acad Sci U S A
2000;97:7882–7.
50. Dupin E, Real C, Glavieux-Pardanaud C, Vaigot P,Le Douarin
NM. Reversal of developmental restrictionsin neural crest lineages:
transition from Schwann cellsto glial-melanocytic precursors in
vitro . Proc Natl AcadSci U S A 2003;100:5229–33.
51. Jamieson CH, Ailles LE, Dylla SJ, et al.
Granulo-cyte-macrophage progenitors as candidate leukemicstem cells
in blast-crisis CML. N Engl J Med 2004;351:657–67.
52. Manz MG, Miyamoto T, Akashi K, Weissman IL.Prospective
isolation of human clonogenic commonmyeloid progenitors. Proc Natl
Acad Sci U S A 2002;99:11872–7.
53. Thiery JP. Epithelial-mesenchymal transitions indevelopment
and pathologies. Curr Opin Cell Biol2003;15:740–6.
54. Hsu MY, Wheelock MJ, Johnson KR, Herlyn M. Shiftsin cadherin
profiles between human normal melano-cytes and melanomas. J
Investig Dermatol Symp Proc1996;1:188–94.
55. Bittner M, Meltzer P, Chen Y, et al. Molecularclassification
of cutaneous malignant melanoma bygene expression profiling. Nature
2000;406:536–40.
56. Coiffier B, Lepage E, Briere J, et al. CHOP chemo-therapy
plus rituximab compared with CHOP alone inelderly patients with
diffuse large-B-cell lymphoma.N Engl J Med 2002;346:235–42.
A Stem Cell Population in Melanomas
www.aacrjournals.org 9337 Cancer Res 2005; 65: (20). October 15,
2005
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/
-
2005;65:9328-9337. Cancer Res Dong Fang, Thiennga K. Nguyen, Kim
Leishear, et al. MelanomasA Tumorigenic Subpopulation with Stem
Cell Properties in
Updated version
http://cancerres.aacrjournals.org/content/65/20/9328
Access the most recent version of this article at:
Cited articles
http://cancerres.aacrjournals.org/content/65/20/9328.full#ref-list-1
This article cites 51 articles, 13 of which you can access for
free at:
Citing articles
http://cancerres.aacrjournals.org/content/65/20/9328.full#related-urls
This article has been cited by 53 HighWire-hosted articles.
Access the articles at:
E-mail alerts related to this article or journal.Sign up to
receive free email-alerts
Subscriptions
Reprints and
[email protected] at
To order reprints of this article or to subscribe to the
journal, contact the AACR Publications
Permissions
Rightslink site. (CCC)Click on "Request Permissions" which will
take you to the Copyright Clearance Center's
.http://cancerres.aacrjournals.org/content/65/20/9328To request
permission to re-use all or part of this article, use this link
Research. on June 15, 2021. © 2005 American Association for
Cancercancerres.aacrjournals.org Downloaded from
http://cancerres.aacrjournals.org/content/65/20/9328http://cancerres.aacrjournals.org/content/65/20/9328.full#ref-list-1http://cancerres.aacrjournals.org/content/65/20/9328.full#related-urlshttp://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerres.aacrjournals.org/content/65/20/9328http://cancerres.aacrjournals.org/