SRI SAI COLLEGE OF ENGINEERING AND TECHNOLOGY Badhani,Pathankot,Punjab,India M.Tech. Thesis A NEW APPROACH TOWARDS INFORMATION SECURITY BASED ON DNA CRYPTOGRAPHY Presented in partial fulfillment of the requirements for the degree of Master of Technology in Computer Science & Engineering PRESENTING BY: ABHISHEK MAJUMDAR(1269890) UNDER THE SUPERVISION OF PROF . MEENAKSHI SHARMA te: Jun 13, 2022 PUNJAB TECHNICAL UNIVERSITY Jalandhar- Kapurthala Highway, Jalandhar
46
Embed
A NEW APPROACH TOWARDS INFORMATION SECURITY BASED ON DNA CRYPTOGRAPHY
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
SRI SAI COLLEGE OF ENGINEERING AND TECHNOLOGY
Badhani,Pathankot,Punjab,India
M.Tech. ThesisA NEW APPROACH TOWARDS
INFORMATION SECURITY BASED ON
DNA CRYPTOGRAPHY Presented in partial fulfillment of the requirements for the
degree ofMaster of Technology in Computer Science & Engineering
Data security is one of the most significant issues of data transmission and communication of today's world.
In order to make secure data the researchers are working on the evolvement of new cryptographic algorithms.
One of the efficient directions of achieving security data communication is DNA based Cryptography.
The proposed encoding and decoding process is based on the use of the DNA sequencing string of the DNA strands. The encoded text that is cipher text produced by the encoding algorithm is looks similar with the biological structure of the DNA strands sequence.
CSE Dept. SSCET, Badhani
2
Objective
Encrypt the plain text into DNA sequence (cipher text ) using new DNA encryption technique.
Decrypt this cipher text using DNA decryption technique.
Propose a new model to DNA cryptography
3
CSE Dept. SSCET, Badhani
Outline
Introduction Basis of cryptography Brief idea of DNA DNA Cryptography
Related Works Proposed Method
Key Selection and Generation Encryption
Algorithmic steps Work flow
Ensuring Integrity Algorithmic steps
Strength Conclusion Future Scope References
CSE Dept. SSCET, Badhani
4
Cryptography: The art of protecting information by transforming Plain Text into an unreadable format.
Those who possess the secret key can decrypt the message .
Encrypted messages can sometimes broken by Cryptanalysis .
Basis of Cryptography5
CSE Dept. SSCET, Badhani
Basis of Cryptography contd….6
Figure 1.Basic Structure of Cryptography
Symmetric Cipher Model7
CSE Dept. SSCET, Badhani
Figure 2. Simplified Model of Symmetric Encryption
Intruder’s Attack
Basis of Cryptography Intruder’s
Attack8
Figure 3.Threat of Intruder
Background Study
Genetic Code: Information encoded within genetic material (DNA or mRNA base) .
DNA sequence : Order of nucleotide bases in the DNA molecule.
ATTAGCCTTATGCATGAACC
9
CSE Dept. SSCET, Badhani
Brief idea of DNA
Deoxyribo Nucleic Acid Carrier of the genetic information A double stranded molecule.
Each strand is based on 4 bases: Adenine (A) Thymine (T) Cytosine (C) Guanine (G)
DNA sequence
10
Brief idea of DNA Base Pairing
Adenine (A) pairs with Thymine (T) Guanine (G) pairs with Cytosine(C)
Hydrogen Bonds
CSE Dept. SSCET, Badhani
Figure 4. DNA Base Pairing
DNA Cryptography
First introduced by L. Adleman in 1990s. Plaintext message Encoded into DNA
sequences. Based on one-time-pads .
12
CSE Dept. SSCET, Badhani
Related works
Bibhash Roy et al.The use of round in the encoding scheme is taken from this work. Each time the user has to validate and authenticate them self while accessing the service of the algorithm and every time a new key is generated randomly for data communication. The encryption scheme is designed based on the property of DNA sequencing. It is much more difficult to do cryptanalyst the coded form of message without knowing the selected DNA sequence.Mohammad Reza Abbasy et al.Common DNA sequence is shared between the sender and the receiver. Then the occurrences of the DNA representation of the plain text in the reference DNA sequence is listed by using an indexing method where every couple of nucleotides in DNA reference sequence is given an index number.CSE Dept. SSCET, Badhani
13
Related works contd…
H.Z. Hsu and R.C.T.Lee et al.They presented three methods, the insertion method, the complementary pair method and the substitution method. For each method, they secretly select a reference DNA sequence, transform the sequence into binary bits using binary coding scheme then sub divide the reference sequence bits into segments of fixed number of bits and incorporate the secret message into each segments.After incorporating the message into the DNA sequence, the encoded form of the message is transform into the DNA sequence form, send this encoded message together with many other DNA, or DNA-like sequences to the receiver. The receiver is able to identify the particular desired sequence that is hidden in the encoded message and ignore all of the other sequences. Thus receiver could be able to extract the message. The process of encryption containing different information along with the original message has also been extracted.
CSE Dept. SSCET, Badhani
14
Related works contd…
Sabari Pramanik et al.A single stranded DNA string used as the secret key whose length depends on the plain text and they used it to encrypt the plain text. They divided the plain text into a number of DNA plain text packets and attach the packet sequence number with each packet.
Nirmalya Kar et alA method in which rather than sharing the actual keys directly between the sender and receiver, session keys are shared between the sender and the receiver that actually bears the information about the encryption keys.They had designed an encryption scheme by using the technologies of DNA synthesis and moreover extra bits and the faked DNA sequence were padded within the cipher text that made the message more secure from intruders.
CSE Dept. SSCET, Badhani
15
Related works contd…
Amal Khalifa et al. Discussed a method of text hiding where the text is encrypted using amino acid and DNA based playfair cipher and also use complementary rules to hide the resultant cipher text in a DNA sequence.
Wang, Xing et al. A new way to show how cryptography works with DNA computing, it can transmit message securely and effectively. They have used RSA algorithm belongs to asymmetric key cryptography along with DNA computing theory.
Suman Chakraborty et al.Incorporated an idea of DNA based image encryption using soduko solution matrix to perform some computations on behalf of the message.
CSE Dept. SSCET, Badhani
16
Proposed method
3 phases : Key Generation and Selection
256 bit key Round key generation
Encryption of Plain Text: Block Ciphering DNA Encoding, Primer padding, Hash Mapping
Step 1: Read the byte values from the input file called plaintext and transform each byte value into 8-bit binary representation.
Step 2: Make 256-bit plaintext blocks from the binary representation. Step 3: Repeat step 4 and 11 for each block of plaintext. Step 4: Split the 256-bit block into four 64-bit blocks, namely P1, P2, P3,
P4. Step 5: Subdivide each 64 bit Plain text parts into two 32 bit parts,
namely P1L , P1R , P2L, P2R, P3L, P3R, P4L , P4R
Step 6: Repeat step 7 and 10 for each Keyi, where 1 ≤ i ≤ 4.
Step 7: Read the round encryption key and split into 64 bit parts, namely K1, K2, K3, and K4.
Step 8: Subdivide each 64 bit round key parts into two 32 bit parts, namely K1L , K1R , K2L, K2R, K3L, K3R, K4L , K4RCSE Dept. SSCET, Badhani
23
Message Encryption Algorithmic
step Step 9: Compute four 64 bit parts of the Intermediate Cipher Text and
store into 4 temporary variables:
temp1= Concate [(P1L ⊕ K1R), (P1R ⊕ K1L)]
temp2= Concate [(P2L ⊕ K2R), (P2R ⊕ K2L)]
temp3= Concate [(P3L ⊕ K3R), (P3R ⊕ K3L)]
temp4= Concate [(P4L ⊕ K4R), (P4R ⊕ K4L)]
Step 10: Combine all 64-bit cipher blocks to form 256-bit Intermediate cipher text block:
ICT = Concate(temp1,temp2,temp3,temp4) Step 11: Input ICT as input for the next round as plaintext. Step 12: Compute result of round 4 as final cipher text CT. Step 13: Club together all the 256-bit cipher text blocks.
CSE Dept. SSCET, Badhani
24
Message Encryption Round
operation
Figure 6. Encryption Operation for 4 Rounds
25
Message Encryption Rounds X-OR
operation
Figure 7. Proposed EX-OR Operation
CSE Dept. SSCET, Badhani
26
Message Encryption DNA
Encoding Cipher text is converted into the DNA form of the data
using Binary to DNA substitution rule. Use WatsonCrick complementary rule of DNA. Primer selection from a public DNA database.(say NCBI). Padding extra information.
CSE Dept. SSCET, Badhani
27
Message Encryption DNA
Encoding Using the substitution rule: A=00, T=11, C=01 and
Long 256 bit encryption key– Difficult to brute force attacks
Improved DNA base encryption – Provide ambiguity
Use of Message Detection Code – Ensuring integrity
CSE Dept. SSCET, Badhani
40
Conclusion
Since there are large number of DNA sequences are available it is almost impossible to predict which sequence has been used for encryption.
Intruders will not be able to predict the main cipher text for cryptanalysis due to the presence of extra information along with the main cipher.
CSE Dept. SSCET, Badhani
41
Future Scope
Implementation of signature, steganography.
This improved concept can be used in the security concerned of real time security of distributed network systems.
CSE Dept. SSCET, Badhani
42
Reference43
[1] Bibhash Roy, Gautam Rakshit, Pratim Singha, Atanu Majumder, Debabrata Datta. “A DNA based Symmetric key Cryptography”, Second International Conference on Signals, Systems & Automation, Gujarat, India, pp. 68-72 Jan.2011.
[2] H.Z. Hsu and R.C.T.Lee,“DNA Based Encryption Methods”, The 23rd Workshop on Combinatorial Mathematics and Computation Theory, National Chi Nan University Puli,Nantou Hsies, Taiwan 545, April 2006.
[3] Ashish Gehani, Thomas LaBean and John Reif, “ DNA-Based Cryptography”, DIMACS DNA Based Computers V, American Mathematical Society, 2000.
[4] Bibhash Roy, Gautam Rakshit, Pratim Singha, Atanu Majumder, Debabrata Datta, “An improved Symmetric Key Cryptography with DNA Based Strong Cipher”, International Conference on Device and Communication, BIT Mesra, Ranchi, Jarkhand, India, Feb 2011.
[5] L. Eschenauer and V. D. Gligor, “A key-management scheme for distributed sensor networks”, Proceedings of the 9th ACM conference on Computer and communications security, Washington, DC, USA, pp. 41-47, November 2002.
[6] Bibhash Roy, Atanu Majumder, “An Improved Concept of Cryptography Based on DNA Sequencing”, International Journal of Electronics Communication and Computer Engineering, Vol-3, Issue-6, Nov-2012.
[7] Wang, Xing, and Qiang Zhang, “DNA computing-based cryptography”, Bio-Inspired Computing, 2009. BIC-TA'09. Fourth International Conference on. IEEE, October 2009, pp. 1-3, ISBN: 978-1-4244-3867-9/09.
[8] Guangzhao Cui, Limin Qin Yanfeng Wang Xuncai Zhang, “ Information Security Technology Based on DNA Computing”, 2007 IEEE International Workshop on 16-18 April 2007,pp. 288-291, ISBN: 1-4244-1035-5, Location: Xiamen, Fujian.
[9] Guangzhao Cui Limin Qin Yanfeng Wang Xuncai Zhang, “An encryption scheme using DNA technology. Bio-Inspired Computing: Theories and Application”, 3rd Conference on Publication, Date: Sept.28-2008, ISBN: 978- 1-4244-2724-6, pp. 37-42; Adelaide, SA.
[10] Nirmalya Kar, Atanu Majumder, Ashim Saha, Anupam Jamatia, Kunal Chakma; “An Improved Data Security using DNA Sequencing”, MobileHealth 2013 3rd ACM MobiHoc Workshop on Pervasive Wireless Healthcare In Conjunction With MobiHoc 2013, Symposium, Bangalore,India, July 29- Aug 01, 2013.
CSE Dept. SSCET, Badhani
Reference44
[11] Suman Chakraborty, Sudipta Roy, Prof. Samir K. Bandyopadhyay, “Image Steganography Using DNA Sequence and Sudoku Solution Matrix”. In: International Journal of Advanced Research in Computer Science and Software Engineering, Feb 2012.
[12] Sabari Pramanik,Sanjit Kumar Setua, "DNA Cryptography", 7th International Conference on Electrical and Computer Engineering, IEEE, December.2012, Dhaka, Bangladesh.
[13] Amal Khalifa and Ahmed Atito, “High-Capacity DNA-based Steganography”, 8th International Conference and informatics and Systems (INFOS2012), IEEE, May.2012
[14] Mohammad Reza Abbasy, Pourya Nikfard, Ali Ordi and Mohammad Reza Najaf Torkaman, "DNA Base Data Hiding Algorithm", International Journal on New Computer Architectures and Their Applications (IJNCAA), 2012.
[15] Mohammad Reza Najaf Torkaman, Pourya Nikfard, Nazanin Sadat Kazazi, Mohammad Reza Abbasy, S.Farzaneh Tabatabaiee, "Improving Hybrid Cryptosystems with DNA Steganography ", E. Ariwa and E. El-Qawasmeh (Eds.): DEIS 2011, CCIS 194, pp. 4252, 2011.Springer-Verlag Berlin Heidelberg 2011.
[16] Majid Babaei.: A novel text and image encryption method based on chaos theory and DNA computing, Nat Comput 2013.Springer Science+Business Media B.V.(2012). doi:10.1007/ s11047-012-9334-9.
[17] G. Xiao, M. Lu, L. Qin and X. Lai. New field of cryptography: DNA cryptography. In Chinese Science Bulletin, vol.51, no.12, pp. 1413-1420, 2006.
[18] Behrouz A.Forouzen, Debdeep Mukhopadhyay, “Cryptography and Network Security”,2nd edition, Tata McGraw Hill Education Pvt.Ltd.
[19] V. I. Risca, “DNA-based steganography,” Cryptologia, Tylor and Francis,vol. 25, no. 1, pp. 37–49, 2001.
[20] L. MingXin, L. XueJia, X. GuoZhen, and Q. Lei, “Symmetric-key cryptosystem with DNA technology,” Science in China Series F: Information Sciences, Springer Verlag, Germany, vol. 50, no. 3, pp. 324–333, 2007.
[21] X. Guozhen, L. Mingxin, Q. Lei, and L. Xuejia, “New field of cryptography:DNA cryptography,” Chinese Sience Bulletin, Springer Verlag, Germany, vol. 51, no. 12, pp. 1413–1420, 2006.
CSE Dept. SSCET, Badhani
Reference45
[22] L. Adleman, “Molecular computation of solutions to combinatorial problems,” Science, JSTOR, vol. 266, pp. 1021–1025, 1994.
[23] L. H. N. C. for Biomedical Communications, Handbook on Genetic Cells and DNA. USA: National Library of Medicine, National Institutes of Health, Department of Health and Human Services., 2010.
[24] M. Zhang, L. Sabharwal, and W. Tao, “Interactive DNA sequence and structure design for DNA nanoapplications,” IEEE Transactions on Nanobioscience, vol. 3, no. 4, pp. 286–292, Dec. 2004.
[25] A. Leier, C. Richter, W. Banzhaf, and H. Rauhe, “Cryptography with DNA binary strands,” BioSystems, Elsevier Science, vol. 57, no. 1, pp. 13–22, 2000.
[26] G. Cui, L. Cuiling, L. Haobin, and L. Xiaoguang, “DNA computing and its application to information security field,” IEEE Fifth International Conference on Natural Computation, Tianjian, China, Aug. 2009.
[27] Nirmalya Kar, Atanu Majumder, Ashim Saha, “Data Security and Cryptography Basedon DNA Sequencing”, International Conference on Human Computer Interaction, Education & Information Management System (ICHCEIMS 2013) Sydney, Australia, June 17-18, 2013.
[28] L. XueJia, L. MingXin, Q. Lei, H. JunSong, and F. XiWen, “Asymmetric encryption and signature method with dna technology,” SCIENCE CHINA Information Sciences, vol. 53, pp. 506–514, 2010.
[29] S. V. Kartalopoulos. “DNA-inspired cryptographic method in optical communications, authentication and data mimicking” . Proc. of the IEEE on Military Communications Conference, vol.2, pp.774-779, 2005.
[30] A.Boukerche, K. R. L. Juca, J. B. Sobral and M. S. M. A. Notare. An artificial immune based intrusion detection model for computer and telecommunication systems, Parallel Computing, vol.30, no.5-6, pp.629-646, 2004.