-
Articleshttps://doi.org/10.1038/s41593-019-0481-5
1Department of Physiology and Pharmacology, University of
Calgary, Calgary, Canada. 2Alberta Children’s Hospital Research
Institute, University of Calgary, Calgary, Canada. 3Hotchkiss Brain
Institute, University of Calgary, Calgary, Canada. 4Cumming School
of Medicine, University of Calgary, Calgary, Canada. 5Department of
Psychiatry & Behavioral Sciences and Department of
Bioengineering, Howard Hughes Medical Institute, Stanford
University, Palo Alto, CA, USA. 6These authors contributed equally:
Junting Huang, Vinicius M. Gadotti. *e-mail: [email protected];
[email protected]
The human dorsal lateral PFC (dlPFC) plays an important role in
the cognitive and affective modulation of pain1–3. Noninvasive
stimulation of the dlPFC in humans leads to acute pain modulation
and effectiveness in the treatment of chronic pain states4,5. The
medial PFC (mPFC) is the rodent homolog of the primate dlPFC6. In
mice, parvalbumin-expressing, γ-aminobutyric acid (GABA)ergic
interneurons (PVINs) mediate increased feed-forward inhibition of
mPFC output after peripheral nerve injury, leading to reduced mPFC
output7,8. Optogenetic inhibition of these PVINs consequently
mediates analgesia, as well as revers-ing increased place avoidance
and escape behaviors associated with neuropathic pain7,8. How this
occurs at the cellular, molecular and network level is not
understood. Specifically, it has remained unclear to what extent
specific inputs into the mPFC are modified after peripheral nerve
injury, and which projections originating from the mPFC might be
the downstream effectors of this dysregu-lated mPFC activity. The
mPFC exhibits reciprocal connections with the BLA, a brain region
that receives ascending sensory inputs from the spinal cord via the
parabrachial nucleus9–11. This then raises the possibility that the
observed alterations in mPFC function may originate from BLA
inputs. In the present study, optogenetic approaches were used to
examine the role of specific glutamatergic BLA inputs into the
mPFC, reveal the molecular basis of dysregula-tion of mPFC signal
processing and elucidate the downstream brain circuitry involved in
neuropathic chronic pain states.
ResultsNerve injury-induced dysregulation of BLA inputs into the
mPFC. To establish a functional link between the mPFC and BLA,
first PVINs were genetically labeled by crossing parvalbumin-cre
(PV-cre) mice with cre-dependent Ai9 tdTomato reporter mice
(PV-cre::Ai9), allowing a record to be made of postsynaptic
activity
from labeled layer 5 PVINs and nonlabeled pyramidal neurons in
prelimbic mPFC slices. To achieve selective activation of inputs
from the BLA, ChR2(H134R)-eYFP was virally expressed in pro-jection
neurons originating from the BLA under the control of the
glutamatergic, cell-specific, CaMKIIα promoter (Fig. 1a). Enhanced
yellow fluorescent protein (eYFP)-expressing fibers were observed
in the BLA, as well as in layers 2/3 and 5 of the mPFC (Fig. 1b).
The experiments focused on prelimbic layer 5 because it is the
major output region of the mPFC11. Current-clamp recordings showed
that blue laser pulses induced time-locked action potential firing
in AAV-ChR2(H134R)-eYFP-infected neu-rons in the BLA and in mPFC
layer 5 neurons that receive BLA inputs (Fig. 1c). Voltage clamp
recordings in prelimbic layer 5 PVINs revealed that blue laser
light-induced short-latency evoked excitatory postsynaptic currents
(eEPSCs) when the membrane voltage was held at −70 mV (Fig. 1d).
These eEPSCs were blocked by bath application of tetrodotoxin (TTX)
and could be rescued by bath application of the potassium channel
blocker 4-amino-pyridine (4-AP), which is believed to cause calcium
influx and thus facilitate vesicular release on optical activation
of axon ter-minals (Fig. 1d)12. This is consistent with a
monosynaptic nature of the BLA inputs to PVINs. An apparent small
evoked inhibi-tory postsynaptic current (eIPSC) disappeared after
TTX, and was not rescued with 4-AP, revealing a bisynaptic nature
to this current. Similarly, voltage clamp recordings from
prelimbic, layer 5 pyramidal neurons (glutamatergic projections or
PNs) revealed blue light-induced eEPSCs as well as eIPSCs, both of
which were eliminated by TTX (Fig. 1e). Only the excitatory events
could be rescued by 4-AP, but not the disynaptic feedforward
inhibition mediated by GABAergic interneurons. Therefore,
glutamatergic BLA input into the mPFC forms monosynaptic
connections with both PVINs and PNs.
A neuronal circuit for activating descending modulation of
neuropathic painJunting Huang1,2,3,4,6, Vinicius M.
Gadotti1,2,3,4,6, Lina Chen1,2,3,4, Ivana A. Souza1,2,3,4, Shuo
Huang1,2,3,4, Decheng Wang1,2,3,4, Charu Ramakrishnan 5, Karl
Deisseroth5, Zizhen Zhang 1,2,3,4* and Gerald W. Zamponi
1,2,3,4*
Neuropathic pain can be a debilitating condition with both
sensory and affective components, the underlying brain circuitry of
which remains poorly understood. In the present study, a
basolateral amygdala (BLA)–prefrontal cortex (PFC)–periaqueductal
gray (PAG)–spinal cord pathway was identified that is critical for
the development of mechanical and thermal hypersensitivity after
peripheral nerve injury. It was shown that nerve injury strengthens
synaptic input from the BLA onto inhibitory inter-neurons located
in the prelimbic medial PFC, by virtue of reduced endocannabinoid
modulation. These augmented synaptic connections mediate a
feedforward inhibition of projections from the PFC to the
ventrolateral PAG region and its downstream targets. Optogenetic
approaches combined with in vivo pharmacology reveal that
these BLA–PFC–PAG connections alter pain behaviors by reducing
descending noradrenergic and serotoninergic modulation of spinal
pain signals. Thus, a long-range brain circuit was identified that
is crucial for pain processing and that can potentially be
exploited toward targeting neuropathic pain.
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
mailto:[email protected]:[email protected]://orcid.org/0000-0002-3474-6332http://orcid.org/0000-0001-8069-3756http://orcid.org/0000-0002-0644-9066http://www.nature.com/natureneuroscience
-
Articles Nature NeuroscieNce
g
ca
h
EP
SC
PV
IN/E
PS
CP
N
*
Sham SNI
0
2
4
6
8
BLA inputPN
PVIN or
0
2
4
6
8
eIP
SC
/eE
PS
C
*
BLA input PN
PVIN
20 m
V
400 ms
20 Hz
BLA PrL
20 m
V
400 ms
20 Hz
BLA
PrL
d
L1 L2/3 L5
b
AAV-CaMKIIα-ChR2-eYFP
PFC
BLA
f
PN
PVIN
BLA input
i
Control TTX
TTX + 4-AP
PN
–70 mV
0 mV
–70 mV
0 mV
–70 mV
0 mV
–70 mV
0 mV
PVIN–70 mV
0 mV
–70 mV
0 mV
Control TTX
TTX + 4-APPN
BLA input
PVIN PN
BLA input
PVIN
2.5
0
Control + AM281
** *
eEP
SC
(nA
)
PN
PVIN
BLA inputP
PR
*
**
**
**
0
0.4
0.8
1.2
0 1 2 3 4 5 6 7 8
eEP
SC
(nA
)
Stimulation (V)
SNI (14)Sham (18)
1.6
j
e
2
0
0.0
0.5
1.0
1.5
2.0
2.5
CB
1 pr
otei
n/α-
Tub
ulin
Sham SNI
*
50 kDa
50 kDa
CB1
α-Tubulin
0
1
2
3
4
5
CB
1 m
RN
A/β
-act
in
Sham SNI
*
k l
1.5
0.5
1.0
2.0
1
(8) (6)
(11) (17) (14) (13)
(18)
(14) (14) (13)
(5) (7)
(9)
(10)
(4) (4) (4) (4)
Sham
ipsi
Sham
cont
ra
SNI ip
si
SNI c
ontra
Sham SNI Sham SNI Sham SNI Sham SNI
2 weeks 4 weeks Ipsi Contra
Fig. 1 | effects of nerve injury on BLA inputs into the
prelimbic mPFC. a, Experimental configuration showing
AAV-CaMKIIα-ChR2-eYFP injection into the BLA. b, Sample image
showing eYFP expression in BLA (left) and the prelimbic mPFC
(right). Scale bar, 200 μm (n = 3 mice) c, Sample current-clamp
traces showing light-evoked action potential firing in a
ChR2-eYFP-expressing BLA neuron (left, representative of five
cells) and in a layer 5 prelimbic mPFC neuron receiving BLA inputs
(right, representative of eight cells). d, Sample voltage-clamp
recording of blue laser-induced synaptic currents in a PVIN at Vh
−70 mV or 0 mV, without (control) and with TTX (1 μM) or TTX and
4-AP (100 μM). e, Same as in d but in a layer 5 PN. The scale bars
in d,e reflect 200 pA and 20 ms. f, Amplitude ratio of optically
evoked eEPSCs from pairs of PVINs and PNs within the same brain
slices (P = 0.0452, t = 2.234). g, Optically evoked eIPSC and eEPSC
ratio from the same layer 5 PNs of prelimbic mPFC (P = 0.0122,
t = 2.685). h, Amplitude of eEPSCs recorded in PVINs after
electrical stimulation of the BLA inputs (4 V: P = 0.0337,
t = 2.225; 5 V: P = 0.0212, t = 2.431; 6 V: P = 0.0123, t = 2.664;
7 V: P = 0.0147, t = 2.596; 8 V: P = 0.0031, t = 3.195). Paired
pulse ratio (right) was obtained from the same experiments
(P = 0.0492, t = 2.067). i, Amplitude of eEPSCs recorded in layer 5
PVINs after electrical stimulation of BLA inputs (stimulation
voltage = 8 V) and CB1 antagonist (AM281, 1 μM) application
(P = 0.0050, F = 4.778). j, Quantitative PCR analysis of CB1
receptor mRNA levels in the contralateral prelimbic mPFC from sham
and SNI mice at 2 and 4 weeks after injury (P = 0.0486, t = 2.245
at 2 weeks; P = 0.3308, t = 1.001 at 4 weeks). k, Western blot
examining CB1 receptor protein levels in the prelimbic mPFC at
4 weeks after SNI surgery. This blot represents four independent
repetitions; in one additional experiment no change was observed,
and this was not included in the quantification shown in l. l,
Densitometry analysis of band intensities for CB1 receptor western
blots (P = 0.0324, F = 3.773). The insets in various panels
illustrate optogenetic electrophysiological configuration, with the
laser stimulation indicated in blue. Data are presented as
mean ± s.e.m. Two-tailed, unpaired Student’s t-tests were used for
f,g,h (left and right) and j, one-way ANOVA with Newman–Keuls
multiple comparison test for i and Tukey’s multiple comparison test
for l. The asterisks denote significant differences. In f–i,
numbers in parentheses denote numbers of cells. In j and l, numbers
in parentheses reflect numbers of mice and numbers of independent
assays, respectively. Contra, contralateral; ipsi, ipsilateral; L,
layer; PrL, prelimbic area of mPFC.
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
http://www.nature.com/natureneuroscience
-
ArticlesNature NeuroscieNceGiven that the BLA projects to PNs
both directly and indirectly
via PVINs, it is important to determine the net contribution of
these synaptic inputs to overall PN output. To address this issue,
blue laser (473 nm, 3–5 mW)-induced maximal eEPSCs were recorded in
pairs of prelimbic mPFC layer 5 PNs and PVINs within the same brain
slices in either sham-operated mice or spared nerve injury (SNI)
mice, 7–10 weeks after AAV(ChR2(H134R)) injection into the BLA.
Importantly, this approach eliminates differential viral expression
of ChR2 between different slices or mice as a potential
confound-ing factor. The eEPSC-PVIN:eEPSC-PN ratio was increased in
SNI mice compared with sham controls (Fig. 1f), indicating a nerve
injury-induced strengthening of excitatory inputs into GABAergic
interneurons, which in turn are expected to mediate enhanced
feedforward inhibition of PNs. As layer 5 PNs integrate both
excit-atory and inhibitory input before sending output signals to
other cortical and subcortical areas, the relative excitatory and
inhibitory balance of these neurons is important in determining
their overall activity. Notably, layer 5 PNs receive inputs from
numerous sources, including GABAergic inputs from interneurons in
layers 2/3 and 5 within the prelimbic cortex11,13, the connections
of which are pre-served in slice preparations. Thus, first the
synaptic strength of the direct glutamatergic BLA input into PNs
was compared with that of their BLA-derived disynaptic feedforward
inhibition (originat-ing from layer 2/3 and/or layer 5 PVINs) via
recording of the blue laser-evoked maximum eEPSCs and eIPSCs in the
same layer 5 PNs. These experiments revealed that nerve injury
causes an augmenta-tion of inhibitory over excitatory events (Fig.
1g), thus leading to a potential net inhibition of mPFC output.
To further pinpoint the origin of the plasticity changes, fiber
bundles originating from the BLA were electrically stimulated and
recordings were conducted specifically from tdTomato-labeled layer
5 PVINs in mPFC slices. Compared with sham-operated mice, the
amplitude of eEPSCs in PVINs from SNI animals was increased across
the entire range of test intensities (Fig. 1h, left).
Concomitantly, there were alterations in paired pulse facilitation
in neurons from SNI animals (Fig. 1h, right). These data indicate
that there is a nerve injury-induced increase in synaptic strength
between BLA inputs and mPFC PVINs. Previous reports showed that
cannabinoids play a role in controlling GABA release in the
infralimbic cortex14 and that cannabinoid receptor type 1 (CB1)
receptors are present on glutamatergic afferent inputs in the
pre-limbic area15,16. To determine whether altered cannabinoid
signal-ing may underlie nerve injury-induced alterations in
synaptic input, eEPSCs in tdTomato-labeled PVINs were recorded in
the absence and the presence of the CB1 antagonist AM281.
Application of AM281 selectively augmented synaptic inputs in sham
mice to lev-els that were similar to those seen in SNI mice (Fig.
1i). By contrast, AM281 had no effect in slices from SNI animals
(Fig. 1i), indicating that cannabinoid signaling is already
weakened after nerve injury. Quantitative PCR and Western blot
analyses revealed a down-regulation of CB1 receptor messenger RNA
(Fig. 1j) and protein (Fig. 1k,l) levels in the prelimbic mPFC SNI
mice. The mRNA lev-els of enzymes involved in the regulation of
endocannabinoids were not notably altered after nerve injury, with
the exception of a reduc-tion in
N-acetylphosphatidylethanolamine-hydrolyzing (NAPE)-phospholipase D
(an enzyme involved in anandamide production) 4 weeks after injury
(see Supplementary Fig. 1). Altogether, these data suggest that
nerve injury leads to weakened endocannabinoid signaling in layer 5
of the mPFC, in turn causing a disinhibition of glutamatergic
inputs into PVINs. It is possible that a similar dys-regulation may
occur in layers 2 and 3, but this was not examined in the present
study.
Functional role of BLA–mPFC inputs in neuropathic pain. To
ascertain whether BLA inputs into the mPFC affect pain responses,
in vivo optogenetic experiments were performed. Viruses
were
injected into the BLA, leading to expression of opsins in the
pre-limbic mPFC (see Fig. 1a,b and Supplementary Fig 2a,b) where
they could be activated by an implanted optic cannula. Activation
of BLA inputs with blue laser light (10 Hz, 5–10 mW) in mice that
express AAV5-ChR2(H134R)-eYFP in the prelimbic mPFC (Fig. 2a)
notably enhanced both mechanical and thermal hyperalgesia in SNI
mice (Fig. 2b,c), but did not change the response of sham con-trol
mice (see Supplementary Fig. 3a,b). Analogous experiments (Fig. 2d
and see Supplementary Fig. 2c,d,e) with viral delivery of
inhibitory opsins (Acrh3.0, NpHR3.0) in the BLA revealed that
yellow light inhibited both mechanical and thermal hyperalgesia in
SNI mice, but had no effect in sham-operated animals (Fig. 2e,f and
see Supplementary Fig. 3c–h). Arch3.0-mediated inhibition of
BLA–mPFC projections also led to analgesic effects in models of
cold allodynia (Fig. 2g) and dynamic tactile plantar allodynia
(Fig. 2h), and reversed place escape/avoidance (PEA) responses to
mechanical stimulation of the hindpaw in SNI mice (Fig. 2i),
without affecting locomotor activity (see Supplementary Fig. 4).
The PEA response is consistent with a recent report showing that
inhibition of BLA inputs into the mPFC alters avoidance responses
during conditioned, context–induced retrieval of morphine
with-drawal memory17. In vivo effects of optogenetic
manipulations of the BLA-to-mPFC inputs were further supported by
c-fos staining (see Supplementary Fig. 5). As expected,
ChR2-mediated activation of BLA–mPFC inputs increased c-fos
expression in PVINs in layer 5 of prelimbic mPFC, whereas
Arch3.0-mediated inhibition of BLA–mPFC inputs increased c-fos
expression in PNs in the same area.
Altogether the data reveal that peripheral nerve injury alters
syn-aptic inputs from the BLA to the prelimbic mPFC, and
optogenetic manipulation of this circuit modulates both sensory and
affective components of pain. By contrast, although nerve injury
was associated with increased anxiety, this was insensitive to
optogenetic manipula-tion of the BLA–mPFC projections (see
Supplementary Fig. 6), indi-cating that the observed changes in
pain responses are not associated with a possible anxiolytic effect
of BLA input manipulation.
Mapping of mPFC to PAG projections. How does altered mPFC output
contribute to the pain neuraxis? The PAG area is an impor-tant hub
that processes pain signals in the descending pathway18,19, with
glutamatergic and GABAergic neurons mediating opposing effects20.
The PAG is known to receive projections from the PFC13,21–25.
However, whether this connection regulates pain responses and how
they process pain signals have remained unclear. Thus the
anatomical and functional connections between the mPFC and the PAG
were investigated together with their roles in neuropathic pain.
First, AAV5-CaMKIIα-ChR2(H134R)-eYFP was injected into layer 5 of
the prelimbic mPFC region and then the PAG region was examined for
YFP expression. These experiments revealed that mPFC layer 5
projects predominantly to the posterior ventrolateral (vl) PAG
region (~−4.6 to −4.8 mm from the bregma) (Fig. 3a), with very few
terminals projecting to other parts of the PAG (see Supplementary
Fig. 7a). Then this connection was retrogradely traced with
injection of the cholera toxin subunit B555 (CTB555, Fig. 3b) and
green retrobeads (see Supplementary Fig. 7b) into the vlPAG,
revealing selective layer 5 labeling within the prelimbic mPFC,
with these retrotracers, but scant labeling of the anterior
cin-gulate cortex, infralimbic area and orbital cortex (data not
shown). In addition, the existence of direct mPFC–vlPAG projections
was further confirmed by concomitant injections of
AAV9-hEF1α-DIO-synaptophysin-mCherry virus into layer 5 of the
prelim-bic mPFC and of Cav2-cre retrovirus into the vlPAG (Fig.
3c). As cre-dependent synaptophysin-mCherry expression can occur
only in neurons infected by both viruses, expression of
synaptophysin-mCherry confirms the synaptic connectivity of the
projections from layer 5 of the prelimbic mPFC to the vlPAG. To
further determine the identity of projections from the prelimbic
mPFC to the vlPAG,
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
http://www.nature.com/natureneuroscience
-
Articles Nature NeuroscieNce
Vglut2-cre and GAD2-cre transgenic mice were crossed with Ai9
tdTomato reporter mice, respectively. CTB488 was injected into the
vlPAG and it was found that the projection neurons from the
prelimbic mPFC to the vlPAG were of glutamatergic rather than
GABAergic origin (Fig. 3d). Furthermore, the glutamatergic
pro-jections from the mPFC were found to innervate both
CaMKIIα-positive projection neurons and GABAergic neurons in the
vlPAG (see Supplementary Fig. 7c).
Role of mPFC–PAG connections in neuropathic pain. To deter-mine
how these glutamatergic mPFC–vlPAG projections regulate nociceptive
responses, AAV5-CamKIIα-ChR2(H134R)-eYFP was injected into layer 5
of prelimbic mPFC and an optic fiber was implanted in the vlPAG
(Fig. 4a). It was found that activation of glutamatergic terminals
in the vlPAG with blue light (473 nm, 20 Hz and 5–10 mW) inhibited
both mechanical allodynia and thermal hyperalgesia on the
ipsilateral paws of SNI mice, whereas there
was no effect on the contralateral paws or in sham-operated mice
(Fig. 4b–e). In contrast, when virus was injected into the
infralim-bic area of the PFC, blue light stimulation in the vlPAG
did not affect mechanical hypersensitivity (see Supplementary Fig.
8a,b). These data are consistent with in vitro observations
that neuro-pathic pain states are associated with decreased
neuronal activity in the prelimbic, but not the infralimbic, cortex
of the mPFC which projects to the PAG7,8,13. It was also
investigated whether expression of the inhibitory opsin NpHR3.0 in
the mPFC–vlPAG projections could enhance pain responses. As
expected, delivery of yellow light (589 nm, solid light, 5 mW) in
the vlPAG reduced the mechanical threshold on the ipsilateral side
of SNI mice (Fig. 4f,g), thus exac-erbating neuropathic pain. Taken
together, these data support a mechanism in which enhanced
feedforward inhibition of PNs in the mPFC reduces the activity of
mPFC–vlPAG projections and exacer-bates pain responses, whereas
boosting the firing of these projection neurons via optogenetics
has analgesic properties.
a
f
0
10
20
30
***
Contra Ipsi
Light off Light on
*
0
5
10
15
***
Contra Ipsi
Light off Light on
***
e
g
AAV-CaMKIIα-Arch3.0-eYFPAAV-CaMKIIα-NpHR3.0-eYFP
PFC
BLA
0
10
20
30
Contra Ipsi
Light off Light on
* *
b
0
PW
thre
shol
d (g
)
5
10
15
Contra Ipsi
Light off Light on
*** *
c
AAV-CaMKIIα-ChR2-eYFP
PFC
BLA
d
h
0
1
2
3
4
Sham SNI
*
Noc
ifens
ive
resp
onse
(s)
0
20
40
60
80
100
Contra Ipsi
***
Per
cent
age
with
draw
al
i
****
Light off Light on Light off Light on
Cold allodynia Dynamic plantar
20
40
80
Sham SNI
** ***
Light off Light on
Tim
e (p
erce
ntag
e in
brig
ht s
ide)
60
PEA
(8) (8) (8) (8) (6)
(8) (8) (8) (8) (8) (8) (8) (8)
(6) (6)
(6)
(4)
(4)
(6)
(7)(4) (5)
(4) (5)
(4) (4)
(4)
(5)
PW
late
ncy
(s)
PW
thre
shol
d (g
)
PW
late
ncy
(s)
Fig. 2 | effects of optogenetic manipulation of BLA inputs into
the prelimbic mPFC. a, Experimental configuration showing
AAV-CaMKIIα-ChR2-eYFP injection into the BLA and optic cannula
implantation in the prelimbic mPFC. b,c, Mechanical paw withdrawal
(PW) threshold (b; P
-
ArticlesNature NeuroscieNce
Signal processing of mPFC inputs into the vlPAG region. To
determine how glutamatergic inputs from the mPFC are processed in
the vlPAG, electrophysiological recordings were performed using
vlPAG brain slices in PrL AAV-ChR2 injected mice (Fig. 4h,i,j).
Optical activation of these glutamatergic inputs from the mPFC
triggered excitatory synaptic events in both glutamatergic (Fig.
4i)
and GABAergic (Fig. 4j) cells within the vlPAG. These were found
to be exclusively monosynaptic because light-evoked synaptic events
could be rescued with 4-AP after TTX treatment. Such light-evoked
glutamatergic events were observed in approximately 40% and 36% of
glutamatergic and GABAergic cells examined in the vlPAG,
respectively (Fig. 4k), indicating that not all cells in
a
c
d
b
PFCPAG
AAV5-ChR2
PFCPAG
CTB555
PFCPAG
CTB488
Vglut2-cre-tdTomato
GAD2-cre-tdTomato Merge
MergeCTB488
PFC
L5
L2/3
vl
dl/l
dm
vlPAG
L1
PFC
L2/3 L5
PFC PAG
AAV9-synapto-physin Cav2-cre
vlPAG
PFC
L5L1 L2/3
L1 L2/3 L5
CTB488
PFC
L1 L2/3 L5
Fig. 3 | Circuit projection from the prelimbic mPFC to the
vlPAG. a, AAV5-CaMKIIα-ChR2 (H134R)-eYFP was injected into the
prelimbic mPFC. Images show eYFP virus expression in the mPFC
(left) and the vlPAG (middle and right, n = 4 mice). Scale bars,
200 μm (left), 50 μm (middle) and 20 μm (right). b, CTB555 was
injected into the vlPAG. Images show CTB555 expression in the vlPAG
(left) and retrograde transport to layer 5 of prelimbic mPFC
(middle and right, n = 4 mice). Scale bars, 200 μm (left), 50 μm
(middle) and 20 μm (right). dm, dorsomedial; dl, dorsolateral; l,
lateral; vl, ventrolateral. c, AAV9-hEF1α-DIO-synaptophysin-mCherry
virus was injected into the prelimbic mPFC, and Cav2-cre virus was
injected into the vlPAG. Expression of mCherry is observed in PFC
cell bodies (left), as well as at vlPAG terminals (arrows, middle
and right, n = 4 mice). Scale bars, 20 μm (left), 50 μm (middle)
and 20 μm (right). d, CTB488 was injected into the vlPAG of
Vglut2-cre::Ai9 and GAD2-cre::Ai9 mice to determine the identity of
projection neurons from the mPFC to the vlPAG. Images show that
glutamatergic (arrows in upper panel), but not GABAergic (lower
panel), neurons project from the prelimbic mPFC to the vlPAG (n = 3
mice). Scale bar, 20μm. L, layer.
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
http://www.nature.com/natureneuroscience
-
Articles Nature NeuroscieNce
the vlPAG receive direct inputs from the mPFC. Consistent with
these slice electrophysiology data, in vivo optogenetic
activation of mPFC-to-vlPAG projections resulted in an increase in
c-fos expres-sion in glutamatergic neurons within the vlPAG (see
Supplementary Fig. 9a,c). A similar pattern was also observed in
the vlPAG on opto-genetic inhibition of BLA inputs into the mPFC
(see Supplementary
Fig. 10a,b,c), supporting the concept that further light-induced
reduction of feedforward inhibition of mPFC outputs is transmit-ted
to the vlPAG. On the other hand, activation of glutamatergic
projections from the mPFC to the vlPAG yielded an unexpected
decrease in c-fos expression in GABAergic cells (see Supplementary
Fig. 9b,d). The most salient explanation of this finding may be
the
a b c
PFC PAG
Light
AAV-CaMKIIα-ChR2-eYFPAAV-CaMKIIα-NpHR-eYFP
SNI Sham
0
2
4
6
8
10
Contra Ipsi
**** ****Light onLight off
Ipsi
10
8
6
4
2
0Contra
SNI Sham
Ipsi
10
8
6
4
2
0
Light off Light on10
Ipsi
8
6
4
2
0Contra Contra
d
** **
Ipsi
20
15
10
5
0
Ipsi
20
15
10
5
0Contra
Contra
SNI
Sham
Light off Light on
g
50 ms
40 p
A
PN
Control
TTX
TTX + 4-AP
PAGPFC input
50 ms
40 p
A
GABA
Control
TTX
TTX + 4-AP
PAGPFC input
GABAPN
Recording sites in vlPAG
PN (2
5)
GABA
(47)
GABA
(27)
Per
cent
age
resp
ondi
ng c
ells
100
0
EPSC responderEPSC nonresponderIPSC nonresponder
h
i
NS
NS
NS
0
0.2
0.4
0.6
0.8
1.0Light offLight on
**A
rea
unde
r th
e cu
rve
–1
0
1
2
3
4
5 Light off Light on
Z-s
core
1 2 3 4 5 6
Time (s)
PFC PAG
BLA
Arch3.0-eYFPYellow
light
AAV-GCaMP6f-tdTomato
Fiber photometryprobe
0 200 400 600 800 1,000 1,200–0.02
–0.01
0
0.01
0.02
0.03
0.04
ΔF
/F
NL, no stim YL, no stimNL, VF stim YL, VF stim
Time (s)
j k l
m
e f
n o
(8) (8) (8)(8) (8)
(8)
(8) (8)(12) (12) (12) (12)
(11) (11) (11) (11) (4) (4) (4) (4) (5) (5) (5) (5)
(3)
PW
thre
shol
d (g
)
PW
thre
shol
d (g
)
PW
late
ncy
(s)
PW
late
ncy
(s) *** ****
PW
thre
shol
d (g
)
PW
thre
shol
d (g
)
Fig. 4 | effects of optogenetic manipulation of the prelimbic
mPFC–vlPAG circuit. a, Schematic diagram for optogenetic
manipulation of the prelimbic mPFC–vlPAG circuit with virus
injection into the mPFC and optical cannula implantation in the
vlPAG. b–e, Blue light activation of the prelimbic mPFC–vlPAG
inputs increases paw withdrawal (PW) threshold (b; P
-
ArticlesNature NeuroscieNceexistence of two populations of
GABAergic cells—one that receives direct glutamatergic inputs from
the mPFC with activity that would be expected to increase on ChR2
stimulation, and a second group of cells that might receive
feedforward GABAergic inhibition, thus accounting for an overall
decrease in c-fos expression. In slice recordings, among 27
GABAergic cells that were tested for light-evoked synaptic events,
none showed an eIPSC (Fig. 4k), suggesting an absence of functional
GABAA-receptors in these GABA neurons. However, GABAergic cells did
respond with an outward current, and a decrease in input resistance
to bath application of the GABAB-receptor agonist baclofen (see
Supplementary Fig. 11a,b,c), suggest-ing that such a putative
feedforward inhibition of GABA cells could potentially occur via
volume transmission (see Supplementary Fig. 11d). However,
considerable additional validation of such a possible mechanism is
required before firm mechanistic conclu-sions can be drawn. Suffice
it to say, mPFC inputs into the vlPAG exert differential effects on
GABAergic and glutamatergic cells.
To further examine changes in neuronal activity within the vlPAG
in vivo in real time, the activity of GABAergic cells was
investigated in freely moving nerve-injured mice using fiber
photometry (Fig. 4l). GCaMP6f and tdTomato were bicistronically and
selectively expressed in GABAergic vlPAG neurons using GAD2-cre
mice, in which Arch3.0 was separately expressed in the BLA-to-mPFC
pro-jections (see Supplementary Fig. 12a,b). Bulk fluorescence, a
mea-sure of population activity, was monitored in response to
hindpaw stimulation with a von Frey filament. As shown in Fig.
4m–o, stimu-lation of the hindpaw triggered time-locked transient
increases in calcium fluorescence in vlPAG GABAergic cells.
Concomitant opto-genetic inhibition of BLA–mPFC inputs (which
boosts mPFC out-put to the vlPAG; see Supplementary Fig. 10) led to
a reduction in evoked calcium transients in the vlPAG, which is
consistent with the reduction in c-fos staining of GABAergic cells
(see Supplementary Fig. 9b,d). These data are important in that
they provide direct real-time confirmation of activity changes in
the vlPAG that are induced by alteration of upstream BLA inputs
into the mPFC.
Ablation of mPFC inputs into the vlPAG. To rule out the
pos-sibility that the analgesic effects of inhibiting BLA inputs
into the mPFC might involve other (parallel) pathways, projections
within this pathway were selectively ablated using dual injection
of AAV-mCherry-flex-dtA and Cav2-cre virus. This leads to
expression of diphtheria toxin subunit A (dtA) only in neurons
connecting the two injected brain regions, and thus their ablation.
SNI mice expressing Arch3.0 in the BLA-to-mPFC projections were
injected with AAV-mCherry-flex-dtA in the prelimbic mPFC and
Cav2-cre virus in the vlPAG, and then a fiberoptic cannula was
implanted in the prelimbic mPFC (Fig. 5a). This procedure greatly
decreased the numbers of neurons in layer 5 of the prelimbic mPFC
(Fig. 5b,c) and prevented the analgesic effects of inhibiting
BLA–mPFC inputs (Fig. 5d), indicating that the mPFC–vlPAG
projection is a neces-sary downstream pathway for the control of
pain responses by the BLA–mPFC.
Link between BLA–mPFC–PAG connections and descending modulation
of pain. The PAG is known to be an important relay station for
descending modulation of pain through projections to the spinal
cord via the rostroventral medulla (RVM) and the locus coeruleus
(LC)19. Injection of retrotracers into these two brain structures,
followed by an analysis of vlPAG slices, revealed that the vlPAG
sends GABAergic and glutamatergic projections to both the LC (see
Supplementary Fig. 12c,d) and the RVM (see Supplementary Fig.
12e,f). The dtA-mediated ablation of either the projections from
the vlPAG to the LC or those from the vlPAG to the RVM prevented
the analgesic effects associated with opto-genetic inhibition of
BLA–mPFC inputs (Fig. 5d), indicating that both pathways are
required for top-down control of neuropathic
pain responses by the mPFC. It was noted that a bifurcation of
pain signals from the PAG to the LC and RVM has also been
implicated in opioid analgesia26.
The RVM and LC are known to send descending serotoninergic and
nordadrenergic projections to the spinal cord, respectively27. To
ascertain how these pathways are involved in the BLA-mediated
modulation of pain signals, optogenetics was combined with
in vivo pharmacology (Fig. 5e). AAV-Arch3.0 was injected into
the BLA and a fiberoptic cannula was implanted into the prelimbic
mPFC of SNI mice, as described above. The mechanical withdrawal
thresh-old was measured in the absence and presence of
Arch3.0-mediated inhibition of BLA-to-mPFC inputs. These paradigms
were then repeated after intrathecal delivery of vehicle, the
serotonin (5-HT3) receptor antagonist ondansetron, the
5HT1/2-receptor antagonist metergoline, or the
α2A-adrenergic-receptor antagonist BRL-44408 at effective doses
that were determined in a separate series of in vivo
dose–response experiments (not shown). As clearly evident from the
data presented in Fig. 5f, neither intrathecal delivery of vehicle
nor blocking of 5-HT3 receptors could prevent the analgesic effects
of yellow light-mediated inhibition of BLA–mPFC projections. In
contrast, blocking of either 5HT1/2- or α2A-adrenergic receptors
abolished the effects of inhibiting BLA-to-mPFC inputs, consistent
with the ablation experiments described above. None of the
com-pounds affected hyperalgesia of SNI mice in conditions in which
the BLA–mPFC pathway was not optogenetically inhibited to boost the
mPFC-to-vlPAG inputs (see Supplementary Fig. 13). This altogether
suggests a loss of serotoninergic and adrenergic control during
neu-ropathic states, which precludes further pro-nociceptive
effects by 5HT1/2- or α2A-adrenergic-receptor antagonists. Finally,
as an addi-tional line of evidence, and consistent with the
pharmacological studies, ablation of noradrenergic descending
projections with intra-thecally delivered
N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine (DSP4) also
extinguished the analgesia produced by yellow light in the
prelimbic mPFC (Fig. 5f, and see Supplementary Fig. 14). It was
acknowledged that DSP4 may ablate noradrenergic projec-tions
originating from other brainstem regions that may contribute to
descending modulation28. However, the observation that deletion of
vlPAG-to-LC projections fully prevented the analgesic effects of
inhibiting BLA-to-mPFC inputs suggests that yellow light
modula-tion in the mPFC does not engage DSP4-sensitive pathways
other than the LC in these optogenetic experiments. Collectively,
the data of the present study thus indicate that BLA inputs
regulate neuro-pathic pain by altering the top-down control of the
mPFC over par-allel descending pain pathways via vlPAG.
DiscussionThe processing of pain signals in the brain is
immensely complex, and involves both sensory and affective
components. Many brain regions, including the thalamus29, anterior
cingulate cortex30,31 and PFC1,32 have been implicated in
processing pain-related informa-tion. These regions interact with
brain structures that are involved in pathologies such as anxiety,
reward seeking and depression, thus further complicating the
analysis of brain circuits that process pain-related
information33,34. In the present study the functional connec-tomics
of a linear circuit have been described that is involved in the
development of neuropathic pain. The data reveal that peripheral
nerve injury leads to a selective augmentation of BLA inputs into
GABAergic interneurons in the prelimbic area of the PFC as a result
of weakened endocannabinoid signaling. Indeed, the strengthening of
these synaptic inputs can be observed in PFC slices that contain
the axonal tracts, indicating that this dysregulation resides
within the PFC itself and is supported by the overall reduction in
CB1-receptor expression in this region. Although quantitative PCR
and western blot analyses do not allow determination of whether
CB1-receptor density is decreased in specific BLA-originating
presyn-aptic terminals, the electrophysiological analysis is
consistent with
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
http://www.nature.com/natureneuroscience
-
Articles Nature NeuroscieNce
such a mechanism. A role for the mPFC cannabinoid system in
neu-ropathic pain is supported by a recent study showing that
sublingual administration of the CB1 agonist
δ9-tetrahydrocannabinol medi-ated analgesia by reducing the
connectivity of the dlPFC (the equiv-alent of which is the mPFC in
rodents) and chronic pain network components in neuropathic pain
patients35. The selective strength-ening of glutamatergic inputs
into PVINs leads to an overall inhi-bition of layer 5 pyramidal
cell output toward the vlPAG. Within the vlPAG, this leads to
reduced activity of glutamatergic neurons and increased activity of
GABAergic neurons. Increased inhibition together with less
excitation is expected to reduce serotoninergic and noradrenergic
output from the RVM and LC to the spinal dorsal horn, respectively,
thus leading to compromised descending modu-lation of ascending
nociceptive inputs (see Supplementary Fig. 15). It is possible that
the loss of descending adrenergic modulation
could give rise to a progressive cycle in which increased inputs
into the BLA sustain a tonic inhibition of mPFC function. Specific
opto-genetic inhibition of BLA inputs into the mPFC weakens the
feed-forward inhibition, thus boosting mPFC inputs into the vlPAG
and its downstream projections to the RVM, LC and spinal cord,
culmi-nating in analgesia. Ablation experiments of the
mPFC-to-vlPAG projections, and the downstream ablation between
vlPAG and LC or RVM fully prevented the analgesic effects of
optogenetic modula-tion of the BLA-to-mPFC input, suggesting that
BLA inputs into the mPFC do not modulate pain behavior through
mPFC-originating pathways that bypass the vlPAG. It is interesting
to reiterate that these analgesic effects required the
functionality of both branches of the descending pathway, as if the
neuronal circuitry within the spinal cord acted as a coincidence
detector for both serotoniner-gic and noradrenergic inputs.
Additional work will be required to
dtAa b
d
e
PFC PAG
Cav2-cre
BLA
Arch3.0-eYFP
AAV-mCherry-flex-dtA
Yellowlight
dtA + Cav2
c
BLA
Arch3.0-eYFP
Intrathecal injectionof drugs
L5PAG
PFC
Yellowlight
0
2
4
6
8
10 ** * **NS
NS
Light offLight on
Light off – no drugLight on – drug
PBS Ond Meterg BRL PBS DSP4
NS
0
2
4
6
8
10 Light off Light on
**
Sham
SNI
NS NSNS
0
20
40
60
80**
dtA + Cav2dtA
No.
of p
roje
ctio
n ne
uron
sin
pre
limbi
c P
FC
f
(3)
(4)
(7) (10) (7) (6) (3)
(7) (5) (5) (11) (4) (4)
PW
thre
shol
d (g
)
dtA
only
PFC-
PAG
PAG-
RVM
PAG-
LC
PW
thre
shol
d (g
)dtA + Cav2dtA
Fig. 5 | optogenetic and pharmacological manipulation of the
BLA–mPFC–vlPAG–spinal cord circuit and its effect on mechanical
allodynia. a, Schematic diagram for dtA-mediated ablation of
mPFC–vlPAG projections. b, Images for mCherry-labeled neurons in
layer 5 of the prelimbic mPFC with dtA (left) versus dtA + Cav2
(right) injection (n = 3 mice for the dtA group and n = 4 mice for
the dtA + Cav2 group). Scale bar, 20 μm. c, Quantification of
neuronal loss in layer 5 of the prelimbic mPFC (P = 0.0069,
t = 4.415). d, Effect of dtA-mediated ablation of mPFC-to-vlPAG
projections, vlPAG-to-RVM projections and vlPAG–LC projections on
the analgesic effects of Arch3-mediated inhibition of the BLA–mPFC
circuit (P
-
ArticlesNature NeuroscieNcedetermine whether blockers of
GABAergic, opioidergic or glyciner-gic signaling in the spinal cord
are also effective in interfering with yellow light-mediated
modulation of BLA–mPFC inputs.
Altogether, the data presented in the present study constitute
an in-depth analysis of the functional connectomics of the
BLA–mPFC–PAG–spinal cord pathway, and establish a causal link
between the dysregulation of this circuit and sensory and
affec-tive components of pain. How this pathway interacts with
other brain structures involved in the regulation of pain signals
will be an important area of future research, and it will be
important to deter-mine how the pathway examined in the present
study interacts with other circuits involved in the cortical
modulation of pain signals. Furthermore, it is fully acknowledged
that other pathways such as anterior cingulate cortex–spinal cord
and S1/S2–spinal cord con-nections contribute to the processing of
neuropathic pain signals36,37 and may play an important role in
descending pain modulation; it is possible that different pathways
are engaged in different types of acute and chronic pain states.
Nevertheless, it must be noted that the present findings are
consistent with observations that enhanced BLA inputs into the mPFC
have been associated with pain-related cognitive deficits in a rat
model of arthritis38. Moreover, two recent human functional
magnetic resonance imaging studies showed a communication of pain
signals between the PFC and the PAG39,40, thus supporting the
relevance of these findings beyond the rodent brain. In this
context, the present data hint at possible strategies for
combatting mechanical allodynia and thermal hyperalgesia in
neuropathic pain sufferers via noninvasive modulation of the
BLA–mPFC–vlPAG neuraxis.
online contentAny methods, additional references, Nature
Research reporting summaries, source data, statements of code and
data availability and associated accession codes are available at
https://doi.org/10.1038/s41593-019-0481-5.
Received: 18 April 2019; Accepted: 25 July 2019; Published: xx
xx xxxx
References 1. Lorenz, J., Minoshima, S. & Casey, K. L.
Keeping pain out of mind: the
role of the dorsolateral prefrontal cortex in pain modulation.
Brain 126, 1079–1091 (2003).
2. Apkarian, A. V. et al. Chronic back pain is associated
with decreased prefrontal and thalamic gray matter density. J.
Neurosci. 24, 10410–10415 (2004).
3. Devoize, L., Alvarez, P., Monconduit, L. & Dallel, R.
Representation of dynamic mechanical allodynia in the ventral
medial prefrontal cortex of trigeminal neuropathic rats. Eur. J.
Pain. 15, 676–682 (2011).
4. Seminowicz, D. A. & Moayedi, M. The dorsolateral
prefrontal cortex in acute and chronic pain. J. Pain 18, 1027–1035
(2017).
5. Taylor, J. J., Borckardt, J. J. & George, M. S.
Endogenous opioids mediate left dorsolateral prefrontal cortex
rTMS-induced analgesia. Pain 153, 1219–1225 (2012).
6. Seamans, J. K., Lapish, C. C. & Durstewitz, D. Comparing
the prefrontal cortex of rats and primates: insights from
electrophysiology. Neurotox. Res. 14, 249–262 (2008).
7. Zhang, Z. et al. Role of prelimbic GABAergic circuits in
sensory and emotional aspects of neuropathic. Pain Cell Rep. 12,
752–759 (2015).
8. Lee, M. et al. Activation of corticostriatal circuitry
relieves chronic neuropathic pain. J. Neurosci. 35, 5247–5259
(2015).
9. Little, J. P. & Carter, A. G. Synaptic mechanisms
underlying strong reciprocal connectivity between the medial
prefrontal cortex and basolateral amygdala. J. Neurosci. 33,
15333–15342 (2013).
10. McGarry, L. M. & Carter, A. G. Prefrontal cortex drives
distinct projection neurons in the basolateral amygdala. Cell Rep.
21, 1426–1433 (2017).
11. Cheriyan, J., Kaushik, M. K., Ferreira, A. N. & Sheets,
P. L. Specific targeting of the basolateral amygdala to
projectionally defined pyramidal neurons in prelimbic and
infralimbic cortex. eNeuro 3,
https://doi.org/10.1523/ENEURO.0002-16.2016 (2016).
12. Collins, D. P., Anastasiades, P. G., Marlin, J. J. &
Carter, A. G. Reciprocal circuits linking the prefrontal cortex
with dorsal and ventral thalamic nuclei. Neuron 98, 366–379
(2018).
13. Cheriyan, J. & Sheets, P. L. Altered excitability and
local connectivity of mPFC-PAG neurons in a mouse model of
neuropathic pain. J. Neurosci. 38, 4829–4839 (2018).
14. Woodhams, S. G., Chapman, V., Finn, D. P., Hohmann, A. G.
& Neugebauer, V. The cannabinoid system and pain.
Neuropharmacology 124, 105–120 (2017).
15. Fortin, D. A. & Levine, E. S. Differential effects of
endocannabinoids on glutamatergic and GABAergic inputs to layer 5
pyramidal neurons. Cereb. Cortex 17, 163–174 (2007).
16. Caballero, A. & Tseng, K. Y. Association of cannabis use
during adolescence, prefrontal CB1 receptor signaling, and
schizophrenia. Front. Pharmacol. 3, 101 (2012).
17. Song, J. et al. Crucial role of feedback signals from
prelimbic cortex to basolateral amygdala. Sci. Adv. 5, eaat3210
(2019).
18. Reynolds, D. V. Surgery in the rat during electrical
analgesia induced by focal brain stimulation. Science 164, 444–445
(1969).
19. Basbaum, A. I. & Fields, H. L. Endogenous pain control
systems: brainstem spinal pathways and endorphin circuitry. Annu.
Rev. Neurosci. 7, 309–338 (1984).
20. Samineni, V. K. et al. Divergent modulation of
nociception by glutamatergic and GABAergic neuronal subpopulations
in the periaqueductal gray. eNeuro 4,
https://doi.org/10.1523/ENEURO.0129-16.2017 (2017).
21. Hardy, S. G. & Leichnetz, G. R. Frontal cortical
projections to the periaqueductal gray in the rat a retrograde and
orthograde. Neurosci. Lett. 23, 13–17 (1981).
22. An, X., Bandler, R., Ongür, D. & Price, J. L. Prefrontal
cortical projections to longitudinal columns in the midbrain
periaqueductal gray in macaque monkeys. J. Comp. Neurol. 401,
455–479 (1998).
23. Ferreira, A. N., Yousuf, H., Dalton, S. & Sheets, P. L.
Highly differentiated cellular and circuit properties of
infralimbic pyramidal neurons projecting to the periaqueductal gray
and amygdala. Front. Cell Neurosci. 9, 161 (2015).
24. Franklin, T. B. et al. Prefrontal cortical control of a
brainstem social behavior circuit. Nat. Neurosci. 20, 260–270
(2017).
25. Rozeske, R. R. et al. Prefrontal-periaqueductal
gray-projecting neurons mediate context fear discrimination. Neuron
97, 898–910 (2018). e896.
26. Kim, J. H. et al. Yin-and-yang bifurcation of
opioidergic circuits for descending analgesia at the midbrain of
the mouse. Proc. Natl Acad. Sci. USA 115, 11078–11083 (2018).
27. Ossipov, M. H., Dussor, G. O. & Porreca, F. Central
modulation of pain. J. Clin. Invest. 120, 3779–3787 (2010).
28. Nam, H. & Kerman, I. A. Distribution of
catecholaminergic presympathetic-premotor neurons in the rat lower
brainstem. Neuroscience 324, 430–445 (2016).
29. Craig, A. D., Bushnell, M. C., Zhang, E. T. & Blomqvist,
A. A thalamic nucleus specific for pain and temperature
sensation.pdf. Nature 372, 770–773 (1994).
30. Johansen, J. P., Fields, H. L. & Manning, B. H. The
affective component of pain in rodents: direct evidence for a
contribution of the anterior cingulate cortex. Proc. Natl Acad.
Sci. USA 98, 8077–8082 (2001).
31. Bliss, T. V., Collingridge, G. L., Kaang, B. K. & Zhuo,
M. Synaptic plasticity in the anterior cingulate cortex in acute
and chronic pain. Nat. Rev. Neurosci. 17, 485–496 (2016).
32. Ohara, P. T., Vit, J. P. & Jasmin, L. Cortical
modulation of pain. Cell. Mol. Life Sci. 62, 44–52 (2005).
33. Barthas, F. et al. The anterior cingulate cortex is a
critical hub for pain-induced depression. Biol. Psychiatry 77,
236–245 (2015).
34. Jahn, A., Nee, D. E., Alexander, W. H. & Brown, J. W.
Distinct regions within medial prefrontal cortex process pain and
cognition. J. Neurosci. 36, 12385–12392 (2016).
35. Weizman, L. et al. Cannabis analgesia in chronic
neuropathic pain is associated with altered brain connectivity.
Neurology 91, 1285–1294 (2018).
36. Chen, T. et al. Top-down descending facilitation of
spinal sensory excitatory transmission from the anterior cingulate
cortex. Nat. Commun. 9, 1886 (2018).
37. Liu, Y. et al. Touch and tactile neuropathic pain
sensitivity are set by corticospinal projections. Nature 561,
547–550 (2018).
38. Ji, G. et al. Cognitive impairment in pain through
amygdala-driven prefrontal cortical deactivation. J. Neurosci. 30,
5451–5464 (2010).
39. Roy, M. et al. Representation of aversive prediction
errors in the human periaqueductal gray. Nat. Neurosci. 17,
1607–1612 (2014).
40. Tinnermann, A., Geuter, S., Sprenger, C., Finsterbusch, J.
& Büchel, C. Interactions between PFC-PAG-spinal cord mediate
value effects in nocebo hyperalgesia. Science 358, 105–108
(2017).
AcknowledgementsThis work was supported by a Foundation Grant to
G.W.Z. from the Canadian Institutes of Health Research, and by the
Canada–Israel Health Research Initiative, jointly funded by the
Canadian Institutes of Health Research, the Israel Science
Foundation, the
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
https://doi.org/10.1038/s41593-019-0481-5https://doi.org/10.1038/s41593-019-0481-5https://doi.org/10.1523/ENEURO.0002-16.2016https://doi.org/10.1523/ENEURO.0002-16.2016https://doi.org/10.1523/ENEURO.0129-16.2017http://www.nature.com/natureneuroscience
-
Articles Nature NeuroscieNceInternational Development Research
Centre and the Azrieli Foundation. G.W.Z. is a Canada Research
Chair in Molecular Neuroscience. V.M.G. is supported through the Vi
Riddell Program in Pediatric Pain of the Alberta Children’s
Hospital Research Institute. S.H. is supported by a studentship
from Alberta Innovates and a University of Calgary Eyes-High
studentship. We thank T. Fuzesi and the Cumming School of Medicine
Optogenetics facility for technical assistance with fiber
photometry.
Author contributionsZ.Z., J.H. and G.W.Z. conceived the project.
J.H., Z.Z. and V.M.G. designed and performed the experiments,
analyzed the data, prepared the figures and contributed to the
writing. L.C. performed the tissue extractions and immunostaining
experiments. I.A.S. performed the western blotting. Z.Z., D.W. and
S.H. performed the electrophysiology experiments. G.W.Z. directed
and supervised the study and co-wrote the manuscript. C.R. and K.D.
provided the reagents and discussion, and edited the
manuscript.
Competing interestsThe authors declare no competing
interests.
Additional informationSupplementary information is available for
this paper at https://doi.org/10.1038/s41593-019-0481-5.
Reprints and permissions information is available at
www.nature.com/reprints.
Correspondence and requests for materials should be addressed to
Z.Z. or G.W.Z.
Peer review information: Nature Neuroscience thanks C. Woolf and
the other, anonymous, reviewer(s) for their contribution to the
peer review of this work.
Publisher’s note: Springer Nature remains neutral with regard to
jurisdictional claims in published maps and institutional
affiliations.
© The Author(s), under exclusive licence to Springer Nature
America, Inc. 2019
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
https://doi.org/10.1038/s41593-019-0481-5https://doi.org/10.1038/s41593-019-0481-5http://www.nature.com/reprintshttp://www.nature.com/natureneuroscience
-
ArticlesNature NeuroscieNceMethodsAnimals. Animal experiments
were approved by the Animal Care Committee of the University of
Calgary. Male C57BL/6J wild-type and transgenic mice were purchased
from Jackson laboratories. Cre transgenic mice (PV-cre:
B6;129P2-Pvalbtm1(cre)Arbr/J, Vglut2-cre: Slc17a6tm2(cre)Lowl/J and
GAD2-cre: Gad2tm2(cre)Zjh/J) were crossed with tdTomato reporter
mice (Ai9: B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J) for labeling
of parvalbumin, glutamatergic and GABAergic neurons, respectively,
in imaging and brain-slice (mPFC and vlPAG) electrophysiological
recordings. Mice were kept on a 12-h light/dark cycle (lights on at
7am) in a holding room kept at a temperature of 23 ± 1 °C; food and
water were freely available.
Electrophysiology. Acute coronal forebrain slices (300 μm)
containing prelimbic mPFC or coronal brainstem slices (260 μm)
containing the vlPAG were obtained from C57BL/6J or transgenic
mice. Briefly, coronal sections were cut using a Vibratome (Leica
VT1200S, Leica Biosystems) in an ice-cold sucrose- or
N-methyl-d-glucamine-based solution. Brain slices were first
incubated at 33.5 °C for 50 min, then transferred to room
temperature in normal external solution for at least 1 h before
recording. Whole-cell patch clamp recordings were performed using
MultiClamp 700B and Digidata 1440 A (Molecular Devices). Normal
external solution contained (mM): NaCl 120, NaH2PO4 1.25, NaHCO3
26, glucose 25, CaCl2 2.5, KCl 2.5, MgSO4·7H2O 1.3. The
intracellular solution for current clamp was potassium gluconate
based, and the solution for voltage clamp was cesium
methanesulfonate based (supplemented with 5 mM QX314). For eEPSC
and eIPSC recordings, Vh was held at –70 mV (calculated from Cl–
reversal potential) and 0 mV (reversal potential for EPSC),
respectively. TTX (1 μM) was used to block action potential-based
synaptic transmission. Both TTX (1 μM) and 4-AP (100 μM) were used
to re-establish monosynaptic transmission under blue light. The
eEPSC recordings in Fig. 1h,i were performed without GABA blockers
in the extracellular solution. The recorded eEPSCs in these
experiments had short constant latency with low jitters, and
followed 20-Hz stimulation (not shown), indicating the monosynaptic
nature of these eEPSCs. To record both eEPSCs and disynaptic eIPSCs
in the prelimbic area of the mPFC in Fig. 1g, GABA blockers were
not typically used, but bicuculline methiodide (10 μM) was added in
the extracellular solution in experiments shown in Fig. 1f. For
experiments in Figs 1d,e and 4h,i,j,k, both TTX and 4-AP were used
to restore glutamatergic, monosynaptic, evoked current9. In some
experiments eEPSCs were verified using
6,7-dinitroquinoxaline-2,3-dione (DNQX, 10 μM) and AP5 (50 μM),
added in extracellular solution at the end of recording. For
experiments in Supplementary Fig. 11a, b, DNQX (20 μM), AP5 (50 μM)
and bicuculline (10 μM) were added to the extracellular solution.
Mice injected with AAV5-CamKIIα-ChR2-eYFP virus in the BLA (mPFC
slice recording) or in the prelimbic area of mPFC (vlPAG slice
recording) were allowed to express ChR2 in the axon terminal area
(PrL or vlPAG, respectively) for at least 8–10 weeks before brain
slice recording. Both diode-pumped solid-state (DPSS) lasers
(Laserglow Technologies) and light-emitting diodes (LEDs; Thorlabs)
were used to illuminate brain slices for recording. The recording
temperature was 33 ± 1 °C. All chemicals were purchased from Tocris
or Sigma.
Stereotaxic surgeries and injections. Mice (~8 weeks old) were
anesthetized with isoflurane (4–5% for induction, 1.5–2.0% for
maintenance) in a stereotaxic frame (Stoelting). Viral titers of
adeno-associated virus (AAV) vectors were between 2 × 1012 and 9.9
× 1012 viral genomes per milliliter. To express opsins in brain
areas of interest, AAV5-CaMKIIα-ChR2 (H134R)-eYFP (500–650 nl),
AAV5-CaMKIIα-Arch3.0-eYFP (500–600 nl) or AAV5-CaMKIIα-NpHR3.0-eYFP
(500–600 nl) was injected using an automatic nanoliter injector
(Nanoject II, Drummond Scientific) positioned into the prelimbic
area of the PFC (anteroposterior (AP) +1.8–1.9 mm; right (R) −0.5
mm; dorsoventral (DV) −2.1 mm), BLA (AP −1.3 mm; R −3.4 mm; DV −4.9
mm) or infralimbic PFC (AP +1.9 mm; R −0.5 mm; DV −2.5-2.6 mm). In
some cases the AAV8 serotype was used in place of AAV5, with
identical results. To retrogradely trace the PFC–PAG long
projection, cholera toxin subunit B (0.1%, w/v, 500-600 nl, CTB488
and CTB555, Thermo Fisher Scientific) or retrobeads (100–150 nl,
Lumafluor Inc.) were injected into the vlPAG (AP −4.6-4.7 mm; R
−0.5 mm; DV −3.3 mm) and allowed 5–7 d for sufficient retrograde
transport41,42. To map the vlPAG–LC and vlPAG–RVM projections,
CTB488 (0.1%, w/v, 600 nl) was injected into the LC (AP −5.4 mm; R
−0.9 mm; DV −4.0 mm) and RVM (AP −5.8 mm; R 0 mm; DV −6.2 mm),
respectively. To further confirm the selective projection from the
prelimbic mPFC to the vlPAG, AAV9-hEF1α-DIO-synaptophysin-mCherry
virus (200 nl) was injected into the prelimbic mPFC (AP +1.9 mm; R
−0.5 mm; DV −2.2 mm) and Cav2-cre virus (100–150 nl)43 was injected
into the vlPAG (AP −4.6–4.7 mm; R −0.5 mm; DV −3.3 mm).
AAV-ChR2, AAV-Arch3.0 and AAV-NpHR3.0 viruses were obtained from
either the Deisseroth lab or the University of North Carolina
Vector Core. Cav2-cre virus was obtained from Dr E. J. Kremer
(Montpellier, France) and AAV9-hEF1α-synaptophysin-mCherry virus
was obtained from Dr R. L. Neve (Massachusetts Institute of
Technology, Cambridge, MA, USA). Injections were performed using a
digital stereotaxic frame with a glass capillary. The viral
suspensions, CTB or retrobeads were delivered at 50 nl min–1. After
completing the injection, the injection capillary remained in
position for 5 min and then was raised 100 μm with an additional 10
min wait to allow for the virus/CTB/retrobeads to diffuse
at the injection site, and then the glass needle was slowly
withdrawn. Viruses were allowed to express themselves for at least
6–8 weeks before optogenetic manipulation. For projection tracing,
the numbers of mice given in the figure captions reflect successful
repetitions. There were cases in which projections could not be
detected in the target area (for example, due to off-target
injections of viruses or retrograde tracers) and data from such
animals are not included in these totals. For Fig. 1b, additional
successful BLA-to-mPFC projections were visually observed during
mPFC slice recordings, but not included in the total numbers of
mice because no images were acquired.
SNI surgeries. Surgeries were performed on 7-week-old, wild-type
(C57BL/6J) or transgenic mice as previously described44. Briefly,
under isoflurane anesthesia a 0.5-cm skin incision was made on the
left thigh to expose the three branches of the sciatic nerve (that
is, common peroneal, tibial and sural nerves). Common peroneal and
tibial nerves were tightly ligated with a 6/0 silk suture (Ethicon)
and transected together. A 1-mm piece of the nerves was removed.
Precaution was taken to avoid damage to the sural nerve. After
surgery, the overlaying muscles and skin were separately closed
with 6/0 silk and 4/0 Vicryl sutures, respectively. After surgery
animals were placed in a new cage for recovery for at least 10–12 d
before further brain cannula implantation or brain slices
recordings. In sham-operated animals, exactly the same procedure
was performed but without ligation and transection of the nerves.
Most of the SNI mice displayed neuropathic pain response (reduced
thermal withdrawal latency and mechanical threshold) 10–14 d after
SNI surgery. Animals that did not exhibit neuropathic phenotype
after 14 d were discarded without further experiments. Baseline
measurements were taken before the surgeries.
Optogenetic manipulation and in vivo testing. For
optogenetic manipulation, a fiberoptic cannula (2.5 mm ceramic
ferrule, 2.0 mm length for the prelimbic mPFC and 4.0 mm length for
the vlPAG, Thorlabs), with core diameter 200 µm, 0.39 numerical
aperture (NA) fiber, was implanted into the right PFC (A: +1.9 mm;
R −0.5 mm; DV −2.1 mm) or right vlPAG (AP −4.6-4.7 mm; R −0.5 mm;
DV −3.3 mm) 10 d after virus injection. For sensory pain analysis,
testing was carried out between 7 and 8 weeks after virus
injections. Thermal withdrawal latency and mechanical withdrawal
threshold were measured with a Hargreave’s Apparatus and a Dynamic
Plantar Aesthesiometer (Ugo Basile), respectively. Mice were placed
individually in Plexiglass chambers on top of a glass platform or a
grid floor, and allowed to habituate for at least 90 min before
testing. Mice were then tested at the ipsilateral hindpaws
(nerve-injured side) and contralateral paws before light
stimulation. After 30 min, mice were stimulated with blue or yellow
light, beginning 3 min before pain assessments and with constant
stimulation until the end of the testing session. Mechanical
thresholds or thermal latencies were measured three times for each
mouse. DPSS lasers (blue 473 nm and yellow 589 nm; Laserglow
Technologies) with 5–15 mW at the fiber tip (S130C power sensor,
Thorlabs) were used for all the behavioral testing.
Acetone evaporation test for cold allodynia. The acetone
evaporation test was performed as previously described, but with
minor modifications45. Acetone 20 µl was applied to the plantar
surface of the left hindpaw using a 0.5-ml syringe. Mice were
divided into four different groups: sham (light OFF), sham (light
ON), SNI (light OFF) and SNI (light ON) and observed for 1 min
after the acetone application. Nocifensive behavior (withdrawal,
licking, flinching) was considered to be a positive response and
quantified with a chronometer. Each paw was tested only once and
the total duration of nocifensive responses recorded.
Dynamic tactile allodynia. Dynamic tactile allodynia testing was
performed between 7 and 8 weeks after virus injection and assessed
by lightly stroking the lateral external side of the surface of the
injured hindpaw, in the direction from heel to toe with a von Frey
monofilament (0.4 g) without bending the filament. After
acclimatizing the mice for about 90 min in the observation chambers
on top of a grid mesh, both contralateral and ipsilateral paws were
tested 10 times, with intervals of 10–15 s, and the percentage of
withdrawal for each paw was considered as the pain response. Mice
were tested before opto-light stimulation (light OFF) and after 45
min they were stimulated with yellow light on (light ON) for 3 min
and both hindpaws were tested.
Open field test for anxiety and locomotor activity. An open
field test was used to access anxiety-related behavior and
locomotor activity. The apparatus consists of a wooden box
measuring 40 × 60 × 50 cm3 with a frontal glass wall46. The floor
of the arena is divided into 12 equal squares and placed in a
sound-free room. Animals were placed in the rear left square and
allowed to explore freely for 6 min. Crossings reflect the number
of grid lines that were crossed with all paws (crossing).
Normalized data (periphery/center ratio) reflect anxiety-related
behavior. The apparatus was cleaned with a 70% alcohol solution and
dried after each individual mouse session.
PEA paradigm. A PEA paradigm was used to assess affective pain
behavior. Mice were assessed for the time spent in the dark and
bright sides of a rectangular enclosure (length × width × height:
65 × 21 × 30 cm3, with one side of the walls
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
http://www.nature.com/natureneuroscience
-
Articles Nature NeuroscieNcepainted dark and the other side
painted white), placed on top of a grid floor platform. Under
normal conditions, the mice spend most of their time in the dark
side. On stimulation of the ipsilateral paw with a von Frey
filament (0.4 g) while at the dark side, the mice displayed PEA
behavior (that is, moving to the bright side) which was exacerbated
by peripheral nerve injury.
Fiber photometry in vivo recording. GAD2-cre:
Gad2tm2(cre)Zjh/J) mice (~8 weeks old) were used. For in vivo
recording, AAV5-CaMKIIα-Arch3.0-eYFP (500–600 nl) and
AAV-EF1a-DIO-GCaMP6f-P2A-nls-tdTomato (600 nl) were injected into
the BLA (AP −1.3 mm; R −3.4 mm; DV −4.9 mm) and vlPAG (AP −4.6 mm,
R −0.5 mm, DV −3.3 mm), respectively. SNI surgery was performed ~2
weeks after virus injection. Fiberoptic calcium-recording cannulas
were implanted in the prelimbic area of the PFC (AP +1.9 mm; R −0.5
mm; DV −2.1 mm) for yellow laser stimulation and into the vlPAG (AP
−4.6 mm; R −0.5 mm; DV −3.3 mm) ~6 weeks after virus injection,
with 2.0-mm (200 μm core, 0.39 NA, ceramic ferrule) and 5.0-mm
length fibers (400 μm core, 0.39 NA, SS ferrule) (Thorlabs),
respectively. In vivo recording was performed ~8 weeks after
virus injection. GCaMP6f virus was purchased from Addgene.
Mice were habituated for 3 d before fiber photometry. The
photometry recording consisted of four sessions totaling 20 min: 5
min recording with light off and no stimulation, 5 min recording
with light off but with 0.4 g von Frey stimulation, 5 min recording
with yellow light but no von Frey stimulation, and 5 min recording
with both yellow light and von Frey stimulation. The injured
hindpaw was stimulated by a von Frey filament (0.4 g) every 30 s
ten times. Calcium signals for the bulk fluorescence signals were
acquired and analyzed with custom-written MATLAB software.
Corrections for bleaching and motion were conducted before
analysis. The calcium signals were recorded with two LED lights at
405 nm and 465 nm (30 μW, Doric)47. The 405 channel was used as the
control channel and change in fluorescence (ΔF) was calculated as
(465-nm signal − fitted 405-nm signal), and ΔF/F was calculated by
dividing each point in ΔF by the 405-nm curve at that time point. A
6-s window around the von Frey stimulation point was analyzed, with
the period −3 s before stimulus onset taken as baseline. The
Z-score of a population of neurons was calculated using the
formula: Z = (x − �x
I)/s.d. (where x = ΔF/F and �x
I = mean of ΔF/F for baseline)
Ablation of projections. Male C57 mice (~8 weeks old) were used
in these studies. For PFC–vlPAG ablation, AAV5-CaMKIIα-Arch3.0-eYFP
(600 nl), AAV-mCherry-flex-dtA (600 nl) and Cav2-cre virus (200 nl)
were injected into the BLA (AP −1.3 mm; R −3.4 mm; DV −4.9 mm), the
prelimbic area of the PFC (AP +1.9 mm; R −0.5 mm; DV: −2.1 mm) and
the vlPAG (AP −4.6 mm; R −0.5 mm; DV −3.3 mm), respectively. SNI
surgery was performed at ~2 weeks and cannula fibers were implanted
in the prelimbic area of the PFC (AP +1.9 mm; R −0.5 mm; DV −2.1
mm) ~6 weeks after virus injection. Mechanical paw withdrawal
threshold was tested ~8 weeks after virus injection with and
without optogenetic manipulation of the PFC–vlPAG projection.
Similarly, for vlPAG–LC and vlPAG–RVM ablation,
AAV5-CaMKIIα-Arch3.0-eYFP (600 nl) and AAV-mCherry-flex-dtA (600
nl) were injected into the BLA (AP −1.3 mm; R −3.4 mm; DV −4.9 mm)
and vlPAG (AP −4.6 mm; R −0.5 mm; DV −3.3 mm), respectively.
Cav2-cre virus (200 nl) was injected into the LC (AP −5.4 mm; R
−0.9 mm; DV −3.9-4.0 mm) or the RVM (AP −5.8 mm; R 0 or −0.1 mm; DV
5.9–6.2 mm). Optic fibers were implanted in the vlPAG (AP −4.6 mm;
R −0.5 mm; DV −3.3 mm). Mechanical allodynia was measured ~8 weeks
after virus injection.
For ablation of descending noradrenergic projections to the
spinal cord, conscious mice were treated with 10 µl DSP4 (50 μg,
intrathecally) or vehicle (phosphate-buffered saline (PBS), 10 µl,
intrathecally), delivered over a period of 10–15 s
per session, 2 weeks before measurements of mechanical
withdrawal thresholds with and without optogenetic inhibition of
BLA-to-mPFC inputs (AAV-Arch3.0 virus was injected into the BLA 7–8
weeks before these experiments). Briefly, mouse furs were shaved
and they were manually restrained, then a 27-g half-needle attached
to a PE20 poly(ethylene) tube connected to a 50-µl Hamilton
microsyringe was inserted into the subarachnoid space between the
L4 and L5 vertebrae. Mice were allowed to acclimatize for about 90
min in the observation chambers, and subsequently had the
ipsilateral hindpaws tested before opto-light stimulation (light
OFF). Some 45 min after the pre-opto-stimulation, mice were then
stimulated with yellow light (light ON) and mechanical withdrawal
thresholds were taken again.
Combined in vivo pharmacology and optogenetic stimulation.
For assessments of mechanical withdrawal thresholds of mice
injected intrathecally with antagonists and opto-stimulation,
testing was also carried out between 7 and 8 weeks after BLA
AAV-Arch3.0 virus injection. At the testing day, mice were placed
individually in observation chambers on top of a grid platform to
acclimatize for about 90 min, where they would subsequently have
the ipsilateral hindpaws tested before opto-light stimulation and
drug treatment. Some 30 min after the pre-drug delivery and
opto-stimulation test, they received an intrathecal injection of
PBS, ondansetron, metergoline or BRL-44408. Intrathecal injections
were performed in fully conscious mice over a period of 10 s as
routinely performed in the lab44. After 15 min of intrathecal
injections, mice were then stimulated with yellow light and
mechanical withdrawal thresholds were taken. The 15-min time point
and the
effective doses of antagonists were selected based on the
ability of such compounds to reverse analgesia produced by
selective agonists observed in a separate series of experiments
(not shown).
SYBR Green quantitative real-time PCR. Fresh prelimbic PFC
tissues were taken from SNI/sham mice 2 and 4 weeks after surgery.
Tissues were homogenized in ice-cold TRI Reagents to extract total
RNA from the samples as previously described48. The primer
sequences were as follows: ACCCGCGAGCACAG CTTCT (forward) and
GCCTCGTCACCCACATAGGAGTCC (reverse) for β-actin, TCCGGATGCTGGAGTATTA
(forward) and CAGGTTCATGTAGGACGAAG (reverse) for CB1, GAA
GGAGCCACCGCGTTTTTA (forward) and TCGGCGAGAAGTTGTATTCC T (reverse)
for NAPE-phospholipase D, CAGTGATGGTGGCTGCTCTT (forward) and
GCCAGCCGA GGAAACAGAG (reverse) for fatty acid amide hydrolase,
GCAGTGTCAGGAG CAAGTCT (forward) and ACAGCAGCAGAA GCTCTACG (reverse)
for diacylglycerol lipase, and ACAAGTCGGAGGGTTCTGCT (forward) and
GAGGAC GTGATAGGCACCTT(reverse) for monoacylglycerol lipase. The
oligos were synthesized by the University of Calgary Core DNA
service. RNA 250 ng was reverse transcribed using SuperScript IV
Reverse Transcriptase (catalog no. 18090050, Life Technologies)
following the manufacturer’s instructions. Complementary DNA
synthesis was conducted at 23 °C for 10 min to extend primers, 53
°C for 10 min to synthesize cDNA and 80 °C for 10 min to inactivate
the reaction. The cDNA samples were amplified using Fast SYBR Green
Master Mix (catalog no. 4385612, Thermo Fisher Scientific) using
Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific). The
PCR reaction started at 95 °C for 20 s to activate AmpliTaq Fast
DNA polymerase, followed by 40 cycles at 95 °C for 3 s to denature
and 60 °C for 30 s to extend the cDNA templates. The mRNA
expression levels were normalized to β-actin.
Western blot analysis. Prelimbic PFC tissue from sham and SNI
mice was homogenized in modified radioimmunoprecipitation buffer
(in mM: Tris 50, NaCl 150, ethylenediaminetetraacetic acid 5, 1%
Triton-X, 1% NP-40, 0.2% sodium dodecylsulfate, pH 7.4) containing
protease inhibitors. Homogenates were centrifuged at 16,000g for 15
min at 4 °C and supernatant protein quantified using the Bio-Rad
protein assay dye. Homogenates, 100 µg, were resolved by sodium
dodecylsulfate/polyacrylamine gel electrophoresis and transferred
to a polyvinylidene fluoride membrane. The membrane was blocked
using 3% bovine serum albumin in Tris-buffered saline (containing
0.1% Tween 20) for 1 h at room temperature and analyzed by western
blotting using anti-CB1 receptor (rabbit, 1:250, Abcam, ab23703)
with ECL anti-rabbit immunoglobulin (Ig)G, horse radish
peroxidase-linked whole antibody (donkey, 1:5,000, GE Healthcare,
catalog no. NA934) and anti-tubulin (mouse, 1:5,000, Abcam, ab7291)
with peroxidase-conjugated, affinity, sheep anti-mouse Ig(heavy +
light) (Ig(H+L) (1:5,000, Jackson ImmunoResearch, catalog no.
515-035-003). Blots were quantified using ImageJ.
Immunohistochemistry. Staining with c-fos was used to assess the
effect of in vivo optogenetic manipulations on neuronal
activity in the PFC and PAG. Mice were stimulated with blue or
yellow light for 10 min. They were then transcardially perfused
with 0.1 M PBS and 4% paraformaldehyde in PBS about 90 min after
light stimulation. Brains were removed and fixed in 4%
paraformaldehyde for 2 h and then transferred to 30% sucrose at 4
°C overnight. Coronal sections (30 μm) of the PFC and PAG were
collected using a cryostat (Leica CM3050 S) and
immunohistochemistry was performed. Briefly, sections were washed
five times and were permeabilized with 0.3% Triton-X for 1 h. Then
sections were blocked with 5% normal goat serum and 2% bovine serum
albumin in PBS for 2 h. The brain sections were then incubated with
anti-c-fos antibody (rabbit, 1:1,000, abcam, ab190289; rabbit,
1:400, SantaCruz, sc-52), anti-CaMKIIα (mouse, 1:100, Thermo Fisher
Scientific, MA1-048), anti-GAD67 (mouse, 1:100, abcam, ab26116),
anti-tyrosine hydroxylase (mouse, 1:1,000, Sigma-Aldrich, T1299)
and anti-parvalbumin (mouse, 1:2,000, Millipore, MAB1572) at 4 °C
overnight. Alexa Fluor 488 donkey anti-mouse (1:400, Life
Technologies, A21202), Alexa Fluor 546 goat anti-rabbit (1:400,
Life Technologies, A11035), Alexa Fluor 546 goat anti-mouse
(1:1,000, Invitrogen, A11030) and Alexa Fluor 633 goat anti-mouse
(1:400, Invitrogen, A21050, shown in green color in the figures)
were incubated at room temperature for 2 h. Images were visualized
using a 40 × 0.4 NA or 20 × 0.75 NA objective lens on a Zeiss LSM
510 META and ConfoCor systems, running Velocity 6 and 20 × 0.75 NA
or 10 × 0.4 NA objective lens on a Leica TCS SP8. For some of the
tracing experiments, whole brain sections were stained with DAPI
(1:10,000) and were scanned using a slide scanner (Olympus, System
VS110, Model BX61VSF). For each mouse, the data from the various
sections were averaged and the mean ± s.e.m. calculated for groups
of mice.
Randomization, blinding and data exclusion. For
electrophysiology, animals were randomly assigned to each day’s
experiments by alternating sham and SNI each day. Mice were
randomly assigned to light or no light stimulation, drug delivery,
and SNI or sham for in vivo experiments. Blinding between SNI
and sham conditions was conducted for a subset of behavioral
experiments involving
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
http://www.nature.com/natureneuroscience
-
ArticlesNature NeuroscieNceoptogenetic studies of the BLA–PFC
projection and ablation experiments. There are two limitations to
the effectiveness of blinding: first, during optogenetics, the
experimenter can easily see whether the laser is ON or OFF. Second,
after SNI, mice often display alterations in gait due to
neuropathic pain. The inability to blind these studies fully is
mitigated by the fact that mechanical and thermal withdrawal
thresholds and latencies are determined in an automated fashion
(that is, with a digital aesthesiometer) and results were
replicated across several cohorts conducted by different
investigators. Criteria for data exclusion are described in the
Reporting Summary accompanying this manuscript.
Statistical analysis. Data were analyzed with GraphPad Instat
v.3.0, Graphpad Prism v.6.0, Synaptosoft and Clampfit (Axon pClamp
software v.10.3), ImageJ and Matlab software, and data are
presented as the mean ± s.e.m. Data for miniature ESPCs (mEPSCs) or
eEPSCs were analyzed using the Mini Analysis Program (Synaptosoft)
and Clampfit (Molecular Devices). Paired or unpaired Student’s
t-tests and one-way analysis of variance (ANOVA), followed by
Newman–Keuls multiple comparison tests, were used for comparison of
electrophysiological data. One-way ANOVA, followed by Tukey’s
multiple comparison test, was used for analysis of western blot
data. Animal behavioral data were analyzed by one- or two-way ANOVA
followed by Bonferroni’s post-hoc corrections, Newman–Keuls
multiple comparison test or two-tailed, paired or unpaired,
Student‘s t-tests. For immunofluorescence analysis, data were
analyzed using one-way ANOVA with Bonferroni’s post-hoc correction
or unpaired Student’s t-tests. Statistical significance was
accepted at the level of P < 0.05 with asterisks in figures
denoting P values as follows: *P < 0.05, **P < 0.01, ***P
< 0.001, ****P < 0.0001. No statistical methods were used to
predetermine sample sizes, but our sample sizes are similar to
those reported in previous publications7,29,37,41. Data
distribution was assumed to be normal but this was not formally
tested in all cases.
Reporting Summary. Further information on research design is
available in the Nature Research Reporting Summary linked to this
article.
Data availabilityData for analysis of in vivo calcium
measurements will be made available upon reasonable request. The
data that support the findings of this study are available from the
corresponding author upon request.
Code availabilityThe code for analysis of in vivo calcium
measurements will be made available upon reasonable request.
References 41. Penzo, M. A. et al. The paraventricular
thalamus controls a central amygdala
fear circuit. Nature 519, 455–459 (2015). 42. Allen, W. E.
et al. Thirst-associated preoptic neurons encode an
aversive
motivational drive. Science 357, 1149–1155 (2017). 43. Beyeler,
A. et al. Divergent routing of positive and negative
information from
the amygdala during memory retrieval. Neuron 90, 348–361 (2016).
44. Zhang, F. X., Gadotti, V. M., Souza, I. A., Chen, L. &
Zamponi, G. W. BK
potassium channels suppress Cavalpha2delta subunit function to
reduce inflammatory and neuropathic pain. Cell Rep. 22, 1956–1964
(2018).
45. Brenner, D. S., Golden, J. P. & Gereau, R. W. A novel
behavioral assay for measuring cold sensation in mice. PLoS One 7,
https://doi.org/10.1371/journal.pone.0039765.g001 (2012).
46. Sestakova, N., Puzserova, A., Kluknavsky, M. &
Bernatova, I. Determination of motor activity and anxiety-related
behaviour in rodents: methodological aspects and role of nitric
oxide. Interdiscip. Toxicol. 6, 126–135 (2013).
47. Simone, K., Fuzesi, T., Rosenegger, D., Bains, J. &
Murari, K. Open-source, cost-effective system for low-light
in vivo fiber photometry. Neurophotonics 5, 025006 (2018).
48. Huang, J. et al. Targeting the D series resolvin
receptor system for the treatment of osteoarthritis pain. Arthr.
Rheumatol. 69, 996–1108 (2017).
NAtuRe NeuRoSCIeNCe | www.nature.com/natureneuroscience
https://doi.org/10.1371/journal.pone.0039765.g001https://doi.org/10.1371/journal.pone.0039765.g001http://www.nature.com/natureneuroscience
-
1
nature research | reporting summ
aryO
ctober 2018
Corresponding author(s): Gerald Zamponi, Zizhen Zhang
Last updated by author(s): Jun 25, 2019
Reporting SummaryNature Research wishes to improve the
reproducibility of the work that we publish. This form provides
structure for consistency and transparency in reporting. For
further information on Nature Research policies, see Authors &
Referees and the Editorial Policy Checklist.
StatisticsFor all statistical analyses, confirm that the
following items are present in the figure legend, table legend,
main text, or Methods section.
n/a Confirmed
The exact sample size (n) for each experimental group/condition,
given as a discrete number and unit of measurement
A statement on whether measurements were taken from distinct
samples or whether the same sample was measured repeatedly
The statistical test(s) used AND whether they are one- or
two-sided Only common tests should be described solely by name;
describe more complex techniques in the Methods section.
A description of all covariates tested
A description of any assumptions or corrections, such as tests
of normality and adjustment for multiple comparisons
A full description of the statistical parameters including
central tendency (e.g. means) or other basic estimates (e.g.
regression coefficient) AND variation (e.g. standard deviation) or
associated estimates of uncertainty (e.g. confidence intervals)
For null hypothesis testing, the test statistic (e.g. F, t, r)
with confidence intervals, effect sizes, degrees of freedom and P
value noted Give P values as exact values whenever suitable.
For Bayesian analysis, information on the choice of priors and
Markov chain Monte Carlo settings
For hierarchical and complex designs, identification of the
appropriate level for tests and full reporting of outcomes
Estimates of effect sizes (e.g. Cohen's d, Pearson's r),
indicating how they were calculated
Our web collection on statistics for biologists contains
articles on many of the points above.
Software and codePolicy information about availability of
computer code
Data collection Axon pClamp software 10.3 (Clampex and
Clampfit), Zeiss LSM 510, Leica TCS SP8, slide scanner (Olympus,
System VS110, Model BX61VSF), 1-site 2-color Fiber Photometry
System (Doric), Applied Biosystems QuantStudio 3
Data analysis Axon pClamp software 10.3 (Clampex and Clampfit) ;
Synaptosoft inc Mini Analysis Program; Image J 2.0.0; Leica
Application Suite X; GraphPad Software Prism 6; GraphPad Instat
3.0, MATLAB R2018b; Adobe Illustrator CC; Microsoft office Excel
2013/2016, Word2013/2016; Adobe Acrobat Pro 2017. Custom code for
fiber photometry is available upon request.
For manuscripts utilizing custom algorithms or software that are
central to the research but not yet described in published
literature, software must be made available to editors/reviewers.
We strongly encourage code deposition in a community repository
(e.g. GitHub). See the Nature Research guidelines for submitting
code & software for further information.
DataPolicy information about availability of data
All manuscripts must include a data availability statement. This
statement should provide the following information, where
applicable: - Accession codes, unique identifiers, or web links for
publicly available datasets - A list of figures that have
associated raw data - A description of any restrictions on data
availability
A statement that data will be made available upon reasonable
request has been included in the methods.
-
2
nature research | reporting summ
aryO
ctober 2018
Field-specific reportingPlease select the one below that is the
best fit for your research. If you are not sure, read the
appropriate sections before making your selection.
Life sciences Behavioural & social sciences Ecological,
evolutionary & environmental sciences
For a reference copy of the document with all sections, see
nature.com/documents/nr-reporting-summary-flat.pdf
Life sciences study designAll studies must disclose on these
points even when the disclosure is negative.
Sample size We didn't use statistical methods to predetermine
the sample size, but our study used similar sample sizes to
previously studies in behavior neuroscience field (PMID:
26212331,PMID: 7695716,PMID: 30209395,PMID: 25600269 ).
Data exclusions 1) In electrophysiology recordings, any cells
with the following properties were excluded, with established a
priori based on standard practice in this field: a leak current
more than -150 pA, or a membrane potential more positive than -50
mV, or a series resistance more than 20 M ohms after series
resistance compensation, or with a 20% increase at the end of the
experiments were excluded. 2) As stated in the methods section, in
tracing experiments, mouse brains with negative labeling were not
considered when this was caused by off target injections of tracers
such as viruses/CTB/GCaMP6f. 3) Animals without pain responses
after SNI surgery were not used for experimentation. 4) Calcium
imaging traces without significant transients were excluded from
analyses.
Replication Numbers of replicates for all experiments are
clearly denoted in all figures. No problems in replicating results
in different mice throughout the duration of the study were
encountered and results were replicated across several cohorts
conducted by different investigators.
Randomization For electrophysiology, animals were randomly
assigned to each day’s experiments and by alternating Sham and SNI
each day. Mice were randomly assigned to light or no light
stimulation, drug delivery, and SNI or Sham for in vivo
experiments.
Blinding Blinding between SNI and sham conditions was conducted
for a subset of behavioral experiments involving optogenetic
studies of the BLA-PFC projection and ablation experiments. There
are two limitations to the effectiveness of blinding: First, during
optogenetics, the experimenter can easily see whether the laser is
ON or OFF. Second, after SNI, mice often display alterations in
gait due to neuropathic pain. The inability to blind these studies
fully is mitigated by the fact that mechanical and thermal
withdrawal thresholds and latencies are determined in an
automatized fashion (i.e., with a digital aesthesiometer) and
results were replicated across several cohorts conducted by
different investigators.
Reporting for specific materials, systems and methodsWe require
information from authors about some types of materials,
experimental systems and methods used in many studies. Here,
indicate whether each material, system or method listed is relevant
to your study. If you are not sure if a list item applies to your
research, read the appropriate section before selecting a
response.
Materials & experimental systemsn/a Involved in the
study
Antibodies
Eukaryotic cell lines
Palaeontology
Animals and other organisms
Human research participants
Clinical data
Methodsn/a Involved in the study
ChIP-seq
Flow cytometry
MRI-based neuroimaging
AntibodiesAntibodies used anti-c-fos antibody (rabbit, 1:1000,
abcam, Cat#: ab190289, Lot#: GR3188743-1; rabbit, 1:400,SantaCruz,
Cat#:sc-52),
anti-CaMKIIα (mouse, 1:100, Thermo Fisher Scientific,
Cat#:MA1-048, Lot#: SE248714,Clone#: 6G9), anti-GAD67(mouse, 1:100,
abcam, Cat#:ab26116, Lot#: GR3188743-1, Clone #: K-87 )
anti-Tyrosine Hydroxylase (mouse,1:1000, Sigma-Aldrich,Cat#:T1299,
Lot#:036M4860V, Clone#: TH-2) anti-parvalbumin (mouse,1:2000,
Millipore, Cat#:MAB1572,Lot#:2552333, Clone#: PARV-19) anti-CB1
receptor (rabbit, 1:250, Abcam, Cat#:ab23703, Lot#:GR3239384-2)
anti-tubulin (mouse, 1:5000, Abcam, Cat#:ab7291, Lot#: GR66309-4,
Clone #: DM1A) Alexa Fluor®488 donkey anti-mouse (1:400, Life
Technologies, Cat#: A21202, Lot#:1423052), Alexa Fluor® 546 goat
anti-rabbit (1:400, Invitrogen, Cat#: A11035, Lot#:1904467)