A genetic map of large yellow croaker Pseudosciaena crocea

(2007) 16–26www.elsevier.com/locate/aqua-online

Aquaculture 264

A genetic map of large yellow croaker Pseudosciaena crocea

Yue Ning a, Xiande Liu a, Zhi Yong Wang a,⁎, Wei Guo a,b, Yiyun Li a, Fangjing Xie a

a The Key Laboratory of Science and Technology for Aquaculture and Food Safety, Fisheries College, Jimei University, Xiamen 361021, Chinab Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China

Received 14 July 2006; received in revised form 25 December 2006; accepted 30 December 2006

Abstract

Genetic linkage maps were constructed for large yellow croaker Pseudosciaena crocea (Richardson, 1846) using AFLP andmicrosatellite markers in an F1 family. Five hundred and twenty-three AFLP markers and 36 microsatellites were genotyped in theparents and 94 F1 progeny. Among these, 362 AFLP markers and 13 SSR markers followed the 1:1 Mendelian segregation ratio(PN0.05). The female genetic map contained 181 AFLP and 7 microsatellite markers forming 24 linkage groups spanning2959.1 cM, while the male map consisted of 153 AFLP and 8 microsatellite markers in 23 linkage groups covering 2205.7 cM. Onesex linked marker was mapped to the male map and co-segregated with the AFLP marker agacta355, suggesting an XY-maledetermination mechanism and this may be useful in the breeding of monosex populations.© 2007 Elsevier B.V. All rights reserved.

Keywords: Pseudosciaena crocea; AFLP; Microsatellite; Genetic linkage map; Sex determination

1. Introduction

Genetic maps have become essential tools in manyfields of genetic studies and have been constructed invarious organisms (Postlethwait et al., 1994; Dib et al.,1996; Dietrich et al., 1996; Groenen et al., 2000), in-cluding several aquaculture species (Kocher et al., 1998;Young et al., 1998; Sakamoto et al., 2000; Robisonet al., 2001; Waldbieser et al., 2001). These maps havebeen efficiently used for various biological analyses,such as quantitative trait loci (QTL) (Jackson et al., 1998;Sakamoto et al., 1999; Ozaki et al., 2001; O'Malleyet al., 2003), marker-assisted selection (Lande andThompson, 1990; Fuji et al., 2006), comparative genome

⁎ Corresponding author. Tel.: +86 592 6183816; fax: +86 5926181476.

E-mail address: [email protected] (Z.Y. Wang).

0044-8486/$ - see front matter © 2007 Elsevier B.V. All rights reserved.doi:10.1016/j.aquaculture.2006.12.042

mapping (Naruse et al., 2000; Woods et al., 2000) andposition-based cloning (Dietrich et al., 1996).

Large yellow croaker (Pseudosciaena crocea Rich-ardson, 1846), one of the most economically importantmarine fish in China, is mainly distributed in coastalregions of East Asia (Feng and Cao, 1979). Its wildpopulation has severely declined since 1970's, and thecommercial characteristics (growth rate, flesh qualityand disease resistance) of the cultured stocks have alsodeclined (Wang et al., 2002). The genetic improvementof farmed large yellow croaker has been relatively slowcompared with other aquaculture species (Fjalestadet al., 2003; Garber and Sullivan, 2006). To date only afew breeding programs have been initiated throughselective breeding and no genetic map has been con-structed for large yellow croaker.

A moderately dense linkage map can be made ra-pidly using amplified fragment length polymorphism(AFLP) markers. As a PCR-based technique, AFLP

17Y. Ning et al. / Aquaculture 264 (2007) 16–26

could generate a large number of polymorphic markerswithout any prior knowledge of DNA sequences forthe organism (Vos et al., 1995). Many initial geneticmaps based on molecular markers have been success-fully constructed primarily relying on AFLP markersin aquaculture species, such as tilapia, Oreochromisniloticus (Kocher et al., 1998) and rainbow trout,Oncorhynchus mykiss (Young et al., 1998). Neverthe-less, transferring AFLP markers between labs, species,and even crosses are questionable; this deficiencycould be overcome by using co-dominant markerssuch as microsatellites. But for large yellow croaker,only limited microsatellites are available. So in thisstudy, AFLP markers with a small set of microsatel-lites were used to construct the maps of large yellowcroaker.

2. Materials and methods

2.1. Mapping population

The mapping population used in this study is an inter-population hybrid family of large yellow croaker. Itsfemale parent was sampled from a commercial pond.This pond stock was derived from around 36 maturelarge yellow croakers that had been trawled from a wildpopulation on the East China Sea in 1986. The maleparent was wild and caught from the East China Sea inthe spawning season. The mapping population wasobtained by artificial propagation. Ninety four two-year-old F1 progeny from this family were sampled, and thesex of the fish was determined by dissection to examinethe gonad.

2.2. Genomic DNA extraction

Genomic DNA was extracted from fin of the F1progeny and their parents using standard phenol–chloroform technique with slight modifications (Wanget al., 2000). Fin samples (20–30 mg) were placedinto individual sterile of 1.5 ml microcentrifuge tubescontaining 550 μl TE buffer (100 mM NaCl, 10 mMTris, pH 8, 25 mM EDTA, 0.5% SDS, and freshlyadded proteinase K, 0.1 mg/ml). The samples wereincubated at 55 °C overnight, and subsequentlyextracted twice using phenol and then phenol/chloroform (1:1). DNA was precipitated by addingtwo and a half volumes of ethanol, collected by briefcentrifugation, washed twice with 70% ethanol, airdried, re-dissolved in TE buffer (10 mM Tris–HCl,1 mM EDTA, pH 7.5), and quantified with aspectrophotometer.

2.3. AFLP analysis

AFLP analysis was performed according to Vos et al.(1995) as modified by Wang et al. (2004). Briefly,genomic DNA was digested with two enzymes, EcoRIand MseI, and ligated to adapters to provide the com-plementary sequence for AFLP primers. Pre-amplifica-tion reactions were performed using EcoRI and MseIprimers each with a single selective base. For theselective amplification two additional selective baseswere used in both primers. The amplification productswere resolved in the 6% denaturing polyacrylamide gelsand run at 80 W using a Sequi-Gen GT (38×50) cm gelapparatus (BioRad, USA). The amplification productswere visualized by silver staining (Wang et al., 2004).

2.4. Microsatellite analysis

Total of 36 microsatellite loci containing (CA) re-peats that were isolated from an enriched large yellowcroaker genomic DNA library were screened formapping (Guo et al., 2004, 2005). All primers weresynthesized by Sangon Biological Engineering Tech-nology CO., Ltd (Shanghai, China). PCR amplificationwas performed in a 20 μl reaction volumes containing40–100 ng template DNA, 1× PCR buffer (10 mM Tris,50 mM KCl, pH 9.0, 200 μM of each dNTP (Promega,USA), the concentrations of MgCl2 varied depending onthe locus, 0.5 U Taq polymerase, and 4 pmol of eachprimer. PCR cycling was carried out on an AutorisierterThermocycler (Eppendorf, German) with the initial de-naturing at 95 °C for 2 min, followed by 30 cycles of30 s denaturing at 95 °C, 30 s annealing at locus-specifictemperatures, 30 s extension at 72 °C, and a finalextension for 10 min at 72 °C. The PCR products weredenatured and visualized using denaturing polyacryl-amide gels (6%) followed by silver staining.

2.5. Markers scored and nomenclature

AFLPs were scored as dominant markers. Then thegenotypes of the parents for a given marker were inferredfrom the marker phenotypes of the offspring. Onlypolymorphic bands that were presented in one (cross typeAa×aa) or both (Aa×Aa) parents and segregated in theprogeny were scored. The AFLP markers were namedaccording to the combination of the selective amplifica-tion primers used and the approximate product size, whichwere determined by using a 10 bp DNA Ladder(Invitrogen, USA). For example, for AFLP markeragacag255, the first three letters (aga) represent theselective nucleotides in the EcoRI primer, the next three

18 Y. Ning et al. / Aquaculture 264 (2007) 16–26

letters (cag) represent the selective nucleotides in theMseIprimer, and the number at the end is the fragment length inbase pairs (bp). Microsatellite markers were scored ascodominant markers, and one of the two alleles from theheterozygous parent was selected for coding and linkageanalysis. For example, if the parent genotypes areAB×BC (female×male), we would pick allele A for thefemale and allele C for the male for coding.

2.6. Linkage analysis

Two parents and 94 offspring were genotyped forAFLP and microsatellite markers. Genotype data wereentered in an Excel spreadsheet and prepared for ana-lysis with the Map Manager QTXb16 software accord-ing to the instruction manual (Manly et al., 2001). Priorto linkage analysis, markers were tested for goodness-of-fit of observed with expected Mendelian ratios usingchi-square test to eliminate markers significantly deviat-ing from the expected ratios (Pb0.05).

Parent-specific map was constructed using the hete-rozygous genetic markers present in one parent but notin the other as suggested by the two-way pseudo-test-cross strategy (Grattapaglia and Sederoff, 1994). Link-age groups using F2 backcross model were formed withan initial P-value of 0.0001 with the “Make LinkageGroups” command in Map Manager. Following forma-tion of linkage groups, the P-value was raised to 0.001.Linkage at Pb0.001 was considered significant. Usingthe command “Distribute”, linkage groups were broughttogether. Then, other previously unlinked markers wereallocated to these new linkage groups, again using the“Distribute” command. Markers with non-random as-sortment after statistical analysis were added next. The“Ripple” function was then used to position markers inan order that maximizes the total LOD (logarithmicodds) score for linkage. The software also estimated theoptimum order and genetic distance between markers in

Table 1Numbers of polymorphic markers generated by 64 different AFLP primer co

M/E E-ACC E-AAC E-AGT E-AGG

M-CAG 9 4 18 3M-CAT 6 5 0 6M-CTC 14 17 3 3M-CTA 10 21 6 19M-CAC 3 0 2 4M-CAA 4 2 17 13M-CTG 16 5 3 2M-CTT 4 22 21 30Total 66 76 70 80

Twenty-nine primer combinations with more than 7 polymorphic markesequences GACTGCGTACCAATTC and GATGAGTCCTGAGTAA, res

centi-Morgans (cM) by using the “Kosambi” function inthe software (Kosambi, 1944). Linkage groups wereassigned in descending size. Maps were drawn usingMapChart (Voorrips, 2002).

2.7. Estimate genome length and map coverage

The expected genome lengths (Ge) of the male andfemale linkage maps were estimated in two ways; (1) Theaveragemarker spacing(s) was first calculated by dividingthe total length of all linkage groups with the number ofintervals (number of markers minus number of linkagegroups). Then Ge1 was calculated by adding 2 s to thelength of each linkage group to account for terminalchromosome regions (Fishman et al., 2001). (2)Ge 2 wasdetermined according to the fourth method of Chakravartiet al. (1991) by multiplying the length of each linkagegroup a factor of (m+1) / (m−1), where m is the numberofmarkers on each linkage group. Then the average of thetwo estimates was used as the estimated genome length(Ge) for the large yellow croaker. Gof /Ge determined theobserved genome coverage, whereGof is the length of theframework map.

3. Results

3.1. Genotypes

In AFLP analysis, all of the 64 primer pairs on a panelof six progeny and their parents were tested firstly. Thenumber of polymorphic markers for each primer combi-nation was shown in Table 1. The frequency of poly-morphic markers per primer combination ranged from 0(AGT+CAT, ACG+CAC) to 31 (AGA+CTG). Twenty-nine primer combinations generating more than sevenpolymorphic markers were selected for genotyping all the94 offspring. A total of 523 polymorphic loci wereproduced with the 29 AFLP primer pairs with an average

mbinations

E-ACG E-AGA E-AGC E-AAG Total

5 17 21 22 992 14 5 6 444 22 0 11 743 15 2 3 790 4 0 4 172 25 5 16 844 31 21 24 1067 23 14 13 13427 151 68 99 637

rs (bold) were chosen for genome mapping. E and M indicate thepectively.

Table 2Primer sequence and annealing temperatures of 13 informative microsatellite markers

Name Primer forward Primer reverse Tm(°C)

LYC0002 ACCTCCAGTGGGATGTGA GGCTGTTTGTTATAATTTGTG 50LYC0006 GGTCAACAGGTCAGCAGTTA GCATCTCTCCTTCAAGTCAC 55→50LYC0007 GACTCCTTTGCTCGGTCTGA ACATGGTTATCCTTCCGTTCG 55LYC0009 GTCAATCACGTCTGTCTCTGC TCAGCCATTGTCTGTGAGGT 60LYC0011 CTTTTATTGGCTCCGTATGA CACTCACACTAGCACGCAC 55LYC0012 CAGAACAAACAATGAATGGG GAGGAGCTCAACAGCAACA 55LYC0013 GCTGCGAGCTACTTTACTCAT AACTCACAAACATGCAC 50LYC0018 CTGAGACCATGTGAGCAGTT GTGACCCAGTCCATGAGAAC 55→50LYC0020 GCCAAACATGGAGCCTTATG GACTATCATCAACTGAAACAAC 55→50LYC0024 GGCTCGTGCCAGCAGGG GTATGAAGAACATGTGCAGTG 55→50LYC0030 GAGACGAGGAGAGGCAGAAG CACCATGGTAGAAAGAGCACAG 60LYC0033 GGATGGAGGAGTGATGATGG GCACTGAGACCTGAATGCTCC 50LYC0036 GCATTCATGGATTAGACTGC GGGTGAGTGTCGGAAGTTC 50

Table 3Statistics for the male and female linkage maps of large yellow croaker

Female Male

Number of AFLP markers scored(no. distorted)

231 (32) 191 (30)

Number of microsatellite markersscored (no. distorted)

11 (0) 10 (0)

Number of markers mapped (no.AFLP and microsatellite mapped)

188 (181+7) 161 (153+8)

Linkage groups 24 23Average number of markers per group 7.8 7Average intermarker spacing 18.0 15.9Minimum length of linkage map (cM) 5.5 15.4Maximum length of linkage map (cM) 337.1 284.3Total length of linkage groups (cM) 2959.1 2205.7

19Y. Ning et al. / Aquaculture 264 (2007) 16–26

of 18markers per primer pair. Among all the polymorphicmarkers, 231 (44.2%) dominantly inherited bands werefrom the female parent, 191 (36.5%) were from the maleand 101 (19.3%) existed in both parents.

For microsatellite analysis, the parents were firstscreened for polymorphisms of all microsatellite loci. Ifa polymorphism was detected, the marker would beamplified for all 94 progeny. Of the 36 microsatelliteloci analyzed, 13 loci were found informative, whosesequences of primers and annealing temperatures areshown in Table 2. Among the 13 informative micro-satellites, only heterozygous markers could be used toconstruct the maps. Eight markers with AB×CD(LYC0009 and LYC0013) or AB×AC (LYC0012,LYC0018, LYC0020, LYC0024, LYC0033 andLYC0036) segregation type were useful for both femaleand male maps, three markers (LYC0002, LYC0006 andLYC00030) with AB×AA (female×male) segregationtype only valued for the female map, and the markerLYC0007 and LYC0011 with AA×BC (female×male)segregation type only valued for the male map.

3.2. Linkage map

For the female map, the total of 242 markers wasobtained from the female parent, among which 32markers showed a significant distortion from the expected1:1 ratio (Pb0.05), and then 210 markers were used forlinkage analysis (Table 3). One hundred and eighty-eightmarkers (181 AFLP and 7 microsatellite markers) wereassigned to the female map (Table 3) and 22 markers(including 4 microsatellite loci) were unlinked. The finallinkage map consisted of 24 linkage groups spanning2959.1 cM with an average distance of 18.0 cM(Fig. 1, A). The number of markers on each linkagegroup ranged from 2 to 19with an average of 7.8 markers.

For the male map, the total of 201 markers wasobtained from the male parent, among which 30 markersshowed a significant distortion from the expected 1:1 ratio(Pb0.05), and then 171 markers were used for linkageanalysis (Table 3). One hundred and sixty-one markers(153AFLP and 8microsatellitemarkers) were assigned tothe male map (Table 3) and 10 markers were unlinked.The total length of the male map, which consisted of 23linkage groups, was 2205.7 cM with an average distanceof 15.9 cM (Fig. 1, B). The number of markers per groupranged from 2 to 20 with an average of 7 markers.

By using 4 microsatellite markers (LYC0012,LYC0020, LYC0024 and LYC0033) heterozygous in bothparents, 4 homologous pairs of linkage groups betweenthe male and female maps have been identified (Fig. 2).

3.3. Genome length and coverage

The observed framework map length was 2959.1 cMfor the female and 2205.7 cM for the male map, respec-tively. After adding twice the average marker spacing of

20 Y. Ning et al. / Aquaculture 264 (2007) 16–26

the female and male maps (18.0 and 15.9 cM, respec-tively) to the lengths of each linkage group (24 for thefemale and 23 for the male), the expected genome length

Fig. 1. Preliminary genetic linkage maps (A, female map; B, male map) ofdistances (in Kosambi cM) on the left. Markers were named after their prim

was increased to 3825.0 cM for the female and2940.7 cM for the male map. While the second methodyielded 3834.2 and 3000.2 cM for female and male map,

large yellow croaker with markers indicated on the right and geneticers and fragment size.

21Y. Ning et al. / Aquaculture 264 (2007) 16–26

Fig. 1 (continued ).

respectively. The average estimated genome length was3829.7 cM for the female and 2970.0 cM for the male.Therefore, the coverage of female and male maps, on thebasis of these average estimates, was 77.3% and 74.3%,respectively.

3.4. Sex-determination locus

The 94 progeny consisted of 50 females and 44males, the sex was treated as a marker for the male andfemale linkage analyses. The sex was mapped to the

Fig. 2. Homologous groups in the female and male maps of large yellow croaker based on the shared microsatellite markers. Female and male linkagegroups have been given the suffixes F and M, respectively.

22 Y. Ning et al. / Aquaculture 264 (2007) 16–26

12th linkage group of the male map, and tightly linkedto marker agacta355 with zero recombination.

4. Discussion

4.1. Mapping family

This paper describes the first linkage map for thelarge yellow croaker, an important aquaculture speciesin China, by using a “two-way pseudo-testcross” map-ping strategy. There is a positive correlation between theefficiency of pseudo-testcross strategy and the level ofgenetic heterozygosity of the species under study(Grattapaglia and Sederoff, 1994). In this study, thelarge yellow croaker mapping family was generated by across between highly heterozygous individuals fromwild and cultured populations and therefore it hasincreased the probability of finding polymorphic

markers. Therefore, our mapping family would be agood choice of using the pseudo-testcross strategy toconstruct the linkage maps of the large yellow croaker.

4.2. Genotyping

A total of 523 AFLP polymorphisms were detectedby 29 selected primer combinations with an average of18 polymorphisms per primer pair (Table 1). This washigher than 9.3 obtained from 12 selected primer pairs intilapia (Kocher et al., 1998). Considering all of the 64primer pairs, the average polymorphic markers/primerwas 10, which was slightly higher than 9.4 in channelcatfish by using an interspecific hybrid resource family(Liu et al., 2003), much higher than 7.6 for Medaka and5.8 for Atlantic salmon, both obtained using a pure-bredpopulation (Naruse et al., 2000; Moen et al., 2004). Thevariable ratio of AFLP markers observed might be

23Y. Ning et al. / Aquaculture 264 (2007) 16–26

attributed to the differences in levels of polymorphismbetween different species.

Among the 64 primer pairs, the number of thepolymorphisms per primer pair varied a lot. Severalprimer pairs such as E-AGG/M-CTT, E-AGA/M-CAAand E-AGA/M-CAC produced over 25 polymorphicmarkers. However, 10 primer pairs produced less than 3polymorphic markers (Table 1). When the polymorphicmarkers were correlated with the primer combinations,it appeared that large numbers of polymorphic markersgenerated with certain primer combinations, Forinstance, when 8 primer pairs with EcoRI -AGA wasused, they produced 134 (21.0%) markers while primerpairs with MseI-CTT produced 151 (23.7%) polymor-phic markers. Interestingly, the AFLP primer pair withMseI-CTT also produced the most polymorphic markersin tilapia (Kocher et al., 1998). More polymorphismsdetected by these primer pairs might due to more muta-tions in the DNA sequence corresponding to selectiveregion of the primers and then lead to abolishing orcreating more AFLP bands. Nevertheless, it was effi-cient to generate adequate polymorphic markers byusing the 29 chosen primer pairs, and the polymorph-isms of all 64-primer pairs would provide a guideline forAFLP primer selection in the large yellow croaker.

Clustering of AFLP markers might appear on a re-combination-based map for the lack of recombination inthat region, which was observed in many mapping expe-riments (Kocher et al., 1998;Young et al., 1998; Sakamotoet al., 2000). In the present study, most AFLP markerswere randomly distributed as in other reports (Remingtonet al., 1999; Wang et al., 2005; Liu et al., 2006). Forchannel catfish, Ictalurus punctatus, many of the clusteredAFLP markers were thought to be at a position close tocentromeres as well as at the end of chromosomes (Liuet al., 2003). Young et al. (1998) suggested that the AFLPclusters should identify the heterochromatic regions asso-ciated with centromeres. Several potential causes weresuggested by Liu et al. (2003), such as a reduced recom-bination rate around centromere regions and/or telomereregions, uneven distribution of restriction sites, presenceof highly repetitive elements, etc. However, high level ofmarker clustering is not well understandable. During somelinkage analyses, the level of AFLP clustering wasincreased with the number of AFLP markers that mightbe one of the most important reasons (Liu et al., 2003;Naruse et al., 2000). In that case, it would be provedthrough the next generation of higher-density of largeyellow croaker linkage maps with more AFLP markers.

By using 13 informative microsatellites selected from36 microsatellites, a total of 7 and 8 microsatellites weresuccessfully assigned to the female and male map

respectively. Meanwhile 4 homologous pairs of linkagegroups have also been found by using the shared mic-rosatellites markers. Although their efficiency was lowercompared with AFLPs, microsatellites have become thepreferred marker to construct genetic map because oftheir high level of heterozygosity, and transferabilityacross strains or species. The microsatellite markersbased genetic maps would have great potential to beapplied in many aspects such as genetic diversity moni-toring or parentage fingerprint in selective breedingprograms. In further study, more microsatellites mayhelp to locate genes for quantitative trait loci (QTL)controlling traits of economic importance and to producean integrated map for large yellow croaker.

4.3. Linkage mapping

The current female linkage map contains 24 linkagegroups covering 2959.1 cM, while the male map has 23linkage groups covering 2205.7 cM. The haploid ge-nome of large yellow croaker has 24 chromosomes(Quan et al., 2000). Therefore, our linkage groups werein good agreement with (in female) or close to (in male)the haploid chromosome number. The lack of exactagreement between the number of linkage groups andchromosomes number is common for linkage mappingstudies (Li and Guo, 2004; Liu et al., 2006).

By using two kinds of methods to estimate thegenome length, the average estimate length was3829.7 cM for female and 2970.0 cM for male withcoverage of 77.3% and 74.3%, respectively. Thepresence of unlinked markers also indicated that thetrue map length would be larger than what observed. Inaddition, 7 small groups (less than 5 markers) in thefemale map and 10 in the male, suggested that themarkers are sparse in a few regions of genome and densein others. Additional markers are required to fill thegaps, condense the existing maps and identify homol-ogous female and male linkage groups.

4.4. Sex-specific recombination ratio

Our results showed that the genome sizes betweenthe male and female maps were clearly different. Thecalculated female's map length was 1.4-fold higher thanthe male's, which demonstrated a high level ofrecombination suppression in males. The recombinationratio difference between sexes has been observed incattle, human, mouse and fish, and the heterogameticsex had lower recombination ratio indeed (Barendseet al., 1994; Dib et al., 1996; Dietrich et al., 1996;Sakamoto et al., 2000; Singer et al., 2002).

24 Y. Ning et al. / Aquaculture 264 (2007) 16–26

In some fish species, the difference has been shownto be significant, such as in tiger pufferfish, zebrafishand rainbow trout where the recombination ratio offemale: male (F: M) found to be 2.17:1, 2.74:1 and3.25:1, respectively (Kai et al., 2005; Singer et al.,2002; Sakamoto et al., 2000). While in Atlantic salmonthe F: M ratio was 8.26:1, the unusually highest ratiodetected (Moen et al., 2004). It is possible that thedifference may be shared by all teleosts.

4.5. Sex-linked marker

The confirmation of sex-linked markers on thepaternal, but not the maternal map may validate thehypothesis that the male was the heterogametic sex inlarge yellow croaker, as Xie et al. (2004) described.Research of sex-determination mechanism has beencarried out in many fish species (Thorgaard, 1977;Amores et al., 1998; Devlin and Nagahama, 2002),however, study of the sex determination in large yellowcroaker is still largely unknown. To date, sex chromo-some has not been observed, nor has any other envi-ronmental sex-determination factors.

Markers linked to sex-determining loci have beenfound in many species (Waldbieser et al., 2001; Li et al.,2003; Felip et al., 2005; Lee et al., 2005). Fortunately, oneAFLP locus was completely linked to the sex-determinedregion in this study,which could be used as a starting pointfor finemapping and identification of the sex-determininglocus or cytologically identify sex chromosome byfluorescent in situ hybridization (FISH), and it haspotentials for eventually yielding sex-determining genesequences in larger yellow croaker.

As important tools for aquaculture, manipulation ofsex ratio and sexual maturation has been initiated in ourlaboratory. To take advantage of the faster growth ratesin female (unpublished data), the production of all-female larger yellow croaker will be desirable. With thehelp of the molecular marker, XX and XY fish could berapidly identified, then feminization can be more effi-ciently produced by mating the normal females withmasculinized females.

5. Conclusion

In conclusion, genetic linkage maps were constructedfor the large yellow croaker using AFLP and micro-satellite markers. The sex-determination locus wasmapped to the male map, suggesting an XY-maledetermination mechanism, and the female's and male'sgenome coverage were 77.3% and 74.3%, respectively.The genetic maps presented here provide a starting point

for the eventual construction of high-density maps, andthe mapping of economically important genes and QTLin the large yellow croaker.

Acknowledgments

We would like to thank Haiyan Li and Cuiluan Yaofor their help in data collection and for reviewing thispaper, Jiafu Liu and Chuanjin Yuan for their contribu-tions in rearing the fish families. This study wassupported by the National Natural Science Foundationof China (30271037), the National High TechnologyResearch and Development Program of China(2002AA603021 & 2006AA10A405), the Science andTechnology Key Project of Fujian Province (2004NZ03-1) and the Foundation for Innovative Research Team ofJimei University (2006A001).

References

Amores, A., Force, A., Yan, Y.L., Joly, L., Amemiya, C., Fritz, A., Ho,R.K., Langeland, J., Prince, V., Wang, Y.L., Westerfield, M.,Ekker, M., Postlethwait, J.H., 1998. Zebrafish hox clusters andvertebrate genome evolution. Science 282, 1711–1714.

Barendse, W., Armitage, S.M., Kossarek, L.M., Shalom, A.,Kirkpatrick, B.W., Ryan, A.M., Clayton, D., Li, L., Neibergs, H.L., Zhang, N., Grosse, W.M., Weiss, J., Creighton, P., McCarthy,F., Ron, M., Teale, A.J., Fries, R., McGraw, R.A., Moore, S.S.,Georges, M., Soller, M., Womack, J.E., Hetzel, D.J.S., 1994. Agenetic linkage map of the bovine genome. Nat. Genet. 6,227–235.

Chakravarti, A., Lasher, L.K., Reefer, J.E., 1991. A maximumlikelihood method for estimating genome length using geneticlinkage data. Genetics 128, 175–182.

Devlin, R.H., Nagahama, Y., 2002. Sex determination and sexdifferentiation in fish: an overview of genetic, physiological, andenvironmental influences. Aquaculture 208, 191–364.

Dib, C., Faure, S., Fizames, C., Samson, D., Drouot, N., Vignal, A.,Millasseau, P., Marc, S., Kazan, J., Seboun, E., Lathrop, M.,Gyapay, G., Morissette, J., Weissenbach, J., 1996. A comprehen-sive genetic map of the human genome based on 5246microsatellites. Nature 380, 152–154.

Dietrich, W.F., Miller, J., Steen, R., Merchant, M.A., DamronBoles,D., Husain, Z., Dredge, R., Daly, M.J., Ingalls, K.A., O'Connor,T.J., 1996. A comprehensive genetic map of the mouse genome.Nature 380, 149–152.

Felip, A., Young, W.P., Wheeler, P.A., Thorgaard, G.H, 2005. AnAFLP-based approach for the identification of sex-linked markersin rainbow trout (Oncorhynchus mykiss). Aquaculture 247, 35–43.

Feng, Z., Cao, Q., 1979. Ichthyology. Agricultural Press House,Beijing, China, pp. 154–155 (in Chinese).

Fishman, L., Kelly, A.J., Morgan, E., Willis, J.H., 2001. A genetic mapin theMimulus guttatus species complex reveals transmission ratiodistortion due to heterospecific interactions. Genetics 159,1701–1716.

Fjalestad, K.T., Moen, T., Gomez-Raya, L., 2003. Prospects forgenetic technology in salmon breeding programmes. Aquac. Res.34, 397–406.

25Y. Ning et al. / Aquaculture 264 (2007) 16–26

Fuji, K., Kobayashi, K., Hasegawa, O., Coimbra, M.R.M., Sakamoto,T., Okamoto, N., 2006. Identification of a single major geneticlocus controlling the resistance to lymphocystis disease in Japaneseflounder (Paralichthys olivaceus). Aquaculture 254, 203–210.

Garber, A.F., Sullivan, C.V., 2006. Selective breeding for the hybridstriped bass (Morone chrysops, Rafinesque×M. saxatilis, Wal-baum) industry: status and perspectives. Aquac. Res. 37, 319–338.

Grattapaglia, D., Sederoff, R., 1994. Genetic linkage maps of Euca-lyptus grandis and Eucalyptus urophylla using a pseudo-testcross:mapping strategy and RAPD markers. Genetics 137, 1121–1137.

Groenen, M.A.M., Cheng, H.H., Bumstead, N., Benkel, B.F., Briles,W.E., Burke, T., Burt, D.W., Crittenden, L.B., Dodgson, J., Hillel,J., Lamont, S., Leon, A.P., Soller, M., Takahashi, H., Vignal, A.,2000. A consensus linkage map of the chicken genome. GenomeRes. 10, 137–147.

Guo, W., Wang, Z., Wang, Y., Gui, J., 2004. Isolation of microsatellitemarkers in large yellow croaker by using FIASCO method.Program & Abstracts of the 4th Marine Biology and Biotechnol-ogy Symposium. April 21–25, 2004, Hong Kong, p. 132.

Guo, W., Wang, Z., Wang, Y., Zhang, Z., Gui, J., 2005. Isolation andcharacterization of six microsatellite markers in the large yellowcroaker (Pseudosciaena crocea Richardson). Mol. Ecol. Notes 5,369–371.

Jackson, T.R., Ferguson, M.M., Danzmann, R.G., Fishback, A.G.,Ihssen, P.E., O'Connell, M., Crease, T.J., 1998. Identification oftwo QTL influencing upper temperature tolerance in three rainbowtrout(Oncorhynnchus mykiss) half-sib families. Heredity 80,143–151.

Kai, W., Kikuchi, K., Fujita, M., Suetake, H., Fujiwara, A., Yoshiura,Y., Ototake, M., Venkatesh, B., Miyaki, K., Suzuki, Y., 2005. Agenetic linkage map for the tiger pufferfish, Takifugu rubripes.Genetics 171, 227–238.

Kocher, T.D., Lee, W.J., Sobolewska, H., Penman, D., McAndrew, B.,1998. A genetic linkage map of a cichlid fish, the tilapia(Oreochromis niloticus). Genetics 148, 1225–1232.

Kosambi, D.D., 1944. The estimation of map distances fromrecombination values. Ann. Eugen. 12, 172–175.

Lande, R., Thompson, R., 1990. Efficiency of marker-assistedselection in the improvement of quantitative traits. Genetics 124,743–756.

Lee, B.Y., Lee, W.J., Streelman, J.T., Carleton, K.L., Howe, A.E.,Hulata, G., Slettan, A., Stern, J.E., Terai, Y., Kocher, T.D., 2005. Asecond-generation genetic linkage map of tilapia (Oreochromisspp.). Genetics 170, 237–244.

Li, L., Guo, X., 2004. AFLP-based genetic linkage maps of the Pacificoyster Crassostra gigas, Thunberg. Mar. Biotechnol. 6, 26–36.

Li, Y., Byrne, K., Miggiano, E., Whan, V., Moore, S., Keys, S., Crocos,P., Preston, N., Lehnert, S., 2003. Genetic mapping of the kurumaprawn Penaeus japonicus using AFLP markers. Aquaculture 219,143–156.

Liu, Z., Karsi, A., Li, P., Cao, D., Dunham, R., 2003. An AFLP-basedgenetic linkage map of channel catfish (Ictalurus punctatus)constructed by using an interspecific hybrid resource family.Genetics 165, 687–694.

Liu, X., Liu, X., Guo, X., Gao, Q., Zhang, G., 2006. A preliminarygenetic linkage map of the pacific abalone Haliotis discus hannaiIno. Mar. Biotechnol. 8, 386–397.

Manly, K.F., Cudmore, R.H., Meer, J.M., 2001. Map Manager QTX,cross-platform software for genetic mapping. Mamm. Genome 12,930–932.

Moen, T., Hoyheim, B., Munck, H., Gomez-Raya, L., 2004. A linkagemap of Atlantic salmon (Salmo salar) reveals an uncommonly

large difference in recombination rate between the sexes. Anim.Genet. 35, 81–92.

Naruse, K., Fukamachi, S., Mitani, H., Kondo, M., Matsuoka, T.,Kondo, S., Hanamura, N., Morita, Y., Hasegawa, K., Nishigaki, R.,Shimada, A., Wada, H., Kusakabe, T., Suzuki, N., Kinoshita, M.,Kanamori, A., Terado, T., Kimura, H., Nonaka,M., Shima, A., 2000.A detailed linkage map of medaka, Oryzias latipes: comparativegenomics and genome evolution. Genetics 154, 1773–1784.

O'Malley, K.G., Sakamoto, T., Danzmann, R., Ferguson, M., 2003.Quantitative trait loci for spawning time and body weight inrainbow trout: testing for conserved effects across ancestrallyduplicated chromosomes. J. Heredity 94, 273–284.

Ozaki, A., Sakamoto, T., Khoo, S.K., Nakamura, K., Coimbra,M.R.M., Akutsu, T., Okamoto, N., 2001. Quantitative trait loci(QTLs) associated with resistance/susceptibility to infectiouspancreatic necrosis virus (IPNV) in rainbow trout (Oncorhynchusmykiss). Mol. Genet. Genomics 265, 23–31.

Postlethwait, J.H., Johnson, S.L., Midson, C.N., Talbot, W.S., Gates,M., Ballinger, E.W., Africa, D., Andrews, R., Carl, T., Eisen, J.S.,Horne, S., Kimmel, C.B., Hutchinson, M., Johnson, M.,Rodriguez, A., 1994. A genetic linkage map for the zebrafish.Science 264, 699–703.

Quan, C., Wang, J., Ding, S., Su, Y., Yao, J., 2000. The Êaryotypes ofPseudosciaena crocea (Richardson). J. Xiamen University (Nat.Sci. Ed.) 29, 107–110 (in Chinese, with English abstract).

Remington, D.L., Whetten, R.W., Liu, B.H., O'Malley, D.M., 1999.Construction of an AFLP genetic map with nearly complete genomecoverage in Pinus taeda. Theor. Appl. Genet. 98, 1279–1292.

Richardson, J., 1846. Report on the ichthyology of the seas of China andJapan. Brit. Ass. Adv. Sci. Rep. 15th Meeting (1845), pp. 187–320.

Robison, B.D., Wheeler, P.A., Sundin, K., Sikka, P., Thorgaard, G.H.,2001. Composite interval mapping reveals a major locusinfluencing embryonic development rate in rainbow trout(Oncorhynchus mykiss). J. Heredity 92, 16–22.

Sakamoto, T., Danzmann, R.G., Okamoto, N., Ferguson, M.M.,Ihssen, P.E., 1999. Linkage analysis of quantitative trait lociassociated with spawning time in rainbow trout (Oncorhynchusmykiss). Aquaculture 173, 33–43.

Sakamoto, T., Danzmann, R.G., Gharbi, K., Howard, P., Ozaki, A.,Khoo, S.K., Woram, R.A., Okamoto, N., Ferguson, M.M., Holm,L.E., Guyomard, R., Hoyheim, B., 2000. A microsatellite linkagemap of rainbow trout (Oncorhynchus mykiss) characterized bylarge sex-specific differences in recombination rates. Genetics 155,1331–1345.

Singer, A., Perlman, H., Yan, Y., Walker, C., Corley-Smith, G.,Brandhorst, B., Postlethwait, J., 2002. Sex-specific recombinationrates in Zebrafish (Danio rerio). Genetics 160, 649–657.

Thorgaard, G.H., 1977. Heteromorphic sex chromosomes in malerainbow trout. Science 196, 900–902.

Voorrips, R.E., 2002. MapChart: software for the graphical presenta-tion of linkage maps and QTLs. J. Heredity 93, 77–78.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee, T., Hornes, M.,Frijters, A., Pot, J., Paleman, J., Kuiper, M., Zabeau, M., 1995.AFLP: a new technique for DNA fingerprinting. Nucleic AcidsRes. 23, 4407–4414.

Waldbieser, G.C., Bosworth, B.G., Nonneman, D.J., Wolters, W.R.,2001. A microsatellite-based genetic linkage map for channelcatfish, Ictalurus punctatus. Genetics 158, 727–734.

Wang, Z., Jayasankar, P., Khoo, S.K., Nakamura, K., Sumantadinata,K., Carman, O., Okamoto, N., 2000. AFLP fingerprinting revealsgenetic variability in common carp stocks from Indonesia. AsianFish. Sci. 13, 139–147.

26 Y. Ning et al. / Aquaculture 264 (2007) 16–26

Wang, Z., Wang, Y., Lin, L., Khoo, S., Okamoto, N., 2002. Geneticpolymorphisms in wild and cultured large yellow croaker Pseu-dosciaena crocea using AFLP fingerprinting. J. Fish. Sci. Chin. 9,199–202 (in Chinese, with English abstract).

Wang, Z.Y., Tsoi, K.H, Chu, K.H., 2004. Applications of AFLPtechnology in genetic and phylogenetic analysis of penaeid shrimp.Biochem. Syst. Ecol. 32, 399–407.

Wang, L., Song, L., Chang, Y., Xu, W., Ni, D., Guo, X., 2005. Apreliminary genetic map of Zhikong scallop (Chlamys farreriJones et Preston 1904). Aquac. Res. 36, 643–653.

Woods, I.G., Kelly, P.D., Chu, F., Ngo-Hazelett, P., Yan, Y., Huang, H.,Postlethwait, J.H., Talbot, W.S., 2000. A comparative map of thezebrafish genome. Genome Res. 10, 1903–1914.

Xie, F., Wang, Z., Liu, J., 2004. Induction of diploid gynogenesis inlarge yellow croaker, Pseudosciaena crocea. Abstracts of the 4thMarine Biology and Biotechnology Symposium. April 21–25,2004. Hong Kong.

Young, W.P., Wheeler, P.A., Coryell, V.H., Keim, P., Thorgaard, G.H.,1998. A detailed linkage map of rainbow trout produced usingdoubled haploids. Genetics 148, 839–850.