A Genetic Analysis of the Life Cycle of Volvariella volvacea

A Genetic Analysis of the Life Cycle of Volvariella volvacea

by He Xiaoyi

Thesis submitted as partial fulfillment for the degree of Master of Philosophy

February, 1996 Division of Biology

Graduate School The Chinese University ofHong Kong

RECEIVED - 5 AUG 199?

^ M ^

(n 2 2 m 1998 j i J ^ ¾ U'IVERSiTY ~iM \>vLiBRARY SYSTEMyW X ^ ^ ^

iK^SffliMMMMBBMHHlB^BBHMMMW———M^^BM^MI^^^^^^^^^^MI^M^MIMB

Statement

All the experimental works reported in this thesis were performed by the author unless specially stated otherwise in the text.

He Xiaoyi

Abstract

Volvariella volvacea is the most popular fresh mushroom in Hong Kong. Li

order to find out whether genetic variation exists in V. volvacea’ a genetical

analysis was carried out. Strain V34 was used and AP-PCR (arbitrarily-primed

polymerase chain reaction) was employed to detect genetic variations. The

released protoplasts from vegetative mycelium were regenerated and the

regeneration frequency in this study was 10.9%. F1 and F2 single spore

progenies of V34 were also isolated. Growth rates of six protoplast

regenerants, ten F1 single spore isolates and ten single spore isolates of two

fertile F1 progenies (F2) were studied by measuring their colony diameters and

biomass gain after 4 days incubation. F1 single spore isolates were cultivated

in compost to examine their fruiting abilities. Results showed that great

variations existed among V34 progenies, in the aspects of colony morphology,

growth rate and fhiiting ability. Protoplast regenerants also showed differences

in colony morphology and growth rate. Two out of ten F1 isolates could fruit

in straw based compost and produced the F2 progenies. Individuals with

different morphologies and growth rates were examined by two arbitrary

primers, M13sq and M13rs. However, none of the primers used in this study

revealed any polymorphism among six randomly choosen protoplast

regenerants and their parental strain V34. As for F1 progenies, both M13sq

and M13rs yielded highly similiar DNA profiles with those ofthe strain V34.

The results from this study confirmed the persistence of phenotypic variations

in V. volvacea. Several possible mechanisms to induce these variations are

discussed. Mitochondrial genome may play an important role.

Acknowledgments

I would like to express my sincere gratitude to my supervisors: Dr. Siu-Wai

Chiu and Prof. Shu-Ting Chang, who not only gave me the opportunity to

study in the establishment of mushroom Volvariella volvacea, but also have

been leading me and offering me countless ideas, advices and encouragement.

I would also like to thank Dr. J. A. Buswell and Dr. H. S. Kwan for acting as

members of my Thesis Committee. Thanks for their patience, advices and

criticism. Moreover, I would like to send my thanks to my external examiner,

although I do not know yet who he is.

My appreciation also extends to Mr. S. N. Mok for teaching me cultivate

mushrooms, to technicians in Biology Department for technical assistance and

to Ms. M. Y. Yu, Mr. H. X. Wang, Mr Y. J. Cai，Ms S. J. Chapman and all the

other classmates for their helping me overcome many difficulties.

Finally but not means the least, I wish to thank my family, for the support,

encouragement and endless love they always give me.

Content Page

List ofTables I

List ofIllustrations 11

List of Abbreviations HI

Chapter 1 Introduction 1

1.1 Fungal life cycles 1

1.1.1 Heterothallism 1

1.1.1.1 Bipolar incompatibility 2

1.1.1.2 Tetrapolar incompatibility 2

1.1.2 Homothallism 2

1.1.2.1 Primary homothallism 2

1.1.2.2 Secondary homothallism 3

1.2 Biology ofhomothallic Volvariella volvacea 3

1.3 Genetic mechanisms generating variations in fungi 8

1.3.1 Meiotic recombination 8

1.3.2 Mitotic recombination 9

1.3.3 Fungal mitochondrial genomes 11

1.3.3.1 Structure of fungal mitochondrial genome 11

1.3.3.2 Mitochondrial plasmids 14

1.3.3.3 Mitochondrial inheritance 14

1.3.3.4 Mitochondrial polymorphisms 15

1.3.4 Transposons 16

1.4 Genetic studies of mushrooms by molecular

and protoplast tools 17

1.4.1 Genetic markers 17

1.4.1.1 Restriction fragement length polymorphisms (RFLPs) 18

1.4.1.2 Polymerase chain reaction (PCR) 18

1.4.1.2.1 Arbitrarilyprimed PCR (AP-PCR) 20

1.4.2 Protoplasts 23

1.4.2.1 Protoplast isolation - 23

1.4.2.2 Mycolytic enzymes 24

1.4.2.3 Osmotic stabilizers 26

1.4.2.4 Physiological condition ofmycelium 27

1.4.2.5 Protoplast regeneration 28

1.4.2.6 Application ofprotoplasts 28

1.5 Purpose and significance ofthis genetic study

on V. volvacea 29

Chapter 2 Materials and Methods 30

2.1 Organism 30

2.2 Cell cultivation and maintenance 30

2.3 Solutions and chemicals 30

2.3.1 Solutions for DNA isolation 30

2.3.2 Solutions for agarose gel electrophoresis 31

2.3.3 PCR primers and reagents 31

2.4 DNA extraction and purification 31

2.5 Agarose gel electrophoresis 32

2.6 Arbitrarily primed polymerase chain reaction (AP-PCR) 33

2.7 Protoplast isolation and regeneration 34

2.7.1 Preparation ofprotoplasts 34

2.7.2 Regeneration of protoplasts 34

2.8 Single spore isolation and germination 35

2.9 Growth rate measurement 36

2.9.1 Colony diameter measurement 36

2.9.2 Biomass gain measurement 37

Chapter 3 Results 38 3.1 Genomic DNA extraction - 38

3.2 Genetic analyses of V34 and its progenies 3 8

3.2.1 Protoplast regenerants ^ 8

3.2.1.1 Protoplast preparation 3 8

3.2.1.2 Protoplast regeneration 42

3.2.1.3 Morphology of V34 protoplast regenerants 42

3.2.1.4 Growth rate measurement 44

3.2.1.5 AP-PCR analysis ofV34 protoplast regenerants 44

3.2.2 V34 single spore isolates (SSIs) - F1 progenies 48

3.2.2.1 Single spore isolation and germination 48

3.2.2.2 Morphology o fF l progenies 48

3.2.2.3 Growth rate measurement 48

3.2.2.4 AP-PCR analysis of 10 V34 single spore isolates 51

3.2.2.5 Fruiting ability of F1 progenies 51

3.2.3 Single spore isolates from F1 progenies-F2 progenies 54

3.2.3.1 Colony morphology and growth rate 54

Chapter 4 Discussion ^^

4.1 Protoplast isolation and regeneration 59

4.2 Phenotypic variations in Volvariella volvacea 61

4.2.1 Colony morphology 61

^ ~ — I •ii ^ M—^ ^—I M^—^M I M^MMMMTmMITMffMlllHIII III i|l|iHIWIillll|i|ii IWH|ll_WHiUMU'mimi_I

4.2.2 Growth rate 61

4.2.3 Fruiting ability 62

4.3 Genetic mechanisms for phenotypic variations

in V. volvacea 63

4.4 AP-PCR analyses 65

4.5 Possible sources ofvariations 66

4.5.1 Mitochondrial DNA (mtDNA) 67

4.5.2 Spontaneous mutations - 67

Conclusion 69

References 70

List ofIllustrations

Fig. 1 Haploid life cycle of Volvariella volvacea (Chiu, 1993). 7

Fig. 2 Meiotic crossing-over in fungi

(modified from Bos & Swart, 1995). 10

Fig. 3 Recombination during mitosis in fungi

(modified from Bos & Swart，1995). 12

Fig. 4 A typical scan spectrum ofgenomic DNA sample from

Volvariella volvacea strain V34 and its progenies. 39

Fig. 5 Agarose gel showing the genomic DNAs from

Volvariella volvacea isolates. 40

Fig. 6 Protoplast yield from different ages ofmycelia

and different times of exposure to lytic enzymes. 41

Fig. 7 Colony morphologies of V34 protoplast regenerants. 43

Fig. 8 The biomass gain by six V34 protoplast regenerants

after 4-day incubation. 45

Fig. 9 AP-PCR profiles of six protoplast regenerants of

V. volvacea V34 using primer M13sq. 46

Fig. 10 AP-PCR profiles of six protoplast regenerants of

V. volvacea V34 using primer M13rs. 47

Fig. 11 Colony morphologies of V34 single

spore isolates (F1). 49

Fig. 12 The biomass gain by ten V34 single spore

isolates (F1) after 4-day incubation. 50

Fig. 13 AP-PCR profiles of 10 single spore isolates

ofV34 using primer M13sq. 52

Fig. 14 AP-PCR profiles of 10 single spore isolates

of V34 using primer M13rs. 53

Fig. 15 Colony morphologies of single spore

isolates ofNo.33 (the F2 progeny). 55

Fig. 16 Colony morphologies of single spore

isolates ofNo. 10 (the F2 progeny). 56

Fig. 17 The biomass gain by ten single spore

isolates of No. 10 isolate after 4-day incubation. 57

Fig. 18 The biomass gain by ten single spore

isolates ofNo. 33 isolate after 4-day incubation. 58

List of Tables

Table 1 Nomenclature for mitochondrial genes

(Hudespeth, 1992). 13

Table 2 Properties of RFLPs and RAPDs/AP-PCR

(modified from Rafalski & Tingey，1993). 22

Table 3 Protoplast isolation system in some edible

mushrooms (sources: Selitrennikoff& Bloomfield，

1984; Kitamoto et al., 1988; Peberdy, 1991). 25

Table 4. The regeneration frequency of protoplasts 42

Table 5. The colony diameters ofprotoplast regenerants

(4 day cultures) 42

Table 6. Germination frequency of V34 spores 48

Table 7. The colony diameters of single spore

isolates (SSIs) (4 day cultures) 48

Table 8. Fruiting test of F1 progeny 51

Table 9. The colony diameters of single spore isolates of

No.lO F1 progeny (4 day cultures) 54

Table 10. The colony diameters ofsingle spore isolates of

No.33 F1 progeny (4 day cultures) 54

List of Abbreviations

AP-PCR: Arbitrarily primed polymerase chain reaction

bp: base pair

CM: Complete medium

dNTPs: deoxyribonucleotide triphosphates

EDTA: Ethylenediaminetetra-acetic acid

Kb: Kilobase pairs

Mb: Megabase pairs

MCM: Mannitol complete medium

MI: First meiotic division

MtDNA: Mitochondrial DNA

PCR: Polymerase chain reaction

PD: Potato dextrose broth

PDA: Potato dextrose agar

RAPDs: Random amplified polymorphic DNAs

RFLPs: Restriction fragement length polymorphisms

SDS: Sodium dodecyl sulfate

SSI: Single spore isolate

Tris: Tris (hydroxymethyl) aminomethane

Chapter 1. Introduction

1.1 Fimgal life cycles

The prospect for breeding programmes ofany organisms depends upon an

understanding ofthe life cycle and this is as essential for lower organisms

as it is for the most highly evolved organisms. Numerous kinds of life

cycles have been revealed in fungi. Different fungi showed variations in

their nuclear components at different stages in their life cycles: the

niunber of nuclei per cell, the ploidy and genotype may vary greatly

(Elliott, 1972). But the basic life cycle of the higher fungi is: a spore

germinates to form mycelium which in tum bears fruiting bodies and from

fhiiting bodies spores are produced.

Sexuality of Basidiomycetes was first described by Bensaude (1918) in

Coprinus fimetarius and Kniep (1920) in Schizophyllum commune (cited

in Miles, 1991). Fungi can be classified as homothallic (self-fertile) or as

heterothallic (self-sterile). According to Burnett (1975), homothallism is

probably the most common mode of sexual reproduction in fungi as a

whole, but in higher fungi, it represents only about 10% of all species

investigated. The other 90% shows heterothallism.

1.1.1 Heterothallism

Cross-mating between homokaryotic mycelia is necessary to establish the

fertile mycelium in heterothallic species (Tanaka & Koga，1972; Raper,

1976). The three phases of sexual reproduction, plasmogamy, karyogamy

and meiosis, are found in their life histories. Mating in heterothallic

species is determined by one of the two incompatibility mechanisms:

bipolar and tetrapolar (Raper, 1966; Fincham et aL, 1979; Elliott, 1982).

1

fotroduction

1.1.1.1 Bipolar incompatibility

There is only one single mating type factor which in most cases possesses

two alleles, A and a. It is also referred as unifactorial system. Jn the case

of biallelic system, the two mating types segregate in a ratio of 1:1 in a

cross of A X a matings. Li Basidiomycetes, about 25% species are

unifactorial heterothallic (Bumett, 1975). Lentinula edodes shows this

mating system (Chang, 1993b).

1.1.1.2 Tetrapolar incompatibility

There are two unlinked mating type factors, A and B, each of which has

multiple alleles. It is also referred as bifactorial system. Four mating

types: AxBx, AxBy, AyBx and AyBy are produced in a 1:1:1:1 ratio in a

cross oiAxBx X AyBy. Only combinations that are heteroallelic for both

mating type factors are fertile. Li Basidiomycetes, 65% are bifactorial

heterothallic (Burnett, 1975). Agaricus bitorquis shows this mating

system (Chang, 1993b).

1.1.2 Homothallism

Homothallic species can complete their life cycle by a single spore

without mating (Raper, 1966; Chang & Yau，1971; Elliott, 1972).

Plasmogamy is not required for karyogamy and meiosis to take place.

There are two forms ofhomothallism: primary and secondary.

1.1.2.1 Primary homothallism

Primary homothallic species produce fmiting bodies by a single spore

with a single postmeiotic nucleus. The presence ofincompatibility factors

has not yet been detected. Volvariella volvacea, one of the conunonly

2

fotroduction

cultivated mushrooms, is thought to be primary homothallic (Chang &

Yau, 1971).

1.1.2.2 Secondary homothallism

Secondary homothallic species produce fruiting bodies by a single spore

possessing two compatible nuclei. It involves incompatibility factors.

Agaricus bisporus displays this kind oflife cycle (Chang, 1993b).

1.2 Biology of homothallic Volvariella volvacea

Mushrooms are generally considered as a special group of higher fungi,

which are fleshy macrofungi with distinctive fruiting bodies producing,

bearing and discharging spores (Chang, 1993a). Most of them are edible

and have served as human food throughout the history because of their

nutrition and delicacy, and some for medical or tonic contributions. It is

now well known that mushrooms have a high protein content of good

quality, which contains the nine amino acids essential to human diet,

especially rich in lysine and leucine which are lacking in most staple

cereal foods. Mushrooms also contain many vitamins, fiber and minerals

and they are low in calories, sodium, fat and cholesterol (Chang, 1980).

As with the development of the society, demanding for mushrooms is

increasing fast. From 1986-1991, world production of cultivated

mushrooms went up by 96.4% (Chang, 1993b). In addition, mushrooms

are also playing an important role in biological cycling in nature through

breaking down lignocellulosic plant debris and agricultural, industrial and

forest wastes. Cellulose, hemicellulose and lignin, the main components

of these wastes which are relatively resistant to biological degradation,

can be degraded by a wide range ofextracellular hydrolytic and oxidative

*

3

fotroduction

enzymes produced by mushrooms (Wood & Fermor, 1982; Wood, 1984).

Therefore, cultivation of mushrooms can provide a solution to many

problems including protein shortage, resource recovery and reuse, and

environmental pollution.

Volvariella volvacea, commonly known as the Chinese straw mushroom

or paddy straw mushroom, belongs to the family Pluteaceae of the

Basidiomycetes. It is an edible mushroom ofthe tropics and subtropics. It

has long been cultivated in China and the first record can be traced back

to 1700 (Chang, 1977). Because it grows at the relatively high

temperature range of 30-36°C, it is also called "warm mushroom" and is

very suitable for South Asian countries. Nowadays, this mushroom is

extensively cultivated in Thailand, Lidonesia, Vietnam, Philippines and

Malaysia. China is the top producer (Chang, 1993c). Following Agaricus

bisporus, Lentinula edodes, Pleurotus spp. and Auricularia spp； V.

volvacea is the fifth most important cultivated mushroom in the world

(Chang, 1993b).

Li nature, V. volvacea is found growing on rotten paddy straw during the

rainy seasons in tropics and subtropics. Any highly rich carbohydrate-

containing substrate, including cotton waste, bagasse, banana leaves，oil

pahn pericarp, sorghum straw and fiber crop wastes, can also be used to

cultivate this mushroom (Chang, 1993c). K volvacea grows very fast.

From spawn to mature fhiiting bodies it takes only 10 days under

favorable conditions. Thus it is considered as one of the easiest

mushrooms to grow. However, the difficulty to obtain high, consistant

yield and the inability to enhance its post-harvest shelf life make V.

volvacea also the most difficult to handle. Its position in the world

popularity list dropped from the third in 1986 to the fifth in 1991 (Chang,

1993b).

4

fotroduction

V. volvacea is not only highly nutritious but also possesses a fine texture

and soft flesh. Many people even prefer it to the cultivated white

mushroom, A. bisporus. Li Hong Kong, V. volvacea is the most popular

fresh mushroom. However, most research activities of V. volvacea have

been carried out only in the past thirty years. Our knowledge of this

mushroom is much less compared to that o f^ . bisporus.

V. volvacea is a large pileate fungus with a dark gray cap (Chang & Ymi，

1971). Li its maturing fruiting bodies, the volva is well developed and

remains distinct. This trait makes V. volvacea very different from many

other mushrooms such as L. edodes, A. bisporus and P. sajor-caju

(Chang, 1991).

The traditional cultivating substrate for V. volvacea was paddy straw. Jn

1971, cotton waste was first introduced as a material to grow V. volvacea

and resulted in a significant increase (2-3 folds) of production and more

stable yield (Yau & Chang，1972). The substrate-degradative enzymes of

V. volvacea have been studied (Wang, 1982; Buswell et aL, 1993; Cai,

1994). These studies showed that V. volvacea produces several enzymes

for the hydrolysis of cellulose and hemicellulose, including endo- and

exoglucanases, p-glucosidase, xylanase and p-xylosidase but lack the

ability to synthesize phenol-oxidizing and lignin-transfonning enzymes.

These results supported that V. volvacea grows well on a rich cellulosic

substrate such as cotton waste, in which the amount of lignified

components is negligible.

The initial information on life history of V. volvacea came from a study of

nuclear behaviour in basidia and a cytological study of its spore

germination (Chang & Ghu，1969; Chang, 1969). V. volvacea possessed

multinucleate hyphae and the clamp connections were absent. This is

quite similiar to A. bisporus. Basidiospores of V. volvacea typically were

5

fotroduction

uninucleate (Chang & Chu，1969). However, the production of fruiting

bodies by both sexual basidiospores and asexual multinucleate

chlamydospores suggested that this mushroom may be a primary

homothallic fungus (Chang, 1969). Since 1969，Chang and colleagues

have showed that a single basidiospore of V. volvacea can germinate and

fortn fruiting bodies by itself without any mating (Chang & Yau，1971;

Li, 1977; Chang et al., 1981; Li, 1991). Thus V. volvacea is thought to be

primary homothallic. -

Basidiospores of V. volvacea were also studied with respect to their

ploidy, using gamma radiation as a tool (Quaye, 1986). The radiation

survival curve implied the haploidy of basidiospores. Royse et al. (1987)

also deduced a haploid nature of basidiospores of K volvacea from the

segregation of isozyme markers of a constructed heterokaryon. The

haploid life cycle in V. volvacea was also demonstrated from

microspectrophotometric measurements of DNA content per nucleus and

observations of nuclear behaviour (Chiu, 1993) (Fig. 1). A haploid

uninucleate basidiospore germinates to haploid multinucleate mycelium

and forms fruiting bodies. Then, a uninucleate hymenial initial divides

mitotically to a binucleate condition, and karyogamy leads to a transient

diploid stage. DNA replicates to 4N content. Basidiospores are formed

through meiosis and the life cycle is completed. Despite of these

evidences, genetics of the life cycle of V. volvacea is still uncertain, in

comparison with other commonly cultivated mushrooms such as A.

bisporus, L edodes andP. sajor-caju (Chang, 1993b).

6

fotroduction

^x-^ZT^ Jk^" , 1 A v k - "kMki r N - - r

ftrRk )丄 ^ = ^ ^ ^ V _ y ^

\ Mciosis Fruiiing / \ ^ and >< m0rph0gcncsi5 Z

\ ^ sporulalion f ] y^

^ ^ _ ^ Fig. 1 Haploid Hfe cycle of Volvariella volvacea (Chiu, 1993). Phenotypic variations among the progenies in another straw mushroom,

Volvariella bombycina, in the aspects of colony morphology, growth rate 7

fotroduction

and fruiting ability were observed (Elliott & Challen，1985; Chiu &

Chang, 1987). Variations among single spore isolates of V. volvacea were

also found by some of the previous studies (Chang & Yau，1971; Li &

Chang, 1978; Chang et al., 1981; Li, 1991). Elliott and Challen (1985)

proposed a tetraploid-diploid secondarily homothallic life cycles for V.

bombycina and V. volvacea. However, Chiu and Chang (1987) concluded

that V. bombycina had a haploid primary homothallic life cycle through

cytological and genetical analysis using auxotrophic mutants. Because of

the lack in genetic markers, it is difficult to fmd out where and how do

these variations happen in V. volvacea. Furthermore, strain preservation

and improvement of V. volvacea through breeding efforts has also been

hindered due to a lack of basic genetic information to develop a rational

breeding programme (Royse & May，1992).

1.3 Genetic mechanisms generating variations in fungi

Most groups of fungi appear to be haploid for the major part of their life

cycle. At the sexual stage, karyogamy takes place in specialized

binucleate hyphal cells and is followed by meiosis. Additional mitotic

divisions may happen and result in haploid and multiple nuclei in spores

(Raper, 1966; Fincham et al., 1979).

1.3.1 Meiotic recombination

The meiotic mechanism in eukaryotes is essentially similar. Meiosis

consists oftwo divisions, the first ofwhich is special (reductional), while

the second resembles a mitotic division (equational). Li the prophase of

the first meiotic division (MI) the homologous chromosomes synapse to

form bivalents and later they become thicker by contraction. During

synapsis, the four chromatids of a pair of chromosomes can undergo

8

fotroduction

exchange and is called crossingover (Bos & Swart，1995) (Fig. 2).

Crossingover between sister chromatids is genetically o fno consequence,

since sister chromatids are identical and no recombinants can occur.

Crossingover between nonsister chromatids is of genetic importance, if

the homologous chromosomes carry different alleles at one or more loci.

Such crossingovers result in recombination of genes that are located on

the same chromosome. Genes that are on the same chromosome belong to

one linkage group, but if two genes are located far from each other, the

frequency of crossingover can be high enough to show independent

segregation.

hi the anaphase ofMI, the homologous chromosomes segregate to the two

poles of the cell, hi this way, a reassortment of non-homologous

chromosomes is possibly achieved.

1.3.2 Mitotic recombination

During mitosis, homologous chromosomes behave independently. At

metaphase the chromosomes move to the equatorial plane and the sister

chromatids separate during the anaphase, resulting in two daughter cells

with the original number of chromosomes. Jn this way, each daughter cell

receives the same genetic information. Usually the homologous

chromosomes do not pair during mitosis. However, there is genetic

evidence that homologous chromosomes can exchange parts of nonsister

chromatids, probably during the four-strand stage. There is also evidence

that unequal crossing-over can occur during mitosis, resulting in

duplications O^ga and Roper, 1968).

*

9

fotroduction

a b + = = = ¢ = = ：

“ ^ 丨。 [1] (21

" I + + c -

Crossing over events In region G e n o t y p e of progeny

= = = = = - a b + n

- + + c

n 1 ^ + +

= = = 1 + b c

n 2 a b c

, 2 + + +

_ = 1 2 a + c 0 丨’‘

, 1,2 + b +

Fig. 2 Meiotic crossing-over in fiingi. One pair of homologous

chromosomes is drawn to illustrate the process of meiotic crossing-over,

a, b，c represent different genes. + represents the wild type allele of a

particular gene. Homologous chromosomes are tightly paired during the

first meiotic division and exchange between chromatids take place

(modified from Bos & Swart，1995).

In somatic diploid nuclei, two recombination processes may occur:

mitocic crossingover between nonsister chromatids of homologous

chromosomes and haploidization (Kafer, 1977; Papa, 1977; Bos and

10

fotroduction

Swart, 1995). Mitotic crossingover results in recombinant chromatids.

Haploidization results from mitotic nondisjunction of sister chromatids

which leads to aneuploid nuclei and by successive losses of chromosomes

ultimately to haploid nuclei. During haploidization, genes on the same

chromosome segregate as a linkage group. Mitotic crossingover results in

recombination of genes within a linkage group (Bos & Swart，1995) (Fig.

3).

Mitotic recombination has been found (Bos & Swart，1995). However,

the frequency of mitotic crossingover is much lower than that of meiotic

crossingover. During meiosis, many crossingover events occurred in each

meiocyte, whereas in artificially induced unstable diploids ofNeurospora 3 •

crassa the mitotic crossingover occurred at a frequency of 10' (Smith,

1974).

1.3.3 Fungal mitochondrial genomes

1.3.3.1 Structure offungal mitochondrial genome

Mitochondrial genome refers to nucleic acids found in organelle

mitochondrion (Hudspeth, 1992). This kind of extrachromosomal genome

is invariably present as simple DNA molecules, not as the chromosomes

of the nucleus which have bound proteins. As a general rule,

mitochondrial DNAs are circular and encode a limited set of gene

products which are constituents either of the mitochondrial translation

apparatus, or of the respiratory chain and oxidative ATP synthase

complexes. A minimum set of 22 tRNAs is sufficient to translate 20

amino acids. All other genes related to mitochondrial functions are

usually nuclear-encoded (Crossman and Hudspeth, 1985; Hudespeth,

1992) (Table 1).

11

fotroduction

Table 1 Nomenclature for mitochondrial genes (Hudespeth, 1992).

Gene Function Translational apparatus

ml L-RNA large ribosomal subunit RNA ms S-RNA small ribosomal subunit RNA tsl tRNA synthesis locus varl small ribosomal subunit protein S-5 small ribosomal subunit protein

Respiratory chain 一

coxl COI, oxi3 cytochrome c oxidase subunit 1 cox2 COII, oxil cytochrome c oxidase subunit 2 cox3 COIII, oxi2 cytochrome c oxidase subunit 3 cob cytb apocytochrome b ndhl urfl ND1 NADH dehydrogenase subunit 1 ndh2 urf2 ND2 NADH dehydrogenase subunit 2 ndh3 urf3 ND3 NADH dehydrogenase subunit 3 ndh4 urf4 ND4 NADH dehydrogenase subunit 4 ndh41 urf4L ND4L NADH dehydrogenase subunit 4L ndh5 urf5 ND5 NADH dehydrogenase subunit 5 ndh6 urf6 ND6 NADH dehydrogenase subunit 6

ATP synthase

atp6 oli2, 4 ATP synthase subunit 6 atp8 urfA6L, aapl ATP synthase subunit 8 atp9 mal，olil, 3 ATP synthase subunit 9

General

ORF open reading frame URF unidentified reading frame

12

fotroduction

+ A B + A B Q= = • g= =

'0- 0= = = _ ^ _ _ ^ _ _ _ _ =

C + + C + B

\ — 0 = 0= = _

[non-d is junct ion 1

aneupioids 2n + 1 , 2n -1

/ \

+ A B / \ Q= / \ |J= , � 0= I '3- _ I

+ A B C + +

non-dis junct ion diploid haploidization

Fig. 3 Recombination during mitosis in fungi. One pair of homologous

chromosomes is drawn to illustrate the recombination events during

mitosis. A, B, C represent different genes with + representing the wild

type allele. (1) Mitotic crossing-over leads to homozygosity distal ofthe

point of exchange. (2) Nondisjunction of chromatids results in aneuploids

which will finally lead to a diploid or a haploid nucleus (modified from

Bos & Swart, 1995).

]ji comparison to the nuclear genome sizes determined by electrophoretic

karyotyping, of which the largest genome of 47 Mb reported for

13

fotroduction

Neurospora crassa (Orbach et al., 1988) and the smallest genome of 13.8

Mb for Schizosaccharomyces pombe (Smith et al., 1987), the

mitochondrial DNAs offungi are very small and usually exhibit large size

variation: from a minimum of 17.6 kb in Schizosaccharomyces pombe to

a maximum of 172 kb 'mAgaricus bitorquis (Hudspeth, 1992).

As a common concept, mtDNAs are circular molecules. But, linear

exceptions have been discovered. Linear mitochondrial DNAs have been

found with high frequency in the yeast genera Williopsis and Pichia by

pulsed field gel electrophoresis (Fukuhara et al., 1993).

1.3.3.2 Mitochondrial plasmids

Mitochondrial plasmids exist widely in higher fungi (Arganoza et al.,

1994) and they are regarded as genetic elements in the mitochondrion. M

Neurospora intermedia, the presence of a linear 9.6 kb Kalilo

mitochondrial plasmid is associated with senescence (Bertrand et al.,

1985; Myers et al., 1989) and in K crassa, senescence is caused by

another linear mitochondrial plasmid, marDNA, which is 7 kb long (Court

et al., 1991; Court & Betrand，1992). The cause of aging is through the

disruption of mtDNA function as a result of plasmid insertion and

progressive replacement of mtDNA (Myers et al., 1989). Jn contrast, in

Podospora anserina, a linear plasmid pAL2-l can integrate into mtDNA

and is involved in the expression oflongevity (Hermanns et al., 1994).

1.3.3.3 Mitochondrial inheritance

The inheritance of mtDNA is usually matemal as demonstrated in

Phytophthora infestans by Whittaker and coworkers (1994). But complex

situations exist in other fimgi. bi Neurospora, matemal, patemal and

recombinant mitochondrial DNAs were segregated in the progeny (Lee &

14

fotroduction

Tayior, 1993; Yang & Griffiths，1993). Li Agaricus bisporus,

mitochondrial DNA is mostly inherited uniparentally (Jin et al., 1992).

1.3.3.4 Mitochondrial polymoiphisms

MtDNA in higher fungi is usually present at high copy number

(Grossman & Hudspeth，1985). Polymorphisms of mtDNA are

conmionly encountered in many fungi. As for any genetic polymorphism,

mitochondrial variants can be associated with disruption of functions

leading to phenotypic abnormality, or they can be apparently neutral with

no detectable phenotypic effect (Griffiths et al., 1995). Length mutations

are prevalent in the mtDNA variation. Many studies showed that the basis

for mitochondrial polymorphisms could come from nucleotide pair

substitution, deletion, insertion, inversion and the presence or absence of

free plasmids or plasmid inserts (Griffiths et al., 1995).

MtDNA polymorphisms have been used extensively in population

analysis; Fukuda and colleagues (1994) studied the restriction fragment

length polymorphisms (RFLPs) in mtDNA in 51 wild strains from

different geographical populations of Lentinula edodes and their result

suggested that L. edodes included some distinct groups with genetic

divergence in both mitochondrial and nuclear genomes.

Nevertheless, the inheritance of mitochondria and nuclei is independent

as demonstrated in Agaricus bitorquis and might be dependent on

nuclear-mitochondrial interaction (Hintz et al., 1988). Further studies are

needed，therefore, to incorporate the genetic relatedness among strains of

a population based on nuclear phenotypes and mitochondrial phenotypes.

1.3.4 Transposons

Transposable elements or transposons are typically a piece of DNA that

can move from one position to another and that consists of one or several

15

fotroduction

genes in the middle flanked by end sequences that are the same as each

other. Within an end segment, there may be shorter repetitive sequences

(terminal repeats) which are believed to help in the insertion and excision

ofthe element (Ayala & Kiger，1984).

The first transposable element discoverd was described in maize by

Barbara McClintock in 1940s. She was able to show that certain genetic

elements within the maize genome modified the expression of other genes

at adjacent sites and from time to time disappear and reappear at different

locations. Later in 1960s, transposable elements were discovered in E.

coli as the cause of one type of spontaneous mutation. These mutations

completely abolished the expression of the gene in which they occurred.

Since then various transposons have been identified in many species

including yeast, fruitfly and mice (Ayala & Kiger，1984). Transposition

seems to happen notjust within nuclear DNA, but also between the genes

of nuclei and mitochondria. Transposons exhibit the following genetic

properties: (i) the ability to transpose and the functions required for

transposition are coded by themselves; (ii) precise excision; (iii) produce

gene mutations such as deletions and invertions; and (iv) interaction

between other genetic elements and chromosomes. Because of these

characteristics, especially that they can move around in the genome，it is

very difficult to detect them.

1.4 Genetic studies ofmushrooms by molecular and protoplast tools

1.4.1 Genetic markers

The aim of mushroom breeders is to bring together an optimum

combination of genes that control characteristics of commercial

importance (Elliott, 1982; Miles & Chang, 1986). Detailed genetic

information is essential for the establishment of a breeding programme.

16

fotroduction

A genetic research requires reliable markers. Morphological markers or

physiological markers do not possess the reliability because they are

usually affected by different environmental and/or nutritional factors.

Genetic markers obey the Mendelian Laws and can serve as reference

points in the genome. These markers are widely used in fungal genetic

studies to quantify genetic variability among strains and to track the

process ofinheritance (Anderson, 1991).

Auxotrophic markers were the first to be used to establish the basic facts

of life cycle of the most commonly cultivated mushroom, A. bisporus

(Raper et al., 1972; Elliott, 1985). However, the number of auxotrophs

currently available is very small because of the difficulties to obtain them

and the process to induce such mutations may result in unintended

damage to the strain (Anderson, 1991). More recently, genetic markers

that are naturally existing have been detected and developed in some

fungi (Royse and May, 1982; Kerrigan & Ross, 1989; Wang et al., 1991).

These markers include allozyme and DNA based markers.

AUozymes are enzymes differing in electrophoretic mobility as the result

of allelic differences in a single gene (Royse & May，1992). Allozyme

electrophoresis has been used to study the life histories of mushrooms

since the early 1980s (May & Royse，1981) and has shown its ability to

analyse genetic information (Spear et al., 1983; Royse et al.’ 1987;

Bowden et al, 1991). However, the availability of allozyme markers is

also small and the expression of such markers is still under physiological

and genetic controls (Anderson, 1991). Nowadays, emphasis is placed on

DNA based markers such as restriction fragment length polymorphisms

(RFLPs), random amplified polymorphic DNAs (RAPDs) and arbitrarily

primed polymerase chain reaction (AP-PCR). They provide direct

17

fotroduction

examination of the genome and have practically inexhaustible source

(Anderson, 1991).

1.4.1.1 Restriction fragement length polymorphisms (RFLPs)

RFLPs are based on variations in banding patterns produced by restriction

endonuclease and brought about by point mutations or rearrangements.

Allelic relationship between individuals is shown by hybridization

patterns of enzyme-digested genomic “ DNA with specific probe(s)

(Southern, 1975; Anderson, 1991). It is one ofthe conmionly used DNA

markers in genetic studies. Li mushrooms, such as A. bisporus and L

edodes, RFLPs have been used to analyse DNA polymorphisms and

construct genetic maps (Bostein et al., 1980; Castle et al., 1987; KuUcami,

1991).

1.4.1.2 Polymerase chain reaction (PCR)

12 years ago (1983)，a novel method, the polymerase chain reaction

(PCR), was discovered that permits the in vitro replication of selected

nucleic acids (Mullis and Faloona, 1987). It is so sensitive that even a

single gene copy can be detected following nuclei acid amplification

(Mullis etal； 1986; Mullis & Faloona，1987; Bej, 1991).

The PCR components include: the segment of DNA to be amplified

(double-stranded DNA or cDNA from RNA, referred to as template); two

single stranded olignonucleotide primers flanking the target region; a

DNA polymerase; four deoxyribonucleotide triphosphates (dNTPs), a

suitable buffer and magnesium ions.

The typical method consists of repetitive cycles ofthree steps:

18

fotroduction

(i) DNA denaturation: double-stranded template DNA is dissociated to

single-stranded DNA by incubation at a high temperature (usually 94°C

or 95°C).

(ii) Primer annealing: two primers arnieal to their complementary

template strands at a lower temperature of30°C - 60 °C.

(iii) Chain extension: primers are extended through addition of

nucleotides to their 3’ ends by the action ofthe polymerase at 72°C.

PCR products can mostly be resolved on agarose gel or polyacrylamide

gel (Foster et al., 1993). By exponentially amplifying a target sequence,

PCR significantly enhances the possibility of detecting target gene in

complex mixtures of DNA and also faciliates the cloning and sequencing

ofgenes. Amplification ofDNA by PCR have been applied in many areas

of biological research, including molecular biology, biotechnology and

medicine (Kwok & Sninsky，1989; Amheim et al., 1990; Ochman et al.,

1990;WelshWa/., 1990).

In fungi, one of the first use of PCR was the amplification of ribosomal

DNA sequences and the determination of their evolutionary relationships

OVhite et al., 1989). Now it has spread to many areas such as cloning,

sequencing, gene manipulation and so on.

1.4.1.2.1 Arbitrarily primed PCR (AP-PCR)

Conventional PCR requires prior information on target gene sequences

and thus restricts the use range of this technique. Many modifications

have been developed shortly after the first report of PCR and expanded

considerably its utilization (Foster et al., 1993). The arbitrarily primed

PCR (AP-PCR), or random amplified polymorphic DNAs (RAPDs),

which use non-specific primer(s) to produce DNA fingerprints relieved

the requirements of any prior sequence information and thus used in

19

Introduction

many organisms, especially mushrooms about which genetic information

is scarce.

AP-PCR and RAPDs were devised in 1990 by Welsh and McClelland and

Williams et al., respectively. These methods use arbitrary primer(s) and

low stringency conditions for primer annealing. RAPDs uses short

oligodeoxynucleotide primer which contains 50-80% G+C composition

and no palindromic sequence, while AP-PCR has no restriction on the

chosen primers. These primers are now available commercially. For

example, Operon Technologies (Alameda, California) sells kits of 20

different random 10-mers. The lower primer annealing temperature

allows various regions of the target DNA to be amplified (Welsh et al.,

1990; Williams et al., 1990). The polymorphisms between individuals

result from sequence differences in one or both ofthe primer binding sites

and are visible as the presence or absence of a particular AP-PCR or

RAPDs band (Rafalski & Tingey，1993).

AP-PCR and RAPDs have been widely used in fingerprinting genomes,

analysing linkage relationships and mapping, phylogenic studies and

detecting genetic variations. Various organisms have been studied,

ranging from bacteria (Fekete et al., 1992) to fimgi (Wyss & Bonfante，

1993), plants (Rafalski & Tingey，1993) and animals including human

being (Welsh & McClelland，1990).

Jn mushrooms, AP-PCR and RAPDs have been used in the genetic studies

of A. bisporus, L edodes, Coprinus cinereus and Volvariella volvacea

(Kerrigan et al., 1992; Khush et al,, 1992; Kwan et al., 1992; Pukkila,

1992; Chen, 1994).

Kerrigan et al. (1992) generated 64 natural genetic markers, including 2

allozyme markers, 24 RFLPs markers and 38 RAPDs markers. By

following the transmission of these 64 markers in the offspings, they

20

M^^M^^^^—^—^^^M^^^^^——^MI^^———^^—^^^^^^^^—^^M^^—IM^^——^—^M^M^———WWB^mni • 111Hlli— \Wili_ || I _W

fotroduction

demonstrated conventional meiosis behaviour in A. bisporus in which

both independent assortment and joint segregation of markers occurred

but crossing-over was infrequent. They also constructed the genetic map

of this mushroom. For the first time, the genome oiA. bisporus could be

surveyed extensively and loci determining economically important traits

in this fungi could be localized.

This study 'mA, bisporus, as well as another study conducted by Khush et

al in 1992, in which they showed the use of RAPDs markers in strain

differentiation and the identification and isolation of

homokaryons/heterokaryons, proved the value of RAPDs in mushroom

genetic research.

Chiu et al (1992) had demonstrated from their studies with L edodes by

AP-PCR that AP-PCR can be used to:

1. Typing, i.e., strain identification,

2. Confirmation ofprotoplast fusion products%brids,

3. Identification ofspecies-specific DNA markers,

4. Establishing monokaryon-dikaryon relationships,

5. Demonstration of dedikaryonization,

6. Generation ofpolymorphic molecular markers which may be used as

genetic markers in progeny analysis.

AP-PCR and RAPDs share the same methodology and in comparison

with RFLPs, they have several advantages (Rafalski & Tingey，1993)

(Table 2). First, the results are rapid, the whole analysis, from reaction to

gel, can be completed within one working day, while RFLPs requires at

least three days. Second, the method is simple. There is no hybridization

or detection techniques required. Third, they do not need gene library or

any form of a clone required as a probe. Fourth, AP-PCR and RAPDs

analysis requires very small quantities ofDNA, whereas for RFLPs, much

21

Introduction

larger amount of DNA with good quality is required. With these

advantages, especially the ignorance of any background DNA

information, AP-PCR and RAPDs have great potential in the genetic

studies ofmushrooms which are still lacking ofbasic information.

In V. volvacea, use of AP-PCR or RAPDs was just started in 1994 by

Chen to distinguish three V. volvacea strains: V14, V22 and V34. Other

applications are not found yet.

Table 2 Properties of RFLPs and RAPDs/AP-PCR (modified from

Rafalski & Tingey，1993).

RFLPs RAPDs/AP-PCR principle

endonuclease restriction DNA amplifacation with southern blotting random primers hybridization

type of polymorphism single base changes single base changes insertions insertions deletions deletions

genomic abundance high very high

level of polymorphism medium medium

dominance codominant dominant

amount ofDNA required 2-10 ig 10-25 ng

sequence information required? no no

radioactive detection required? yes/no no

development costs medium low

start-up costs mediumMgh ] ^

22

^•^^—^^M^^—^M^——^——^^^M——l^^^——I^^MM^1^—^^M^^—————^^^^^^M^M^——W—M—_l_ l| i^_ I I IMI I_ l| i i_ l l_ l«HI I» l 111 1111inmonF****-"'—™--

fotroduction

]n V. volvacea, use of AP-PCR or RAPDs was just started in 1994 by

Chen to distinguish three K volvacea strains: V14, V22 and V34. Other

applications are not found yet.

1.4.2 Protoplasts

One of the most significant development of mushroom biotechnology

during recent years has been the isolation, culture and fusion of

protoplasts (Cocking, 1972). Neurospora crassa was the first reported

filamentous ftmgus from which protoplasts were isolated (Emerson &

Emerson, 1958; Bachmami & Bonner，1959). Since then, protoplasts have

been obtained from more and more filamentous fungi (Meinecke, 1960;

Moore, 1975; Chang et al., 1984; Kitamoto et al., 1988, Tamova et al.,

1993) and these structures have become the tool in several key areas of

fungal biology such as transformation, cell wall synthesis (Peberdy,

1995).

1.4.2.1 Protoplast isolation

Protoplast isolation has been described in many Basidiomycetes including

the commonly cultivated edible mushrooms A. bisporus, L edodes, P.

sajor-caju and V. volvacea (Chang et aL, 1984; Peberdy & Fox^ 1991;

Peberdy, 1995).

The basic system for protoplast isolation includes (Peberdy, 1995):

i) fungal material: cells, mycelium or spores;

ii) an enzyme mixture that digests the hyphal wall;

iii) an inorganic salt or organic solute to make the solution isotonic with

the cytoplasmic contents and

iv) a buffer.

23

fotroduction

Enzyme, osmotic stabilizer and buffer are all subject to variation for

different fungal materials (Peberdy, 1991). A variety of systems used in

the most commonly cultivated mushrooms is listed in Table 3.

1.4.2.2 Mycolytic enzymes

Mycolytic enzymes which digest away fungal cell wall to liberate

protoplasts are mostly of microbial origin (Peberdy, 1991). Liitially,

strains of Streptomyces species isolated from soil samples were found to

cause lysis of fungal cell walls and were used in the production of lytic

enzymes. Later the lytic activity in Trichoderma harzianum was also

discovered (Peberdy, 1985). Most enzymes produced in recent years have

been derived from strains of Trichoderma harzianum. Some lytic

enzymes which have been used to release protoplasts are compiled in

Table 3.

Mbrmation on wall composition in edible mushrooms is very scanty

(Mendoza et al., 1987; Peberdy, 1991). The current available results

revealed that the major components were chitin, p-glucan and a-glucan,

indicating the requirement of corresponding hydrolytic enzymes for

digestion.

Lytic enzymes usually exist as a mixture of several hydrolytic enzymes,

mainly chitinase, P-glucanase and a-glucanase (Hamlyn et al., 1981).

Studies on several lytic enzymes including Novozym 234 OSFovo

Industries Ltd, Bagsvaerd, Denmark); lywallzyme (prepared from

Trichoderma longibrachiatum Rifai by Guangdong Listitute of

Microbiology, China) and Cellulase CP (John & E. Sturge Ltd, Selby,

North Yorkshire, England) by Yu and Chang in 1987 showed that

24

fotroduction

Novozym 234 provided the best chitinase, P-glucanase and a-glucanase

activities.

Novozym 234 produced satisfactory protoplast yield in many ftmgi

including edible mushrooms such as V. volvacea, Pleurotus and Lentinus

(Lau et aL, 1985). However, its action is not universal against all fungi

and why the walls of some fungi are resistant to Novozym 234 are

unknown (Hocart & Peberdy，1990).

Table 3 Protoplast isolation system in some edible mushrooms (sources:

klitrennikoff&Bloomfield，1984; Kitamoto etal； 1988; Peberdy, 1991)

organism stablizer lytic enzyme used Agaricus 0.5M MgSO4 induced lytic enzyme bisporus 0.6M MgSO4 lywallzyme

0.6M sucrose induced lytic enzyme 0.5M MgSO4, chitinase, Novozym 234 lmM CaCl2

Lentinula 0.5M MgSO4 induced lytic enzyme edodes 0.6M MgSO4 p-glucuronidase, celluase

1.2M MgSO4 induced lytic enzyme 0.5M mannitol celluase, chitinase,

Zymolase 60,000 0.6M mannitol celluase, chitinase

Pleurotus 0.4M MgSO4 lywallzyme sajor-caju 0.6M MgSO4 celluase, Novozyme 234

0.7M mannitol p-glucuronidase, celluase

Volvariella volvacea 0.5M MgSO4 induced lytic enzyme

0.6M MgSO4 Novozym 234 1.2M MgSO4 induced lytic enzyme,

Novozym 234 1.2M KC1 induced lytic enzyme,

Novozym 234 0.6M NaCl Novozym 234 0.6/0.8M mannitol lywallzyme

Novozym 234

25

fotroduction

Activity of a lytic enzyme is also subject to batch variation with respect to

yields ofprotoplasts resulted (Peberdy, 1995). bi digestion complex, their

activities will also be affected by other factors such as osmotic stabilizer

(Yu & Chang，1987). Therefore, optimized conditions for protoplast yield

are different from strain to strain (Peberdy, 1991).

1.4.2.3 Osmotic stabilizers

Osmotic stabilizer is required to keep the fragile protoplasts from bursting

after they are released from the cell walls. Results from many studies

showed that, generally, inorganic salts (except heavily-charged cation and

anion), sugars and sugar alcohols are good for filamentous fungi (Davis,

1985; Yu & Chang, 1987; Peberdy, 1991). MgSO4, mannitol and sucrose

have been the most commonly used in Basidiomycetes (Yu & Chang，

1987; Peberdy, 1991).

The types of osmotic stabilizer vary in each laboratory and the

determination of the most effective osmoticum for a given fungus is

empirical (Peberdy, 1991). Jn fact, the mechanism involved in the

digestion has not been understood yet.

The osmotic stabilizer and the lytic enzyme interact each other in the

digestion mixture (Peberdy, 1991). Yu and Chang (1987) observed that

chitinase was the most sensitive to inhibition by the various compounds

tested. For inorganic salts, the inhibition increased in the order: NO3-，C1'

< SO4 " < PO43-, and Na+，K+ < Mg〗+，Ca�+. However, MgSO4 has been

shown to be equally efficient as KC1 and NH4Cl for protoplast liberation

(Davis, 1985). For organic compounds, Yu and Chang (1987) showed

sucrose at a concentration of 600 mmol/1 had no effect on chitinase or P-

glucanase activity, but there was a 50% inhibition ofa-glucanase activity.

26

fotroduction

Mannitol and sorbitol enhanced chitinase activity about 2-fold, had no

effect on p-glucanase but produced a 20-30% inhibition ofa-glucanase.

1.4.2.4 Physiological condition ofmycelium

The importance of the physiological condition of mycdium used for

protoplast isolation has been reported for many fungi (Peberdy, 1989).

Most reports indicated poorer protoplast yield in Basidiomycetes when

compared to other species. Mycelia of most Basidiomycetes grow very

slowly and the different phases of growth are less distinct. However,

whether it is an important factor in poor protoplast production is unknown

(Peberdy, 1995).

Jn P. sajor-caju, Lau et al. (1985) found that protoplast release was

markedly affected by the age of the mycelium. One day old mycelium

gave a yield of 3.2 X 1 0 W , while four day old mycelium gave only 7.0

X 10Vml.

1.4.2.5 Protoplast regeneration

The process of new wall formation on the protoplast surface and

regeneration to the normal cell form are the crucial events in the

application of protoplasts in genetic manipulation (Peberdy, 1991).

Regeneration frequency is normally assessed on the basis of counts ofthe

colony forming units. Jn many fimgi, especially Basidiomycetes, such

frequency is low, less than 10% (Chang et al., 1985; Lau et al., 1985;

Peberdy, 1989; Zhao & Chang，1993).

As with protoplast isolation, the optimization of conditions for

regeneration is also empirical with external factors such as osmotic

stabilizer and lytic enzymes used (Peberdy, 1991). Lau et al. (1985)

found in their study that mannitol, when compared with KC1 and MgSO4,

27

fotroduction

is the most effective osmoticum in the regeneration of protoplasts of P.

sajor-caju. Zhao and Chang also showed in their study in 1993 the

suitability of mannitol for protoplast regeneration in the several edible

mushrooms they tested.

1.4.2.6 Application ofprotoplasts

Protoplasts have played an important role in genetic study and

manipulation in fungi. A new experimental approach to karyotype

analysis, called pulse-field gel electrophoresis (PFGE), involving

subjecting intact chromosomes to a pulse field in an agarose gel matrix

has been used widely in ftmgal genetic research since its first

development in 1984 (Walz, 1995). The prerequisite for a successful

karyotyping by PFGE is the isolation of an adequate quantity of

protoplasts as the source ofintact chromosomes.

In genetic manipulation, protoplasts are used in two areas: fusion and

transformation (Peberdy，1991). Through protoplast fusion, it is possible

to bring together whole genomes of related or unrelated strains and

promote recombinations leading to production of novel strains. This

technology has been adopted with several mushrooms such as Coprinus,

Pleurotus and Lentinula (Peberdy， 1991). Transformation is the

introduction of the gene of interest into the cell through a vector DNA

molecule. Up to now, most successful methods to introduce DNA into

fimgal cells have been using protoplasts (Peberdy, 1995). In other areas,

such as strain improvement and detection of pharmacologically important

drugs, protoplasts also provide a useful tool.

28

Introduction

1.5 Purpose and significance ofthis genetic study on V. volvacea

In order to find out whether and how genetic variations exist in V.

volvacea, a genetic analysis was carried out. The F1 and F2 progenies

were obtained to examine inheritance pattern. AP-PCR (arbitrarily primed

polymerase chain reaction) is one of the most commonly used PCR

methods in DNA fingerprinting. Since it requires no prior sequence

information, it was used in this study to detect any genetic variation in V.

volvacea about which the DNA sequenc& information is still unavailable.

In addition, morphological and physiological characters such as colony

morphology and growth rate of the progenies were also examined. This

study can detect evidence for the existence of genetic variations in V.

volvacea. Thus, further studies on the variation-generating mechanisms

and other details in the life cycle ofthis mushroom can be carried out.

29

— — ^ ^ — • ^ ^ ^ ^ ^ ^ ^ • ^ ^ • — — ^ ^ ^ ^ — ^ ^ ^ ^ ^ ^ M ^ ^ ^ ^ ^ ^ ^ — l ^ — I ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ B ^ — — ^ M ^ — B a a B » — i i A K J J 」 J i _ l l l _ ljWWmMPwnrwj_uwui

Chapter 2. Materials and Methods

2.1 Organism

Volvariella volvacea strain V34 was used. This strain originates from

Thailand.

2.2 Cell cultivation and maintenance

Cultures were maintained at 32°C on potato dextrose agar (PDA) which

contains 200 gm of potato infusion and 20 gm of bacto-dextrose. To mass

produce mycelium for DNA extraction, agar blocks of 1 cm in diameter

carrying mycelium were aseptically inoculated into potato dextrose (PD)

broth. The cultures were kept at 32°C stationary in darkness for 3-4 days.

2.3 Solutions and chemicals

2.3.1 Solutions for DNA isolation

(a) Lysis Buffer: 50 mM Tris-HCl, pH 7.2; 50 mM EDTA, pH 7.2; 3%

sodium dodecyl sulfate (SDS); 1% 2-mercaptoethanol.

(b) TE buffer: 10 mM Tris-HCl (pR 8.0); 0.1 mM EDTA.

(c) Phenol: Phenol (molecular biology grade, Sigma) was melted at 60°C and

saturated with 1 M Tris-HCl ^pH 8.0).

(d) Phenol: chloroform: isoamyl alcohol (25:24:1, pH 8.0±2): from Amesco

or Pharmacia Biotechnology Ltd.

(e) DNAase-free pancreatic RNase solution: Dissolve pancreatic RNase

(RNase A) at concentration of 10 mg/ml in 10 mM Tris-HCl Q>H 7.5)

30

HHH^HHHBI^H^^H^^HIH^HI^^^BIHHII^HHHII^H^^HIHmHIHHHHHBBIHBmB^BUSffiWffiByaffiHBR

Materials and Methods

and 15 mM NaCl. Heat at 100°C for 15 minutes. Allow to cool slowly to

room temperature. Store at -20°C.

2.3.2 Solutions for agarose gel electrophoresis

(a) 5 X TBE buffer: 0.089 M Tris base; 0.089 M boric acid; 0.002 M EDTA

(pH 8.0). Store at room temperature.

(b) 6 X gel loading buffer: 0.25% bromophenol blue, 0.25% xylene cyanol;

30% glycerol in distilled H2O.

(c) 10 mg^nl ethidium bromide: 100 mg ethidium bromide in 10 ml distilled

H2O. Store at 4°C in darkness.

2.3.3 PCR primers and reagents

Primers:

(a) M13 forward sequence (M13sq):

5'- CGCCAGGGTTTTCCCAGTCACGAC -3，

(b) M13 reverse sequence (M13rs):

5'- AGCGGATAACAATTTCACACAGGA -3'

Reagents:

Replica-Pack Reagent Set (Boehringer Mannheim).

2.4 DNA extraction and purification

Fresh mycelium was freeze-dried and ground in liquid nitrogen using a set

of sterilized and precooled mortar and pestle. Genomic DNA was extracted

and purified following the mini-preparation method (Lee & Taylor，1990).

The ground mycelium was transferred into a 1.5 ml eppendorf tube and 400

31

Materials and Methods

^1 lysis buffer was added. Then the content was mixed by a pipette tip to

obtain a homogenous solution, which was then incubated in a 65°C water

bath for 1.5 hours with occasional inversion. Then one volume of phenol:

chloroform: isoamyl alcohol (25:24:1) was added, and the tube was inverted

gently to mix. The clear top phase was transferred to a new tube after 10 min

of centrifugation at 14,000 x g. Phenol extraction could be repeated 2-3

times to remove the proteins. Then, 0.1 volume of 3 M sodium acetate and

1 volume of ice-chilled isopropanol were added and mixed gently. The tube

was left at -20°C for 2 hours and the precipitated DNA was pelleted by

centrifugation at 14,000 x g for 2 min. The pellet was rinsed with 70% ice-

cold ethanol, air dried and resuspended in 100 ^1 TE buffer. RNA was

removed by adding 5 il of 10 mg/ml RNaseA solution and incubating at

37°C for 1 hour. Then 100 mg of cesium chloride (CsCl) was added and the

tube was gently shaken to dissolve the CsCl. After centrifugation at 14,000 x

g for 15 min, the supernatant containing purified DNA was transferred to a

new tube. Three volumes of TE buffer were added, and followed by 1

volume of isopropanol. Then the solution was centrifuged again. DNA pellet

was rinsed with ice-cold 70 % ethanol, air dried and resuspended in 100 il

TE.

2.5 Agarose gel electrophoresis

DNA samples were loaded and resolved on agarose gel (LE grade, FMC). A

100 bp ladder (Pharmacia) or HinAlll digest of phage lambda DNA

(Pharmacia) was loaded in parallel to serve as DNA size marker. After

electrophoresis at 80 v for 120 min (for PCR products), or, at 100 v for 90

32

Materials and Methods

min (for genomic DNAs), the gel was stained by 0.5 ^g/ml ethidium bromide

for 20 min, destained in H2O for 2 min and photographed under UV

transillumination using Polaroid fibn (type 667，speed = ISO 3000) or

pictured with video camera and saved as a computer file using the gel

documentation system (BIO-RAD, model no.: GS 670).

2.6 Arbitrarily-primed polymerase chain reaction (AP-PCR)

In 50 ul PCR reaction mixture, there were the following components: lx

PCR buffer (Boehringer Mannheim), 10 ng of genomic DNA, 4 mM MgCl2,

0.2 mM each of dNTPs (Boehringer Mannheim), 1 ^M primer, (Operon

Technologies, Alameda) and 2.5 U Taq DNA polymerase (Boehringer

Mannheim). The mixture was overlaid with mineral oil (Sigma). The reaction

was performed in a thermal cycler (minicycler, MJ) programmed as: 2 low

stringency cycles at first (94�C，5 min; 35�C，5 min; 72�C，5 min), then 38

high stringency cycles (94°C，1 min; 55°C, 1 min; 72�C，2 min) and a fmal

10 min chain extension at 72°C. Amplification product was checked by

resolving 5 il ofPCR mixture on 3 % NuSieve agarose (FMC) as mentioned

in section 2.5. The experiment was repeated at least once.

2.7 Protoplast isolation and regeneration

2.7.1 Preparation ofprotoplasts

Volvariella volvacea was grown on PDA plates at 32°C for 1 week. Then

agar blocks (1 cm in diameter) carrying mycelium were transferred into 100

ml PD broth contained in a 250 ml conical flask and cultured for 3 days at

32°C stationary. Mycelium was harvested by filtering through a sterilized

33

Materials and Methods

nickel sieve and washed with sterilized 0.8 M mannitol solution. It was

soaked-dry by sterilized absorbent paper. Then the mycelium was suspended

in filter-sterilized lywallzyme solution (10 mg/ml in 0.8 M majmitol)

(Guangdong Listitute of Microbiology, China) and was digested for 1.5

hours at 30°C at 100 rpm. To harvest protoplasts, hyphal fragments were

removed by filtration through about 5 mm thick cotton packed in a 5 ml

syringe. Protoplasts were collected from the filtrate by centrifugation (3,000

rpm at room temperature for 10 minutes). Pellets were resuspended in 0.8 M

mannitol.

The optimum condition for protoplast yield used in this study was

determined by digesting mycelium of various ages (2 - 4 day old) with

lywallzyme for different times (1 hr, 1.5 hr, 2 hr and 2.5 hr). Protoplast

concentration was measured by haemocytometer.

2.7.2 Regeneration of protoplasts

Protoplasts in 0.8 M mannitol were diluted to around 10 protoplasts/ml.

Then 0.1ml diluted suspension was spread onto a MCM plate (2 g/1 yeast

extract; 2 g/1 peptone; 0.5 g/1 MgSO4 • 7压0; 0.46 g/1 KH2PO4； 1 g/1

K2HPO4； 20 g/l glucose; 0.8 M mannitol) and incubated at 32°C.

Regenerated protopasts were picked up with a needle and transferred to fresh

CM medium (0.5 g/1 MgSO4 • 7氏0; 0.46 g/1 KH2PO4； 1.5 g/1 K2HPO4； 2.0

g/1 peptone; 15 g/l glucose; 2.0 g/1 yeast extract; 0.5 mg/1 Thiamin HC1).

The regeneration frequency was calculated according to the average number

of regenerated protoplasts on four MCM plates. Viable hyphal fragments

could form colonies on both types of plates while regenerated protoplasts

could survive only on MCM plates. Jn parallel, protoplast suspension was

34

Materials and Methods

also spread onto MCM plates without mamutol as control. For each type of

media, four plates were spread.

R. F. = no. ofregenerated protoplasts X 100%

no. oftotal protoplasts

R. F.: regeneration frequency

Where number of regenerated protoplasts is counted by deduction of the

number of colonies on MCM without mannitol from the number of colonies

on MCM.

2.8 Single spore isolation and germination

Volvariella volvacea mycelium was grown on PDA plates at 32°C for 4 days

and then inoculated into plastic bags (size: 36 cm x 15 cm) 2/3 filled with

compost (88% straw; 10% wheat bran; 2% lime; 60% moisture content).

These bags were incubated at 34°C to let the mycelium run for 12-14 days.

Then they were opened under the conditions of 28-32°C with humidity

controlled at 85-95%. These bags were watered and illuminated every day in

the following two weeks to harvest mature fruiting bodies. Spores were

collected by placing a fruiting body in a petri dish with a sterile dry filter

paper and incubated at 32°C for 4-5 hours. Then a small piece of the filter

paper was cut and dipped into sterile distilled H2O to prepare a spore

suspension. Spore concentration was counted using a haemocytometer and

fmther diluted to arornid 10 spores/ml. An aliquot of 0.1 ml ofthe diluted

spore suspension was spread onto a CM plate and incubated at 32°C for 2

days. Germinated single spores were counted, then picked out with a needle

and transferred to fresh CM plates using aseptic techniques.

35

•! ^ •• ^ ^ • ••••• ^ •• ^ ^ ^ ^ ^ ^ •! • ^ ^ ^ ^ HIH ^ ^ HIHII ^ ^ ^ ^ ^ ^ ^ IHII ^ ^ ^ HHI ^ ^ BHS R RSIMSMSRKSQS SSmi

Materials and Methods

The germination frequency was determined by average numbers of

germinated spores on four CM plates:

G. F. = average no. of germinated spores X 100%

no. of spores spread

G. F.: germination frequency

2.9 Growth rate measurement

2.9.1 Colony diameter measurement -

Mycelial plugs of the same diameter (1 cm) of strain V34, a single spore

isolate or a protoplast regenerant was transferred to fresh CM plates. After

inoculation, the plates were incubated at 32�C for 4 days. Then colony

diameter of each individual was measured at three different dimensions.

Three replicates for one individual were made.

2.9.2 Biomass gain measurement

Mycelial plugs of a strain (parental, single spore isolate or protoplast

regenerant) was inoculated into PD broth and incubated for 4 days. Then wet

mycelium was harvested and transferred into 15 ml fresh CM broth. This

mycelium was homogenised in a sterilized blender cup using a Waring

blender. A suitable volume (1 ml in this study) of mycelial suspension was

pipetted into a 150 ml flask containing 20 ml of fresh CM broth to have

similiar inoculum size. All flasks were incubated at 32°C stationary for 4

days. Then, mycelium was collected from each flask by filtering through

nickel sieve and blotted dry with Whatman 3MM paper. The fresh mycelial

36

Materials and Methods

weight from each flask was then measured. For one isolate, three cultures

were performed.

37

Chapter 3 Results

3.1 Genomic DNA extraction

Genomic DNAs of V. volvacea strain V34, its protoplast regenerants and F1

progenies were extracted. DNA concentration and purity were checked by

0.7% agarose gel electrophoresis (Fig. 5) and spectrophotometty. The

average yield ofDNA extraction in this study was 300 ug per gram offreeze-

dried mycelium. In general, the absorbance ratios of 260 nm: 280 rnn and

260 nm: 230 nm were 1.9 and 1.8，respectively (Fig. 4). These DNAs were

then used for polymerase chain reaction.

3.2 Genetic analyses ofV34 and its progenies

3.2.1 Protoplast regenerants

3.2.1 • 1 Protoplast preparation

The effects of mycelial age and digestion time on protoplast yield were

shown in Figure 6. Three-day old broth cultures gave the highest yield of

protoplasts after digestion for 1.5 hr (Fig. 6): 1.27 土 0.08 x 10 protoplasts /

ml (mean value ofthree repeats).

38

—^^^^»^—^^^^^^^—^^^^—^^^^^^^^^^^^——^——^^—^^^^^^^^^^—^^^^^^——^H^^^^^^^^^—*^^^^^^^^^™WWWMBHaMi!,JaiBBBUWW—

i N ： ^ 1 \

0 1 • t _ I • I I , • ； • , . , 220 230 240 250 260 270 280 290

Wavelength (nm)

Fig. 4 A typical scan spectrum of genomic DNA sample from Volvariella

volvacea strain V34 and its progenies.

39

Result3

1 1 3 4 5 6 1 8

B B B | i » i ^ ™ i H ^ I

_ M M w^^mt^mam I ^ H I ^ H H H B I W K t K M ^^^K^^^^^K^^^

Fig. 5 Agarose gel showing the genomic DNAs from Volvariella volvacea

isolates.

Lanes 1 and 8，DNA size standard: \'HinA\\l\

Lanes 2-7, genome DNA samples.

40

16 .

14 - 12 12.733

1- ” i T ^ r »^JM I ''''' •

9 . 2 9 2 M : H 9.06 mycehum r ^ ^ ^ ® - _ f , age (day)

動 门 Bj 9_ ^ ^ 9 _ I I mm I o2: 動 丨_3: ^ J ^ ^ I I

i I I I = 0 . 3 9 3 0.4 0.266 [ “ ^ _ M ^ ^ rnm^^ y ^ , ‘ I ‘ > ；

1 1.5 2 2.5 Incubation time (hr)

Fig. 6 Protoplast yield from different ages of mycelia and different times of

exposure to lytic enzymes.

41

Result3

3.2.1.2 Protoplast regeneration

After spreading the protoplast solution onto MCM plates with mannitol and

MCM plates without mannitol (as control), colonies appeared on the plates

after 2-3 days. Number of regenerated protoplasts on both kinds of plates

were counted and the regeneration frequency was calculated according to the

equation in section 2.7.2 (Materials and Methods).

The protoplast regeneration frequency in this study was about 10.9% as

shown in Table 4.

Table 4. The regeneration frequency ofprotoplasts

average no. ofregenerated regeneration frequency = no. of protoplasts on a MCM plate regenerated protoplasts / no. of

total protoplasts x 100%

with mannitol without mannitol 10.9 士 2.6 %

43 .0 i2 .7 28.5 士 1.3

3.2.1.3 Morphology of V34 protoplast regenerants

Different colony morphologies and growth rates were observed among V34

protoplast regenerants (Fig. 7). The colony diameters of six randomly

choosen protoplast regenerants were measured (Table 5).

Table 5. Thecolony diameters ofprotoplast regenerants (4 day cultoe) protoplast no.3~~ no.5 no.7 no.9 no. 10 no.l4 V34 regenerants colony diameter(cm) 8.5土0.1 6.6土0.1 7.0士0.1 8.5士0.0 8.5士0.0 5.8士0.1 8.5士0.0

42

Results

| ^ ^ H .T # 1 發

^ ^ ^ | ^ ^ ^ ^ B ^ ^ ^ 9

^ ^

Ki ESiKl

Fig. 7 Colony morphologies of V34 protoplast regenerants.

43

^Ji^[j^^g^^jj^^^^[n^mi^jji^^^j^j^jimjjii^[mm^[i^jj[mjj^^jmiu^[mm^^mum^j^^[^^m^^^[[^^^[mjjj^^^^j^^jfl^^^^pi^^^§^^^^^^^^jj^j^^j3^^j^^^

Result3

3.2.1.4 Growth rate measurement

Then mycelium of the protoplast regenerants and V34 were collected and

their weight were measured, respectively (Fig. 8). The protoplast regenerants

exhibited different growth rates: faster, slower, or similiar to that ofV34.

Li this study, offsprings were divided into 3 groups based on their linear

growth rates and the abundance of aerial hyphae. Fast-growing group, of

which individuals had full petri dish growth and plenty of aerial hyphae. Li

this group, they were similiar to V34. Medium-growing group, of which

individuals had more than halfbut not covering the whole petri dish and less

aerial hyphae; and the slow-growing group, of which individuals had less

than halfpetri dish ofgrowth. For F1 progeny, isolates no. 8，no. 10 and no.

33 belonged to fast-growing group; isolates no. 3，no. 7，no. 23，no. 26 and

no. 36 belonged to medium-growing group and isolates no. 6 and no. 9

belonged to slow-growing group.

3.2.1.5 AP-PCR analysis of V34 protoplast regenerants

The two arbitrary primers: M13sq and M13rs, used in this study did not

show any polymorphisms among the six tested protoplast regenerants and

V34 (Figs. 9 and 10).

44

Result3

7 1 5.813 - 5.815

6 一 T T ^ - ^ 8 461^ 5.。53 5.04 ^ ^

I J I m _ _ i a I 3 謹 _ _ _ • _ ^ \ m m 霸 • 識 • m

^ - I i i 1 i ； I

1- I 1 i 腹 _ i 圓

J圏w變丨1 1,1 11 1 3 5 7 9 10 14 V34

No. of protoplast regenerants

Fig. 8 The biomass gain by six V34 protoplast regenerants after 4-day

incubation.

45

Result3

^ ^ ^ ^ ^ ^ 8

•

Fig. 9 AP-PCR profiles of six protoplast regenerants of V. volvacea V34

using primer M13sq.

Lane 1，DNA size standard: A,-/f/>zdIII;

lane 2-7, protoplast regenerants no.3, no.5, no.7, no.9, no.lO and no.l4;

lane 8, V34.

46

Result3

^ ^ ^ ^ ^ ^ 3 M ^ ^^^^^^^^ ^ ^ ^ ^ ^ | H ^ ^ ^ ^ ^ ^ ^ ^ ^ H ^ " ' '

^ ^ ^ K ^M^HP [1 ^U^ iff H g ^ ^ ^ g n U ^ ^ ^ K i m ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ K

Fig. 10 AP-PCR profiles of six protoplast regenerants of V. volvacea V34

using primer M13rs.

Lane 1，DNA size standard: X-Hin&ll',

lane 2-7, protoplast regenerants no.3, no.5, no.7, no.9, no.lO and no.l4;

lane 8, V34.

47

Result3

3.2.2 V34 single spore isolates (SSIs) - F1 progenies

3.2.2.1 Single spore isolation and germination

V34 was cultured and fruiting was carried out. Spores from mature fruiting

bodies were collected and germinated. Germination frequency was 31.1% in

this study (Table 6).

Table 6. Germination frequency ofV34 spores

no. of spores spread on each CM plate (a) 185

average no. of spores germinated (b) 57.5士 7.7

percentage of germinated spores=b/a xlOO 31.1 ±4.2

3.2.2.2 Morphology o f F l progenies

Different colony morphologies and growth rates were also observed among

germinated spores (F1 progeny) (Fig. 11). Colony diameters of ten randomly

choosen single spore isolates were measured (Table 7).

Table 7. The colony diameters ofsingle spore isolates (SSIs) (4 day cultures)

~~SSIs no.3 no.6 no.7| no.8 no.9|no.lO|no.23 no.26 no.33 no.36 V34

colony diameter^-^-^-^ 4.0±0.1 8.5±0.18.5+0.03.0±0.18.5+0.05.5±0.1 7.5±0.18.5±0.07.5±0.18.5±0.0

(cm)

3.2.2.3 Growth rate measurement

The weights of F1 progenies were measured. (Fig. 12). Highly variable

growth rates among F1 progenies and V34 parent were observed.

48

Result3

^ ^ ^ Tf^- ： • 7 iP | ^ ^ ^ ^ A ^ ^ i l ^ ^ ^ ^ ^ * ^ i i ^ f

^ n j^^^^^^^|

Fig. 11 Colony morphologies of V34 single spore isolates (F1).

49

7 n — I 6.358

5.996 ^ 6 - 1 ^ H

4.984 ^ H

5 ‘ 藝 • B 4.424 4.382

_ i J l s Q ^ S MH ^ a I B 'fea i^i ^ ^ _[1» ^ ^ Hi~-

3 6 7 8 9 10 23 26 33 36 V34 No. ofSSIs

Fig. 12 The biomass gain by ten V34 single spore isolates (F1) after 4-day

incubation.

50

Result3

3.2.2.4 AP-PCR analysis of 10 V34 single spore isolates

The two primers: M13 sq and M13rs, were used to detect i fDNA polymorphism

existed in F1 progenies. The tested isolates gave highly similiar DNA profiles

with parental strain V34 using arbitrary primers, M13 sq and M13rs (Figs. 13 and

14). Rare susceptible polymorphic DNA bands were observed but were not

reproducible when the experiment was repeated.

3.2.2.5 Fruiting ability o f F l progenies

Ten SSIs (Single Spore Isolates) of V34 were grown in compost bags to examine

their fruiting ability (Table 8). All individuals with slow or medium growth rate

could not even grow in compost. Among three fast growing individuals: no.8,

no.lO and no.33 single spore isolates, two ofthem, no. 10 and no. 33，could fruit

normally as V34 parent. No.8 could grow to primordial stage，but all primordia

died shortly after their appearance.

Table 8. Fruiting test o f F l progeny

n。T no.3 no.6 no.7 no.8 no.9 no.lO no.23 no.26 no.33 no.36 V34 SSls

vegetative 1 . 一 _ _ + - + - - + - + growthm

composf

fruitingin b - - - P * - F - - F 一 F

compost a: “-，，； no myceliimi growth; "+": with mycelium growth.

b： “—，，； no primordia or growth; "P*": primordia aborted; "F": mature fruiting

bodies.

51

Result3

^ ^ ^ ^ j ^ ^ ^ ^ ^ ^ ^ o n ^ 2

9Hi99 mStSm ^^^^^^^^^HT VK^^^K2^^^^B •

Fig. 13 AP-PCR profiles of 10 single spore isolates of V34 using primer

M13sq.

Lane 1，1 kb DNA size standard;

lane 2-11, SSIs no.3, no.6, no.7, no.8, no.9, no.lO, no.23, no.26, no.33 and

no.36;

lane 12，V34.

52

Results

12 11 10 9 8 7 6 5 4 3 2 1 m ^ H H ^ H ^ ^ H ^ ^ ^ H | ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ _

^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^| H ^^^^^^^^^^^^^^^^^^^^^^^H

^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^H

| ^ ^ ^ ^ |H^ [ lf| ^HI ^H{ g ^ ^ ^ ^ ^ ^ |

^ ^ ^ ^ ^ MHHflfl ^ ^ H ^ ^ ^ ^ ^ ^ ^ ^ | ^ H BIB^^^^^^^^^^^^^^^^^I I H | K 2 | ^ ^ M ^ H ^ ^ ^ H ^ ^ ^ | ^^^^^^^^H^^^^jjl^^^^^^^^^^^^^^^^^g ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ * ^ ^ ^ ^ ^ ^ ^ ^

Fig. 14 AP-PCR profiles of 10 single spore isolates of V34 using primer M13rs. I

(i«

Lane 1, 1 kb DNA size standard;

lane 2—11，SSIs no.3, no.6, no.7，no.8, no.9, no.lO, no.23, no.26, no.33 and

no.36; lane 12, V34.

53

^^M^—i i^^^—^M^M^M^^——^^—MMI—iMMWMllmi l l l l l _ I IBI I I_ i l l l l '

Results

3.2.3 Single spore isolates from F1 progenies-F2 progenies

3.2.3.1 Colony morphology and growth rate

Spores were collected from two F1 progenies which did fruit: no.lO and

no.33. After germination, morphological variations in the F2 progenies still

existed (Figs. 15 and 16). The colony diameters of the F2 progenies were

measured (Tables 9 and 10). Their gowth rates were also measured (Figs. 17

and 18).

Table 9. The colony diameters of single spore isolates ofNo.lO F1 progeny

(4 day cultures)

SSIs no.l no.2 no.3 no.4 no.5 no.6 no.7 no.8 no.9 no.l4 No.lO

colony diametei8.5±0.0 8.5+0.0 8.510.0 8.5±0.1 8.5±0.1 8.5±0.14.0±0.1 3.9±0.1 3.7±0.1 1.6±0.1 8.5±0.0

(cm)

Table 10. The colony diameters of single spore isolates ofNo.33 F1 progeny

(4 day cultures)

SSIs no.l no.2 no.4 no.5 no.6no.7 no.9 tio.lO no.ll no.l2 No..33

colony diameter8.5±0.0 8.5±0.0 8.510.1 8.510.0 8.5±0.0 8.5±0.1 5.2±0.5 7.5±0.1 5.210.4 6.110.1 8.5±0.0

(cm)

54

^^^^^^^^^^^^^^^m^^^^^^^^^^^^^^^^^^^^^M^^^^^^^^^^^ M^^^M^^I^^^M^^M^^ BBBS *jMi^^^^^^

Results

| ^ l J

mm^m^^ ^^^¾ 1 ^ ¾ H K H ^

Fig. 15 Colony morphologies of single spore isolates of No.33 (the F2

progeny).

55

i i i ^ i ^ ^ ^ ^ ^ ^ ^ i ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ i ^ ^ ^ ^ ^ ^ ^ i ^ ^ i ^ ^ ^ wis K si Bj s ^ ^ ^

Result3

^^m ^ H j ^ 3 ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ E ^ ^ |

^ K K l ^^^^^BH ^^^^^^^^^^^^^^m^^^M

^m p i | ^ B ^ K H

mm I

Fig. 16 Colony morphologies of single spore isolates of No.lO (the F2

progeny).

56

7 ^ G.24 , 6.07

6 i j l j _ m _

f ‘ ‘ 4.31 I I ^ A [ ^ W _ ' p 外 - 3 . 5 3 朽 ^ i 3.47 3.5 3.47 麗

t;||ii|| || E I 1 二 雾 • i f 1.4 1 . 3 9 1 . 4 3 I I

:illyjjjjjiLi 1 2 3 4 5 6 7 8 9 14 S10

No. of single spore isolates ofS10

Fig. 17 The biomass gain by ten single spore isolates o fNo . 10 after 4-day

incubation.

57

s

n^^^ia^

5

r

2

^ n

遣

3

”-iw5#Fwd 1

H

Fr^_1 1

^ ””

J

1 K

s

o ^

.^

S

ii^ 9

_ 譯

d s

.u ^

1

^i^liii

%i 8

I I

^

•

S

-isiii 6

I

I .

細

S

g^^^i 5

a

- m

^ t^^s,广(.f^.^.v^t4c^

|v

>«.

aJ

<

4

.2

3 *

n

- #

: .

e

^ .

T n

2

n“““—TT““n”nJ

？

o

力

t^

££^s

ps

f^ 2 5

.u

6

¾¾¾^! €

3

-¾ -a-.J

8

对

1

^ ,_^^^iii^^^ 1

•阮•咖

8 6

4

2

o

(3)

ul^pM

lumlsxol

Chapter 4 Discussion

4.1 Protoplast isolation and regeneration

The isolation of protoplasts is a total result of the interactions of many

factors. The three major factors are: lytic enzyme, osmotic stabilizer and

the physiological state of the mycelium. Although Novozym 234 was

reported in many studies to give the highest chitinase, p-glucanase and a-

glucanase activities and also very satisfactory protoplast yield in many

fungi, including Volvariella volvacea (Chang et aL, 1985; Yu & Ghang,

1987; Peberdy, 1995), it is too expensive to be widely used.

The lywallzyme used in this study is derived from Trichoderma

longibrachiatum and was very effective in the lysis of several edible

mushrooms such as Agaricus, Lentinula and Pleurotus (Chang et aL,

1985; Zhao & Chang 1993). Result of protoplast yield from this study

(1.27 土 0.08 X 10 protoplast/ml) also proved its effectiveness for

Volvariella volvacea.

As an osmotic stabilizer, mannitol was choosen because it has been one

of the most commonly used in Basidiomycetes and it was also shown to

enhance chitinase activity in digestion mixture (Yu & Chang，1987). In

the prelinmiary experiments, both spores and vegetative mycelium were

used to release protoplasts but spores were more resistant to lytic

enzymes than vegetative mycelium and gave much lower yield. Another

tissue tried was young gills of fruiting bodies at the button stage. They

gave rather high yield comparable with that ofvegetative mycelium. They

were not used because fruiting bodies are not easily available as with

vegetative mycelium.

59

Discussion

Regeneration of protoplasts is a very important step to apply protoplasts

in genetic manipulations. However, in many fungi, especially

Basidiomycetes, regeneration frequencies are low (Peberdy, 1989). Jn P.

sajor-caju and V. volvacea, Chang and co-workers (1985) observed that

the regeneration frequencies of both fungal protoplasts were lower than

1%. Lau et al. (1985) showed a 4-6% regeneration frequency in P. sajor-

caju. Zhao and Chang (1993) showed in their study that, among the

several mushrooms examined, the highest regeneration frequency of

9.6% was found with P. florida and the lowest of 0.96% with L edodes.

Li this study, the regeneration frequency was 10.9% in Volvariella

volvacea. The reason for low regeneration frequency is still not known

(Peberdy, 1995). Santiago (1982) observed that the cytoplasm in a

mycelial cell during protoplast release was repeatedly constricted to

divide into two or more spherical bodies. Some of them had no nuclei.

Moreover, it is also possible that protoplasts which possess nuclei might

have lost some other important organelles, such as mitochondria, resulting

in insufficient energy production and biosynthesis of proteins/reserve

materials which are needed in cell growth. Even if there is no loss of

nuclei or mitochondria, the protoplasts isolated from fungal mycelium are

very heterogeneous because of the spatial differentiation of biochemical

activities in the growing hyphae. The poor regeneration of protoplasts

from many fungi may be a reflection of the heterogeneity (Peberdy,

1995). The attempt to isolate protoplasts from spores was to produce a

more homogeneous preparation with a presumed higher regeneration

frequency. However, regeneration frequency of spore protoplasts was still

significantly lower than 90% (Bos, 1985). This could be because some

spores may not be fully developed or matured.

60

Discussion

External factors also affect regeneration of protoplasts, such as presence

oflytic enzymes. These enzymes are used to iyse cell walls and therefore

liberate protoplasts. If they are not completely removed from protoplast

preparation, the residue enzyme, even only a very small amount, is able to

inhibit cell wall formation.

4.2 Phenotypic variations in Volvariella volvacea

4.2.1 Colony morphology

It was found that there were wide variations in colony morphology among

V34 protoplast regenerants, F1 single spore isolates and F2 single spore

isolates (Figs 7，11，15, 16). Offspring individuals can be easily divided

into "parental" and "non-parental" groups in which "parental" group have

plenty of mycelium and aerial hyphae, while "non-parental" group does

not. However, it is difficult to subdivide them because of the great

variations among individuals such as presence or absence of concentric

rings, abundance of aerialhyphae (Figs. 7, 11，15, 16).

4.2.2 Growth rate

Two methods were used in this study to measure growth rate of the

individuals: colony diameter measurement and biomass gain

measurement. Colony diameter measurement, also called linear growth

rate measurement, is a very simple method to measure fungal growth. It

involves only the transfer of mycelial plugs with the same diameters and

colony morphology can be observed directly from the agar plates.

Biomass gain measurement, however, requires more manipulations and

time and thus is slower and more complicated. Colony morphology

information cannot be provided by the latter method. But colony diameter

can roughly present the growth rate since mycelia usually grow radially in

61

Discussion

all directions. Those growing inside the agar cannot be measured.

Moreover, there is no correlation between the spread area of a mycelial

front on a solid surface and the total amount the fungus produced. On the

contrary, biomass gain measurement provides accurate data on growth

rate and thus is a better criterion in growth rate test. For instance, among

F1 single spore isolates, No.3, No.7, No.8, No.lO and No.33 had the

same colony diameters (8.5±0.0 cm or 8.510.1 cm) but their biomass

gains were very different, ranging from 2.09±0.12 g to 6.36±0.15 g

(Table 7，Fig. 12).

4.2.3 Fruiting ability

Since 1969, Chang and colleagues have repeatedly shown that a single

basidiospore of V. volvacea can germinate and form fruiting bodies by

itself without any mating (Chang & Yau，1971; Li，1977; Chang et al.,

1981; Li, 1991). Thus V. volvacea is taken as homothallic. Great

variations among its single spore isolates were also observed in these

studies. Li and Chang (1979), Chang and coworkers (1981) demonstrated

that there was no correlation between the mycelial colony morphology,

linear growth rate and self-fertility. Both "normal" isolates which grew

vigorously to form a greyish-white colony with abundant aerial hyphae,

and the "abnormal" isolates which differed from "normal", could be

either fertile or sterile.

Jn this study, 10 F1 single spore isolates were examined for their fruiting

ability. The data agreed mostly with those previous description (Table 8).

Both self-fertile and self-sterile individuals occurred among single spore

isolates. All those individuals which could fhiit normally as their parent

V34 were fast-growing ones. All medium or slow-growing isolates

62

Discussion

showed very poor or no vegetative growth in compost. However, not

every fast-growing isolates can fruit normally. No.8 isolate, which was

very fluffy and fast-growing, could only reach primordia stage and No.36

was sterile.

4.3 Genetic mechanisms for phenotypic variations in V, volvacea

Li fungi, two mechanisms have been recognized to generate genetic

variations: meiotic recombination and mitotic recombination (Raper,

1966; Fincham et al., 1979; Bos and Swart, 1995). ln the anaphase offirst

meiotic division (MI)，homologous chromosomes segregate to the

different poles of the spindle. In this way, a reassortment of non-

homologous chromosomes is achieved. Before the chromosome

seperation, exchange between sister or non-sister chromatids happens. If

the homologous chromosomes carry different alleles at one or more loci,

crossingovers between non-sister chromatids will result in recombination

ofgenes (Fig. 1).

Homologous chromosomes behave independently during mitosis. Sister

chromatids separate during the anaphase resulting in two daughter cells

with the same genetic information. However, genetic evidence in

Aspergillus ^Sfga and Roper, 1968) demonstrated that homologous

chromosomes can exchange parts of nonsister chromatids and unequal

crossingover can occur during mitosis, resulting in duplication. Mitotic

crossingovers also result in recombination ofthe genes (Fig. 2).

Studies on nuclear behaviour and ploidy level at different developmental

stages, sensitivity to radiation and segregation of isozyme markers proved

the haploid life cycle of V. volvacea (Quaye, 1986; Royse et al., 1987;

Chiu, 1993). Chiu (1993) concluded that a haploid uninucleate

basidiospore germinates to haploid multinucleate mycelium and forms

63

Discussion

fruiting bodies. Then, a uninucleate hymenial initial divides mitotically

to a binucleate condition, and karyogamy leads to a transient diploid

stage. DNA replicates to 4N in content. Basidiospores are formed through

meiosis and life cycle of V. volvacea is completed (Fig. 3).

The transient diploid stage provides possibility for V. volvacea to generate

meiotic recombinations leading to the formation of haploid, uninucleate

basidiospores carrying genetic variations, bi principle, mitotic

crossingover cannot occur when the nuclei of the fungus are haploid

(Raper, 1966; Bos and Swart, 1995). JnAspergillus, it was observed that

occasionally, two nuclei in a hypha cell can fuse and give rise to diploid

condition (Bos and Swart, 1995). bi V. volvacea, since the vegetative

mycelium is multinucleate, crowding of nuclei was commonly

encountered (Li, 1977). Whether mitotic recombination exists in V.

volvacea or not is uncertain.

Mitotic recombination has been found (Smith, 1974; Bos and Swart,

1995). However, the frequency of mitotic crossingover is much lower

than that ofmeiotic crossingover (Bos and Swart, 1995). During meiosis,

many crossingover events occurred in each meiocyte, whereas mitotic

crossingover in artificially induced unstable diploids could occur at a

frequency as high as 10' in Neurospora crassa (Smith, 1974).

Since basidiospores are meiotic products, they should bear higher

frequency of genetic variation than protoplasts, which come from mitotic

vegetative mycelium. Therefore, higher frequency of phenotypic

variations should be observed in basidiospores. If we assume that

phenotypic variations observed in this study were arisen from meiotic or

64

Discussion

mitotic recombinations, then these results agreed with the observations in

which F1 single spore isolates did exhibit much more variations in their

colony morphologies and growth rates (Fig. 11) than protoplast

regenerants (Fig. 7).

4.4 AP-PCR analyses

AP-PCR generates unique DNA profiles for every individual as

demonstrated in many organisms such as bacteria, plant and man (Welsh

& McClelland，1990; Fekete et al., 1992; Rafalski & Tingey, 1993). In

mushroom L edodes, AP-PCR has been used for typing strains (Chiu et

al., 1992; Chiu, 1993; Kwan et al., 1992). AP-PCR has been widely used

in detecting genetic variations. The polymorphic bands generated from

AP-PCR behave as dominant genetic markers (Rafalski & Tingey，1993).

In V. volvacea, AP-PCR was first used by Chen (1994) to type three

strains: V14, V22 and V34. Four arbitrary primers (Del, Eco, M13sq and

Gal) were used and three of them (Del, Eco and M13sq) gave different

banding patterns among the three strains. Jn this study, two arbitrary

primers: M13sq and M13rs, were used to analyse V34 protoplast

regenerants. Six randomly choosen protoplast regenerants and V34 itself

were analysed. However, no polymorphism was detected by any of the

primers (Figs. 9,10).

Ten randomly choosen F1 single spore isolates were also tested. Results

were surprising, too: all 10 F1 progenies as well as their parent V34, no

matter how different their phenotypes were, their DNA banding patterns

were similiar using primer M13rs and M13sq, respectively (Figs. 13，14).

65

Discussion

Different phenotypes may reflect variations in genetic makeup. Genetic

information generally transfers from DNA to RNA and finally to

poteins/peptides. DNA variations which can be expressed is able to be

printed on RNA, resulting in polymorphisms in RNA fingerprint. These

polymorphisms, however, do not mean the differences in DNA because of

the gene expression regulation in DNA. Thus, RNA fingerprinting cannot

be used to detect DNA variations. To hunt for the mechanisms generating

DNA variation, it is crucial to understand the possible mechanisms.

4.5 Possible sources for variations

Expression of morphological characters depends not only on the genetic

information but also on environmental factors. However, the role of

environmental factors is not taken into account in this study as well as

previous studies on morphological variations among single spore isolates

since all cultures were grown in uniform conditions as far as possible. Li

and Chang (1979) suggested the differences among the progenies may

due to either spontaneous mutations, or expression of pre-existed

morphological mutants by recombination, or even chromosomal

aberrations.

Mitotic recombinations have been demonstrated in Neurospora (Smith,

1974)，although there is not enough evidence for V. volvacea yet. Also, in

ftmgal nuclear divisions, asynchronous movement of chromosomes is

very common (Heath, 1978). Mitotic nondisjunction of sister chromatids

may lead to aneuploidy. Such genetic variation cannot be detected since

there are normal nuclei in the same thallus (Chiu & Chang，1987). Other

sources of variation may come from other genetic materials besides the

nucleus, such as mitochondrial genome or transponsons.

66

Discussion

Transposons, if present, can move around in the genome. Thus there is

induced variation in the phenotype. Detection of the transposons is

difficult as they are not stably inherited and the random movement in the

genome.

4.5.1 Mitochondrial DNA (mtDNA)

Because of the genes encoding subunits of the respiratory chain complex

and ATPase in mtDNA, defects in mitochondrial genome usually be

expressed in the progenies as affecting their growth rates. Li Neurospora

and yeast, mitochondrial DNA mutations occur at rather high frequency

in wild type strains, such as certain types of yeast petites (deletion

mutation in mtDNA) arose at 10" (Griffiths et al., 1995; Marotta et al.,

1982). Such spontaneous mutations in mtDNA, and also the interactions

with nuclear genome, are possible to account for the phenotypic

variations in growth rate of V. volvacea because of the widely observed

different growth rate.

Li comparison with nuclear genome, fungal mitochondrial DNA is very

small (Smith et aL, 1987; Orbach et al., 1988, Hudspeth, 1992).

Therefore, the amplified AP-PCR profile mostly reflects the genetic

makeup ofnuclear genome.

4.5.2 Spontaneous mutations

Spontaneous mutations are very rare events, hi Neurospora, such

mutation rate is about 10' (Ayala & Kiger，1984). Unlike Neurospora

and many other fungi, which have single or a few nuclei in each cell,

vegetative mycelium of V. volvacea is multinucleate. Chang and Ling in

1970 observed that, the number of nuclei in each mycelial cell was very

high, ranging from 3-105，with a mean value of 22.10 土 1.54. Ifmutations

67

Discussion

oceur in only one nucleus, it may not be able to be detected or expressed

in phenotype. But with so many nuclei and in each of them DNA

duplication and nuclear division are undergoing, there is not only more

chances to accumulate mutation effect leading to the change of

phenotype, but also the increasement of accumulated mutation events.

Thus, for V. volvacea, spontaneous mutation has a higher possibility to

cause phenotypic variations in progenies than for many other fungi.

However, spontaneous mutation cannot be detected unless the whole

genome is to be screened.

As a summary of these possible sources, mtDNA genome should be

examined in the future.

68

I ^ ^BBB^ ^ MBBI ^ ^ ^ BI ^M^ ^ ^B^M^B^M^—^—^———Ml MMMwmnmw«ranwr_i___iii_i_则丨丨

Conclusion

The present study confirmed that variations in Volvariella volvacea do

exist. In F1 single spore isolates, colony morphology, growth rate and

fertility are highly variable; even from F1 to F2 progeny, these variations

still persist; in protoplast regenerants, phenotypic variations showed less

variablility. No distinct relationship between colony morphology, growth

rate and fertility have been found. However, with these great phenotypic

variations among V34, its protoplast regenerants and single spore isolates,

AP-PCR analysis using two arbitrary primers did not detect DNA

polymorphisms. These results provide evidence for the primary

homothallic life cycle of V. volvacea. The mechanisms in V. volvacea

generating such wide variations may not from nuclear genome only.

Among these possible sources, mitochondrial genome, which controls the

ATP synthesis, growth rate and life span, might have contributed to the

observed variations in V. volvacea.

69

References

Anderson, J. B. 1991. Molecular tools in breeding Agaricus. Li:

Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T.,

Buswell, J. A. and Miles, P. G.), pp. 207-223. Gordon and Breach

Sci. Pub.: Philadelphia.

Arganoza, M. T.，Min, J.，Hu, Z. Y. and Akins, R. A. 1994.

Distribution of seven homology groups of mitochondrial

plasmids in Neurospora: evidence for widespread mobility

between species in nature. Current Genetics 26: 62-73.

Amheim, N., Li, H. H. and Cui, X. F. 1990. PCR analysis of DNA

sequences in single cells-single sperm gene mapping and genetic

disease diagnosis. Genomics 8: 415-419.

Ayala, F. J. and Kiger, J. A. 1984. Modern Genetics, pp. 243-244 & pp.

672-676. The Benjamin/Cummings Pub. Company Jnc.: London.

Bachmann, B. J. and Bonner, D. M. 1959. Protoplasts from

Neurospora crassa. Journal of Bacteriology 78: 550-556.

Bej, A. K. 1991. Amplification of nucleic acid by polymerase chain

reaction (PCR) and other methods and their applications. Critical

Reviews in Biochemistry and Molecular Biology 26: 301-334.

70

References

d

Bprtrand, H., Chan, B. S. S. and Griffiths, A. J. F. 1985. Insertion o f a

foreign nucleotide sequence into mitochondrial DNA causes

senescence in Neurospora intermedia. Cell 41: 877-884.

Bos, C. J. 1985. Protoplasts from fimgal spores. Hi; Fungal protoplasts

(eds. Peberdy, J. F. and Ferenczy, L.), pp. 189-203. Marcel

Dekker: New York.

Bos, C. J. and Swart, K. 1995. Genetics of Aspergillus, bi: The

Mycota: Genetics and Biotechnology (eds. Esser, K. and Lemke,

P. A.), pp. 19-33. Spring-Verlag: Berlin, Heideberg.

Bostein, D., White, R., SkoMck, M. and Davis, R. W. 1980.

Construction of a genetic linkage map in man using restriction

fragment length polymorphisms. American Journal of Human

Genetics 32: 314-331.

Bowden, C. G., Royse, D. J. and May, B. 1991. Linkage relationships

of allozyme encoding loci in Lentinula edodes. Genome 34: 652-

657.

Bumett, J. H. 1975. Mycogenetics. John Wiley and Sons: London.

Buswell, J. A.，Cai, Y. J. and Chang, S. T. 1993. Fungal- and

substrate-associated factors affecting the ability of individual

mushroom species to utilize different lignocellulosic growth

substrates. Li: Mushroom Biology and Mushroom Products (eds.

71

References f

Chang, S. T.，Buswell, J. A. and Chiu, S. W.), pp. 141-150. The

Chinese University Press: Hong Kong.

Cai, Y. J., Buswell, J. A. and Chang, S. T. 1994. Production of

cellulase and hemicellulase by the straw mushroom, Volvariella

volvacea. Mycological Research 98: 1019-1024.

Castle, A. J., Horgen, P. A. and Anderson, J. B. 1987. Restriction

fragment length polymorphisms in the mushrooms Agaricus

brunnescem and Agaricus bitorquis. Applied and Environmental

Microbiology 53: 816-822.

Chang, S. T. 1969. A cytological study of spore germination of

Volvariella volvacea. The Botanical magazine 82: 102-109.

Chang S. T. 1977. The origin and early development of straw

mushroom cultivation. Economic Botany 31: 374-376.

Chang, S. T. 1978. Volvariella volvacea. In: The Biology and

Cultivation of Edible mushrooms (eds. Chang, S. T. and Hayes,

W. A.), pp. 573-605. Academic Press: New York.

Chang, S. T. 1980. Mushrooms as human food. Bioscience 30: 399-

401.

Chang, S. T. 1991. Cultivated mushrooms. In: Handbook of Applied

Mycology, volume 3: Foods and Feeds (eds. Arora, D. K.,

72

^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ HHHHH HH HmHBBHHHHHB BE HmESBBnsBn KKnHi Bm

References

Mukerji, K. G. and Marth, E. H.), pp. 221-240. Marcel Dekker:

New York.

Chang, S. T. 1993a. Mushroom and mushroom biology, hi: Genetics

and Breeding of Edible Mushrooms (eds. Chang, S. T., Buswell,

J. A. and Miles, P. G.), pp.M3. Gordon & Breach Pub. Inc:

Philadelphia.

Chang, S. T. 1993b. Mushroom biology: the impact on mushroom

production and mushroom products. In: Mushroom Biology and

Mushroom Product (eds. Chang, S. T.，Buswell, J. A. and Chiu,

S. W.), pp. 3-17. The Chinese University Press: Hong Kong.

Chang, S. T. 1993c. Biology and cultivation technology of Volvariella

volvacea. In: Mushroom Biology and Mushroom Product (eds.

Chang, S. T., Buswell, J. A. and Chiu, S. W.), pp. 73-83. The

Chinese University Press: Hong Kong.

Chang, S. T. and Chu, S. S. 1969. Nuclear behaviour in the basidium

of Volvariella volvacea. Cytologia 34: 293-299.

Chang, S. T. and Ling, K. Y. 1970. Nuclear behaviour in the

basidiomycete，Volvariella volvacea. American Journal of Botany

57: 165-171.

Chang, S. T. and Yau, C. K. 1971. Volvariella volvacea and its life

history. American Journal ofBotany 58: 552-562.

73

References

Chang, S. T., Miles, P. G. and Wai, C. C. 1981. A study of

monosporous isolates of Volvariella volvacea. Mushroom Science

11，603-619.

Chang, S. T.，Li, G. S. F. and Peberdy, J. F. 1985. Isolation of

protoplasts from edible fungi. MIRCENJournal 1: 185-194.

Chen, M. J. 1994. Molecular Studies on the Chinese Straw Mushroom,

Volvariella volvacea. M. Phil thesis. The Chinese University of

Hong Kong: Hong Kong.

Chiu, S. W. 1993. Evidence for a haploid life-cycle in Volvariella

volvacea fi:om microspectrophotometric measurements and

observations of nuclear behavior. Mycological Research 97:

1481-1485.

Chiu, S. W. and Chang, S. T. 1987. Volvariella bombycina and its life

history. Mushroom Journalfor the Tropics 7: 1-12.

Chiu, S. W.，Kwan, H. S. and Cheng, S. C. 1992. Application of

arbitrarily-primed polymerase chain reaction in molecular studies

of mushroom species with emphasis on Lentinula edodes. In:

Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T.,

Miles, P. G. and Buswell, J. A.), pp. 265-284. Gordon & Breach

Pub. Lic: Philadelphia.

74

1 M^ B —^ M—M^MM^ BM^ BMl BMBW^MMI WM—WWMWl—MM—MMWi_i__iiim™_iiiii

References

Clutterbuck, A. J. 1993. Aspergillus nidulans. In: Genetic Maps (eds.

O'Brien, S. J.), pp. 234-268. Cold Srping Harbor Laboratory

Press: New York.

Cocking, E. C. 1972. Plant cell protoplasts-isolation and development.

Annual Review of Plant Physiology 23: 29-50.

Court, D. A. and Bertrand, H. 1992. Genetic organization and

structural features of maranhar, a senescence-inducing

mitochondrial plasmid of Neurospora crassa. Current Genetics

22: 385-397.

Court, D. A.，Griffiths, A. F. J., Kraus, S. R.，Russell, P. J. and

Bertrand, H. 1991. A new senescence-inducing mitochondrial

linear plasmid in field-isolated Neurospora crassa strains from

India. Current Genetics 19: 129-137.

Crossman，L. L. and Hudspeth, M. E. S. 1985. Fungal mitochondrial

genomes. Li: Gene Manipulation in Fungi (eds. Bennet, J. W. and

Lasure, L.), pp. 65-103. Academic Press: New York.

Davis, B. 1985. Factors influencing protoplast isolation. Li: Fungal

Protoplasts (eds. Peberdy, J. F. and Ferenczy, L.)，pp. 45-71.

Marcel Dekker: New York.

Dinouel, N., Drissi，R.，Miyakawa, 1.，Sor, F., Rousset, S., Fukuhara,

H. 1993. Linear mitochondrial DNAs of yeasts: closed-loop

75

References

Structure of the termini and possible linear-circular conversion

mechanisms. Molecular and Cellular Biology 13: 2315-2323.

Elliott, T. J. 1972. Sex and the single spore. In: Mushroom Science 8:

11-18.

Elliott, T. J. 1982. Genetics and breeding of cultivated mushrooms, ][n:

Tropical Mushrooms-Biological Nature and Cultivation Methods

(eds. Chang, S. T. and Quimio, T. H.). The Chinese University

Press: Hong Kong.

Elliott, T. J. and Challen, M. P. 1985. The breeding system of the

silver-siUc straw mushroom, Volvariella bombycina. Mushroom

Newsletter for the Tropics 6: 3-8.

Emerson, S. and Emerson, M. R. 1958. Production, reproduction and

reversion of protoplast like structures in the osmotic strain of

Neurospora crassa. Proceedings of the National Academy of

Science, U.S.A. 44: 668-671.

Fekete, A., Bantle, J. A.，Hailing，S. M. and Stich, R. W. 1992.

Amplification fragment length polymorphism in Brucella strains

by use of polymerase chain reaction with arbitrary primers.

Journal ofBacteriology 174: 7778-7783.

Finchan, J. R. S., Day, P. R. and Radford, A. 1979. Fungal Genetics.

Blackwell Scientific Publifications Ltd: Oxford.

76

References

Foster, L. M., Kozak, K. R., Loftus, M. G., Stevens, J. and Ross，L

1993. The polymerase chain reaction and its application to

filamentous fungi. Mycological Research 97: 769-781.

Fukuda, M., Nakai, Y. F., Hibbet, D. S.，Matsumoto, T. and Hayashi,

Y. 1994. Mitochondrial DNA restriction fragment length

polymorphisms in natural populations of Lentinula edodes.

Mycological Research 98: 169-175.

Fukuhara, H.，Sor, S., Drissi, R.，Dinouel, N., Miyakawa, I.，Rousset,

S. and Viola, A. M. 1993. Linear mitochondrial DNAs of yeast:

frequency of occurrence and general features. Molecular and

CellularBiology 13(4): 2309-2314.

Griffiths, A. F. J. and Bertrand, H. 1984. Unstable cytoplasms in

Hawaiian strains of Neurospora intermedia. Current Genetics 8:

387-398.

Griffiths, A. F. J., Collins, R. A. and Nargang, F. E. 1995.

Mitochondrial genetics of Neurospora. Hi: The Mycota: Genetics

and Biotechnology (eds. Esser, K. and Lemke, P. A.)，pp. 93-105.

Spring-Verlag: Berlin Heideberg.

Grossman, L. L. and Hudspeth, M. E. S. 1985. Fungal mitochondrial

genomes. Li: Gene Manipulations in Fungi (eds. Bennett, J. W.

and Lasure, L.), pp. 65-103. Academic Press: New York.

77

,

References

Hamlyn, P. F.，Bradshaw, R. E., Mellon, F. M., Santiago, C. M.，

Wilson, J. M. and Peberdy, J. F. 1981. Efficient protoplast

isolation from fungi. Enzyme and Microbiological Technology 3:

321-325.

Heath, I. B. 1978. Experimental studies of mitosis in the fungi. In:

Nuclear Division in the Fungi (ed. Heath, I. B.), pp. 89-176.

Academic Press: New York.

Hermanns, J., Asseburg，A. and Osiewacz, H. D. 1994. Evidence for a

life span-prolonging effect of a linear plasmid in a longevity

mutant of Podospora anserina. Molecular & General Genetics

243: 297-307.

Hintz, W. E. A., Anderson, J. B. and Horgen, P. A. 1987. Nuclear

migration and mitochondrial inheritance in the mushroom

Agaricus bitorquis. Genetics 119:35-41.

Hocart, M. J. and Peberdy, J. F. 1990. Protoplasts and the

improvement of fungi used in biological control. Li:

Biotechnology of Fungi for Improving Plant Growth (eds.

Whipps, J. M. and Lumsden, R. D.)，pp. 235-258. Cambridge

University Press: Cambridge.

Hudspeth, M. E. S. 1992. The fungal mitochondrial genome - a broader

prospective. Jn: Applied Mycology. Vol 4. Fungal Biotechnology

(eds. Arora, D. K.，Lander, R. P. E. and Mukeri, K. G), pp. 213-

242. Marcel Dekker Lic: New York, Basel and Hong Kong.

78

References

Jin, T.，Sonnemberg, A. S. M., Van Griensven, L. J. L. D. and Horgen,

P. A. 1992. Investigation of mitochondrial transmission in

selected matings between homokaryons from commercial and

wild-collected isolates of Agaricus bisporus {=Agaricus

bmnnescens). Applied and Environmental Microbiology 58(11):

3553-3560.

Kafer, E. 1977. Meiotic and mitotic recombination in Aspergillus and

its chromosomal aberrations. Advances in Genetics 19: 33-131.

Kerrigan, R. W. and Ross, L K. 1989. Allozymes of a wild Agaricus

bisporus population: new alleles, new genotypes. Mycologia 81:

433-443.

Kerrigan, R. W., Royer, J. C., Baller, L. M., Kohli, Y., Horgen, P. A.

and Anderson, J. B. 1992. Meiotic behavior and linkage

relationship in the secondarily homothallic fungus Agaricus

bisporus. Genetics 133: 225-236.

Khush, R. S.，Becker, E. and Wach, M. 1992. DNA amplification

polymorphisms of the cultivated mushroom Agaricus bisporus.

Applied and Environmental Microbiology: 2971-2977.

Kitamoto, Y.，Mori, N.，Yamamoto, M., Phiwa, T. and Ichikawa, Y.

1988. A simple method for protoplast formation and improvement

of regeneration from various fungi using an enzyme from

79

References

Trichoderma reesei. Journal of General Microbiology 131: 1339-

1347.

Kohli, J. 1987. Genetic nomenclature and gene list ofthe fission yeast

Schizosaccharomyces pombe L. Current Genetics 11: 575-590.

KuUcami, R. K. 1991. DNA polymorphisms in Lentinula edodes, the

shiitake mushroom. Applied and Environmental Microbiology 57:

1735-1739.

Kwan, H. S., Chiu, S. W., Pang, K. M. and Cheng，S. C. 1992. Strain

typing in Lentinula edodes by polymerase chain reaction.

ExperimentalMycology 16: 163-166.

Kwok, S. and Sninsky, J. J. 1989. Application ofPCR to the detection

ofhuman infectious disease. In: PCR Technology: Principles and

Applications for DNA Amplification (ed. Erlich, H. A.)，pp. 235-

250. Stockton University Press: New York.

Lau, W. C., Dhillon, E. K. S. and Chang, S. T. 1985. Isolation and

reversion of protoplasts of Pleurotus sajor-caju. MIRCEN

Journal 1: 345-353.

Lee，S. B. and Taylor, J. W. 1993. Uniparental inheritance and

replacement of mitochondrial DNA in Neurospora tetrasperma.

Genetics 134(4): 1063-1075.

80

References

Li, A. and Horgan, P. A. 1993. Evidence for cytogine methylation in

ribosomal RNA genes and in a family of dispersed repetitive

DNA elements in Agaricus bisporus and selected Agaricus

species. Experimental Mycology 17: 356-361.

Li, G. S. F. 1977. Cytological and Genetical Analysis on the Life

Cycle of Volvariella volvacea. M Phil, thesis. The Chinese

University ofHong Kong: Hong Kong.

Li, S. F. and Chang, S. T. 1978. Variation in the homothallic

basidiomycete, Volvariella volvacea. Mushroom Science 10: 171-

184.

Li, S. X. 1991. Genetical and Cytological Studies on Variations of

Volvariella volvacea. Ph.D thesis. The Chinese University of

Hong Kong: Hong Kong.

Marota, R., Colin, Y., Goursot, R. and Bemadi, G. 1982. A region of

extreme instability in the mitochondrial genome of yeast. EMBO

Journal 1: 529-534.

May, B. and Royse, D. J. 1981. Applications of the electrophoretic

methodology to the elucidation of genetic life histories of edible

mushrooms. Mushroom Science 11: 799-817.

Meinecke, G. 1960. Protoplasts from Penicillium glaucum. Nature,

London 188: 246.

81

References

Mendoza, C. G., Avellan, M. A., Sanchez，E. and Novaes-Ledieu, M.

1987. Differentiation and wall chemistry of Agaricus bisporus

vegetative and aggregated mycelia. Archives ofMicrobiology 148:

68-71.

Miles, P. G. 1991. Biological background for mushroom breeding. In:

Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T.,

Buswell, J. A. and Miles, P. G.), pp.37-63. Gordon and Breach

Sci. Pub: Philadelphia.

Miles, P. G. and Chang, S. T. 1986. Application of biotechnology in

strain selection and development of edible mushrooms. ASEAN

Food Journal 2: 3-10.

Moore, D. 1975. Production of Coprinus protoplasts by use of

chitinase and helicase. Transactions of the British Mycological

Society 65: 134-136.

Mullis, K. B., Faloona, F. A.，Scharf, S.，Saiki, R., Hom, G. and

Erlich, H. 1986. Specific enzymatic amplification of DNA in

vitro: the polymerase chain reaction. Cold Spring Harbor

Symposium on Quantitive Biology 51: 263-273.

Mullis K. B. and Faloona F. A. 1987. Specific synthesis of DNA in

vitro via a polymerase catalysed chain reaction. Methods in

Enzymology 155: 335-350.

82

References

Myers, C., Griffiths, A. F. J. and Bertrand, H. 1989. Linear Kalio DNA

is a Neurospora mitochondrial plasmid that integrate into the

mitochondrial DNA. Molecular and General Genetics 220: 113-

120.

Nga, B. H. and Roper, J. A. 1968. Quantitative intrachromosomal

changes arising at mitosis in Aspergillus nidulans. Genetics 58:

193-209.

Ochman, H., Medhora，M.，Garza, D. and Hartl, D. L. 1990.

Amplification of flanking sequences by inverse PCR. Li: PCR

Protocols (eds. Innis, M.，Gelfand，D.，Sninsky, J. and White, T.),

pp. 219-227. Academic Press: New York.

Orbach, M. J., Volkath, D., Davis, R. W. and Yanofsky, C. 1988. An

electrophoretic karyotype of Neurospora crassa. Molecular and

CellularBiology%: 1469-1473.

Papa, K. E. 1977. The parasexual cycle in Aspergillus parasiticus.

Mycologia 70: 766-773.

Peberdy, J. F. 1985. Mycolytic enzymes. In: Fungal protoplasts (eds.

Peberdy, J. F. and Ferenczy, L.)，pp. 31-44. Marcel Dekker: New

York.

83

References

Peberdy, J. F. 1989. Fungi without coats-protoplasts as tools for

mycological research. Mycological Research 93: 1-20.

Peberdy, J. F. 1991. Fungal protoplast. Jn: More Gene Manipulations

in Fungi (eds. Bennett, J. W. and Lasure，L. A.), Academic

Press: San Diego.

Peberdy, J. F. 1995. Fungal protoplasts. In: The Mycota: Genetics and

Biotechnology (eds. Esser, K. and Lemke, P. A.)，pp. 49-60.

Spring Verlag: Berlin, Heideberg.

Peberdy, J. F. and Fox, H. M. 1991. Protoplast technology and edible

mushrooms, bi: Genetics and Breeding of Edible Mushrooms

(eds. Chang, S. T., Miles, P. G. and Buswell, J. A.)，pp. 125-155.

Gordon & Breach Sci. Pub: Philadelphia.

Plummer, K. M. and Howlett, B. J. 1993. Major chromosome length

polymorphisms are evident after meiosis in the phytopathogenic

fungus Leptosphaeria maculans. Current Genetics 24: 107-113.

Pukkila, P. J. 1992. Methods of genetic manipulation in Coprinus

cinereus. Li: Genetics and Breeding of Edible Mushrooms (eds.

Chang, S. T.，Miles，P. G. and Buswell, J. A.)，pp. 249-264.

Gordon & Breach Sci. Pub: Philadelphia.

Quaye, J. R. 1986. Evidence for haploidy of the basidiospores of

Volvariella volvacea from gamma radiation studies. Mushroom

Journal for the Tropics 7: 39-44.

84

References

Rafalski, J. A. and Tingey, S. V. 1993. Genetic diagnostics in plant

breeding: RAPDs, microsatellites and machines. Trends in

Genetics 9: 275-280.

Raper, C. A. 1976. Sexuality and life cycle ofthe edible WiXAAgaricus

bitorquis. Journal of General Microbiology 95: 54-66.

Raper, J. R. 1966. Genetics of Sexuality in Higher Fungi. Ronald

Press: New York.

Raper, J. R. and Raper, C. A. 1972. Life cycle and prospects for

interstrain breeding in Agaricus bisporus. Mushroom Biology 8:

1-9.

Royse, D. J. and May, B. 1992. Multilocus enzyme electrophoresis for

the genetic analysis of edible mushrooms. Hi: Genetics and

Breeding of Edible Mushrooms (eds. Chang, S. T., Miles, P. G.

and Buswell, J. A.)，pp. 225-247. Gordon & Breach Sci. Pub:

Philadelphia.

Royse, D. J., Jodon, M. H.，Antonio, G. G. and May, A. P. 1987.

Confirmation of intraspecific crossing and single and joint

segregation of biochemical loci of Volvariella volvacea.

ExperimentalMycology 11: 11-18.

85

References

Santiago, C. M. 1982. Production of Volvariella protoplasts by use of

Trichoderma enzyme. Mushroom Newsletter for the Tropics 3: 3-

6.

Selitremiikoff, C. P. and Bloomfield, E. C. 1984. Formation and

regeneration of protoplasts of wild-type Neurospora crassa.

CurrentMicrobiology 11: 113-118.

Smith, C. L.，Matsumoto, T.，Niwa, O.，Klco, S., Fan, J. B., Yanagida,

M. and Canter, C. R. 1987. An electrophoretic karyotype for

Schizosaccharomyces pombe strain by pulse field gel

electrophoresis. NucleicAcids Research 15: 4481-4488.

Smith, D. A. 1974. Unstable diploids of Neurospora amd a model for

their somatic behaviour. Genetics 76: 1-17.

Smith, M. L. and Anderson, J. B. 1994. Mitochondrial DNAs of the

fungus Armillaria ostoyae.. restriction map and length variation.

Current Genetics 25: 545-553.

Sonnerberg, A. S., Wessels, J. G. H. and Van Griensven, L. J. 1988.

An efficient protoplastingA*egeneraton system for Agaricus

bisporus and Agaricus bitorquis. Current Microbiology 17: 285-

291.

86

M^Bl^M—^^^^M——M^M^—^H^—^—^^^——lWMfM—l———M,_"MiWiff___iii_i_,w___/i rii,i_ _•__••__

References

Southern, E. M. 1975. Detection of specific sequences among DNA

fragements seperated by gel electrophoresis. Journal ofMolecular

Biology 98: 503-517.

Spear, M. C.，Royse, D. J. and May, B. 1983. Atypical meiosis and

segregation ofbiochemical loci mAgaricus brunnescens. Journal

ofHeredity 74: 417-420.

Tamova, G.，Betina, V. and Farkas, V. 1993. An efficient method for

producing protoplasts from Trichoderma virude. Folia

Microbiology 38: 214-218.

Tanaka, R. and Koga, I. 1972. Karyological studies on Lentinus

edodes, a basidiomycete. Janpanese Journal ofBotany 47: 289-

296.

Vickery, D. B. and Griffiths, A. J. F. 1993. Transcription ofthe kalio

linear senescence plasmid from Neurospora intermadia. Plasmid

29(3): 180-192.

Walz, M. 1995. Electrophoretic karyotyping. Li: The Mycota: Genetics

and Biotechnology (eds. Esser, K. and Lemke, P. A.)，pp. 61-73.

Spring-Verlag: Berlin Heideberg.

Wang, C. W. 1982. Cellulolytic enzymes of Volvariella volvacea. In:

Tropical Mushrooms: Biological Nature and Cultivation Methods

87

References

(eds. Chang, S. T. and Quimio, T. H.), pp. 167-186. The Chinese

University Press: Hong Kong.

Wang, Z. S., Liao, J. H., Li, F. G. and Wang, H. C. 1991. Studies on

genetic basis ofesterase isozyme loci Est A, B, and C mAgaricus

bisporus. Mushroom Science 13，3-9.

Welsh, J. and McClelland, M. 1990. Fingerprinting genomes using

PCR with arbitrary primers. Nucleic Acids Research 18: 7213-

7218.

Welsh, J.，Liu, J. P. and Efstratiadis, A. 1990. Cloning of PCR-

amplified total cDNA: construction of a mouse oocyte cDNA

library. GeneticAnalysis: Techniques andApplications 7: 5-17.

White, T. J., Bruns, T., Lee，S. and Taylor, R J. 1989. Amplification

and direct sequencing of fungal ribosomal RNA genes for

phylogenetics. Jn: PCR Protocols (eds. Innis, M., Gelfand, D.,

Sninsky, J. and White, T.), pp. 315-322. Academic Press: New

York.

Whittaker, S. L., Assinder, S. L. and Shaw, D. S. 1994. Inheritance of

mitochondrial DNA in Phytophthora infestans. Mycological

Research 98: 569-575.

Williams, J. G. K., Kubelik, A. R., Livak, K. L., Rafalski, J. A. and

Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary

88

iimillilllililMlillll I lll_l lllMlM^MII

References

primers are useful as genetic markers. Nucleic Acids Research 18:

6531-6535.

Wood, D. A. 1984. Microbial process in mushroom cultivation: a large

scale solid substrate fermentation. Journal of Chemical

Technology and Biotechnology 34B: 232-240.

Wood, D. A. and Fermor, T. R. 1982. Nutrition of Agaricus bisporus

in compost. The Mushroom Journal 114: 194-197.

Wyss, P. and Bonfante, P. 1993. Amplification of genomic DNA of

arbuscular-mycorrhizal (AM) fungi by PCR using short arbitrary

primers. Mycological Research 97: 1351-1357.

Yanagi, S. 0., Monma, M.，Kawasumi, T., Hino, A., Kito, M. and

Takebe, L 1985. Conditions for isolation of and colony formation

by mycelial protoplasts of Coprinus macrorhizus. Agricultural

and Biological Chemistry 49: 171-179.

Yang, X. and Griffiths, A. J. F. 1993. Male transmission of linear

plasmids and mitochondrial DNA in the fungus Neurospora.

Genetics 134(4): 1055-1062.

Yau, C. K. and Chang, S. T. 1972. Cotton waste for indoor cultivation

of straw mushroom. World Crops 24: 302-303.

89

^ BHI H ^ ^ HHII ^ ^ ^ ^ ^ ^ ^ ^ ^ IBHI ^ ^ ^ H HHBI ^ HI H ^ HHI HHIH ^ ^ B HasamMmnwrafl rasKii n tffnneftan Ki

References

Yu, M. Y. and Chang, S. T. 1987. Effects of osmotic stabilizer on the

activities of mycolytic enzymes used in fungal protoplast

liberation. MIRCENJournal 3: 161-167.

Zhao, J. and Chang, S. T. 1993. Monokaryotization by protoplasting

heterothallic species of edible mushrooms. World Journal of

Microbiology and Biotechnology 9: 538-543.

90

I M MM BM ^ M B — — —l — — B ^ ———nmMi—MnMMimmmihi_i_i__i"ii_TrmimmnrrnKinm_ii_"_•••_

CUHK L i b r a r i e s

_ _ l l l l _ l : 0D3SflT37^