-
lable at ScienceDirect
Food Control 38 (2014) 116e123
Contents lists avai
Food Control
journal homepage: www.elsevier .com/locate/ foodcont
A barcode for the authentication of the snappers (Lutjanidae)
ofthe western Atlantic: rDNA 5S or mitochondrial COI?
Ivana Veneza a, Bruna Felipe a, Joiciane Oliveira a, Raimundo
Silva a, Iracilda Sampaio b,Horacio Schneider b, Grazielle Gomes
a,b,*a Laboratório de Genética Aplicada, Instituto de Estudos
Costeiros, Universidade Federal do Pará, Campus Universitário de
Bragança,Alameda Leandro Ribeiro s/n, Aldeia, Bragança, Pará,
Brazilb Laboratório de Genética and Biologia Molecular, Instituto
de Estudos Costeiros, Universidade Federal do Pará,Campus
Universitário de Bragança, Brazil
a r t i c l e i n f o
Article history:Received 5 February 2013Received in revised
form8 October 2013Accepted 9 October 2013
Keywords:COIrDNA 5SSnappersBarcodeLutjanids
* Corresponding author. Instituto de Estudos CostePará e
Bragança, Alameda Leandro Ribeiro s/n, AldeiPA, Brazil. Tel.: þ55
091 3425 1593.
E-mail addresses: [email protected], graziell
0956-7135/$ e see front matter � 2013 Elsevier
Ltd.http://dx.doi.org/10.1016/j.foodcont.2013.10.012
a b s t r a c t
The increasing demand for fishery resources in recent years has
stimulated a growth in the output ofprocessed products, which has
made the fraudulent substitution of species a common practice. In
thepresent study two different protocols were evaluated for the
molecular authentication of lutjanid species,one based on the
banding pattern of the nuclear rDNA 5S gene, and the other on the
sequences of themitochondrial Cytochrome Oxidase subunit I (COI)
gene. A total of 132 samples were analyzed fromspecimens identified
previously as belonging to seven lutjanid species (Lutjanus
purpureus, Lutjanussynagris, Lutjanus vivanus, Lutjanus jocu,
Lutjanus analis, Ocyurus chrysurus, and Rhomboplites aurorubens),as
well as unidentified individuals. The results indicate the absence
of a species-specific rDNA 5S bandingpattern in lutjanids. However,
the 1131 bp fragment of the COI gene not only discriminated the
identifiedlutjanid species systematically, but also defined the
species of the unidentified specimens, identifyinganother two
species from the database, Lutjanusbucanella and
Lutjanuscyanopterus. The species wererepresented by well-defined
consensual clades in the phylogenetic trees, supported by the
interspecificdistances and the mutations characteristic of each
species. This segment of the COI gene proved to be arobust tool for
the molecular authentication of lutjanid species.
� 2013 Elsevier Ltd. All rights reserved.
1. Introduction
The trade in fishery products has expanded significantly
inrecent years, with a total worldwide harvest of 154 million tons
in2011, including both wild-caught and farmed produce (FAO,
2012).At the same time, there has been an ever-increasing tendency
forthe diversification of the products being marketed, including
filletsand steaks, smoked fish and canned goods, derived from a
widerange of different fish species.
This growth in trade has been accompanied by an increase in
thefraudulent substitution of more valuable species by inferior
ones(Ward, 2000). In addition to the marked morphological
similaritiesof species of some fish families, such as the
Sciaenidae, Mugilidae,and Lutjanidae (Allen, 1985; Cervigón, 1993;
Cervigón et al., 1993),
iros, Universidade Federal doa, Bragança, CEP: 68.600-000
[email protected] (G. Gomes).
All rights reserved.
processing can remove distinguishing features, and impede
thediagnosis of species recognized solely on the basis of
morphologicaltraits (Carvalho, Neto, Brasil, & Oliveira, 2011;
Céspedes et al., 1999;Filonzi, Chiesa, Vaghi, & Marzano, 2010;
Sales, Rodrigues-Filho,Haimovici, Sampaio, & Schneider, 2011;
Sotelo, Piñeiro, Gallardo,& Pérez-Martín, 1993).
Inadequate product labeling can have serious consequences
interms of public health, as well as having ecological and
economicimplications. In addition to entailing potential risks for
the con-sumer (Van Leeuwen et al., 2009), including financial costs
e asshown by Marko et al. (2004) in the case of the snappers e it
mayimpact management programs designed for the conservation of
thestocks of certain species (Ward, 2000).
The lutjanids fishes known as snappers represent an
importantfishery resource in all the regions where they occur
(Allen, 1985;Cervigón, 1993; Matos-Caraballo, 2000; Mendoza &
Larez, 1996;Prescod, Oxenford, & Taylor, 1996; Zhang & Liu,
2006). These me-dium to large-sized fishes are widely distributed
in the Atlantic,Indian, and Pacific oceans. The family is composed
of approximately108 species distributed among 17 genera, organized
in four
Delta:1_given nameDelta:1_surnameDelta:1_given
nameDelta:1_surnameDelta:1_given nameDelta:1_surnameDelta:1_given
namemailto:[email protected]:[email protected]://crossmark.crossref.org/dialog/?doi=10.1016/j.foodcont.2013.10.012&domain=pdfwww.sciencedirect.com/science/journal/09567135http://www.elsevier.com/locate/foodconthttp://dx.doi.org/10.1016/j.foodcont.2013.10.012http://dx.doi.org/10.1016/j.foodcont.2013.10.012http://dx.doi.org/10.1016/j.foodcont.2013.10.012
-
I. Veneza et al. / Food Control 38 (2014) 116e123 117
subfamilies, the Etelinae, Apsilinae, Paradicichthyinae, and
Lutja-ninae (Allen, 1985; Cervigón, 1993; Froese & Pauly, 2012;
Moura &Lindeman, 2007; Nelson, 2006).
Many lutjanids, such as the red snappers (Lutjanus vivanus,
L.purpureus, L. campechanus, L. bucanella, and L. peru), are
highlysimilar morphologically (Cervigón, 1993; Cervigón et al.,
1993;Nelson, 2006) and are difficult to identify reliably based
onexternal characteristics. This problem is exacerbated by the
in-dustrial processing of catches, which typically involves the
removalof the fillets.
Based on the analysis of a fragment of the mitochondrial
Cyto-chrome b gene, Marko et al. (2004) discovered that
approximately80% of the fillets sold in the United States as red
snapper(L. campechanus) were actually derived from other lutjanid
species,presumably as a result of errors in the identification of
specimensduring the production process and/or the intentional
substitutionwith less popular and/or cheaper species.
Molecular studies based on nucleotide sequences havebecome
increasingly popular for the identification of fishes and/or
fishery products (Brown et al., 1996; Carrera et al., 2000;
Chiu,Su, Pai, & Chang, 2012; De Salle & Birstein, 1996;
Filonzi et al.,2010; Mackie et al., 1999; Rasmussen &
Morrissey, 2008; Wen,Hu, Zhang, & Fan, 2011). One genomic
region that has beenused successfully for molecular diagnosis is
the CytochromeOxidase subunit I (COI) gene, which is considered to
be a “bio-logical barcode” (Hebert, Cywinska, Ball, & de Waard,
2003). Anumber of studies have demonstrated the usefulness of
differentfragments of this gene for the identification of fish
species andthe products derived from them (Carvalho, Neto, et al.,
2011;Carvalho, Oliveira, et al., 2011; Filonzi et al., 2010;
Haye,Segovia, Vera, Gallardo, & Gallardo-Escárate, 2012;
Rasmussen,Morrissey, & Hebert, 2009; Silva-Oliveira et al.,
2011; Ward,Zemlak, Innes, Last, & Hebert, 2005; Yang, Huang,
Hsieh, Huang,& Chen, 2012).
In addition to DNA sequences, a number of alternatives havebeen
tested, based on faster and more practicable approaches,which allow
for the analysis of PCR (Polymerase Chain Reaction)products
directly in agarose gels (see Rodrigues-Filho et al., 2010),such as
the banding pattern provided by the amplification of therDNA 5S
gene. This marker is a multigenic family composed ofrepeated units
in a conserved coding region with approximately120 base pairs
arranged in tandem, separated by non-transcribedspacers (NTS) of
variable length (Alves-Costa et al., 2008; Martins& Wasko,
2004; Pinhal et al., 2008; Rodrigues-Filho et al., 2010;Wasko,
Martins, Wright, & Galetti, 2001). This arrangement pro-duces a
unique banding pattern which is species-specific in many
Table 1List of the taxa analyzed in the present study, their
common names, codes and the num
Family Species Common name
Lutjanidae Lutjanus purpureus Southern red snapperLutjanus
synagris Lane snapperLutjanus jocu Dog snapperLutjanus analis
Mutton snapperLutjanus vivanus Silk snapperRhomboplites aurorubens
Vermellion snapperOcyurus chrysurus Yellowtail snapperIdentified
SnapperUnidentified Snapper
Haemulidae Conodon nobilis Barred grutGenyatremus luteus Torroto
grunt
Scombridae Scomberomorus brasiliensis Serra Spanish
mackereSciaenidae Cynoscion sp. WeakfishCentropomidae Centropomus
undecimalis Common snook
cases (see Céspedes et al., 1999; Rodrigues-Filho et al., 2010;
Saleset al., 2011).
Given the marked morphological similarities among thedifferent
lutjanid species and the fact that snappers are typicallymarketed
in fillet form, which facilitates the illicit substitution
ofspecies, an effective molecular species identification
protocolwhich is both fast and inexpensive is urgently needed. In
anattempt to provide an appropriate approach to this problem,
thepresent study evaluated two different molecular methods e
onebased on the banding patterns of the amplified rDNA 5S
generesolved on an agarose gel, and the other, a more
conventionalapproach, which has been shown to be effective in
snappers (seeVictor, Hanner, Shivji, Hyde, & Caldow, 2009),
based on the analysisof the sequences of a fragment of the
mitochondrial COI gene. Thiscomparative analysis will provide an
initial step towards thedevelopment of rapid and low-cost molecular
protocols that pro-vide an unambiguous identification of snapper
species.
2. Material and methods
2.1. Samples
A total of 132 lutjanid specimens (Table 1) were analyzed in
thepresent study. The samples were obtained from the
Lutjanidaetissue bank held by the Applied Genetics Laboratory at
the CoastalStudies Institute of the Federal University of Pará in
Bragança,Brazil. In all, 37 of the specimens had been identified
previously(Allen, 1985; Cervigón, 1993; Cervigón et al., 1993;
Menezes &Figueiredo, 1980), representing seven species,
belonging to threegenera e Lutjanus (L. purpureus, L. synagris, L.
jocu, L. analis, andL. vivanus), and the monotypic Rhomboplites
aurorubens andOcyurus chrysurus. The remaining 95 specimens, which
werecollected at a number of different locations around the
Braziliancoast, were considered to be “unidentified snappers” or
UISs forthis analysis. A number of additional specimens were
included inthe analysis to provide a comparative perspective of
rDNA 5Sbanding patterns at the family level. These specimens
include threeindividuals representing two haemulidae species
(Conodon nobilisand Genyatremus luteus), a scombridae
(Scomberomorus brasi-liensis), a centropomidae (Centropomus
undecimalis), and a sciae-nidae, Cynoscion sp. (Table 1).
The approach adopted here was to use the specimens
identifiedaccording to their morphological traits as models for the
identifi-cation of all the other samples, based on both the
amplification ofthe rDNA 5S/NTS gene and the sequencing of the COI
gene. Inaddition to evaluating the different molecular procedures
for the
ber of samples used for the analysis of each genomic region.
Code Samples used for 5S Samples used for COI
Lpu 3 6Lsy 3 8Ljo 3 5Lan 3 5Lvi 3 3Rau 3 3Och 3 7
37UIS 15 95TOTAL 36 132Cno 1 2Glu 1 1
l Sbr 1Csp 1Cun 1TOTAL 41 135
-
I. Veneza et al. / Food Control 38 (2014) 116e123118
identification of species, it was possible to recognize certain
in-consistencies in the original identification of the specimens,
whichwas based on morphological traits.
2.2. Isolation, amplification, and sequencing of the genetic
material
The genetic material was isolated following the protocol
ofSambrook and Russell (2001). The genomic regions (rDNA 5S andCOI)
were amplified by Polymerase Chain Reaction (PCR) in a finalvolume
of 25 ml, containing 4 ml of dNTP (1.25 mM), 2.5 ml of 10�buffer, 1
ml of MgCl2 (50 mM), 1 ml of each primer (50 ng/mL),approximately
100 ng of the total DNA, 0.2 ml of Taq DNA poly-merase (5 U/mL)
(Invitrogen, Carlsbad, CA, USA), and purified waterto complete the
final reaction volume.
The primers used to amplify the rDNA 5S gene were 5SA
(50-TACGCCCGATCTCGTCCGATC-30) and 5SB
(50-CAGGCTGGTATGGCCGTAAGC-30), as used by Sales et al. (2011), with
the followingamplification conditions: initial denaturation at 95
�C for 4 min,followed by 35 cycles of 20 s at 95 �C, 50 s at 55 �C,
and 30 s at 72 �C,and final extension of 7 min a 72 �C.
The COI gene was amplified using the primers FishF1, FishF2(Ward
et al., 2005), COIF and COIA (Palumbi & Benzie, 1991)(Table 2),
thus permitting the analysis of a fragment of 1131 bp forall
species of Lutjanidae and Haemulidae. For each individual, weretwo
reactions of PCR, first to amplify a fragment of about 550
bp,located in second portion of COI, using the primes described
byPalumbi and Benzie (1991) (COIF and COIA), and then, a fragment
ofapproximately 1200 bp, including the barcode region, with
FishF1or FishF2 (Ward et al., 2005) and COI A (Palumbi &
Benzie, 1991).The primers used for the sequencing were FishF1 or
FishF2 andCOIF (Table 2).
The amplification conditions were: initial denaturation at 94
�Cfor 3 or 5 min, followed by 35 cycles of 30 or 40 s at 94 �C, 40
s or1min at 53 �Ce56.2 �C (Table 2), and 45 s or 2min at 72 �C, and
finalextension of 10 min a 72 �C. The positive PCRs were
sequencedusing the dideoxy-terminal method (Sanger, Nichlen, &
Coulson,1977), with Big Dye kit reagents (ABI Prism� Dye
Terminator
Table 2Primers used to amplify the fragment of COI gene (1131
bp) for each species ofLutjanidae and Haemulidae, with the
respective hybridization temperature.
Species Combination of primers Hybridization(�C)
Lutjanussynagris
COIF-50CCTGCAGGAGGAGGAGAYCC30b,c
COIA-50AGTATAAGCGTCTGGGTAGTC30b
FishF1-50TCAACCAACCACAAAGACATTGGCAC30a,c
COIA-50AGTATAAGCGTCTGGGTAGTC30b
53.8
Lutjanusjocu
53.8
Ocyuruschrysurus
53.8
Lutjanuscyanopterus
53.8
Lutjanusanalis
56.2
Conodonnobilis
53,8
Genyatremusluteus
55
Lutjanuspurpureus
COIF-50CCTGCAGGAGGAGGAGAYCC30b,c
COIA-50AGTATAAGCGTCTGGGTAGTC30b
FishF2-50TCGACTAATCATAAAGATATCGGCAC30a,c
COIA-50AGTATAAGCGTCTGGGTAGTC30b
55
Lutjanusvivanus
55
Lutjanusbuccanella
55
Rhomboplitesaurorubens
55
a Ward et al. (2005).b Palumbi and Benzie (1991).c Primers used
for sequencing.
Cycle Sequencing Reading Reaction e PE Applied Biosystems).
Theprecipitated product was electrophoresed in an automatic
capillarysequencer, model ABI 3500 xl (Applied Biosystems).
2.3. Analyses
2.3.1. Banding pattern e rDNA 5S/NTSThree specimens were
selected from each of the seven lutjanid
species analyzed in the present study for the evaluation of
intra-specific variation (Table 1), together with a number of the
un-identified specimens (UISs). Two separate batteries of PCRs
wereconducted. One included a single representative of each
lutjanidspecies together with the specimens representing other
perciformfamilies (Haemulidae, Scombridae, Centropomidae, and
Sciaeni-dae), in an attempt to confirm species- or genus-specific
bandingpatterns, or a pattern that is characteristic of the
lutjanids. In thesecond battery, a number of different individuals
of each specieswere included, together with the UISs.
The positive PCRs were submitted to further submarine
elec-trophoresis, this time in concentrated (2%) agarose gel
stained withethidium bromide, together with a ladder (DirectLoad�
50 bp StepLadder, containing 17 fragments) whichwas used as ametric
for themeasurement of the observed bands. The electrophoretic run
lastedan hour and a half with a current of approximately 70 V. The
gel wassubsequently viewed under ultraviolet light in a
transilluminatorand photographed for analysis.
2.3.2. The mitochondrial COI geneThe sequences obtained for the
COI gene were aligned manually
using the BIOEDIT program (Hall, 1999). For the identification
ofindividuals and species we created two databases, a reduced
bankwith the 600 bp barcode region of all previously identified
Lutja-nidae specimens and a total bank of all the 132 analyzed
snapperswith the 1131 bp of COI. For the reduced dataset, we
included onerepresentative of each previously identified lutjanid
(initially sevenindividuals), obtained from the BOLD platform
(Barcode of LifeDatabase) (Database available in
www.boldsystems.org), Rhombo-plites aurorubens e ANGBF7605-12;
Ocyurus chrysurus eANGBF7608-12; Lutjanus synagris e ANGBF7611-12;
L. purpureus eDOACS017-08; L. vivanus e ANGBF7609-12; L. jocu e
ANGBF7613-12; L. analis e ANGBF7686-12.
The data were fed into the DnaSP v 5 program (Librado &
Rozas,2009) to generate a list of haplotypes, which were used as
abenchmark for the taxonomic identification of the samples.
Phylogenetic trees were constructed using the
Neighbor-Joining(NJ) and Maximum Likelihood (ML) approaches. The NJ
trees wereproduced in MEGA 5.0 (Tamura et al., 2011), using the K2P
evolu-tionary model (Kimura, 1980), which is normally used for
thismolecular marker (Hubert et al., 2008; Rasmussen et al.,
2009;Victor et al., 2009; Ward et al., 2005). The ML trees were
gener-ated by the PHYML 3.0 program (Guindon & Gascuel, 2003),
usingthe evolutionary model suggested by JMODELTEST 0.1.1
(Posada,2008). The significance of the observed groupings was
estimatedby bootstrap analysis, based on 1000 pseudoreplicates. The
se-quences of the species Conodon nobilis and Genyatremus
luteus(Haemulidae) were used as the outgroup.
Intra and interspecific genetic divergence was evaluated
usingthe K2P (Kimura, 1980) distances obtained fromMEGA 5.0
(Tamuraet al., 2011). Preliminary analyses (list of haplotypes and
phyloge-netic trees) permitted the allocation of individuals to
differentgroups corresponding to each lutjanid species, including
the UISs.Some of the UISs were not allocated to any established
group,formed distinct groups. Overall, a total of 10 groups were
identified,including the seven lutjanid species (L. purpureus, L.
vivanus,L. synagris, L. analis, L. jocu, R. aurorubens, and O.
chrysurus), two
http://www.boldsystems.org
-
I. Veneza et al. / Food Control 38 (2014) 116e123 119
others, designated UIS1 and UIS2, as well as the representatives
ofthe outgroup (Haemulidae). The pattern of interspecific
geneticdistances was supported by the polymorphic sites,
demonstratingthe mutations that separate the different species,
observed inMEGA 5.0 (Tamura et al., 2011).
In addition to the analyses performed, the “barcode” sequencesof
all specimens were submitted to NCBI/BLAST (Basic LocalAlignment
Search Tool) to confirm identification. This allowed
theidentification of individuals UIS 1 and UIS 2 to the species
level,with respective representatives later included in the
reduceddataset (Lutjanus cyanopterus e ANGBF7616-12; Lutjanus
bucanellae ANGBF7617-12).
3. Results
3.1. rDNA 5S/NTS gene
The amplification of the rDNA 5S/NTS gene in the seven
lutjanidspecies resulted in bands of different sizes for the
majority of theindividuals (Fig. 1), which included intraspecific
differences and alack of any clear species- or genus-specific
pattern. In addition,many individuals assigned to different species
shared the samebanding pattern (Fig. 2). Most of the lutjanids,
including the un-identified specimens, presented two bands, one of
which (ofapproximately 200 bp) was shared by all individuals, while
theothere of around 450 bpewas observed in all the different
species(Figs. 1 and 2).
Overall, four distinct banding patterns were identified (Figs.
1and 2) e (a) a single band of approximately 200 bp, which
isdenominated here as the “lutjanid family band”, (b) a double
band,including the lutjanid family band and a second band of
approxi-mately 450 bp, (c) a triple band, including the two bands
in (b) plusa third band of approximately 600 bp, and (d) a triple
band as (c),but with a third sequence of only 300 bp instead of 600
bp.
Comparing bands among different families, it was not possibleto
identify a band that is unique to the Lutjanidae, given that
eventhe 200 bp band identified as the “lutjanid family band”was in
factfound in the common snook, Centropomus undecimalis. However,
itwas possible to differentiate the lutjanids from the haemulidae
andsciaenidae. Even so, the diagnosis of the family based on
thismarker was inconclusive.
3.2. Mitochondrial COI gene
A 1131 bp fragment of the COI gene was obtained from
thespecimens of the seven lutjanid species, as well as the
unidentifiedspecimens and three haemulidae specimens, which were
used asthe outgroup, resulting in a total of 135 sequences
(GenbankAccession Number: KF633260eKF633393; KF646804). The
132lutjanids presented 880 conserved and 251 polymorphic sites.
Fig. 1. Image of the 2% agarose gel, showing the products of the
amplification of the rDNaurorubens (Rau); Lutjanus purpureus (Lpu);
Lutjanus vivanus (Lvi); Lutjanus synagris (Lsy); Luhaemulidae:
Conodon nobilis (Cno); Genyatremus luteus (Glu); (3) one
scombridae: Scombercentropomidae: Centropomus undecimalis (Cun). L
(DNA Ladder- DirectLoad� Step Ladder,
Two databases were used for analysis, one containing all
135samples, with 132 Lutjanidae and three Haemulidae (1131 bp)
andthe other, only the samples for the seven identified species (n¼
37),together with the specimens UIS1 and UIS2 (n ¼ 3) and
specimensfrom the BOLD platform (n ¼ 9), resulting in a total of 52
sequences(49 Lutjanidae and 3 Haemulidae) with a 600 bp barcode
fragment.
A total of 52 haplotypes were identified in the 132
lutjanidsamples, of which the most common were those of the
speciesL. synagris and O. chrysurus, shared by 38 and nine
specimens,respectively. L. analis, O. chrysurus and L. jocu
presented the largestnumber of haplotypes (21, eight and six,
respectively), while allother species were represented by only one
or a few haplotypes.The majority of the unidentified specimens had
haplotypes typicalof one of the seven lutjanid species sampled.
The trees generated using the different methods (ML and
NJ)produced exactly the same topology, so only the NJ tree is
pre-sented here, although the ML bootstrap values are shown in
theFig. 3. The lutjanid species form well-supported consensual
cladesin both trees, which are well differentiated from the
outgroup(Fig. 3A and B). All of the unidentified specimens were
allocated toone of the seven species clades except for four
individuals (speci-mens UIS1 and UIS2) (Fig. 3A). However, with the
barcode fragmentit was possible to identify them as L. bucanella
(UIS 1) andL. cyanopterus (UIS 2), and to confirm the identify of
all specimensthat had a prior identification (Fig. 3B).
Of the 95 UISs, 10 were identified as L. vivanus, 11 as O.
chrysurus,32 as L. synagris, 24 as L. analis, one as L. purpureus,
14 as L. jocu, twowere allocated to UIS1 (L. bucanella) and one to
UIS2(L. cyanopterus). Species-specific mutations were found in
thepolymorphic sites representing all the species throughout
thefragment of 1131 bp, however, due to the high number of
poly-morphic sites, only those observed in the barcode fragment
areshown in Fig. 4
The mean genetic distance (K2P) between the lujanids and
theoutgroup for the 1.1 kb fragment varied from 18.2% for R.
aurorubensand Haemulidae to 19.9% for L. cyanopterus and
Haemulidae.Within the lutjanids, interspecific distances ranged
from 3.1% (for L.purpureus vs. L. vivanus) to 12.7% (for R.
aurorubens vs. L. cya-nopterus), although L. cyanopterus was the
most divergent overall.Distances between genera varied from 6.6% to
11.4% for Ocyurus vs.Lutjanus, and 5.6%e12.7% for Rhomboplites vs.
Lutjanus (Table 3).Mean divergence within species does not exceed
0.5% in any case.
4. Discussion
4.1. rDNA 5S bands or COI sequences?
The amplified products of the rDNA 5S gene did not provide
aclear banding pattern capable of differentiating the lutjanid
speciesanalyzed in the present study. In addition to the
observed
A 5S/NTS gene. In (1) nine lutjanidae species: Ocyurus chrysurus
(Och); Rhomboplitestjanus analis (Lan); Lutjanus jocu (Ljo);
Unidentified Snappers (UIS) 68 and 44; (2) twoomorus brasiliensis
(Sbr); (4) one sciaenidae of the genus Cynoscion (Csp); and (5)
one50 bps, containing 17 fragments).
-
Fig. 2. Image of the 2% agarose gel, showing the products of the
amplification of the rDNA 5S/NTS gene demonstrating the pattern of
intraspecific variation. Ocyurus chrysurus(Och); Rhomboplites
aurorubens (Rau); Lutjanus purpureus (Lpu); Lutjanus vivanus (Lvi);
Lutjanus synagris (Lsy); Lutjanus analis (Lan) and Lutjanus jocu
(Ljo), as well as UnidentifiedSnappers (UIS). L (DNA Ladder-
DirectLoad� Step Ladder, 50 bps, containing 17 fragments).
I. Veneza et al. / Food Control 38 (2014) 116e123120
intraspecific variation, the same banding pattern was recorded
indifferent species, a situation also found in fishes such as
mullets(Mugilidae). However, whereas equivalent banding patterns
wereobserved in some mullet species, i.e., Mugil cephalus, M. liza,
and
Fig. 3. Phylogenetic Neighbor-Joining trees for the fragment of
the Cytochrome Oxidase sub(1131 bp) (A) and a subset for only the
barcode region (600 bp) containing only the identified(B). The
numbers above the nodes correspond to the bootstrap values for the
Neighbor Joi
M. platanus, others e M. hospes, M. incilis, M. sp. and M.
curema ewere differentiated (Rodrigues-Filho et al., 2010). In this
case,however, the authors attributed the results to problems with
thetaxonomy of the group, rather than the ineffectiveness of
the
unit I gene for the whole data set, including 132 lutjanids and
the outgroup (hamulids)lutjanids and UIS1 and UIS2 together with
sequences retrieved from the BOLD platformning (left) and Maximum
Likelihood (right) approaches.
-
Fig. 4. The approximately 145 polymorphic sites of the 600 bp of
the barcode Cytochrome Oxidase subunit I (COI) gene sequences
analyzed in the present study, showing themutations that separate
the species. Rau ¼ Rhomboplites aurorubens; Och ¼ Ocyurus
chrysurus; Lpu ¼ Lutjanus purpureus; Ljo ¼ Lutjanus jocu; Lsy ¼
Lutjanus synagris; Lan ¼ Lutjanusanalis; Lvi ¼ Lutjanus vivanus;
Lbu (UIS 1) ¼ Lutjanus bucanella; Lcy (UIS 2) ¼ Lutjanus
cyanopterus.
I. Veneza et al. / Food Control 38 (2014) 116e123 121
marker, as may have occurred in the lutjanids analyzed in
thepresent study.
The discrimination of species using rDNA 5S banding
patternsshould be possible due to differences in the size of the
fragmentsamplified, which are related to variation in the NTSs.
This shouldprovide a distinct banding pattern observable in the
gel, as found inother fishery resources, such as cephalopods (Sales
et al., 2011),salmonids (Pendás, Móran, Martínez, &
Garcia-Vásquez, 1995), andsharks (Pinhal, Gadig, & Martins,
2009). However, many speciespresent fragments of the same size, and
can be distinguished onlyby mutations (base substitutions), as
found in the genus Brycon(Wasko et al., 2001) and members of the
family Sciaenidae (Alves-Costa et al., 2008).
Four distinct banding patterns were observed in the
lutjanids,which may indicate the existence of different classes of
the rDNA5S gene in this family. A similar situation has been
described for anumber of other fishes, such as Salmo salar (Pendás,
Móran,Freije, & Garcia-Vásquez, 1994), Oncorhynchus mykiss
(Móran,Martínez, Garcia-Vásquez, & Pendás, 1996), Oreochromis
niloti-cus (Martins et al., 2002), and the genera Coregonus
(Sajdak,Reed, & Phillips, 1998), Leporinus (Martins &
Galetti, 2001) andBrycon (Wasko et al., 2001). Two different
arrangements of theribosomal 5S gene have been found in sciaenidae
fishes, asshown by Alves-Costa et al. (2008) in Isopisthus
parvipinnis,which suggests that this may be a common arrangement in
this
Table 3Mean genetic distances (k2P) between species (lutjanids
and haemulidse outgroup)considering a 1131-bp fragment of the
Cytochrome Oxidase subunit I (COI) gene.OG ¼ outgroup; Rau ¼ R.
aurorubens; Och ¼ O. chrysurus; Lpu ¼ L. purpureus;Lvi ¼ L.
vivanus; Lsy ¼ L. synagris; Lan ¼ L. analis; Ljo ¼ L. jocu; Lbu ¼
L. bucanella;Lcy ¼ L. cyanopterus.
Nucleotide divergence (%)
1 2 3 4 5 6 7 8 9
1 OG2 Rau 18.23 Och 18.8 8.34 Lpu 18.7 5.6 7.65 Lvi 19.5 6.7 6.6
3.16 Lsy 19.5 6.3 7.6 7.3 7.27 Lan 19 6.5 7.1 6.1 6.7 5.78 Ljo 18.6
11 11 10.9 11.5 10.9 10.49 Lbu 18.9 7.4 7 6.8 6.6 6.2 5.2 11.310
Lcy 19.9 12.7 11.4 11.8 12 11.5 11.1 11.4 12.5
group of vertebrates, hampering molecular identification
usingthis marker.
By contrast, a large number of studies have emphasized
theeffectiveness of the COI gene for the reliable discrimination of
taxa,in both invertebrates (Greenstone et al., 2005; Haye et al.,
2012;Hogg & Hebert, 2004; Silva-Oliveira et al., 2011; Smith,
Woodley,Janzen, Hallwachs, & Hebert, 2006) and vertebrates,
including avariety of fishes, such as teleosts, rays, chimaeras,
and sharks(Ardura, Linde, Moreira, & Garcia-Vazquez, 2010;
Hubert et al.,2008; Ward, Hanner, & Hebert, 2009; Ward et al.,
2005). Many ofthe studies of fishes have focused on the
discrimination ofcommercially-important species, providing an
important tool forthe identification of fraudulent practices in the
fishery trade. Spe-cific cases include Filonzi et al. (2010) study
of Dicentrarchus labrax,Sparus aurata, and Mullus surmuletus,
Barbuto et al. (2010) onMustelus spp., Rasmussen et al. (2009) on
salmon and trout, andcatfish (Siluriformes), studied by Wong et al.
(2011) and Carvalho,Neto, et al. (2011).
The results of the present study have shown that it is possible
toidentify all the lutjanid species using the COI gene, further
rein-forcing the efficiency of this marker as a reliable
bio-identifier. Inaddition to the seven species identified
initially, two other specieswere discriminated using the COI
barcode fragment, resulting in atotal of nine species of Lutjanidae
analysed.
Most COI studies have analyzed a fragment located in the
firsthalf of this gene, which is considered to be a “barcode”
(Hebertet al., 2003; Rock et al., 2008; Ward et al., 2005). The
presentstudy includes an alternative segment, located in the second
half ofthe gene e approximately between nucleotides 770 and 1300
ewhich together with the barcode region produced a fragment
withapproximately 1130 bp.
The arrangement of polymorphic sites in the region of
COIanalyzed here revealed the presence of species-specific
mutationsthroughout the segment, reinforcing its effectiveness for
the dif-ferentiation of species.
The separation of the lutjanids in the phylogenetic trees
wasreinforced by the genetic distances found among species,
whichreflects the interspecific polymorphism mentioned above,
weretypical of those found within and between fish species in
otherstudies. For the divergence between families e Lutjanidae
andHaemulidae (outgroup) e the values found in the present
studywere similar to those recorded by Ward et al. (2005),
althoughHubert et al. (2008) reported mean values greater than
19%.
-
I. Veneza et al. / Food Control 38 (2014) 116e123122
The genetic distances between genera recorded in the
presentstudy were lower than those recorded by Ward et al. (2005)
andCarvalho, Oliveira, et al. (2011), and in some cases, such asL.
purpureus vs. R. aurorubens and L. vivanus vs O. chrysurus,
weremore characteristic of intrageneric comparisons. Gold, Voelker,
andRenshaw (2011) proposed a molecular phylogeny for some
lutja-nids using mitochondrial markers (NADH-subunit 4, COI and
Cy-tochrome b) and discussed the close relationship between
Ocyurus,Lutjanus, and Rhomboplites, which they interpreted as
beingconsistent with that of a single genus, as proposed by Miller
andCribb (2007).
In the present study, mean interspecific distances were over2.5%
in all cases, and well above the mean distances observedwithin
populations (0.5%), reflecting the presence of well-definedand
coherent groups equivalent to species. Comparing DNA bar-coding
sequences in L. analis and L. cyanopterus, Victor et al.
(2009)found a divergence of over 11%. Ward et al. (2005) detected a
meandistance of approximately 9.9% for comparisons between species
ofthe same genus and 0.4% for intra-population comparisons,
whichare similar to the values of 8.3% and 0.3%, respectively,
recorded byHubert et al. (2008). A similar pattern was observed in
the presentstudy.
Overall, the results presented here, including genetic
diver-gence, the distribution of polymorphic sites, and tree
topology,confirm the hypothesis that different regions of the COI
gene maybe used successfully to create a reliable authentication
system forfishery products. This procedure thus constitutes a
powerful toolfor biological identification, given that it is able
to discriminate notonly intraspecific variation, but also
interspecific differences reli-ably enough to permit the
identification of species.
4.2. Using COI sequences to authenticate lutjanids
The banding pattern of the rDNA 5S gene observed directly
inagarose gel, without the need for sequencing, would be in
principlea more practical alternative for the routine
identification of species.However, no species- or genus-specific
patternwas observed in thepresent study, indicating that this
molecular marker is not appro-priate for the discrimination of the
species in this group.
By contrast, the COI fragment analyzed (barcode and non bar-code
region) in this study proved to be an extremely effective
andreliable tool for the diagnosis of the authenticity of fishery
productsderived from lutjanids. All of the unidentified specimens
(100%)could be assigned unequivocally to a species.
The characterization of genomic regions with potential for
bio-identification, represents a fundamental first step towards
thedevelopment of rapid and reliable molecular protocols for
theauthentication of processed fishery products. This technique
maybe an important tool for the identification of frauds or the
acci-dental substitution of one fish species for another, which
mayhappen frequently during the processing and marketing of
fisheryproducts.
Acknowledgements
This study was supported by CNPq.
References
Allen, G. R. (1985). FAO species catalogue. In Snappers of the
world (Vol. 6 (pp. 208).N� . 125.
Alves-Costa, F. A., Martins, C., Matos, F. D. C., Foresti, F.,
Oliveira, C., & Wasko, A. P.(2008). 5S rDNA characterization in
twelve Sciaenidae fish species (Teleostei,Perciformes): depicting
gene diversity and molecular markers. Genetics andMolecular
Biology, 31, 303e307.
Ardura, A., Linde, A. R., Moreira, J. C., & Garcia-Vazquez,
E. (2010). DNA barcoding forconservation and management of
Amazonian commercial fish. Biological Con-servation, 143,
1438e1443.
Barbuto, M., Galimberti, A., Ferri, E., Labra, M., Malandra, R.,
Galli, P., et al. (2010).DNA barcoding reveals fraudulent
substitutions in shark seafood products: theItalian case of
‘‘palombo” (Mustelus spp.). Food Research International, 43,
376e381.
Brown, J. R., Beckenbach, K., Beckenbach, A. T., & Smith, M.
J. (1996). Length vari-ation, heteroplasmy and sequence divergence
in the mitochondrial DNA of fourspecies of Sturgeon (Acipmer).
Genetics, 142, 525e535.
Carrera, E., Garcia, T., Céspedes, A., Gonzalez, I., Fernandez,
A., Asensio, L. M., et al.(2000). Differentiation of smoked Salmo
salar, Oncorhynchus mykiss and Bramaraii using the nuclear marker
5S rDNA. International Journal of Food Science &Technology, 35,
401e406.
Carvalho, D. C., Neto, D. A. P., Brasil, B. S. F., &
Oliveira, D. A. A. (2011). DNA barcodingunveils a high rate of
mislabeling in a commercial freshwater catfish fromBrazil. Informa
Healthcare, 22(S1), 97e105.
Carvalho, D. C., Oliveira, D. A. A., Pompeu, P. S., Leal, C. G.,
Oliveira, C., & Hanner, R.(2011). Deep barcode divergence in
Brazilian freshwater fishes: the case of theSão Francisco River
basin. Informa Healthcare, 22(S1), 80e86.
Cervigón, F. (1993) (2th ed.).. Los peces marinhos de Venezuela
(Vol. II (pp. 498)Caracas, Venezuela: Fundacion Científica Los
Roques.
Cervigón, F., Capriani, F., Fischer, W., Garibaldi, L.,
Hendrickx, M., Lemus, A. J., et al.(1993). FAO species
identification sheets for fishery purpose. Field guide to
thecommercial marine and Brackish-water resources of the Northerrn
Coast of SouthAmerica (pp. 513). Rome: FAO.
Céspedes, A., Garcia, T., Carrera, E., Gonzalez, I., Fernandez,
A., Hernandez, P. E., et al.(1999). Identication of sole (Solea
solea) and Greenland halibut (Reinhardtiushippoglossoides) by PCR
amplication of the 5S rDNA gene. Journal of Agriculturaland Food
Chemistry, 47, 1046e1050.
Chiu, T. H., Su, Y. C., Pai, J. Y., & Chang, H. C. (2012).
Molecular markers for detectionand diagnosis of the giant grouper
(Epinephelus lanceolatus). Food Control, 24,29e37.
De Salle, R., & Birstein, V. J. (1996). PCR identification
of black caviar. Nature, 381,197e198.
FAO. (2012). The state of world fisheries and aquacultura.
Disponível em: . Acesso em: ago. 2012.
Filonzi, L., Chiesa, S., Vaghi, M., & Marzano, F. N. (2010).
Molecular barcoding revealsmislabelling of commercial fish products
in Italy. Food Research International, 43,1383e1388.
Froese, R., & Pauly, D. (2012). In FishBase (Ed.), World
wide web electronic publica-tion. Disponível em: www.fishbase.org.
Acesso em: ago.2012.
Gold, J. R., Voelker, G., & Renshaw, M. A. (2011).
Phylogenetic relationships oftropical western Atlantic snappers in
subfamily Lutjaninae (Lutjanidae: Perci-formes) inferred from
mitochondrial DNA sequences. Biological Journal of theLinnean
Society, 102, 915e929.
Greenstone, M. H., Rowley, D. L., Heimbach, U., Lundgren, J. G.,
Pfannenstiel, R. S., &Rehner, S. A. (2005). Barcoding
generalist predators by polymerase chain re-action: Carabids and
Spiders. Molecular Ecology, 14, 3247e3266.
Guindon, S., & Gascuel, O. (2003). A simple, fast, and
accurate algorithm to estimatelarge phylogenies by maximum
likelihood. Systematic Biology, 52, 696e704.
Hall, T. A. (1999). BioEdit: a user-friendly biological sequence
alignment editor andanalysis program for Windows 95/98/NT. Nucleic
Acids Symposium Series, 41,95e98.
Haye, P. A., Segovia, N. I., Vera, R., Gallardo, M. A., &
Gallardo-Escárate, C. (2012).Authentication of commercialized
crab-meat in Chile using DNA barcoding.Food Control, 25,
239e244.
Hebert, P. D. N., Cywinska, A., Ball, S. L., & de Waard, J.
R. (2003). Biological iden-tifications through DNA barcodes.
Proceedings of the Royal Society of LondonSeries B, Biological
Sciences, 270, 313e332.
Hogg, I. D., & Hebert, P. D. N. (2004). Biological
identification of springtails (Col-lembola: Hexapoda) from the
Canadian Arctic, using mitochondrial DNA barc-odes. Canadian
Journal of Zoology, 82, 749e754.
Hubert, N., Hanner, R., Holm, E., Mandrak, N. E., Taylor, E.,
Burridge, M., et al. (2008).Identifying Canadian freshwater fishes
through DNA barcodes. PLoS One, 3, 2490.
Kimura, M. (1980). A simple method for estimating evolutionary
rate of base sub-stitutions through comparative studies of
nucleotide sequences. Journal ofMolecular Evolution, 16,
111e120.
Librado, P., & Rozas, J. (2009). DnaSP v5: a software for
comprehensive analysis ofDNA polymorphism data. Bioinformatics, 25,
1451e1452.
Mackie, I. M., Pryde, S. E., Gonzales-Sotelo, C., Medina, I.,
Pérez-Martín, R.,Quinteiro, J., et al. (1999). Challenges in the
identification of species of cannedfish. Trends in Food Science
& Technology, 10, 9e14.
Marko, P. B., Lee, S. C., Rice, A. M., Gramling, J. M.,
Fitzhenry, T. M., McAlister, J. S.,et al. (2004). Mislabelling of a
depleted reef fish. Nature, 430, 309e310.
Martins, C., & Galetti, P. M., Jr. (2001). Organization of
5S rDNA in species of the fishLeporinus: two different genomic
locations are characterized by distinct non-transcribed spacers.
Genome, 44, 903e910.
Martins, C., & Wasko, A. P. (2004). Organization and
evolution of 5S ribosomal DNAin the fish genome. In C. R. Williams
(Ed.), Focus on genome research (pp. 289e318). Hauppauge: New
Science Publishers.
Martins, C., Wasko, A. P., Oliveira, C., Porto-Foresti, F.,
Parise-Maltempi, P. P.,Wright, J. M., et al. (2002). Dynamics of 5S
rDNA in the tilapia (Oreochromisniloticus) genome: repeat units,
inverted sequences, pseudogenes and chro-mosome loci. Cytogenetic
and Genome Research, 98, 76e85.
http://refhub.elsevier.com/S0956-7135(13)00535-5/sref1http://refhub.elsevier.com/S0956-7135(13)00535-5/sref1http://refhub.elsevier.com/S0956-7135(13)00535-5/sref1http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref2http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref3http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref4http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref5http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref6http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref7http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref8http://refhub.elsevier.com/S0956-7135(13)00535-5/sref9http://refhub.elsevier.com/S0956-7135(13)00535-5/sref9http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref10http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref11http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref12http://refhub.elsevier.com/S0956-7135(13)00535-5/sref13http://refhub.elsevier.com/S0956-7135(13)00535-5/sref13http://refhub.elsevier.com/S0956-7135(13)00535-5/sref13http://www.%20fao.org/docrep/016/i2727e/i2727e00.htmhttp://www.%20fao.org/docrep/016/i2727e/i2727e00.htmhttp://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://refhub.elsevier.com/S0956-7135(13)00535-5/sref15http://www.fishbase.orghttp://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref17http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref18http://refhub.elsevier.com/S0956-7135(13)00535-5/sref19http://refhub.elsevier.com/S0956-7135(13)00535-5/sref19http://refhub.elsevier.com/S0956-7135(13)00535-5/sref19http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref20http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref21http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref22http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref23http://refhub.elsevier.com/S0956-7135(13)00535-5/sref24http://refhub.elsevier.com/S0956-7135(13)00535-5/sref24http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref25http://refhub.elsevier.com/S0956-7135(13)00535-5/sref26http://refhub.elsevier.com/S0956-7135(13)00535-5/sref26http://refhub.elsevier.com/S0956-7135(13)00535-5/sref26http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref27http://refhub.elsevier.com/S0956-7135(13)00535-5/sref28http://refhub.elsevier.com/S0956-7135(13)00535-5/sref28http://refhub.elsevier.com/S0956-7135(13)00535-5/sref28http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref29http://refhub.elsevier.com/S0956-7135(13)00535-5/sref30http://refhub.elsevier.com/S0956-7135(13)00535-5/sref30http://refhub.elsevier.com/S0956-7135(13)00535-5/sref30http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31http://refhub.elsevier.com/S0956-7135(13)00535-5/sref31
-
I. Veneza et al. / Food Control 38 (2014) 116e123 123
Matos-Caraballo, D. (2000). Overview of Puerto Rico’s
small-scale fisheries statis-tics: 1994e1997. Proceedings of the
Gulf and Caribbean Fisheries Institute, 51,215e231.
Mendoza, J. J., & Larez, A. (1996). Abundance and
distribution of snappers andgroupers targeted by the artisanal
medium range fishery off northeasternVenezuela (1981e1992). ICLARM
Conference Proceedings, 48, 266e276.
Menezes, N. A., & Figueiredo, J. L. (1980). Manual de Peixes
marinhos do Sudeste doBrasil. IV. Teleostei (3) (pp. 96). São
Paulo: Museu de Zoologia e Universidade deSão Paulo (USP).
Miller, T. L., & Cribb, T. H. (2007). Phylogenetic
relationships of some common Indo-Pacific snappers (Perciformes:
Lutjanidae) based on mitochondrial DNA se-quences, with comments on
the taxonomic position of the Caesioninae. Mo-lecular Phylogenetics
and Evolution, 44, 450e460.
Móran, P., Martínez, J. L., Garcia-Vásquez, E., & Pendás, A.
M. (1996). Sex linkage of5S rDNA in rainbow trout (Oncorhynchus
mykiss). Cytogenetics and Cell Genetics,75, 145e150.
Moura, R. L., & Lindeman, K. C. (2007). A new species of
snapper (Perciformes:Lujanidae) from Brazil, with comments on the
distribution of Lutjanus griseusand L. apodus. Zootaxa, 1422,
31e43.
Nelson, J. S. (2006). Fishes of the world (4th ed.). (pp. 539)
New Jersey: John Wiley &Sons, Inc.
Palumbi, S., & Benzie, J. (1991). Large mitocondrial DNA
differences betweenmorphologically similar Penaeid shrimp.
Molecular Marine Biology andBiotechnology, 1, 27e34.
Pendás, A. M., Móran, P., Freije, J. P., & Garcia-Vásquez,
E. (1994). Chromosomallocation and nucleotide sequence of two
tandem repeats of the Atlantic salmon5S rDNA. Cytogenetics and Cell
Genetics, 67, 31e36.
Pendás, A. M., Móran, P., Martínez, J. L., & Garcia-Vásquez,
E. (1995). Applications of5S rDNA in Atlantic salmon, brow trout,
and in Atlantic salmon x brown trouthybrid identification.
Molecular Ecology, 4, 275e276.
Pinhal, D., Gadig, O. B. F., & Martins, C. (2009). Molecular
organization of 5S rDNA insharks of the genus Rhizoprionodon:
insights into the evolutionary dynamics of5S rDNA in vertebrate
genomes. Genetics Research, 91, 61e72.
Pinhal, D., Gadig, O. B. F., Wasko, A. P., Oliveira, C., Ron,
E., Foresti, F., et al. (2008).Discrimination of shark species by
simple PCR of 5S rDNA repeats. Genetics andMolecular Biology, 31,
361e365.
Posada, D. (2008). JMODELTEST: phylogenetic model averaging.
Molecular Biologyand Evolution, 25, 1253.
Prescod, S. D., Oxenford, H. A., & Taylor, C. (1996). The
snapper fishery of Barbados:present status and a preliminary
assessment of the potential for expansion.Proceedings of the Gulf
and Caribbean Fisheries Institute, 44, 159e179.
Rasmussen, R. S., & Morrissey, M. T. (2008). Application of
DNA-based methods toidentify fish and seafood substitution on the
commercial market. Comprehen-sive Reviews in Food Science and Food
Safety, 8, 118e154.
Rasmussen, R. S., Morrissey, M. T., & Hebert, P. D. N.
(2009). DNA barcoding ofcommercially important Salmon and trout
species (Oncorhynchus and Salmo)from North America. Journal of
Agricultural and Food Chemistry, 57, 8379e8385.
Rock, J., Costa, F. O., Walker, D. I., North, A. W., Hutchinson,
W. F., & Carvalho, G. R.(2008). DNA barcodes of fish of the
Scotia Sea, Antarctica indicate prioritygroups for taxonomic and
systematics focus. Antarctic Science, 20, 253e262.
Rodrigues-Filho, L. F. S., Cunha, D. B., Vallinoto, M.,
Schneider, H., Sampaio, I., &Fraga, E. (2010). Polymerase chain
reaction banding patterns of the 5S rDNA
gene as a diagnostic tool for the discrimination of South
American mullets ofthe genus Mugil. Aquaculture Research, 1e6.
Sajdak, S. L., Reed, K. M., & Phillips, R. B. (1998).
Intraindividual and interspeciesvariation in the 5S rDNA of
coregonid fish. Journal of Molecular Evolution, 46,680e688.
Sales, J. B. L., Rodrigues-Filho, L. F. S., Haimovici, M.,
Sampaio, I., & Schneider, H.(2011). Food Control, 22,
96e98.
Sambrook, j., & Russell, D. (2001). Molecular cloning: A
laboratory manual. ColdSpring Harbor, New York: Cold 303 Spring
Harbor Laboratory Press.
Sanger, F., Nichlen, S., & Coulson, A. R. (1977). DNA
sequencing with chain-termination inhibitors. Proceeding of the
National Academy of Science of theUSA, 74, 5463e5468.
Silva-Oliveira, G. C., Ready, J. S., Iketani, G., Bastos, S.,
Gomes, G., Sampaio, I., et al.(2011). The invasive status of
Macrobrachium rosenbergii (De Man, 1879) inNorthern Brazil, with an
estimation of areas at risk globally. Aquatic Invasions,6(3),
419e428.
Smith, M. A., Woodley, N. E., Janzen, D. H., Hallwachs, W.,
& Hebert, P. D. N. (2006).DNA barcodes reveal cryptic
host-specificity within the presumed polyphagousmembers of a genus
of parasitoid flies (Diptera: Tachinidae). Proceedings of
theNational Academy of Sciences, 103, 3657e3662.
Sotelo, C., Piñeiro, C., Gallardo, J. M., & Pérez-Martín, R.
I. (1993). Fish species identi-fication in seafood products. Trends
in Food Science and Technology, 4, 395e440.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M.,
& Kumar, S. (2011). MEGA5: molecular evolutionary genetics
analysis using maximum likelihood,evolutionary distance, and
maximum Parsimony methods. Molecular Biologyand Evolution, 28(10),
2731e2739.
Van Leeuwen, S. P., van Velzen, M. J., Swart, C. P., van der
Veen, I., Traag, W. A., & deBoer, J. (2009). Halogenated
contaminants in farmed salmon, trout, tilapia,pangasius, and
shrimp. Environmental Science and Technology, 43, 4009e4015.
Victor, B. C., Hanner, R., Shivji, M., Hyde, J., & Caldow,
C. (2009). Identification of thelarval and juvenile stages of the
Cubera Snapper, Lutjanus cyanopterus, usingDNA barcoding. Zootaxa,
2215, 24e36.
Ward, R. D. (2000). Genetics in fisheries management.
Hydrobiologia, 420, 191e201.Ward, R. D., Hanner, R., & Hebert,
P. D. N. (2009). The campaign to DNA barcode all
fishes, FISH-BOL. Journal of Fish Biology, 74, 329e356.Ward, R.
D., Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D.
N. (2005). DNA
barcoding Australia’s fish species. Philosophical Transactions
of the Royal Societyof London. Series B, 360, 1847e1857.
Wasko, A. P., Martins, C., Wright, J. M., & Galetti, P. M.,
Jr. (2001). Molecular orga-nization of 5S rDNA in fishes of the
genus Brycon. Genome, 44, 893e902.
Wen, J., Hu, C., Zhang, L., & Fan, S. (2011). Genetic
identification of global com-mercial sea cucumber species on the
basis of mitochondrial DNA sequences.Food Control, 22, 72e77.
Wong, L. L., Peatman, E., Lu, J., Kucuktas, H., He, S., Zhou,
C., et al. (2011). DNAbarcoding of catfish: species authentication
and phylogenetic assessment. PLoSOne, 6, e17812.
Yang, Y. C., Huang, Y. W., Hsieh, C. H., Huang, Y. R., &
Chen, C. H. (2012). A uniquespecification method for processed
unicorn filefish products using a DNA bar-code marker. Food
Control, 25, 292e302.
Zhang, J., & Liu, X. (2006). The phylogenetic relationship
of the family Lutjanidaebased on analyses of AFLP and mitochondrial
12S rRNA sequences. ChineseScience Bulletin, 51, 143e148.
http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref32http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref33http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref34http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref35http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref36http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref37http://refhub.elsevier.com/S0956-7135(13)00535-5/sref38http://refhub.elsevier.com/S0956-7135(13)00535-5/sref38http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref39http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref40http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref41http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref42http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref43http://refhub.elsevier.com/S0956-7135(13)00535-5/sref44http://refhub.elsevier.com/S0956-7135(13)00535-5/sref44http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref45http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref46http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref47http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref48http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref49http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref50http://refhub.elsevier.com/S0956-7135(13)00535-5/sref51http://refhub.elsevier.com/S0956-7135(13)00535-5/sref51http://refhub.elsevier.com/S0956-7135(13)00535-5/sref51http://refhub.elsevier.com/S0956-7135(13)00535-5/sref52http://refhub.elsevier.com/S0956-7135(13)00535-5/sref52http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref53http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref54http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref55http://refhub.elsevier.com/S0956-7135(13)00535-5/sref56http://refhub.elsevier.com/S0956-7135(13)00535-5/sref56http://refhub.elsevier.com/S0956-7135(13)00535-5/sref56http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref57http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref58http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref59http://refhub.elsevier.com/S0956-7135(13)00535-5/sref60http://refhub.elsevier.com/S0956-7135(13)00535-5/sref60http://refhub.elsevier.com/S0956-7135(13)00535-5/sref61http://refhub.elsevier.com/S0956-7135(13)00535-5/sref61http://refhub.elsevier.com/S0956-7135(13)00535-5/sref61http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref62http://refhub.elsevier.com/S0956-7135(13)00535-5/sref63http://refhub.elsevier.com/S0956-7135(13)00535-5/sref63http://refhub.elsevier.com/S0956-7135(13)00535-5/sref63http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref64http://refhub.elsevier.com/S0956-7135(13)00535-5/sref65http://refhub.elsevier.com/S0956-7135(13)00535-5/sref65http://refhub.elsevier.com/S0956-7135(13)00535-5/sref65http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref66http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67http://refhub.elsevier.com/S0956-7135(13)00535-5/sref67
A barcode for the authentication of the snappers (Lutjanidae) of
the western Atlantic: rDNA 5S or mitochondrial COI?1 Introduction2
Material and methods2.1 Samples2.2 Isolation, amplification, and
sequencing of the genetic material2.3 Analyses2.3.1 Banding pattern
– rDNA 5S/NTS2.3.2 The mitochondrial COI gene
3 Results3.1 rDNA 5S/NTS gene3.2 Mitochondrial COI gene
4 Discussion4.1 rDNA 5S bands or COI sequences?4.2 Using COI
sequences to authenticate lutjanids
AcknowledgementsReferences