441 The influence of interleukin- 10 promoter gene polymorphism on the occurrence of non hodgkin lymphoma (NHL) in subjects infected with hepatitis C virus (HCV)

www.elsevier.com/locate/jhep

Journal of Hepatology 45 (2006) 779–785

Interleukin-10�1082 GG polymorphism influences the occurrenceand the clinical characteristics of hepatitis C virus infection

Marcello Persico1,*, Mario Capasso2, Eliana Persico1, Mario Masarone1,Amalia de Renzo3, Daniela Spano2, Savino Bruno4, Achille Iolascon2

1Cattedra di Medicina Interna, Seconda Universita di Napoli, Italy2Cattedra di Genetica Medica, Dipartimento di Biochimica e Biotecnologie Mediche, CEINGE-Biotecnologie Avanzate, Italy

3Cattedra di Ematologia, Universita Federico II, Napoli, Italy4Hepatology Unit, Fatebenefratelli Hospital, Milan, Italy

Background/Aims: In this study, we determined the genotypic and allelic frequencies of the Interleukin (IL)-10�1082G/A

IL-10�592A/C, and IL-10�819C/T polymorphisms, and their association with the risk to develop B cell Non Hodgkin

Lymphoma (NHL) in hepatitis virus C (HCV) carriers.

Results: Genetic polymorphisms in the IL-10 gene promoter were studied in 250 consecutive patients with B-cell NHLwith no clinical and /or laboratory findings of cryoglobulinemia, 142 NHL/HCV� and 108 NHL/HCV+ with chronic

hepatitis (CH), 120 consecutive subjects with HCV-related CH, and 110 age, sex-matched healthy blood donors. The

frequency of the IL-10�1082GG genotype vs remaining genotypes (IL-10�1082GA/AA) was higher in NHL/HCV+ patients

than HCV-related CH patients (P = 0.0002, OR = 2.89, CI: 1.62–5.15) and in NHL/HCV+ than NHL/HCV� patients

(P = 0.0001, OR = 2.99, CI: 1.72–5.19). Moreover, the IL-10�1082GG genotype was more prevalent in indolent

NHL/HCV+ cases than aggressive NHL/HCV+ (P = 0.0004, OR = 4.97, CI: 2.10–11.79). Finally, we confirmed that

IL-10�1082GG genotype is associated with higher IL-10 production compared to AA homozygous (P = 0.037).

Conclusions: The high IL-10 production, due to IL-10�1082GG genotype, influences the clinical expression of the HCVinfection by increasing susceptibility to develop NHL and might contribute to the indolent form of the disease.

� 2006 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Keywords: Hepatitis C virus; Non Hodgkin Lymphoma; Interleukin 10 genetic polymorphism; Liver disease

1. Introduction

Hepatitis C virus (HCV) along with chronic liverdisease is believed to cause other pathological condi-tions [1]. This suggests a possible role of the virusin clinical conditions due to infection of distinct celltypes, including hepatocytes and leukocytes. In partic-ular, HCV is considered the etiological agent of cryo-globulinemic syndrome and its prevalence in subjectsaffected with this syndrome ranges from 60% to 90%

0168-8278/$32.00 � 2006 European Association for the Study of the Liver.

doi:10.1016/j.jhep.2006.07.026

Received 14 April 2006; received in revised form 5 June 2006; accepted

28 July 2006; available online 22 September 2006* Corresponding author. Fax: +390815666838.

E-mail address: [email protected] (M. Persico).

[2]. Prevalence of HCV is also significantly higher inpatients with Non Hodgkin Lymphoma (NHL) inall geographic areas, except North Europe and someareas in North America [3]. In Italy, different studieshave shown a prevalence ranging from 15% to 30%[4]. Specific subtypes of NHL appear to be associatedwith HCV infection [5]. The prevalence of Lympho-plasmacytic/Waldenstrom is increased among patientwith HCV-type 2 cryoglobulinemia and the prevalenceof extranodal marginal zone cell lymphoma isincreased in HCV-infected patients with cryoglobulin-emia compared to the International LymphomaStudy [6].

Interleukin-10 (IL-10) is an important immunoregu-latory cytokine mainly produced by monocytes, mac-

Published by Elsevier B.V. All rights reserved.

Table 1

Clinical characteristics of patients

CH NHL NHL/HCV�

HCV/CH+ NHL

Number 120 250 142 108Age

Median 5 7 62 64 62Range 41–66 30–75 30–75 44–75

Sex (M/F) 76/44 118/132 70/72 48/60ALT (value ± SD) 78 ± 36a 39 ± 1 45 ± 12Virus genotype 1b / 1bStaging (Ishak)

Median 3 / 1Range 1–6 / 0–6

Indolent 118 (47.2) 54 (38.0) 64 (59.3)Aggressive 132 (52.8) 88 (62.0) 44 (40.7)Favourable disease

outcome142/250 76/142 66/108

a P < 0.01: significant difference of ALT levels between CH patientsand NHL/HCV�.

780 M. Persico et al. / Journal of Hepatology 45 (2006) 779–785

rophages and T cells [7]. Its main biological functionseems to be the limitation and termination of inflam-matory responses and the regulation of differentiationand proliferation of several immune cells such as Tcells, B cells, natural killer cells, antigen-presentingcells, mast cells, and granulocytes. The human IL-10gene is located on chromosome 1 and encodes 5 exons(5.1 kb) [8]. The IL-10 promoter is highly polymorphicwith two informative microsatellites, IL10.G andIL10.R, located 1.2 and 4 kb upstream of the tran-scription start site [7,8], and three frequent pointmutations �1082(G/A), �819(C/T), and �592(C/A)[9]. The �1082(G), �592(C), and �819(C) alleles wereassociated with higher IL-10 production (likely both Tcells and monocytes) [9,10]. Numerous studies haveshown that IL-10 may be involved in the pathogenesisof lymphoid disorders [11–13]. Moreover, in a recentstudy, it was demonstrated that patients with diffuselarge B-cell lymphoma (DLBCL) have a higher fre-quency of the IL-10�1082G allele than ethnicallymatched healthy individuals in the French populationand IL-10�1082G allele was associated with longer free-dom from progression and overall survival [12]. Con-versely, Berglund et al. demonstrated that thefrequency of the IL-10�1082G allele was not significant-ly different in their patients with DLBCL versus thecontrol group and there was no difference in overallsurvival between the patients with IL-10�1082GA/GG

genotype and the patients with IL-10�1082AA. So, itis not clear the role of the IL-10 promoter polymor-phisms in the development of DLBCL (Diffuse largeB-cell lymphoma).

The aim of the present study is to test thepossible influence of the IL-10�1082G/A IL-10�592A/C,and IL-10�819C/T polymorphisms in patients withHCV-related chronic hepatitis and NHL B-celllymphoma.

2. Patients, materials and methods

2.1. Subjects

The study was performed with three cohorts of patients enrolledfrom January 2001 to December 2005 (Table 1):

• 250 consecutive patients with incident, histologically confirmedB-cell NHL with no clinical and/or laboratory findings of cryo-globulinemia, 142 NHL/HCV� and 108 NHL/HCV+ withchronic hepatitis (CH). They had not received any cytotoxictreatment;

• 120 consecutive subjects with HCV-related CH;• 110 age, sex-matched healthy blood donors.

All the patients agreed to participate in the research protocol,which had been approved by the Ethical Committee.

Histologic specimens were classified according to the InternationalClassification of Disease for Oncology (second edition) [14] which wasupdated to include categories in the Revised European-American Lym-phoma (Real)/World Heath Organization (WHO) classification [15].

The extent of the NHL was categorized according to Real classifi-cation and grouped into indolent or aggressive lymphomas [16].

The initial medical evaluation consisted of a complete history andphysical examination; blood morphology, blood chemistry and HCVtesting (antibodies, viral RNA and genotype) were performed. Ultra-sound examination of the abdomen and computed topographic scanof chest, abdomen and pelvis were performed when appropriate. CHwas assessed by liver biopsy, evaluated according to Ishak’s score[17], in all the HCV positive patients.

2.2. RNA preparation and HCV RNA determination

All the phases were performed under RNase-free conditions. TotalRNA was isolated from serum according to Chomczynsky and Sacchi[18] and reverse transcribed using random hexamers. All serum sam-ples were treated in parallel with negative controls. Resolution of thePCR products was obtained by gel-electrophoresis. Carryover PCRcontamination was avoided by applying the measures suggested byKwok and Higuchi [19].

2.3. DEIA procedure for HCV genotyping

Serum PCR products were hybridized to type- and subtype-specificprobes 1a, 1b, 2a, 2b and 3a, in order to classify the HCV genotypes.The probes used were to fulfill two main criteria: no more than twomismatches to the corresponding published sequences of the same sub-type and they were to differ by three or more mismatches compared topublished sequences of other types and subtypes. The only exception isprobe 2b showing only two mismatches to the corresponding sequenceof type 3a [20].

2.4. DNA extraction

Genomic DNA was extracted from peripheral blood leukocytesusing Perfect gDNA Blood mini protocol according to the manufac-turer’s instruction (Eppendorf).

2.5. PCR

PCR amplifications of gene IL-10 promoter were performed withprimer sequences given in Table 2. The PCR mixtures contained100 ng of genomic DNA, 0.1 mM each of the deoxynucleotide triphos-phates, 12.5 pmol each of the primers, and 1 U of Taq polymerase in a25 lL final volume. PCRs were performed using a 9700 Gene Amp

Table 2

Characteristics of the cytokine gene polymorphisms, primer sequences and PCR conditions

Gene Promoter position of the polymorphism Allele Phenotype Primer sequences 5 0–3 0 TAa (�C)

IL-10 �1082 G High F: CCAGGTAGAGCAACACTCCT 55A Low R: CTCTTACCTATCCCTACTTCCGC

IL-10 �592 C High F: GTGGAAACATGTGCCTGAGA 58A Low R: ATGAGGGGGTGGGCTAAATA

IL-10 �819 C High F: TCCAGCCACAGAAGCTTACA 60T Low R: GGCACATGTTTCCACCTCTT

a TA, annealing temperature for each individual SNP.

M. Persico et al. / Journal of Hepatology 45 (2006) 779–785 781

PCR System Thermal Cycler (Applied Biosystem) according to the fol-lowing thermocycler conditions: 94 �C for 2 min followed by 35 cyclesof 94 �C for 30 s, TA for each SNP for 30 s (Table 2) and 72 �C for 30 s,with a final extension at 72 �C for 7 min.

2.6. Genotyping methodology

IL-10�1082G/A, IL-10�592A/C, and IL-10�819C/T single nucleotidepolymorphisms (SNPs) were genotyped by Restriction FragmentLength Polymorphism (RFLP).

For IL-10�1082G/A SNP, a RFLP assay was performed in a 15 lLreaction volume containing PCR product and specific restrictionenzymes (EarI). The digestion products were visualized on a 3% aga-rose gel stained with ethidium bromide. In the presence of the IL-10�1082G allele, EarI cut the 155 bp PCR product into two bands of128 and 27 bp, respectively.

For IL-10�592A/C SNP, a RFLP assay was performed in a 15 lLreaction volume containing PCR product and specific restrictionenzymes (RsaI). The digestion products were visualized on a 3% aga-rose gel stained. In the presence of the IL-10�592A allele, RsaI cutthe 154 bp PCR product into two bands of 79 and 75 bp, respectively.

For IL-10�819C/T SNP, a RFLP assay was performed in a 15 lL reac-tion volume containing PCR product and specific restriction enzymes(MaeIII). The digestion products were visualized on a 3% agarose gelstained. In the presence of the IL-10�819C allele, MaeIII cut the 312 bpPCR product into two bands of 171 and 141 bp, respectively.

Genotyping was successfully confirmed by automated DNAsequencing.

2.7. IL-10 expression in plasma of NHL/HCV+ patients

The plasma samples were collected by centrifugation and were storedat�80 �C. Determination of IL-10 level was assessed by using a humanEnzyme Amplified Sensitivity Immunoassay (EASIA) (BioSource Inter-national, Camarillo, CA). The detection limit was 1 pg/mL.

2.8. Statistical analysis

Comparison of genotypic and allelic frequencies between groupswas performed by chi-square test with Yates correction in the specificcase of 2 · 2 tables. Odds ratios (ORs) and 95% confidence intervals(CIs) were calculated to assess the relative disease risk conferred bya specific allele and genotype. The plasma IL-10 concentrations werecompared by Mann–Whitney test. Student’s t test and/or variance testwere used for comparing ALT levels.

3. Results

3.1. Allele and genotype frequencies

Epidemiological, clinical and histological data arereported in Table 1. Age and sex were not different

among groups whereas ALT levels were significantlyhigher (P < 0.01) in HCV-related CH compared toHCV negative and positive NHL. Liver histology andliver fibrosis (staging) were significantly milder inHCV-related NHL as compared to HCV-related CHnot affected with NHL (Table 1).

Table 3 shows allelic and genotypic distribution ofcytokine gene SNPs in all collected samples. The IL-10�1082GG genoptype seemed to influence the occurrenceof NHL in HCV-infected patients, regardless of age, sex,virus genotype and/ or severity of chronic liver disease.In fact, the distribution of the IL-10�1082G/A polymor-phism was different between NHL/HCV+ and HCV-re-lated CH patients (P = 0.0001). Compared with AAhomozygotes, the ORs of NHL/HCV+ patients forGA heterozygotes and GG homozygotes were 1.46(CI: 0.75–2.83) and 3.61 (CI: 1.79–7.28), respectively.The IL-10�1082G allele was significantly more frequent(P = 0.00007, OR = 2.17, CI: 1.49–3.16) in NHL/HCV+ patients than CH patients. The IL-10�1082GG

genotype vs IL-10�1082GA/AA was more frequent inNHL/HCV+ patients than HCV-related CH patients(P = 0.0002, OR = 2.89, CI: 1.62–5.15). Also, the distri-bution of the IL-10�1082G/A polymorphism was differentbetween NHL/HCV+ and NHL/HCV� patients(P = 0.0003); compared with AA homozygotes, theORs of NHL/HCV+ patients for GA heterozygotesand GG homozygotes were 1.09 (CI: 0.56–2.11) and3.49 (CI: 1.77–6.89), respectively. The frequency of theIL-10�1082G allele (P = 0.00007, OR = 2.11, CI, 1.47–3.03) and the frequency of the IL-10�1082GG genotypeagainst all the rest of genotypes (IL-10�1082GA/AA) weresignificantly different between NHL/HCV+ and NHL/HCV� patients (P = 0.0001, OR = 2.99, CI: 1.72–5.19), thus suggesting that carriers of the IL-101082GG

genotype infected with HCV are prone to develop NHL.Moreover, we demonstrated that NHL/HCV+

cases were more often indolent than NHL/HCV�(P = 0.001, OR = 2.37, CI: 1.47–3.96) (Table 4) andthat the IL-10�1082GG genotype was more prevalentin indolent NHL/HCV+ cases (P = 0.0004,OR = 4.97, CI: 2.10–11.79) (Table 5) than aggressiveNHL/HCV+ cases. No significantly different alleleand genotype frequencies of IL-10 �592 A/C and

Table 3

Differential distribution of the IL-10�1082, IL-10�592, and IL-10�819 polymorphisms in normal controls and in HCV � CH, HCV/CH + NHL,

NHL/HCV� patients

Geneticpolymorphisms

ControlN = 110Na (%)

HCV � CHN = 120N (%)

HCV/CH + NHLN = 108 N (%)

NHL/HCV�N = 142 N (%)

P valueb ORc CI P valued ORe CI

IL-10�1082G/A

GenotypesAA 36 (32.7) 43 (35.8) 22 (20.4) 48 (33.8) 0.0001 – – 0.0003 – –GA 56 (50.9) 51 (42.5) 38 (35.2) 64 (45.1) 1.46 0.75–2.83 1.09 0.56–2.11GG 18 (16.4) 26 (21.7) 48 (44.4) 30 (21.1) 3.61 1.79–7.28 3.49 1.77–6.89

AllelesA 128 (58.2) 137 (57.1) 82 (38.0) 160 (56.3) 0.00007 – – 0.00007 – –G 92 (41.8) 103 (42.9) 134 (62.0) 124 (43.7) 2.17 1.49–3.16 2.11 1.47–3.03

GGvsGA/AAGA/AA 92 (83.6) 94 (78.3) 60 (55.6) 112 (78.9) 0.0002 – – 0.0001 – –GG 18 (16.4) 26 (21.7) 48 (44.4) 30 (21.1) 2.89 1.62–5.15 2.99 1.72–5.19

IL-10�592A/C

GenotypesAA 6 (5.5) 6 (5.0) 4 (3.7) 8 (5.6) 0.67 – – 0.78 – –AC 51 (46.4) 54 (45.0) 44 (40.7) 56 (39.4) 1.22 0.32–4.60 1.57 0.44–5.56CC 53 (48.2) 60 (50.0) 60 (55.6) 78 (54.9) 1.50 0.40–5.59 1.54 0.44–5.35

AllelesA 63 (28.6) 66 (27.5) 52 (24.1) 72 (25.3) 0.46 – – 0.82 – –C 157 (71.4) 174 (72.5) 164 (75.9) 212 (74.7) 1.20 0.78–1.82 1.07 0.71–1.62

CCvsCA/AACA/AA 57 (51.8) 60 (50.0) 48 (44.4) 64 (45.1) 0.48 – – 1 – –CC 53 (48.2) 60 (50.0) 60 (55.6) 78 (54.9) 1.25 0.74–2.11 1.03 0.62–1.70

IL-10�819C/T

GenotypesTT 6 (5.5) 6 (5.0) 4 (3.7) 8 (5.6) 0.67 – – 0.78 – –CT 51 (46.4) 54 (45.0) 44 (40.7) 56 (39.4) 1.22 0.32–4.60 1.57 0.44–5.56CC 53 (48.2) 60 (50.0) 60 (55.6) 78 (54.9) 1.50 0.40–5.59 1.54 0.44–5.35

AllelesT 63 (28.6) 66 (27.5) 52 (24.1) 72 (25.3) 0.46 – – 0.82 – –C 157 (71.4) 174 (72.5) 164 (75.9) 212 (74.7) 1.20 0.78–1.82 1.07 0.71–1.62

CCvsCT/TTCT/TT 57 (51.8) 60 (50.0) 48 (44.4) 64 (45.1) 0.48 – – 1 – –CC 53 (48.2) 60 (50.0) 60 (55.6) 78 (54.9) 1.25 0.74–2.11 1.03 0.62–1.70

a The genotype and allele frequencies of HCV � CH and NHL/HCV� patients were not significantly different as compared with controls.b Significance of difference between HCV � CH and HCV/CH + NHL groups.c Risk of NHL occurrence between HCV � CH patients according to heterozygosity and homozygosity for the G allele.d Significance of difference between NHL/HCV� and HCV/CH + NHL groups.e Risk of HCV infection between NHL patients according to heterozygosity and homozygosity for the G allele.

782 M. Persico et al. / Journal of Hepatology 45 (2006) 779–785

IL-10 �819 C/T polymorphisms were seen betweenperformed groups. There were no significant differenc-es between the frequencies of IL-10�1082G/A geneticpolymorphism of the HCV-related CH and NHL/HCV� patients, respectively, and healthy controlsubjects (Table 3).

Table 4

Frequency distribution of indolent and aggressive tumoral forms in NHL/

HCVminus and HCV/CH + NHL/patients

HCV/CH +NHL N = 108N (%)

NHL/HCV�N = 142N (%)

P

valueOR CI

Indolent 64 (59.3) 54 (38.0) 0.001 – –Aggressive 44 (40.7) 88 (62.0) 2.37 1.47–3.96

3.2. Differential IL-10 plasma levels associated with

�1082 G/A polymorphism

Total plasma concentrations of IL-10 were differentbetween IL-10�1082GG NHL/HCV+ patients [medi-

Table 5

Frequency differential distribution of IL-10�1082, polymorphisms in

HCV/CH+ NHL carriers with indolent or aggressive form

IndolentHCV/CH+NHL N = 64N (%)

AggressiveHCV/CH+NHL N = 44N (%)

P value OR CI

GA/AA 38 (59.4) 10 (25.0) 0.0004 – –GG 26 (40.6) 34 (85.0) 4.97 2.09–11.79

Genotype

0.000

1.000

2.000

3.000

4.000

5.000

6.000

7.000

GG

IL-10 Plasma pg/ml

AA

Fig. 1. Differential IL-10 plasma levels according to IL-10�1082G/A

polymorphism. Total plasma concentrations of IL-10 were different

between IL-10�1082GG NHL/HCV+ patients [median = 6.081 pg/mL

(3.908–37.166 pg/mL)] and IL-10�1082AA NHL/HCV+ patients [medi-

an = 3.606 pg/mL (3.174–4.858 pg/mL); Mann–Whitney rank sum test;

P = 0.037].

M. Persico et al. / Journal of Hepatology 45 (2006) 779–785 783

an = 6.081 pg/mL (3.908–37.166 pg/mL)] and IL-10�1082AA NHL/HCV+ patients [median = 3.606 pg/mL (3.174–4.858 pg/mL); P = 0.037] as reported inFig. 1. This finding is consistent with observations ofothers, indicating higher capability of IL-10 productionfor the IL-10�1082GG genotype [7–11].

4. Discussion

In general, HCV-infected patients have chronic liverdisease at different severity stages ranging from minimallesions to liver cirrhosis but only few develop hemato-logical disorders [21]. Patients who develop cryoglobu-linemia and/or NHL rarely develop severe liverdisease, while patients with chronic liver disease rarelydevelop hematological disorders [22]. HCV replicatesin hepatocytes and likely in lymphocytes and otherhuman cell types [23,24]. The evidence supporting thepeculiar HCV lymphotropism might be at the basis ofthe HCV-related extra-hepatic manifestations of whichmixed cryoglobulinemia1 is the most common one[25,26]. Consistently, with these findings, in recent years,have been published many reports showing the associa-tion of HCV and NHL. The association seems spreadworldwide with some exceptions [3]. In particular, itseems that HCV-infected people from Mediterraneanarea and from Japan have an increased risk of develop-ing NHL, whereas people from the Northern Europehave not. This evidence suggests that the HCV-relatedinduction of lymphoproliferative disorders seems some-how related to a peculiar individual predisposition thatmight emerge from interaction of genetic and environ-mental factors.

Several studies show the association between HCVinfection and extra-hepatic manifestations but no datawere produced at present speculating on why somepatients develop only chronic liver diseases and someothers also had associated extra-hepatic manifesta-

tions. The question arises as to whether or not epide-miological, virological and/or genetic factors mightcontribute to the different clinical expression of HCVinfection. However, neither age, nor sex or particularHCV genotypes seemed to influence the occurrenceand clinical characteristics of HCV positive NHL.To date, there are no data on genetic factors thatmight contribute to the different clinical manifestationsof HCV infection.

The cytokine IL-10, produced by macrophages,monocytes, T and B cells, has a relevant role in the func-tion and regulation of the immune system. It may beproduced also by neoplastic B lymphocytes and severalstudies have shown that it might be involved in the path-ogenesis of lymphoproliferative malignancies. It hasbeen reported that it might upregulate the bcl-2 expres-sion acting as an autocrine growth factor [27,28]. Elevat-ed serum levels of IL-10 have been shown associatedwith poor prognosis in patients with diffuse large B-celllymphoma (DLBCL) [29–31]. Although the mechanismsunderlying the production of IL-10 are not clear yet,inherited factors might play an important role [32].Under the persistent stimulus of a viral agent (i.e.HCV), peculiar genetic polymorphisms affecting IL-10production might be responsible for the neoplasticderangement of the lymphocytes. A recent study onDLBCL has shown that increased IL-10 serum valueswere associated with advanced disease stage and worseclinical outcome [12]. In the same study they alsoshowed that a higher prevalence of IL-10�1082G allelepredisposed to the disease and correlated with a favor-able disease outcome. They concluded that the IL-10production is involved in the clinical course of theDLBCL and it is regulated by a peculiar genetic compo-nent [12]. In this study, the authors do not report onHCV prevalence and it is not clear if HCV was ever test-ed. However, the favorable influence of IL-10 geneticpolymorphism shown seems in agreement with the pos-sibility that the peculiar genetic background, condition-ing the clinical outcome of NHL, might also causeindividual predisposition to develop NHL in the pres-ence of HCV. In our study, we show that a significantlyhigh prevalence of IL-10�1082GG genoptype, associatedto high capability to produce the cytokine, seemed toinfluence the occurrence of NHL in HCV-infectedpatients. IL-10�1082GG genotype prevalence is higher inpatients with HCV-related NHL than in patients withchronic active hepatitis, HCV-unrelated NHL. A recentreport demonstrated reduction of spontaneously activat-ed B cells and antiapoptotic gene expression in NZB IL-10 knockout mice. Lymphoma incidence was decreasedin these animals, indicating that IL-10 is a critical factorfor the progression of this B-cell malignant disease [33].Our study shows, in human, that the IL-10�1082GG geno-type, high producer, predispose to B-cell NHL inpatients infected by virus C (removed). Accordingly,

784 M. Persico et al. / Journal of Hepatology 45 (2006) 779–785

increased serum levels of IL-10 seem associated to devel-opment of lymphoma in the context of the acquiredimmunodeficiency syndrome (AIDS) [13].

Moreover, the higher frequency of IL-10�1082GG

genotype is associated with a less severe disease inHCV-infected patients affected with NHL compared toHCV negative NHL. So, we hypothesize that the combi-nation of a specific genetic background and HCV infec-tion determines a milder phenotype in patients affectedby NHL. Some studies report that the clinical outcomeof HCV-positive NHL does not seem to be differentfrom that of NHL patients without HCV infection[34,35] but there are no studies which correlate geneticfactors to clinical conditions in patients with NHL andinfected by HCV. Further studies are required to deter-mine the molecular mechanisms of HCV and IL-10which determine the better outcome in HCV-relatedNHL patients.

In conclusion, the high IL-10 production influencesthe clinical expression of the HCV infection by deter-mining a higher susceptibility to develop NHL andmight contribute to the indolent clinical condition ofthe disease.

References

[1] Cacoub P, Poynard T, Ghillani P, Charlotte F, Olivi M, Piette JC,et al. Extrahepatic manifestations of chronic hepatitis C. MUL-TIVIRC Group. Multidepartment Virus C. Arthritis Rheum1999;42:2204–2212.

[2] Agnello V, Chung RT, Kaplan LM. A role for hepatitis C virusinfection in type 2 cryoglobulinemia. N Engl J Med 1992;117:573–577.

[3] Matsuo K, Kusano A, Sugumar A, Nakamura S, Tajima K,Mueller NE. Effect of hepatitis C virus infection on the risk of nonHodgkin’s lymphoma: a meta analysis of epidemiological studies.Cancer Sci 2004;95:745–752.

[4] Mele A, Pulsoni A, Bianco E, Musto P, Szklo A, Sanpaolo MG,et al. Hepatitis C virus and B-cell non-Hodgkin lymphomas: anItalian multicenter case-control study. Blood 2003;102 (3):996–999.

[5] De Rosa G, Gobbo ML, De Renzo A, Notaro R, Garofalo S,Grimaldi M. High prevalence of hepatitis C virus infection inpatients with B-cell lymphoproliferative disorders in Italy. Am JHematol 1997;55:77–82.

[6] Harris NL. Principles of the revised Eurpean-American lympho-ma classification (from the International Lymphoma StudyGroup). Ann Oncol 1997;8 (Suppl. 2):S11–S16.

[7] Moore KW, de Waal Malefyt R, Coffman RL, O’Garra A.Interleukin-10 and the interleukin-10 receptor. Ann Rev Immunol2001;19:683–765.

[8] Eskdale J, Kube D, Gallagher G. A second polymorphicdinucleotide repeat in the 5_ flanking region of the human IL10gene. Immunogenetics 1996;45:82–83.

[9] Turner DM, Williams DM, Sankaran D, Lazarus M, Sinnott PJ,Hutchinson IV. An investigation of polymorphism in the inter-leukin-10 gene promoter. Eur J Immunogenetics 1997;24:1–8.

[10] Koss K, Satsangi J, Fanning GC, Welsh Kl, Jewell DP.Cytokine (TNF alpha, LT alpha and IL-10) polymorphisms ininflammatory bowel diseases and normal controls: differentialeffects on production and allele frequencies. Genes Immun2000;1:185–190.

[11] Fassone L, Gaidano G, Ariatti C, Vivenza D, Capello D, GloghiniA, et al. The role of cytokines in the pathogenesis and manage-ment of AIDS-related lymphomas. Leuk Lymphoma 2000;38 (5–6):481–488.

[12] Maranda EL, Baseggio L, Bienvenu J, Charlot C, Berger F, RegalD, et al. Interleukin-10 gene promoter polymorphisms influencethe clinical outcome of diffuse large B-cell lymphoma. Blood2004;103 (9):3529–3533.

[13] Breen EC, Boscardin WJ, Detels R, Jacobson LP, Smith MW,O’Brien SJ, et al. Non-Hodgkin’s B cell lymphoma in personswith acquired immunodeficiency syndrome is associated withincreased serum levels of IL10, or the IL10 promoter �592 C/Cgenotype. Clin Immunol 2003;109 (2):119–129.

[14] Percy C, Van Holten V, Muir C. International classification ofdiseases for oncology ICD-O. 2nd ed. Geneva: WHO; 1990.

[15] Harris NL, Jaffe ES, Stein J, Banks PM, Chan JK, Cleary ML,et al. A revised European-American classification of lymphoidneoplasms: a proposal from the International Lymphoma StudyGroup. Blood 1994;84:1361–1392.

[16] Jaffe ES, Harris NL, Stein H, Vardiman JW, editors. WorldHealth Organization classification of tumours. Pathology andgenetics of tumours of haematopoietic and lymphoid tissues.Lyon: IARC, 2001.

[17] Ishak K, Baptista A, Bianchi L, Callea F, De Groote J, Gudat F,et al. Histological grading and staging of chronic hepatitis. JHepatol 1995;22:696–699.

[18] Choczynski P, Sacchi N. Single step method of RNA isolation byacid guanidium thiocyanate–phenol–chloroform extraction. AnalBiochem 1987;162:156–159.

[19] Viavoz S, Zilbert A, Ramakrishnan K, Widell A, Cavicchini A,Schreier E, et al. Typing of hepatitis C virus isolates by DNAenzyme immunoassay. J Virol Methods 1994;48:81–92.

[20] Kwok S, Higuchi R. Avoiding false positives with PCR. Nature1989;339:237–238.

[21] Persico M, De Renzo A, Persico E, Torella D, Rotoli B, TorellaR. Chronic liver disease and lymphoproliferative disordes inHCV-positive patients: a working hypothesis. J Hepatol1998;29:857–859.

[22] Persico M, De Marino FA, DiGiacomo Russo G, Persico E,Morante A, Palmentieri B, et al. Prevalence and incidence ofcryoglobulins in hepatitis C virus-related chronic hepatitispatients: a prospective study. Am J Gastroenterol2003;98:884–888.

[23] Ferri C, Monti M, La Civita L, Longobardo G, Greco F,Pasero G. Infection of peripheral blood mononuclear cells byhepatitis C virus in mixed cryoglobulinemia. Blood1993;82:3701–3704.

[24] Crovatto M, Zorat F, Pussini E, Nascimben F, Baraccetti S,Mazzaro C. Peripheral blood neutrophills from HCV infectedpatients are sites of replication of the virus. Haematologica2000;85:356–361.

[25] Ferri C, Greco F, Longobardo G, Palla P, Moretti A, Marzo E.Association between hepatitis C virus and mixed cryoglobuline-mia. Clin Exp Rheumatol 1991;9:95–96.

[26] Misiani R, Bellavita P, Fenili D, Borrelli G, Marchesi D,Massazza M. Hepatitis C virus infection in patients with essentialmixed cryoglobulinemia. Eur J Clin Invest 1993;23:399–405.

[27] Rousset F, Garcia E, Defrance T. Interleukin10 is a potent growthand differentiation factor for activated human B lymphocytes.Proc Natl Acad Sci USA 1992;89:1890–1893.

[28] Levy Y, Brouet JC. Interleukin-10 prevents spontaneous death ofgerminal centre B cells by induction of the bcl-2 protein. J ClinInvest 1994;93:424–428.

[29] Sarris AH, Kliche KO, Pethambaram P. Interleukin-10 levels areoften elevated in serum of adults with Hodgkin’s disease and areassociated with inferior failure-free survival. Ann Oncol1999;10:433–440.

M. Persico et al. / Journal of Hepatology 45 (2006) 779–785 785

[30] Blay JY, Burdin N, Rousset F. Serum interleukin-10 in non-Hodgkin’s lymphoma: a prognostic factor. Blood1993;82:2169–2174.

[31] Fayad L, Keating MJ, Reuben JM. Interleukin-6 andinterleukin-10 levels in chronic lymphocytic leukemia: correla-tion with phenotypic characteristics and outcome. Blood2001;97:256–263.

[32] Westendorp RG, Langermans JA, Huizinga TW. Genetic influ-ence on cytokine production in meningococcal disease. Lancet1997;349:170–173.

[33] Czarneski J, Lin YC, Chong S, McCarthy B, Fernandes H, ParkerG, et al. Studies in NZB IL-10 knockout mice of the requirementof IL-10 for progression of B-cell lymphoma. Leukemia2004;18:597–606.

[34] Musto P. Hepatitis C virus infection and B-cell non-Hodgkin’slymphomas: more than a simple association. Clin Lymphoma2002;3:150–160.

[35] Tomita N, Kodama F, Takabayashi M, et al. Clinical featuresand outcome in HCV-positive aggressive non-Hodgkin’s lympho-ma. Leuk Lymphoma 2003;44:1159–1164.