3796 (1): 062 080 Article ZOOTAXA

ZOOTAXA

ISSN 1175-5326 (print edition)

ISSN 1175-5334 (online edition)Copyright © 2014 Magnolia Press

Zootaxa 3796 (1): 062–080

www.mapress.com/zootaxa/Article

http://dx.doi.org/10.11646/zootaxa.3796.1.3

http://zoobank.org/urn:lsid:zoobank.org:pub:4874CD6C-C834-4639-AB74-8E15739A0E6D

Delimiting the distribution range of Indirana leithii (Boulenger, 1888)

(Anura: Ranixalidae), an endemic threatened anuran of the Western Ghats,

based on molecular and morphological analysis

NIKHIL MODAK1, ANAND PADHYE2,5 & NEELESH DAHANUKAR3,4

1Department of Biodiversity, MES’ Abasaheb Garware College, Karve Road, Pune 411004, Maharashtra, India2Department of Zoology, MES’ Abasaheb Garware College, Karve Road, Pune 411004, Maharashtra, India3Indian Institute of Science Education and Research (IISER), G1 Block, Dr. Homi Bhabha Road, Pashan, Pune 411008, Maharahtra,

India4Systematics, Ecology and Conservation Laboratory, Zoo Outreach Organization (ZOO), 96 Kumudham Nagar, Vilankurichi Road,

Coimbatore, Tamil Nadu 641 035, India5Correspondeing author. E-mail: [email protected]

Abstract

Indirana leithii (Boulenger, 1888) (Anura: Ranixalidae) is a frog species endemic to the Western Ghats and is categorized

as Vulnerable according to IUCN red list. This species is currently considered to be widespread over the entire Western

Ghats. Our study based on molecular data (using DNA sequence fragments of the mitochondrial 12S rRNA and 16S rRNA

genes and the nuclear rhodopsin gene), morphological analysis of topotypic material as well as material collected from a

wide range within the northern Western Ghats, suggests that the species has instead a restricted range in the state of Ma-

harashtra. Specimens identified as I. leithii from the southern Western Ghats as well as from outside the Western Ghats

probably belong to hitherto undescribed species. To facilitate future studies in understanding the nature of this species

complex and provide better means for identification and delimitation of species we provide molecular, morphological and

osteological characters of I. leithii from topotyic material.

Key words: Vulnerable, Molecular phylogeny, species complex

Introduction

Indirana leithii was described as Rana leithii by Boulenger (1888) from a single female specimen collected at

Matheran (18.98°N; 73.27°E; 772 mASL), northern Western Ghats, India. After several taxonomic revisions

(Kirtisinghe 1958; Dubois 1986; 1987a; 1987b; Laurent 1986) and molecular evidence (Roelants et al. 2004) I.

leithii is now included in a Western Ghats endemic and monogeneric family Ranixalidae Dubois, 1987. Because of

the restricted and fragmented distribution and severe decline in the quality of the habitat, the species is currently

assessed as Vulnerable in IUCN Redlist (Biju et al. 2004).

According to current knowledge, the species Indirana leithii is supposed to occur in Gujarat (Daniel & Shull

1964), Maharashtra (Boulenger 1888; McCann 1932; Chari & Daniel 1953; Abdulali & Daniel 1954; Sekar 1992;

Padhye & Mahabaleshwarkar 2001; Dahanukar & Padhye 2005; Katwate et al. 2013); Andhra Pradesh (Srinivasulu

et al. 2007; Srinivasuslu & Das 2008); Karnataka (Krishnamurthy & Katre 1993; Krishnamurthy 2003; Nair et al.

2012a) and Kerala (Radhakrishanan 1996; Nair et al. 2012a). However, Biju et al. (2004) have doubted the

presence of I. leithii from localities other than the Western Ghats of Maharashtra.

In the current communication, based on the study of topotypic material and material collected from a wide

range within the northern Western Ghats, we show that Indirana leithii is restricted to the Western Ghats parts of

Maharashtra and that DNA sequence considered as I. leithii from southern India are genetically divergent. We

provide molecular and morphological evidences to restrict species distributional boundaries for I. leithii and also

provide an osteological study of the topotypic material so as to facilitate future studies in understanding the nature

of this species complex and provide better means for identification and delimitation of the species.

62 Accepted by M. Vences: 17 Mar. 2014; published: 16 May 2014

Materials and methods

Study sites and specimen collection. Surveys were conducted at various places from Anjaneri to Amboli in

Western Ghats of Maharashtra. The specimens morphologically resembling the original description of Indirana

leithii were studied from thirteen different populations from non protected areas at Anjaneri, Ratangad,

Harishchandragad, Matheran, Visapur fort, Tamhini, Sinhagad, Helwak, Shirota, Koynanagar, Amba ghat,

Anuskura ghat and Gaganbawda in Western Ghats of Maharashtra. Twenty eight specimens from ten localities

(Anjaneri, Ratangad, Harishchandragad, Matheran, Visapur Fort, Tamhini, Koynanagar, Amba ghat, Anuskura

ghat and Gaganbawda) were collected for molecular analysis, osteology and sexing. Additional specimens were

released in the same habitat after morphometric measurements done in the field. We adhered to IUCN (2008)

guidelines for research involving species at risk of extinction. Collected specimens are deposited in the museum

collection of Bombay Natural History Society (BNHS), Wildlife Information Liaison Development (WILD),

Zoological Survey of India, Western Regional Centre (ZSI-WRC) and Abasahab Garware College Zoology

Research Laboratory (AGCZRL), India.

Comparative study of museum specimens. Apart from the study of fresh collections we also studied

specimens of I. leithii and other related species of Indirana from the museum collection of BNHS. Details of all the

comparative material are provided in Appendix A.

Morphometric data collection and analysis. Morphometric measurements of I. leithii were obtained for 11

females and 16 males collected during the survey, 26 unsexed live specimens which were released at the same

location after study and 32 museum specimens from the collection of BNHS. Morphological characters were

measured using a digital calliper to the nearest 0.1 mm. Measurements were taken for the following characters :

SVL (snout to vent length), HL (head length-from behind the tympanum to the tip of snout), HW (head width-

between the posterior borders of tympanums), SL (snout length-from anterior orbital border to the tip of a snout),

EL (eye length-between anterior and posterior orbital borders), UEW (maximum upper eyelid width), TyL

(tympanum length-horizontal length of a tympanum), SNL (snout to nostril length), ENL (eye to nostril length-

distance between the anterior orbital border and the centre of a nostril), TEL (tympanum to eye length-distance

between the posterior orbital border and anterior border of tympanum), INL (inter narial distance-distance between

two nostrils), IOL (inter orbital distance-minimum distance between two eyelids), FAL (forelimb length-addition

of lengths of humerus, radio-ulna, and palm), F1-F4 (finger 1 to finger 4 length from the base of inner meta tarsal

tubercle), F3D (finger 3 disc width), F3W (finger 3 width at the base of a disc), THL (thigh length), TL (tibia

length), FOL (foot length-from tibio-tarsal articulation to the tip of a fourth toe), T1-T5 (toe 1 to toe 5 length), T4D

(toe 4 disc width), T4W (toe 4 width at the base of a disc).

We performed Principal Component Analysis (PCA) on log transformed morphometric data of 16 males and

11 females to understand any gender difference in morphology of Indirana leithii. PCA was performed using the

freeware PAST (Hammer et al. 2001).

Osteology. The osteology of a single female specimen (AGCZRL-Amphibia-200; SVL = 32.6 mm) from

Matheran was studied following the methods of Dingerkus & Uhler (1977).

DNA extraction, PCR, sequencing and Phylogenetic analysis. Fourteen specimens (BNHS5590,

BNHS5591, WILD-013-AMP-173 to 178, AGCZRL-Amphibia-112, 113, 192, 193, 195, 199) were used for

molecular work. Genomic DNA was extracted from thigh muscle tissue. The tissue was digested at 55°C using STE

buffer (50mM Tris-HCl, 20 mM EDTA and 50 µl of 10%SDS) with 10µl of 20mg/ml Proteinase K. RNase

treatment was given for 2 hours at 37°C. Final extraction process was done using phenol-chloroform method.

Polymerase Chain Reaction was performed for amplification of two mitochondrial genes (12S and 16S) and one

nuclear gene rho (exon 1) (Table 1). PCR reaction was performed in a 25µl reaction volume containing 5µl of

template DNA (~200ng), 2.5µl of 10X reaction buffer (100 mM Tris pH 9.0, 500 mM KCl, 15 mM MgCl2, 0.1%

Gelatin), 2µl of 25mM MgCl2, 1µl of 10mM dNTPs, 1µl of each primer, 1µl Taq polymerase and 16.5µl nuclease

free water. The thermal profile was 10 minutes at 95°C, and 35 cycles of 1 minute at 94°C, 1 minute at respective

annealing temperature for 12S, 16S and rho (Table 1) and 2 min at 72°C, followed by extension of 10 min at 72°C.

Amplified DNA fragments were purified using the ‘Promega Wizard Gel and PCR clean up’ system and sequenced.

The purified PCR products were sequenced using ABI prism 3730 sequencer (Applied Biosystems, USA) and Big

dye terminator sequencing kit (ABI Prism, USA). Sequences were analyzed by BLAST tool (Altschul et al. 1990).

These sequences have been deposited in GenBank under the accession numbers (Appendix B).

Zootaxa 3796 (1) © 2014 Magnolia Press · 63DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

TABLE 1. Primers used for molecular study along with melting temperature (Tm) and annealing temperatures (Ta).

Additional sequences (Appendix B) of related species were retrieved from the NCBI GenBank database (http:/

/www.ncbi.nlm.nih.gov/). GenBank accession numbers for the sequences used for the analysis are provided in

Appendix B. Gene sequences were aligned separately using MUSCLE (Edgar 2004) and were concatenated to

make a combined matrix of 1011 nucleotides. Molecular phylogenetic analysis was performed using the freeware

MEGA 6 (Tamura et al. 2013). The best fit model for nucleotide substitution was selected from 24 models using

Mega 6 (Tamura et al. 2013) based on the minimum Bayesian Information Criterion (BIC) value (Schwarz 1978;

Nei & Kumar 2000). This analysis was not carried out to thoroughly resolve the deep phylogeny of the genus but to

assign individuals to genetically homogenous clusters for the purpose of species identification and delimitation.

Reliability of the phylogenetic tree was estimated using bootstrap values from 1000 replicates.

Results and discussion

Description of type locality and confirmation of topotypic material of Indirana leithii. The type locality of I.

leithii, Matheran (18.98°N, 73.27°E, 772 mASL), is the smallest hill station of India. The mountain is associated

with northern Western Ghats but separated from the main range of Western Ghats from all sides by low-lying

Konkan area. The mountain-top is a plateau (Figure 1A) with mid elevation type wet evergreen forest (Ramesh et

al. 1997) dominated by Memecylon umbellatum, Syzygium cumini and Actinodaphne lanceolata (Birdwood 1886;

Ramesh et al. 1997). The plateau also hosts species like Carallia integerrima, Glochidion lanceolarium, Olea

dioica, Garcinia indica and Carissa carandas (Birdwood 1886). The area shows presence of many endemic

species of orchids, grasses and other herbaceous plants (Kothari and Moorthy, 1993). The plateau is separated from

the surrounding hill slopes by vertical cliffs. We found I. leithii adults and tadpoles in large numbers in Matheran

often occupying the cliff faces and rock crevices in the wet season from June to October (Figure 1).

Our specimens from Matheran matched exactly with the original description (Boulenger 1888) in diagnostic

characters including the presence of vomerine teeth in two oblique groups (one on either side), just behind the level

of the choanae; free pointed papilla on the middle of the tongue; snout obtuse with obtuse canthus rostralis and

concave loreal region; nostrils nearer to snout than to eye (i.e. SNL<ENL); tymapanum distinct about 2/3rd the

diameter of the eye; shorter inner finger; toes 2/3rd webbed with web reaching the discs of third and fifth; tips of

fingers and toes dilated into small but well developed disks; presence of moderate subarticular tubercles and a

single small oval inner metatarsal tubercle, absence of tarsal fold; tibio-tarsal articulation reaches half way between

eye and snout; limbs with dark tranverse bands; skin of back with small scattered longitudinal warts and a strong

fold from eye to the shoulder. Boulenger (1888) also mentioned three additional characters, namely brown above

with small dark spots; lower parts white and throat mottled with brown and upper eyelid width greater than inter

orbital width. However, his description was based on a single female specimen, while we observed individual

variations in these characters. Although, we observed two different colour morphs (Figure 2), both colour morphs

were genetically identical (Figure 3). Morphometric characters of topotypic material are provided in Table 1.

We recorded only a single species of Indirana, viz. I. leithii, from Matheran. Our observation is consistent with

the previous studies (Chari & Daniel 1953; Abdulali & Daniel 1954; Sekar 1992), wherein only I. leithii was

reported from the type locality.

Primer Sequence Tm (°C) Ta (°C) Reference

12SF AAACTGGGATTAGATACCCCACTAT 55.1 56 Simon et al. (1994)

12SR GAGGGTGACGGGCGGTGTGT 64.8

16SF CGCCTGTTTATCAAAAACAT 49.2 50 Palumbi et al. (1991)

16SR CCGGTCTGAACTCAGATCACGT 58.6

RhoF ACCATGAACGGAACAGAAGGYCC 60.4 56 Bossuyt & Milinkovitch (2000)

RhoR GTAGCGAAGAARCCTTCAAMGTA 54.9

MODAK ET AL.64 · Zootaxa 3796 (1) © 2014 Magnolia Press

TABLE 2. Morphometry of topotypic Indirana leithii. All measurements are in mm. Detailed morphometry of all

specimens is provided as Supplementary Information Table S1. Total includes fresh as well as museum specimens.

Molecular phylogenetic analysis. Model test of 1011 bases of concatenated 12S, 16S and rho genes suggested

a general time reversible substitution model with gamma distribution (BIC = 8635.98, lnL = -3773.6). Maximum

likelihood analysis revealed that the topotypic Indirana leithii from Matheran formed a monophyletic group

(bootstrap value 100) along with specimens collected from other parts of the northern Western Ghats (Figure 3).

The Indirana leithii sequence available from southern Western Ghats from the study of Nair et al. (2012b), which

is marked as “Indirana leithii” (IND/AA/DD212) in Figure 3, was separated from northern Western Ghats

populations by the branch length of 0.0569. Within the northern Western Ghats populations, specimens from

Tamhini, Harishchandragad, Koynanagar and Visapur fort formed a monophyletic group. However, the short

branch length (0.0083) does not support considering the diverged clade as a separate species. Further, individual

analysis of three molecular markers suggested that all the northern Western Ghats populations had identical 12S

rRNA partial gene sequence (Appendix C), even though 16S rRNA (Appendix D) and rho (Appendix E) genes

showed some genetic divergence. Analysis of individual genes, however, unequivocally suggested that sequence

submitted as Indirana leithii by Nair et al. (2012b) is genetically divergent from northern Western Ghats

populations of I. leithii sensu stricto.

Characters Males Females Total (n = 39)

ZSI-WRC

A/1486

ZSI-WRC

A/1487

BNHS

5588

BNHS

5589

BNHS

5590

BNHS

5591

Mean (sd) Range

SVL 27.2 28.4 29.0 24.7 32.7 30.8 26.1 (5.6) 16.0–35.0

HL 10.8 15.2 11.1 10.3 13.1 12.8 10.6 (2.0) 6.7–15.2

HW 9.6 13.3 9.5 8.6 11.4 11.1 9.1 (1.8) 5.3–13.3

SL 5.1 4.3 5.2 4.7 6.0 5.6 4.6 (0.9) 2.7–6.4

EL 4.3 3.1 3.5 3.5 3.8 3.9 3.7 (0.5) 2.7–4.5

TyL 3.2 1.8 2.3 1.8 2.7 2.6 2.2 (0.5) 1.2–3.3

UEW 2.0 1.5 1.8 2.2 2.2 2.3 2.2 (0.5) 1.3–3.2

SNL 1.7 2.0 2.1 1.5 1.8 2.0 1.8 (0.4) 1.0–2.6

ENL 3.4 2.8 2.7 2.9 3.5 4.0 2.8 (0.5) 1.7–4.0

INL 3.0 2.5 2.4 2.5 3.1 2.7 2.5 (0.5) 1.5–3.6

IOL 2.0 1.9 1.7 1.7 3.9 3.6 2.3 (0.7) 1.2–3.9

FAL 19.1 14.7 17.5 17.4 23.0 22.5 16.8 (3.8) 9.1–23.1

F1 4.7 3.8 4.6 3.4 5.7 4.5 3.9 (0.9) 2.1–5.7

F2 5.6 4.7 4.7 4.5 6.7 6.1 4.9 (0.9) 2.8–6.7

F3 7.1 6.2 5.8 5.9 8.8 8.4 6.6 (1.4) 4.0–9.0

F4 5.3 5.0 5 5.1 7.4 6.6 5.3 (1.2) 2.8–7.8

F3D 1.1 1.0 1.3 1.1 1.4 1.0 1.2 (0.4) 0.6–1.9

F3W 0.6 0.5 0.5 0.3 0.5 0.5 0.5 (0.2) 0.2–0.9

THL 14.8 11.6 13.5 12.5 16.5 16.2 13.1 (2.4) 8.7–17.0

TL 15.7 12.4 15.5 13.6 19.4 17.9 14.1 (2.8) 9.0–19.4

FOL 20.6 17.3 18.7 16.4 24.9 23.7 18.1 (3.9) 11.1–25.3

T1 5.0 3.4 4.7 3.1 5.4 5.8 4.4 (1.0) 2.7–6.4

T2 7.5 5.5 6.9 5.1 8.0 7.3 6.2 (1.3) 3.6–8.9

T3 10.4 7.7 9.8 7.8 12.0 11.4 9.0 (1.9) 5.8–12.3

T4 14.1 11.0 12.9 10.3 17.3 16.3 12.2 (2.6) 7.9–17.3

T5 9.5 8.0 9.4 7.9 11.9 11.0 8.8 (2) 5.1–12.5

T4D 1.0 0.8 1.1 0.6 1.1 1.1 1.0 (0.3) 0.5–1.7

T4W 0.5 0.3 0.5 0.4 0.6 0.6 0.5 (0.2) 0.1–0.8

Zootaxa 3796 (1) © 2014 Magnolia Press · 65DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

Morphological analysis. All the northern Western Ghats populations identified as I. leithii based on molecular

analysis were morphologically similar to the topotypic material. Detailed morphometry of Indirana leithii from

different localities within northern Western Ghats is provided in Table 3. Total includes fresh as well as museum

specimens.

TABLE 3. Morphometry of Indirana leithii from throughout its range in northern Western Ghats and I. cf leithii (BNHS

2367 from Papanasam, Tirunelvelli, Tamil Nadu and BNHS 2514 from Kodaikanal, Tamil Nadu). Detailed morphometry

of all specimens is provided as Supplementary Information Table S1.

Our morphometric measurements suggest that the species Indiarana leithii can be diagnosed as a medium

sized frog (SVL 26.3 ± 5.8 mm, N=83) with (1) head slightly longer than wide (HL 10.5 ± 2.0 mm; HW 9.0 ± 1.9

mm), (2) canthus rostralis obtuse, (3) snout longer than eye (SL 4.7 ± 1.0 mm; EL 3.5 ± 0.7 mm); slightly

protruding beyond the mouth ventrally (4) interorbital distance (IOL 2.4 ± 0.6 mm) larger than the upper eyelid

width (UEW 2.1 ± 0.5 mm) (5) nostrils nearer to the snout than to the eye (SNL 1.8 ± 0.4 mm; ENL 2.8 ± 0.6 mm)

(6) internarial distance (INL 2.5 ± 0.5 mm) larger than the interorbital width (2.4 ± 0.6 mm) (7) upper arm longer

than the forearm (8) hand length longest in the forelimb (9) fingers from smallest to greatest length are: I<II<IV<III

(10) fingers without web or skin-fold (11) large discs present (12) discs wider than long (13) width of a disc at its

Character Male (n = 16) Female (n = 11) Total (n = 83) Indirana cf. leithii

Mean (sd) Range Mean (sd) Range Mean (sd) Range BNHS 2367 BNHS 2514

SVL 23.5 (3.3) 19.1–29.0 32.6 (3.6) 23.9–36.3 26.3 (5.8) 15.2–36.3 19.0 20.8

HL 9.8 (1.8) 8.0–15.2 12.7 (1.3) 9.5–14.0 10.5 (2.0) 6.5–15.2 8.1 8.8

HW 8.5 (1.7) 6.4–13.3 11 (1.4) 7.5–12.6 9 (1.9) 5.1–13.3 6.5 7.4

SL 4.3 (0.6) 3.4–5.3 5.7 (0.6) 4.4–6.7 4.7 (1.0) 2.7–6.7 3.4 4.0

EL 2.9 (0.7) 1.9–4.3 3.9 (0.6) 2.6–4.6 3.5 (0.7) 1.7–4.7 2.5 3.2

TyL 1.9 (0.4) 1.5–3.2 2.8 (0.3) 2.3–3.4 2.2 (0.5) 0.9–3.4 1.5 2.3

UEW 1.8 (0.3) 1.3–2.4 2.4 (0.4) 1.4–3.1 2.1 (0.5) 1.3–3.2 1.7 1.6

SNL 1.6 (0.2) 1.2–2.1 2.1 (0.4) 1.4–2.6 1.8 (0.4) 0.8–2.6 1.4 1.5

ENL 2.7 (0.5) 1.9–3.9 3.5 (0.5) 2.5–4.4 2.8 (0.6) 1.7–4.4 1.7 1.8

INL 2.2 (0.4) 1.5–3.0 2.8 (0.5) 1.6–3.2 2.5 (0.5) 1.5–3.6 2.2 2.3

IOL 2.3 (0.4) 1.7–3.0 3.2 (0.6) 1.9–3.9 2.4 (0.6) 1.2–3.9 2.0 2.6

FAL 15.3 (2.4) 11.7–19.1 21.9 (2.2) 16.3–24.4 17.3 (4.0) 9.1–24.4 11.2 14.3

F1 3.5 (0.8) 2.2–4.8 5.1 (0.6) 3.7–6.0 4.0 (1.0) 1.6–6.0 2.5 3.5

F2 4.4 (0.6) 3.6–5.6 6.5 (0.8) 4.5–7.5 5.0 (1.2) 2.1–7.5 3.2 5.0

F3 5.9 (0.7) 5.1–7.1 8.5 (0.9) 6.2–9.6 6.8 (1.6) 3.1–9.6 4.3 6.4

F4 4.8 (0.4) 4.0–5.7 7.2 (0.9) 4.9–8.2 5.5 (1.4) 2.7–8.2 3.4 4.3

F3D 1.0 (0.2) 0.7–1.3 1.5 (0.4) 1.0–2.0 1.2 (0.4) 0.2–2.2 0.7 1.2

F3W 0.5 (0.1) 0.3–0.6 0.6 (0.2) 0.4–0.9 0.5 (0.2) 0.1–0.9 0.4 0.5

THL 11.6 (1.8) 9.0–14.9 17.2 (1.8) 12.5–18.7 13.5 (3.0) 7.9–18.7 9.3 11.5

TL 12.4 (2) 10.0–15.8 18.3 (2.0) 13.4–20.9 14.4 (3.3) 8.0–20.9 10.1 14.1

FOL 16.7 (2.2) 13.8–20.6 24.7 (2.3) 18.6–27.0 18.9 (4.6) 8.8–27.0 14.2 19.0

T1 3.6 (0.8) 2.7–5.0 5.5 (0.8) 3.3–6.0 4.4 (1.2) 2.1–6.4 2.3 3.7

T2 5.4 (1.0) 4.0–7.5 8.0 (0.8) 5.8–8.7 6.4 (1.6) 2.9–9.3 4.1 6.1

T3 7.9 (1.3) 6.2–10.4 11.8 (1.2) 8.9–13.8 9.3 (2.3) 4.5–13.8 6.1 8.5

T4 11.0 (1.8) 8.7–14.1 16.3 (1.5) 12.4–17.7 12.7 (3.0) 6.4–17.7 9.5 12.5

T5 7.6 (1.2) 5.8–9.5 11.5 (1.1) 8.5–12.6 9.1 (2.3) 4.5–13.3 5.9 8.5

T4D 0.8 (0.2) 0.5–1.1 1.2 (0.2) 0.9–1.5 1.0 (0.3) 0.4–1.7 0.5 0.7

T4W 0.4 (0.1) 0.2–0.5 0.7 (0.1) 0.4–0.9 0.5 (0.2) 0.1–0.9 0.3 0.6

MODAK ET AL.66 · Zootaxa 3796 (1) © 2014 Magnolia Press

base is about half of its maximum width (F3D 1.2 ± 0.4 mm F3W 0.5 ± 0.2 mm) (14) Thigh length (THL 13.5 ± 3.0

mm) slightly shorter than the tibial length (TL 14.4 ± 3.3 mm) (15) foot length longest within the hindlimb (18.9 ±

4.6 mm) (16) toes from smallest to greatest length are T1<T2<T5≤T3<T4 (17) Web formula I1-2II1-2III1-

2½IV2½-1V.

Specimens registered in BNHS (2367 and 2514) as Indirana leithii from Papanasam and Kodaikanal, Tamil

Nadu, southern Western Ghats respectively, were morphometrically very similar to Indirana leithii (Table 3),

however, they had much reduced webbing on the toes (Figure 4). They are therefore treated as I. cf. leithii.

Even though Indirana leithii male and females could not be separated morphologically, principal component

analysis of morphometric data separated males and females on the first principal axis (Figure 5). The first principal

component explained 82.43% of the total variation while the second component explained 4.09% of the total

variation in the data (Table 4). Morphometric separation of the males and females was thus mainly based on the

larger size of females as compared to the males, given that the first principal component of non-size corrected

measurements typically is mainly influenced by size (Table 4).

TABLE 4. Eigenvalue, percent variation explained and factor loading for the first two principal components.

PCA Axis 1 PCA Axis 2

Eigenvalue 0.27 0.01

% variance 82.43 4.09

SVL 0.17 0.08

HL 0.14 0.18

HW 0.15 0.12

SL 0.16 0.06

EL 0.19 0.34

TYL 0.18 0.10

UEW 0.15 -0.03

SNL 0.15 0.07

ENL 0.15 0.10

INL 0.17 0.01

IOL 0.16 -0.25

FAL 0.19 0.06

F1 0.23 0.06

F2 0.18 0.08

F3 0.17 0.02

F4 0.19 0.09

F3D 0.20 -0.09

F3W 0.19 -0.46

THL 0.20 0.03

TL 0.20 0.12

FOL 0.19 0.05

T1 0.23 0.19

T2 0.20 0.05

T3 0.20 0.08

T4 0.20 0.07

T5 0.21 0.07

T4D 0.21 -0.29

T4W 0.28 -0.59

Zootaxa 3796 (1) © 2014 Magnolia Press · 67DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

Osteology. An image of the cleared and stained specimen has been submitted to Morphbank (http://

www.morphbank.net/) under submission ID 835396. The species showed a typical ranid skeleton with following

details: Axial Skeleton: (a) Skull: In dorsal view, frontoparietals large, convex; maxilla thin; occipital condyls

round, fitting tightly into atlas; pterygoid normal shaped but thin; quadratojugal thin, unusually curved outwards

out of the maxillary symmetry; sphenethmoid very small cartilageneous; nasals large bony with round proximal

end. In ventral view, lower mandible typically joined to quadratojugulo-squamosal joint however; does not exactly

fit under quadratojugular bone; vomers obliquely placed; other bones and cartilage typical in view. (b) Vertebral

column: typically ranid, atlas broader than long, transverse processes (TP) of axis straight (not winged shaped), TP

of 3rd vertebra are longest, TP of 3rd and 4th stout with broad end, TP of 5th, 6th, 7th and 8th thin, rather pointed, 9th

vertebra typical with backwardly directed stout transverse processes.

Appendicular skeleton: (a) Pectoral girdle: scapula and suprascapula with typical structures, coracoid typical in

shape but long and thin; clavicle unusually thin. (b) Forelimb: humerus longer than fused radio-ulna; metatarsals

long; terminal phalanges T-shaped. Phalange formula 2-2-3-3 for fingers from I to IV. (c) Pelvic girdle: iliac rods

slightly out curved; urostyle typical. (d) Hindlimb: femur typically S-shaped, slightly shorter than tibio-fibula,

tarsals typical 2+3, astragalus-calcaneum unusually long making foot longer than tibia, centrale and prehallux

present but not noticeable in external morphology, metatarsals long; terminal phalanges Y-shaped; phalange

formula 2-2-3-4-3 for toes I to V.

FIGURE 1. Habitat and microhabitat of Indirana leithii at type locality. (A) Distant shot of Matheran plateau, (B) cliffs with

vegetation forms the habitat for I. leithii adults and tadpoles, (C) adult and (D) tadpole of I. leithii are usually found associated

with rock crevices on the cliffs in wet season.

MODAK ET AL.68 · Zootaxa 3796 (1) © 2014 Magnolia Press

FIGURE 2. Live specimens of topotypic (Matheran) Indirana leithii showing two colour patterns in (A&C) lateral and (B&D)

dorsal view. The color morphs (A&B) morph–1 and (C&D) morph–2 are genetically identical (Figure 3).

Distribution of Indirana leithii. Distribution of Indirana leithii based on current knowledge and our

morphological and genetic analysis is shown in Figure 6. We could collect I. leithii from northern Western Ghats

from Gaganbawda (16.55ºN, 73.83ºE) in the south to Anjaneri (19.93ºN, 73.58ºE) in the north. However, based on

the literature survey the species could also be present in Surat Dangs (20.78ºN, 73.75ºE) in the north (Daniel &

Shull 1964). We could not confirm presence of the species in Surat Dangs, as it is difficult to confirm the species

identification from tadpoles collected by J. C. Daniel (BNHS 1272) in July 1963. Even though Biju et al. (2004)

have mentioned that the species might be distributed south down to Amboli, despite our best efforts we failed to

collect I. leithii from Amboli or any other locality south of Gaganbawda. Altitude wise our study suggests that the

species is found from 139 mASL (Sanjay Gandhi National Park) to 1329 mASL (Harishchandragad).

Records of the species from southern Western Ghats in Karnataka and Kerala (Krishnamurthy & Katre 1993;

Krishnamurthy 2003; Nair et al. 2012a) are only visual records and no information on the voucher specimens are

provided by the authors so these records are difficult to verify. Even though we could not examine the specimens

from southern Western Ghats studied by Nair et al. (2012a; 2012b), our molecular analysis suggests that the

specimen considered by them as I. leithii is genetically divergent (see the specimen marked as “Indirana leithii”

(IND/AA/DD212) in Figure 3). Our examination of two specimens from southern Western Ghats (BNHS 2367 and

2514) also confirms that the specimens identified as I. leithii from southern Western Ghats are morphologically

different from topotypic material (Figure 4).

Records of this species from Madhya Pradesh are based on cross cited reviews dating back to Inger & Dutta

(1986) and we could not trace the original report of this species from Madhya Pradesh. Further, all the reviews only

mention the presence of this species in the state of Madhya Pradesh and no information is available on the precise

locality. Because no voucher specimen information is available from Madhya Pradesh we considered this report

invalid until further more reliable information is available.

Zootaxa 3796 (1) © 2014 Magnolia Press · 69DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

FIGURE 3. Maximum likelihood phylogenetic analysis of concatenated mitochondrial 12S and 16S rRNA genes and nuclear

rho gene. There were final 1011 bases in the final matrix. Best fit model for the nucleotide substitution was general time

reversal model (Tavaré 1986) with gamma distribution (BIC = 8635.98, lnL = -3674.67). Values along the nodes are percent

bootstrap values run for 1000 iterations.

MODAK ET AL.70 · Zootaxa 3796 (1) © 2014 Magnolia Press

FIGURE 4. Toe webbing pattern in Indirana leithii (A), and Indirana cf. leithii from Papanasam (B) and Kodaikanal (C),

Tamil Nadu. Sub-articular tubercles are shown by filled circles, while discs are shown by empty circles.

FIGURE 5. Principal component analysis of log transformed morphometry of males and females. Percentage in parenthesis is

percent variation explained by each principal component.

Zootaxa 3796 (1) © 2014 Magnolia Press · 71DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

FIGURE 6. Distribution of Indirana leithii.

Records of I. leithii from Andhra Pradesh could not be verified and further studies are required to determine

the conspecificity of these records with I. leithii sensu stricto. However, because even within the Western Ghats, I.

leithii is restricted only to the northern parts, the presence of this species in Andhra Pradesh would indicate a wide

disjunct distribution of the species within the peninsular India, which seems to be unlikely.

Based on the above arguments we suggest that I. leithii is restricted to northern Western Ghats between 16ºN to

21ºN latitudes and specimens with the label I. leithii from south of WG are likely to be different.

MODAK ET AL.72 · Zootaxa 3796 (1) © 2014 Magnolia Press

Taxonomic summary

Indirana leithii (Boulenger, 1888)

Rana leithii Boulenger, 1888

Rana (Discodeles) leithii Boulenger, 1888)

Ranixalus leithii (Boulenger, 1888)

Type locality: “Matheran, Bombay (= Mumbai)”, Maharashtra, India.

Type specimen. BMNH 1869.8.28.50.

Known specific distributional range. Based on the current study the species is distributed in the northern

Western Ghats between 16°N to 21°N latitudes.

Specific comments on the taxonomy. Genetically, the specimens collected from different populations from

various sites in northern Western Ghats, show a monophyletic group. We could not compare the specimens

collected by Nair et al. (2012b) morphometrically as the information on the vouchers and museum deposition is not

provided by the authors. However, we can say that the species defined by them as Indirana leithii from southern

Western Ghats (south of 16ºN latitude) should be treated as Indirana cf. leithii—a hitherto undescribed species, on

the basis of the molecular analysis. Our study of two specimens from BNHS (2367 and 2514) labelled as I. leithii

suggests that morphometrically the specimens do not differ from I. leithii topotypic material, however they had

much reduced webbing on the toes. It is therefore likely that the species from southern Western Ghats were

misidentified by previous workers because of their overall morphological similarity to I. leithii.

Conclusions

The amphibian fauna of the Western Ghats biodiversity hotspot is affected by both the Wallacean (limited

knowledge on the distribution of already described species) and Linnean (presence of several undescribed species)

shortfalls (Bini et al. 2006). Since biological conservation requires reliable data on the number of extant species

and their distribution, overcoming the Wallacean and Linnean shortfalls is an immediate concern. However, genetic

sequences published without rigorous taxonomic studies, voucher information and locality details can sometimes

create more confusion and hurdles to this goal. To illustrate this point, the molecular tree depicted in Figure 3,

based on the sequences provided by Nair et al. (2012b), clearly indicates that their species identification is in

question. Unfortunately, Nair et al. (2012b) do not provide any details of museum vouchers or the exact locality of

specimen collection, making it difficult to verify the validity of their taxonomic identification. Nevertheless, based

on the study of topotypic material, we could at least resolve the issue of I. leithii in Nair et al. (2012b) by showing

that it is genetically distinct from I. leithii sensu stricto and should be considered as I. cf. leithii pending further

taxonomic studies. As reliable identification of the material is required for the clear taxonomy of this species, we

are convinced that our genetic and morphometric data of the topotypic material of I. leithii will be helpful to

resolve the Wallacean and Linnean shortfalls in this possible species complex.

Acknowledgements

Nikhil Modak is supported by DST-INSPIRE Student Fellowship [IF 120398]. Neelesh Dahanukar is supported by

DST-INSPIRE Faculty Fellowship. This work was partially funded by DST-INSPIRE Research Grant [IFA12-

LSBM-21] to Neelesh Dahanukar. We thank Principal and Head of the Zoology and Biodiversity Departments,

MES’ Abasaheb Garware College, Pune and Indian Institute of Science Education and Research, Pune, for

providing infrastructural facilities. We are grateful to Dr. Asad Rahmani, Director; Dr. Deepak Apte, COO; Rahul

Khot, incharge Natural History Collection department; and Vithoba Hegde, senior field assistant, for their help

during study of the museum specimens and registration of specimens in Bombay Natural History Society, Mumbai.

We also thank Dr. P.S. Bhatnagar, officer-in-charge, and Dr. Shrikant Jadhav, ZSI, Western Regional Center, Pune,

for their help in registering specimens in ZSI-WRC. Keerthi Krutha helped in registration of specimens in the

Wildlife Information Liaison Development Museum, Coimbatore. We thank Abhijeet Bayani and Keerti Krutha for

Zootaxa 3796 (1) © 2014 Magnolia Press · 73DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

photographying the material and Ashwini Keskar for help in the molecular work. NM would like to thank Yogesh

and Sagar Joshi, Omkar Khade and Omkar Akhade and their friends for helping in field work at Matheran. We

would also like to thank Sumedh Thatte, Satish Pande, Sanjay Khatavkar, Vivek Vishwasrao, Shruti Paripatyadar,

Sayali Sheth, Anushree Jadhav, Unmesh Katwate, Abhijeet Bayani, Keerti Krutha and Anil Pujari for assisting in

field work.

References

Abdulali, H. & Daniel, J.C. (1954) Distribution of Rana leithii Boulen.-A correction. Journal of Bombay Natural History

Society, 52, 635–636.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) Basic local alignment search tool. Journal of

Molecular Biology, 215, 403–410.

http://dx.doi.org/10.1016/S0022-2836(05)80360-2

Biju, S.D., Dutta, S., Padhye, A. & Inger, R. (2004) Indirana leithii. In: IUCN 2013. IUCN Red List of Threatened Species.

Version 2013.2. Available from: http://www.iucnredlist.org (Accessed 20 February 2014).

Bini, L.M., Diniz-Filho, J.A.F., Rangel, T.F., Bastos, R.P. & Pinto, M.P. (2006) Challenging Wallacean and Linnean shortfalls:

knowledge gradients and conservation planning in a biodiversity hotspot. Diversity and Distributions, 12, 475–482.

http://dx.doi.org/10.1111/j.1366-9516.2006.00286.x

Birdwood, H.M. (1886) A catalogue of the flora of Matheran. Journal of Bombay Natural History Society, 1 (4), 203–214.

Bossuyt, F. & Milinkovitch, M.C. (2000) Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal

covariation between larval and adult traits. Proceedings of National Academy of Science USA, 97, 6585–6590.

http://dx.doi.org/10.1073/pnas.97.12.6585

Boulenger, G.A. (1888) Descriptions of two new Indian species of Rana. Annals and Magazine of Natural History, 6 (2),

506–508.

Chari, V.K. & Daniel, J.C. (1953) The tadpole of Rana leithii Boulenger. Journal of Bombay Natural History Society, 51,

512–514.

Dahanukar, N. & Padhye, A. (2005) Amphibian diversity and distribution in Tamhini, northern Western Ghats, India. Current

Science, 88, 1496–1501.

Daniel, J.C. & Shull, E.M. (1964) A list of the reptiles and amphibians of Surat Dangs, South Gujarat. Journal of Bombay

Natural History Society, 60, 737–743.

Dingerkus, G. & Uhler, L.D. (1977) Enzyme clearing of alcian blue stained whole small vertebrates for demonstration of

cartilage. Stain Technology, 52, 229–232.

Dubois, A. (1986) Diagnose préliminaire d’un nouveau genre de Ranoidea (Amphibiens, Anoures) du sud de l’Inde. Alytes, 4,

113–118.

Dubois, A. (1987a) Miscellanea taxinomica batrachologica (I). Alytes, 5, 7–95.

Dubois, A. (1987b) Miscellanea nomenclatorica batrachologica (XV). Alytes, 5, 175–176.

Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research,

32, 1792–1797.

http://dx.doi.org/10.1093/nar/gkh340

Hammer, Ø., Harper, D.A.T. & Ryan, P.D. (2001) PAST: Paleontological statistics software package for education and data

analysis. Palaeontologia Electronica, 4, 1–9.

Inger, R.F. & Dutta, S.K. (1986) An overview of the amphibian fauna of India. Journal of Bombay Natural History Society, 83,

135–146.

IUCN (2008) ‘IUCN Policy Statement on Research Involving Species at Risk of Extinction’. Available from: http://

intranet.iucn.org/webfiles/doc/SSC/SSCwebsite/Policy_statements/IUCN_Policy_Statement_on_Research_Involving_Sp

ecies_at_Risk_of_Extinction.pdf (accessed 21 February 2014)

Katwate, U., Apte, D. & Raut, R. (2013) Diversity and distribution of anurans in Phansad Wildlife Sanctuary (PWS), northern

Western Ghats of India. Journal of Threatened Taxa, 5, 3589–3602.

Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of

nucleotide sequences. Journal of Molecular Evolution, 16, 111–120.

http://dx.doi.org/10.1007/BF01731581

Kirtisinghe, P. (1958) Some hitherto undescribed anuran tadpoles. Ceylon Journal of Science, 1, 171–176.

Kothari, M.J. & Moorthy, S. (1993) Flora of Raigad District, Maharashtra state. Botanical survey of India, Calcutta, 581 pp.

Krishnamurthy, S.V. (2003) Amphibian assemblages in undisturbed and disturbed areas of Kudremukh National Park, central

Western Ghats, India. Environmental Conservation, 30, 274–282.

http://dx.doi.org/10.1017/S0376892903000274

Krishnamurthy, S.V. & Katre, S. (1993) Amphibian fauna of Sringeri taluk (Chickamagalure district: Karnataka). Journal of the

Indian Institute of Science, 73, 443–452.

MODAK ET AL.74 · Zootaxa 3796 (1) © 2014 Magnolia Press

Laurent, R.F. (1986) Sous-classe des lissamphibiens (Lissamphibia). Systématique. Traité de zoologie: anatomie, systématique,

biologie, tome XIV, Fascicle 1B—Batraciens, 594–797.

McCann, C. (1932) Notes on Indian batrachians. Journal of Bombay Natural History Society, 36, 152–180.

Nair, A., Gopalan, S.V., George, S., Kumar, K.S., Teacher, A.G.F. & Merilä, J. (2012a) Endemic Indirana frogs of the Western

Ghats biodiversity hotspot. Annales Zoologici Fennici, 49, 257–286.

http://dx.doi.org/10.5735/086.049.0501

Nair, A., Gopalan, S.V., George, S., Kumar, K.S., Teacher, A.G.F. & Merilä, J. (2012b) High cryptic diversity of endemic

Indirana frogs in the Western Ghats biodiversity hotspot. Animal Conservation, 2012, 1–10.

http://dx.doi.org/10.1111/j.1469-1795.2012.00539.x

Nei, M. & Kumar, S. (2000) Molecular Evolution and Phylogenetics. Oxford University Press, New York, 333 pp.

Padhye, A.D. & Mahabaleshwarkar, M. (2001) Amphibian species decline in Pune City. Journal of Ecological Society, 13/14,

52–54.

Palumbi, S., Martin, A., Romano, S., McMillan, W.O., Stice, L. & Grabowski, G. (1991) The simple fool’s guide to PCR.

Version 2.0. Honolulu Department of Zoology and Marine Laboratory, University of Hawaii, 45 pp.

Radhakrishnan, C. (1996) Amphibians from Aralam Wildlife Sanctuary, Western Ghats, Kerala. Zoos’ Print Journal, 11 (8), 1 & 6.

Ramesh, B.R., Pascal, J.P. & Nouguier, C. (1997) Atlas of endemics of the Western Ghats (India): distribution of tree species in

the evergreen and semi-evergreen forests. Vol. 38. Institut Français de Pondichéry, 403 pp.

Roelants, K., Jiang, J. & Bossuyt, F. (2004) Endemic ranid (Amphibia: Anura) genera in the southern mountain ranges of the

Indian subcontinent represent ancient frog lineages: evidence from molecular data. Molecular Phylogenetics and

Evolution, 31, 730–740.

http://dx.doi.org/10.1016/j.ympev.2003.09.011

Schwarz, G. (1978) Estimating the dimension of a model. Annals of Statistics, 6, 461–464.

Sekar, A.G. (1992) Morphometry, habitat, behaviour & food of the tadpoles of Leith’s frog Rana leithii. Journal of Bombay

Natural History Society, 89, 259–261.

Simon, C., Friati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, P. (1994) Evolution, weighting and phylogenetic utility of

mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of

Entomological Society of America, 87, 651–686.

Srinivasulu, C. & Das, I. (2008) The herpetofauna of Nallamala Hills, Eastern Ghats, India: An annotated checklist, with

remarks on nomenclature, taxonomy, habitat use, adaptive types and biogeography. Asiatic Herpetological Research, 11,

110–131.

Srinivasulu, C., Siliwal, M., Rajesh, A., Srinivasulu, B., Venkateshwarulu, P. & Nagulu, V. (2007) Diversity and distribution of

amphibian fauna in Nagarjunsagar-Srisailam Tiger Reserve, Andhra Pradesh. Frog Leg, 13, 3–6.

Tamura, K. (1992) Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C

content biases. Molecular Biology and Evolution, 9, 678–687.

Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis

version 6.0. Molecular Biology and Evolution, 30, 2725–2729.

http://dx.doi.org/10.1093/molbev/mst197

Tavaré, S. (1986) Some probabilistic and statistical problems in the analysis of DNA sequences. Lectures on Mathematics in

the Life Sciences, 17, 57–86.

APPENDIX A. Comparative material examined.

Indirana leithii (n = 60) : Maharashtra: Raigad District, Matheran, BNHS 5588, 5589 (adult males), collected by N. Modak

& A. Bayani on 25 August 2012; AGCZRL-Amphibia-200 (adult female), collected by N. Modak & A. Bayani on 25

August 2012; Raigad District, Matheran, ZSI-WRC A/1486, 1487 (adult males), collected by N. Modak & A. Bayani on

25 August 2012; Raigad District, Matheran, BNHS 5590, 5591 (adult females), collected by N. Modak on 30 September

2012; Raigad District, Matheran, BNHS 1197 (unsexed), collected by C. McCann on 6 October 1945; Raigad District,

Matheran, BNHS 1212, 1213, 1216, 1217, 1218, 1225, 1238, 1240 (unsexed), collected by V. K. Chari on 10 February

1953; Raigad District, Khandala, BNHS 1204, 1243 (unsexed), collected by H. Abdulali on 30 August 1953; Raigad

District, Matheran, BNHS 1253, 1254 (unsexed), collected by H. Abdulali on 19 October 1954; Raigad District,

Matheran, BNHS 1261 (unsexed), collected by V. K. Chari on 22 July 1956; Raigad District, Matheran, BNHS 1275

(unsexed), collected by J. C. Daniel in November 1966; Raigad District, Matheran, BNHS 1695 (unsexed), collected by

H. Abdulali in October 1967; Raigad District, Matheran, BNHS 2830, 2831, 2833, 2837, 2838, 2841 (unsexed), collected

by A. G. Sekar and V. Hegde on 8 January 1991; Raigad District, Matheran, BNHS 4151 (unsexed), collected by V. Giri, I.

Das and A. Captain in 2002; Pune District, Tamhini, WILD-013-AMP-175, 176 (adult male), collected by A. Padhye and

N. Dahanukar on 11 September 2011; Pune District, Adarwadi, AGCZRL-Amphibia-107 (adult male) collected by A.

Padhye and N. Dahanukar on 28 September 2011; Pune District, Tamhini, ZSI-WRC A/1488, 1489 (adult females),

collected by N. Modak, A. Padhye and N. Dahanukar on 15 February 2013; Pune District, Visapur fort, WILD-013-AMP-

178 (adult female), collected by N. Modak on 23 March 2013; Pune District, Lonavala, BNHS 1262 (unsexed), collected

by Humayun Abdulali on 22nd September 1957; Pune District, “Malchis” (=Malshej?) ghat, BNHS 2516, BNHS 2516

Zootaxa 3796 (1) © 2014 Magnolia Press · 75DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

(two specimens bearing same number, unsexed) collected by H. Abdulali on 21 August 1984; Thane District, Kanheri,

BNHS 1258 (unsexed), colleted by Humayun Abdulali on 4 May 1955; Thane District, Sanjay Gandhi National Park,

BNHS 2925, 2926 (unsexed), collected by A. G. Sekar and V. Hegde on 10 September 1993; Thane District, Kanheri,

BNHS 2923 (unsexed), collected by A. G. Sekar on 10 September 1993; Nashik District, Anjaneri, AGCZRL-Amphibia-

198 (sub-adult female) and 199 (male), collected by R. Naik and C. Joshi on 14 October 2013; Ahamadnagar District,

Harishchandragad, WILD-013-AMP-173, 174 (adult females), collected by N. Modak, K. Krutha, A. Padhye, S. Molur

and N. Dahanukar on 1 May 2012; Ahamadnagar District, Ratangad, AGCZRL-Amphibia-112, 113 (adult females),

collected by N. Modak and S. Thatte on 30 March 2013; Satara District, Koynanagar, AGCZRL-Amphibia-59 (adult

male), collected by A. Padhye in July 2011; Satara District, Koynanagar, WILD-013-AMP-177 (adult female), collected

by N. Modak, N. Dahanukar, K. Krutha and U. Katwate on 17 June 2013; Ratnagiri District, Amba Ghat, AGCZRL-

Amphibia-191, 192 (sub-adult males), collected by A. Padhye and N. Modak on 22 September 2013; Ratnagiri District,

Anuskura ghat, AGCZRL-Amphibia-193, collected by N. Modak and A. Padhye on 20 September 2013; Kolhapur District,

Gaganbawda, AGCZRL-Amphibia-194, 195, 196 and 197, collected by N. Modak and A. Padhye on 20 September 2013;

Tamil Nadu: Tirunelvelli District, Papanasam, BNHS 2367 (unsexed), collected by Humayun Abdulali on 4 September

1978;�Dindigul District, Kodaikanal, BNHS 2514 (unsexed), collected by Mrs. Philippa on 10 September 1984.

Indirana beddomii (n = 8): Maharashtra: Satara District, Mahabaleshwar, BNHS 1923 (unsexed), collected by J. C. Daniel in

April 1968; Sindhudurg District, Hewale, BNHS 3054 (unsexed), collected by A. G. Sekar and V. Hegde on 17 January

1996; Sindhudurg District, Amboli, BNHS 4073 and 4081 (unsexed), collected by V. Giri and V. Hegde on 17 August

2000. Karnataka: Dakshin Kannada District, Neria, BNHS 2909 (unsexed), collected by R. J. R. Daniels, on 31 October

1990. Tamil Nadu: Tirunelvelli District, Courtallam, BNHS 1196/2016 (unsexed), collected by J. C. Daniel on 19 May

1966. Kerala: Idukki/Pathanamthitta District, Periyar, BNHS 2668, 2671 (unsexed), collected by, A. Malhotra on 26 July

1987.

Indirana semipalmata (n = 4): Karnataka: Udupi District, Kerekatte, Kudremukh NP, BNHS 4044 (unsexed), collected by S.

V. Krishnamurthy, collection date not available; Kerala: Calicut District, Pulloorampara, Calicut, BNHS 1290 and 1291

(unsexed), collected by K. G. Adiyodi, collection date not available; Dindigul District, Poombarai, Kodaikanal, BNHS

2099 (unsexed), collected by P. B. Shekar, on 23 April 1971.

Indirana diplosticta (n = 2): Kerala: Idukki/Pathanamthitta District, Periyar, BNHS 2674 and 2683 (unsexed), collected by A.

Malhotra on 29 July 1987.

Indirana leptodactyla (n = 4): Tamil Nadu: Dindigul District, Kodaikanal, BNHS 1296 (unsexed), collected by J. C. Daniel on

27 April 1966; Kodaikanal District, Bear Shola, Kodaikanal, BNHS 1293 and 1295 (unsexed), collected by J. C. Daniel

on 8 May 1966; Kerala: Idukki District, Eravikulam NP, BNHS 2392 (unsexed), collected by J. C. Daniel on 25 July

1987.

APPENDIX B. Sequences used for molecular analysis.

Voucher GenBank Accession number

Species 12S 16S Rho 12S 16S Rho

Indirana leithii Matheran BNHS5590 KF590627 KF590637 KF590647

Indirana leithii Matheran BNHS5591 KF590628 KF590638 KF590648

Indirana leithii Tamhini WILD-013-AMP-173 KF590629 KF590639 KF590649

Indirana leithii Tamhini WILD-013-AMP-174 KF590630 KF590640 KF590650

Indirana leithii Harishchandragad WILD-013-AMP-175 KF590631 KF590641 KF590651

Indirana leithii Harishchandragad WILD-013-AMP-176 KF590632 KF590642 KF590652

Indirana leithii Koynanagar WILD-013-AMP-177 KF590633 KF590643 KF590653

Indirana leithii Ratangad WILD-013-AMP-178 KF590634 KF590644 KF590654

Indirana leithii Ratangad AGCZRL-Amphibia-112 KF590635 KF590645 KF590655

Indirana leithii Visapur AGCZRL-Amphibia-113 KF590636 KF590646 KF590656

Indirana leithii Anjaneri AGCZRL-Amphibia-199 KJ442870 KJ442874 KJ442878

Indirana leithii Amba ghat AGCZRL-Amphibia-192 KJ442871 KJ442875 KJ442879

Indirana leithii Anuskura ghat AGCZRL-Amphibia-193 KJ442872 KJ442876 KJ442880

Indirana leithii Gaganbawda AGCZRL-Amphibia-195 KJ442873 KJ442877 KJ442881

“Indirana leithii” IND212 AA212 DD212 JQ596717 JQ596673 JQ596778

Indirana semipalmata IND256 AA256 DD256 JQ596715 JQ596671 JQ596787

......continue on the next page

MODAK ET AL.76 · Zootaxa 3796 (1) © 2014 Magnolia Press

* not specified.

APPENDIX B. (Continued)

Voucher GenBank Accession number

Species 12S 16S Rho 12S 16S Rho

Indirana semipalmata IND245 AA245 DD245 JQ596713 JQ596669 JQ596785

Indirana semipalmata IND257 AA257 DD257 JQ596716 JQ596672 JQ596788

Indirana semipalmata IND255 AA255 DD255 JQ596714 JQ596670 JQ596786

Indirana semipalmata IND243 AA243 DD243 JQ596712 JQ596668 JQ596784

Indirana leptodactyla IND850 AA850 DD850 JQ596719 JQ596682 JQ596805

Indirana leptodactyla IND848 AA848 DD848 JQ596721 JQ596684 JQ596803

Indirana leptodactyla IND851 AA851 DD851 JQ596718 JQ596685 JQ596806

Indirana leptodactyla IND849 AA849 DD849 JQ596720 JQ596681 JQ596804

Indirana leptodactyla IND847 AA847 DD847 JQ596722 JQ596683 JQ596802

Indirana brachytarsus IND71 AA71 DD71 JQ596690 JQ596646 JQ596800

Indirana brachytarsus IND23 AA23 DD23 JQ596689 JQ596645 JQ596801

Indirana brachytarsus IND638 AA638 DD638 JQ596691 JQ596647 JQ596799

Indirana cf. diplosticta IND92 AA92 DD92 JQ596698 JQ596654 JQ596813

Indirana cf. diplosticta IND94 AA94 DD94 JQ596700 JQ596656 JQ596815

Indirana cf.diplosticta IND91 AA91 DD91 JQ596697 JQ596653 JQ596812

Indirana cf. diplosticta IND93 AA93 DD93 JQ596699 JQ596655 JQ596814

Indirana cf. diplosticta IND98 AA98 DD98 JQ596701 JQ596657 JQ596816

Indirana cf. beddomii IND77 AA77 DD77 JQ596688 JQ596644 JQ596795

Indirana cf. beddomii IND175 AA175 DD175 JQ596692 JQ596648 JQ596773

Indirana cf. beddomii IND180 AA180 DD180 JQ596694 JQ596650 JQ596775

Indirana cf. beddomii IND193 AA193 DD193 JQ596696 JQ596652 JQ596777

Indirana cf. beddomii IND220 AA220 DD220 JQ596708 JQ596664 JQ596779

Indirana cf. beddomii IND230 AA230 DD230 JQ596710 JQ596666 JQ596782

Indirana cf. beddomii IND244 AA244 DD244 JQ596729 JQ596674 JQ596789

Indirana cf. beddomii IND724 AA724 DD724 JQ596726 JQ596676 JQ596791

Indirana cf. beddomii IND246 AA246 DD246 JQ596728 JQ596675 JQ596790

Indirana cf. beddomii IND800 AA800 DD800 JQ596727 JQ596677 JQ596792

Indirana cf. beddomii IND178 AA178 DD178 JQ596693 JQ596649 JQ596774

Indirana cf. beddomii IND189 AA189 DD189 JQ596695 JQ596651 JQ596776

Indirana cf. beddomii IND200 AA200 DD200 JQ596707 JQ596663 JQ596780

Indirana cf. beddomii IND75 AA75 DD75 JQ596687 JQ596643 JQ596794

Indirana cf. beddomii IND227 AA227 DD227 JQ596709 JQ596665 JQ596781

Indirana cf. beddomii IND231 AA231 DD231 JQ596711 JQ596667 JQ596783

Indirana cf. beddomii IND72 AA72 DD72 JQ596686 JQ596642 JQ596793

Indirana sp. IND88 AA88 DD88 JQ596703 JQ596659 JQ596809

Indirana sp. IND95 AA95 DD95 JQ596705 JQ596661 JQ596808

Indirana sp. IND99 AA99 DD99 JQ596706 JQ596662 JQ596811

Indirana sp. IND89 AA89 DD89 JQ596704 JQ596660 JQ596810

Indirana sp. IND87 AA87 DD87 JQ596702 JQ596658 JQ596807

Micrixalus fuscus MF5111 MF3006 * GU143817 GU136106 AF249120

Zootaxa 3796 (1) © 2014 Magnolia Press · 77DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

APPENDIX C. Maximum likelihood phylogenetic analysis of mitochondrial 12S rRNA gene. The best fit model for the

nucleotide substitution was a Kimura 2-parameter model (Kimura 1980) with gamma distribution (BIC = 3345.30, lnL = -

1134.60). Values along the nodes are percent bootstrap values run for 1000 iterations.

MODAK ET AL.78 · Zootaxa 3796 (1) © 2014 Magnolia Press

APPENDIX D. Maximum likelihood phylogenetic analysis of mitochondrial 16S rRNA gene. Best fit model for the nucleotide

substitution was Tamura (1992) model with gamma distribution (BIC = 4794.60, lnL = -1832.70). Values along the nodes are

percent bootstrap values run for 1000 iterations.

Zootaxa 3796 (1) © 2014 Magnolia Press · 79DISTRIBUTION RANGE OF MATHERAN LEAPING FROG

APPENDIX E. Maximum likelihood phylogenetic analysis of nuclear rhodopsin gene. Best fit model for the nucleotide

substitution was Kimura 2-parameter model (Kimura, 1980) with gamma distribution (BIC = 2234.00, lnL = -586.29). Values

along the nodes are percent bootstrap values run for 1000 iterations.

MODAK ET AL.80 · Zootaxa 3796 (1) © 2014 Magnolia Press