This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
EPHB3 and EPHB4. ON-TARGETplus siRNA uses a validated pool of 4 individual
siRNAs per target gene. Cells were transfected with either 10 nM or 50 nM siRNA and
gene expression levels tested by qPCR 48 hours post-transfection. Data are presented as
mean ± SD. P < 0.05, Student’s t-test.
Supplementary Figure 3 Uncropped blot images from Figure 1. (a). Uncut blots for
Figure 1b. (b) Uncut gels for Figure 1d. (c) Uncut blots for Figure 1e. (d). Uncut blots
for Figure 1i.
Supplementary Figure 4. Uncropped blot images from Figure 2. (a) Uncut blots for
Figure 2a. (b) Uncut blots for Figure 2b.
Supplementary Figure 5. Uncropped blot images from Figure 3. (a). Uncut blots for
Figure 3h. (b) Uncut gels for Figure 3i. (c) Uncut blots for Figure 3l. (d). Uncut blots for
Figure 3p.
Nature Medicine: doi:10.1038/nm.4419
Supplementary Figure 6. Uncropped blot images from Figure 4. (a). Uncut blots for
Figure 4h. (b) Uncut gels for Figure 4j. (c) Uncut blots for Figure 4n. (d). Uncut blots for
Figure 4p. (e) Uncut blots for Figure 4s.
Supplementary Figure 7. Uncropped blot images from Figure 5. (a). Uncut blots for
Figure 5a. (b) Uncut gels for Figure 5d.
Supplementary Figure 8. Uncropped blot images from Figure 6. (a). Uncut blots for
Figure 6i.
Nature Medicine: doi:10.1038/nm.4419
Supplementary Table 1: IPF and Control Subject Characteristics. IPF (n = 30) Controls (n = 30) Age (yrs) 68.5 (7.0) 68.3 (7.0) Sex (M/F) 21/9 21/9 Smoking (current/ever/never)
0/26/4 0/26/4
FVC predicted (%) 66.8 (14.9) N/A DLCO [Hb] predicted (%) 44.0 (18.2) N/A Data are presented as mean +/- SD as appropriate. N/A refers to data that was not available or collected. Pulmonary function data (FVC/DLCO [Hb] – the long forms of this should be defined) was performed within 15 days of plasma collection and was available on 27/30 subjects.
Nature Medicine: doi:10.1038/nm.4419
Supplementary Table 2
Gene Species Sequence (5’ to 3’)
Collagen type I α1 chain (col1α1)
Human F: GAACGCGTGTCATCCCTTGT R: GAACGAGGTAGTCTTTCAGCAACA
α-smooth muscle actin (α-SMA)
Human F: TTCAATGTCCCAGCCATGTA R: GAAGGAATAGCCACGCTCAG
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
Human F: CCCATGTTCGTCATGGGTGT R: TGGTCATGAGTCCTTCCACGATA
Supplementary Table 2. Primer pairs used for quantitative real-time PCR. The table shows the specific gene detected, the species (mouse or human) and the corresponding sequence for forward (F) and reverse (R) primers.