24 April, 2008 MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.
Dec 21, 2015
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Load organisms from green house.
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Click “open”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Select an organism for self crossfor eg. The Red organism
Then click tab“Self-cross One Organism”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Resulting offsprings of Red organism.
Then double click on Tray1and click “Send to Lower Panel”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Select two different organisms(heterozygous)
Then click the tab“Cross Two Organisms”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Resulting offsprings of Red and Green-1 organism.
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Select two same organisms(homozygous)
Then click the tab“Cross two Organisms”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Resulting offsprings of Red organism.
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Select an organism
Then click “Mutate One Organism”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Mutant versions of Green-2 organism.
Then click the tab“Biochemistry”.
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
In the Biochemistry addamino acid sequence SSSSSSS here.
Then click“FOLD”
Corresponding phenotype populated when sequence is folded.
The default phenotype
History List is populated with correspondingtemplate and phenotype.-White organism
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Enter another sequenceFFFFFFFand click “FOLD”
Correspondingphenotype(Red)
Heterozygous combined phenotype(Red)
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Enter the same sequence FFFFFFF here and click “FOLD”
Homozygous combined phenotype.(Red )
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Then click tab“Molecular Biology”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Click the tab“Enter New DNA”
Then enter the DNA sequence-TATAAATGTCTAATCGTCATATTTTATTAGTTTTTTGTCGTCAATAGGGGGG
and click “OK”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Then click “Fold Protein”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Resulting Organism -Red
Default Phenotype
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Double click “History List”and select “Send to LowerPanel” orEnter the same DNA byclicking “Enter New DNA” in Lower panel.
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
The same two DNA sequencesgive the combined phenotype here(Red) which is homozygous.
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Enter DNA-CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT
and click “OK”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Click “Fold Protein”
24 April, 2008 MGX TUTORIAL MGX © 2007-2008UMASS BOSTON
Resulting Green-1 organism
The two different DNA sequences gives a Heterozygous combined phenotype which populates here.