Identifying Amphibian Pathogens Using Quantitative PCR Alexis Gramera*, Jessica Krempp, and Gregory Ruthig, Ph. D. Department of Biology, North Central College, Naperville, IL Abstract Water molds are a major source of mortality for amphibians. It is essential to understand the diseases that contribute to these amphibian declines and to develop methodology for the identification of amphibian pathogens. We designed techniques to identify the presence and abundance of pathogens in the environment. Pathogens were isolated from frog egg samples (either Lithobates catesbeianus or L. clamitans). The abundance of a pathogen was determined using real-time quantitative PCR analysis. The formation of this technique provides future researchers a less costly and more time efficient method for water mold identification. Introduction • Amphibian populations have declined drastically since 1989 (Wilkinson 2003). • Water molds are amphibian pathogens that can live on many different host species (Ruthig and Provost-Javier 2012). • It is difficult to identify pathogenic water mold species using morphology. • A critical component of the study of water molds includes the detection of the pathogen on infected amphibians, as well as in the environment (Ruthig and DeRiddler 2012). Methods • We collected frog egg masses from bodies of water in Naperville, IL (A-B). • We isolated water molds from infected eggs onto cornmeal agar (C-D). • We extracted and amplified the ITS regions of the genomes of collected pathogens. • PCR products were purified and sequenced at the University of Chicago. • Using MEGA6.06, we aligned our sequences with known sequences from the database, Genbank to determine the taxonomic identity of our strains. • We designed a qPCR probe that is species specific, that does not bind to other strains. • We are now testing the ability of our qPCR probe to determine its efficacy. We want to determine if: 1. The probe works on the strain for which it was designed. 2. The probe works on other water mold strains. A B D C Results E Acknowledgements • Thank you to Dr. Gregory Ruthig for his assistance and guidance throughout this project. • Thank you to North Central for making this project possible. • Thank you to Chris Boffa and Jacquelyn Pfaff for their laboratory assistance. • Thank you to Andrew DuBois, Joel DiBernardo, and Katy Reese for their contribution to the Ruthig Lab. • Thank you to Dr. Jonathan Visick, Dr. Stephen Johnston, and Dr. Jennifer Leptolegnia sp.E M 32A Leptolegnia sp.N T Leptolegnia sp.S P A chlya papillosa A chlya oligacantha A chlya racem osa A chlya colorata Leptolegnia sp.S A P 248 A chlya aquatica A chlya prim oachlya A chlya am ericana A chlya intricata A chlya am bisexualis A chlya heterosexualis 2014 G ram era R vW k M ating B ITS 1 (Leptolegnia sp.) S aprolegnia sem ihypogyna A chlya sp.O 3E G 1 A chlya sp.D G Leptolegnia sp.C B S S aprolegnia diclina 2014 G ram era R vW k M ating A ITS 1 (S aprolegnia sp.) S aprolegnia salm onis S aprolegnia hypogyna S aprolegnia parasitica 2014 G ram era Field S aprolegnia ferax ITS 1 S aprolegnia oliviae S aprolegnia ferax S aprolegnia sp.A E S B S aprolegnia bulbosa S aprolegnia anom alies S aprolegnia longicaulis A phanom yces sp.N V A A spergillus tubingensis Pythium sp.O A K Pythium erinaceum Pythium parvum Pythium takayam anum 2014 G ram era R vW k M ating C ITS 1 (P ythium sp.) 2014 G ram era Field P hytophthora sp.ITS 1 P hytophthora brassicae P hytophthora botryosa P hytophthora tropicalis P hytophthora riparia 96 58 52 24 65 97 19 38 100 87 98 52 99 100 27 40 19 18 9 18 12 78 55 78 93 36 50 0.1 1. We collected three egg masses. 2. We obtained DNA sequences from the ITS region of fourteen water mold isolates (E). 3. We classified these isolates using Maximum Likelihood Phylogenetic analysis (F). 4. We designed a locked nucleic acid (LNA) primer/probe set for qPCR using Primer Express 3.0 for strain 2014 Gramera RvWk Mating A, a likely member of the genus Saprolegnia. 5. We are currently testing the LNA probe’s efficacy, with the goal that the probe will only amplify our desired strain (G). F Forward Primer [TTGCTTGTGCTTCGGTACGA] Reverse Primer [ATTTCGGCGAGGCTGTTG] LNA Probe [TGGACATATATTGCTTTTTG] (Bold letters indicate LNAs) G B Arrow indicates samples collected Positive Amplificatio ns • Quantitative PCR (qPCR) is a molecular technique that allows researchers to identify the presence and abundance of a particular pathogen strain.